>Feature sequence001 1732 983 gene locus_tag LOCUS_00010 1732 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2191 1943 gene locus_tag LOCUS_00020 2191 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2382 2188 gene locus_tag LOCUS_00030 2382 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3079 3315 gene locus_tag LOCUS_00040 3079 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3427 3657 gene locus_tag LOCUS_00050 3427 3657 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_00050 3654 4007 gene locus_tag LOCUS_00060 3654 4007 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142392.1 protein_id gnl|my_center|LOCUS_00060 4928 4044 gene locus_tag LOCUS_00070 4928 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 5248 6297 gene locus_tag LOCUS_00080 5248 6297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 6291 7136 gene locus_tag LOCUS_00090 6291 7136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 7789 7076 gene locus_tag LOCUS_00100 7789 7076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 8751 8482 gene locus_tag LOCUS_00110 8751 8482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 9026 8757 gene locus_tag LOCUS_00120 9026 8757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 9201 9626 gene locus_tag LOCUS_00130 9201 9626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 9949 10218 gene locus_tag LOCUS_00140 9949 10218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 11257 10970 gene locus_tag LOCUS_00150 11257 10970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 12724 11900 gene locus_tag LOCUS_00160 12724 11900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00160 13273 14037 gene locus_tag LOCUS_00170 13273 14037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 14351 15142 gene locus_tag LOCUS_00180 14351 15142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 16423 15590 gene locus_tag LOCUS_00190 16423 15590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 18199 16430 gene locus_tag LOCUS_00200 18199 16430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 18843 18196 gene locus_tag LOCUS_00210 18843 18196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 19796 18858 gene locus_tag LOCUS_00220 19796 18858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 20845 19793 gene locus_tag LOCUS_00230 20845 19793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 21588 20842 gene locus_tag LOCUS_00240 21588 20842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 22840 21683 gene locus_tag LOCUS_00250 22840 21683 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787334.1 protein_id gnl|my_center|LOCUS_00250 24695 22833 gene locus_tag LOCUS_00260 gene asnB 24695 22833 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930749.1 protein_id gnl|my_center|LOCUS_00260 25660 24698 gene locus_tag LOCUS_00270 25660 24698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 26664 25657 gene locus_tag LOCUS_00280 26664 25657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 28388 26661 gene locus_tag LOCUS_00290 28388 26661 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698821.1 protein_id gnl|my_center|LOCUS_00290 29524 28385 gene locus_tag LOCUS_00300 29524 28385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 30977 29532 gene locus_tag LOCUS_00310 30977 29532 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901994.1 protein_id gnl|my_center|LOCUS_00310 32085 30985 gene locus_tag LOCUS_00320 32085 30985 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_00320 33964 32087 gene locus_tag LOCUS_00330 33964 32087 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_00330 34575 33967 gene locus_tag LOCUS_00340 34575 33967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 36119 34578 gene locus_tag LOCUS_00350 36119 34578 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813883.1 protein_id gnl|my_center|LOCUS_00350 37399 36116 gene locus_tag LOCUS_00360 37399 36116 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294691.1 protein_id gnl|my_center|LOCUS_00360 38408 37389 gene locus_tag LOCUS_00370 38408 37389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 39533 38598 gene locus_tag LOCUS_00380 39533 38598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 40947 39556 gene locus_tag LOCUS_00390 40947 39556 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257227.1 protein_id gnl|my_center|LOCUS_00390 41544 40975 gene locus_tag LOCUS_00400 gene cysC 41544 40975 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140515.1 protein_id gnl|my_center|LOCUS_00400 42754 41552 gene locus_tag LOCUS_00410 42754 41552 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 protein_id gnl|my_center|LOCUS_00410 43725 42751 gene locus_tag LOCUS_00420 43725 42751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 44984 43722 gene locus_tag LOCUS_00430 44984 43722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 46063 44993 gene locus_tag LOCUS_00440 46063 44993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 47739 46060 gene locus_tag LOCUS_00450 47739 46060 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942628.1 protein_id gnl|my_center|LOCUS_00450 49187 47760 gene locus_tag LOCUS_00460 49187 47760 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_00460 50107 49886 gene locus_tag LOCUS_00470 50107 49886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 50024 54133 gene locus_tag LOCUS_00480 50024 54133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 54260 54484 gene locus_tag LOCUS_00490 54260 54484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 54478 54825 gene locus_tag LOCUS_00500 54478 54825 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617906.1 protein_id gnl|my_center|LOCUS_00500 55108 55407 gene locus_tag LOCUS_00510 55108 55407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 55404 55832 gene locus_tag LOCUS_00520 55404 55832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 55917 56369 gene locus_tag LOCUS_00530 55917 56369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 56433 57140 gene locus_tag LOCUS_00540 56433 57140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 59188 57518 gene locus_tag LOCUS_00550 59188 57518 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090330.1 protein_id gnl|my_center|LOCUS_00550 60425 59199 gene locus_tag LOCUS_00560 60425 59199 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877874.1 protein_id gnl|my_center|LOCUS_00560 61974 61057 gene locus_tag LOCUS_00570 61974 61057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 63615 62734 gene locus_tag LOCUS_00580 63615 62734 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_00580 64095 63646 gene locus_tag LOCUS_00590 64095 63646 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393694.1 protein_id gnl|my_center|LOCUS_00590 64373 64092 gene locus_tag LOCUS_00600 64373 64092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 64492 65814 gene locus_tag LOCUS_00610 64492 65814 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969697.1 protein_id gnl|my_center|LOCUS_00610 66085 68019 gene locus_tag LOCUS_00620 66085 68019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 68048 70363 gene locus_tag LOCUS_00630 68048 70363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 71896 70451 gene locus_tag LOCUS_00640 71896 70451 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897870.1 protein_id gnl|my_center|LOCUS_00640 76529 71964 gene locus_tag LOCUS_00650 gene gltB 76529 71964 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926853.1 protein_id gnl|my_center|LOCUS_00650 76642 77541 gene locus_tag LOCUS_00660 76642 77541 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329773.1 protein_id gnl|my_center|LOCUS_00660 77628 78638 gene locus_tag LOCUS_00670 77628 78638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 78649 78906 gene locus_tag LOCUS_00680 78649 78906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 78903 80774 gene locus_tag LOCUS_00690 78903 80774 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_00690 80771 81811 gene locus_tag LOCUS_00700 80771 81811 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324151.1 protein_id gnl|my_center|LOCUS_00700 81955 82179 gene locus_tag LOCUS_00710 81955 82179 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021610.1 protein_id gnl|my_center|LOCUS_00710 82172 82393 gene locus_tag LOCUS_00720 82172 82393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 82390 83832 gene locus_tag LOCUS_00730 82390 83832 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257031.1 protein_id gnl|my_center|LOCUS_00730 83836 85146 gene locus_tag LOCUS_00740 83836 85146 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929187.1 protein_id gnl|my_center|LOCUS_00740 85143 86420 gene locus_tag LOCUS_00750 85143 86420 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143065.1 protein_id gnl|my_center|LOCUS_00750 86417 87160 gene locus_tag LOCUS_00760 86417 87160 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150234528.1 protein_id gnl|my_center|LOCUS_00760 87291 88700 gene locus_tag LOCUS_00770 87291 88700 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531459.1 protein_id gnl|my_center|LOCUS_00770 88700 89428 gene locus_tag LOCUS_00780 88700 89428 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256718.1 protein_id gnl|my_center|LOCUS_00780 89425 89841 gene locus_tag LOCUS_00790 89425 89841 CDS product DUF2203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227790.1 protein_id gnl|my_center|LOCUS_00790 89838 90593 gene locus_tag LOCUS_00800 89838 90593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 90690 91631 gene locus_tag LOCUS_00810 gene trxB 90690 91631 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975041.1 protein_id gnl|my_center|LOCUS_00810 91861 92139 gene locus_tag LOCUS_00820 91861 92139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 92215 95325 gene locus_tag LOCUS_00830 gene fdnG 92215 95325 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546362.1 transl_except (pos:92791..92793,aa:Sec) note codon on position 193 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_00830 95328 96104 gene locus_tag LOCUS_00840 95328 96104 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727951.1 protein_id gnl|my_center|LOCUS_00840 96097 96921 gene locus_tag LOCUS_00850 96097 96921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 96934 97857 gene locus_tag LOCUS_00860 96934 97857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 98746 97967 gene locus_tag LOCUS_00870 98746 97967 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020996.1 protein_id gnl|my_center|LOCUS_00870 100311 98782 gene locus_tag LOCUS_00880 100311 98782 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582707.1 protein_id gnl|my_center|LOCUS_00880 100817 100314 gene locus_tag LOCUS_00890 100817 100314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 101775 100825 gene locus_tag LOCUS_00900 101775 100825 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818532.1 protein_id gnl|my_center|LOCUS_00900 101928 102887 gene locus_tag LOCUS_00910 101928 102887 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941192.1 protein_id gnl|my_center|LOCUS_00910 102888 103970 gene locus_tag LOCUS_00920 102888 103970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 103967 105694 gene locus_tag LOCUS_00930 103967 105694 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143441.1 protein_id gnl|my_center|LOCUS_00930 105713 106015 gene locus_tag LOCUS_00940 105713 106015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 106032 107288 gene locus_tag LOCUS_00950 106032 107288 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728380.1 protein_id gnl|my_center|LOCUS_00950 108413 107385 gene locus_tag LOCUS_00960 108413 107385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 108909 110162 gene locus_tag LOCUS_00970 108909 110162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 110159 110629 gene locus_tag LOCUS_00980 110159 110629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 111340 110759 gene locus_tag LOCUS_00990 111340 110759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 112125 111337 gene locus_tag LOCUS_01000 112125 111337 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_01000 112285 113262 gene locus_tag LOCUS_01010 112285 113262 CDS product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037478.1 protein_id gnl|my_center|LOCUS_01010 113253 114203 gene locus_tag LOCUS_01020 113253 114203 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259194.1 protein_id gnl|my_center|LOCUS_01020 114379 116127 gene locus_tag LOCUS_01030 114379 116127 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940770.1 protein_id gnl|my_center|LOCUS_01030 116114 117910 gene locus_tag LOCUS_01040 116114 117910 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940777.1 protein_id gnl|my_center|LOCUS_01040 117945 118289 gene locus_tag LOCUS_01050 117945 118289 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017800955.1 protein_id gnl|my_center|LOCUS_01050 118274 119302 gene locus_tag LOCUS_01060 118274 119302 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_01060 119311 119778 gene locus_tag LOCUS_01070 119311 119778 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228850.1 protein_id gnl|my_center|LOCUS_01070 119946 120707 gene locus_tag LOCUS_01080 119946 120707 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815983.1 protein_id gnl|my_center|LOCUS_01080 120707 121654 gene locus_tag LOCUS_01090 120707 121654 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250632.1 protein_id gnl|my_center|LOCUS_01090 121651 121797 gene locus_tag LOCUS_01100 121651 121797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01100 121807 122118 gene locus_tag LOCUS_01110 121807 122118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01110 122504 123001 gene locus_tag LOCUS_01120 122504 123001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 122994 123905 gene locus_tag LOCUS_01130 122994 123905 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_01130 124497 123889 gene locus_tag LOCUS_01140 124497 123889 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942096.1 protein_id gnl|my_center|LOCUS_01140 125306 124563 gene locus_tag LOCUS_01150 125306 124563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 125381 125857 gene locus_tag LOCUS_01160 125381 125857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 126301 125831 gene locus_tag LOCUS_01170 126301 125831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 126473 127663 gene locus_tag LOCUS_01180 126473 127663 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113162.1 protein_id gnl|my_center|LOCUS_01180 128077 127688 gene locus_tag LOCUS_01190 128077 127688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 129309 128077 gene locus_tag LOCUS_01200 129309 128077 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_01200 130055 129306 gene locus_tag LOCUS_01210 130055 129306 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_01210 131740 130061 gene locus_tag LOCUS_01220 131740 130061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 133183 131774 gene locus_tag LOCUS_01230 133183 131774 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941618.1 protein_id gnl|my_center|LOCUS_01230 136347 133180 gene locus_tag LOCUS_01240 136347 133180 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140878.1 protein_id gnl|my_center|LOCUS_01240 137659 136355 gene locus_tag LOCUS_01250 137659 136355 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393804.1 protein_id gnl|my_center|LOCUS_01250 137890 140196 gene locus_tag LOCUS_01260 137890 140196 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164561900.1 protein_id gnl|my_center|LOCUS_01260 140215 140532 gene locus_tag LOCUS_01270 140215 140532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 140831 141223 gene locus_tag LOCUS_01280 140831 141223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 141616 143919 gene locus_tag LOCUS_01290 141616 143919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 143930 144853 gene locus_tag LOCUS_01300 143930 144853 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942386.1 protein_id gnl|my_center|LOCUS_01300 145138 145527 gene locus_tag LOCUS_01310 145138 145527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 145598 146128 gene locus_tag LOCUS_01320 145598 146128 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143719.1 protein_id gnl|my_center|LOCUS_01320 146134 148158 gene locus_tag LOCUS_01330 gene uvrB 146134 148158 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 protein_id gnl|my_center|LOCUS_01330 148163 148372 gene locus_tag LOCUS_01340 148163 148372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 148392 150227 gene locus_tag LOCUS_01350 gene uvrC 148392 150227 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_01350 150264 150512 gene locus_tag LOCUS_01360 150264 150512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 150584 153103 gene locus_tag LOCUS_01370 gene leuS 150584 153103 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942849.1 protein_id gnl|my_center|LOCUS_01370 153103 153642 gene locus_tag LOCUS_01380 153103 153642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 153642 154637 gene locus_tag LOCUS_01390 153642 154637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 154625 156010 gene locus_tag LOCUS_01400 154625 156010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223273.1 protein_id gnl|my_center|LOCUS_01400 156669 156409 gene locus_tag LOCUS_01410 gene rpsT 156669 156409 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775769.1 protein_id gnl|my_center|LOCUS_01410 156702 158348 gene locus_tag LOCUS_01420 gene murJ 156702 158348 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_01420 158473 159384 gene locus_tag LOCUS_01430 gene xerD 158473 159384 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390080.1 protein_id gnl|my_center|LOCUS_01430 159371 161083 gene locus_tag LOCUS_01440 159371 161083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 161080 162690 gene locus_tag LOCUS_01450 gene pyrG 161080 162690 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320045.1 protein_id gnl|my_center|LOCUS_01450 162693 163574 gene locus_tag LOCUS_01460 gene kdsA 162693 163574 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_01460 163588 164559 gene locus_tag LOCUS_01470 163588 164559 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_01470 164556 165077 gene locus_tag LOCUS_01480 164556 165077 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815172.1 protein_id gnl|my_center|LOCUS_01480 165128 165730 gene locus_tag LOCUS_01490 165128 165730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 165727 166359 gene locus_tag LOCUS_01500 165727 166359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 166364 167086 gene locus_tag LOCUS_01510 gene lptB 166364 167086 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047473.1 protein_id gnl|my_center|LOCUS_01510 167110 168561 gene locus_tag LOCUS_01520 gene rpoN 167110 168561 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_01520 168577 169098 gene locus_tag LOCUS_01530 gene raiA 168577 169098 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942531.1 protein_id gnl|my_center|LOCUS_01530 169104 169988 gene locus_tag LOCUS_01540 gene rapZ 169104 169988 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_01540 169981 172086 gene locus_tag LOCUS_01550 169981 172086 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118691.1 protein_id gnl|my_center|LOCUS_01550 172181 173332 gene locus_tag LOCUS_01560 gene metK 172181 173332 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546806.1 protein_id gnl|my_center|LOCUS_01560 173409 174668 gene locus_tag LOCUS_01570 gene ahcY 173409 174668 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545526.1 protein_id gnl|my_center|LOCUS_01570 174731 177433 gene locus_tag LOCUS_01580 174731 177433 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942970.1 protein_id gnl|my_center|LOCUS_01580 179749 177443 gene locus_tag LOCUS_01590 179749 177443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 179792 180835 gene locus_tag LOCUS_01600 179792 180835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 180983 183463 gene locus_tag LOCUS_01610 180983 183463 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942688.1 protein_id gnl|my_center|LOCUS_01610 183460 184230 gene locus_tag LOCUS_01620 183460 184230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 184214 184981 gene locus_tag LOCUS_01630 184214 184981 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_01630 185113 186273 gene locus_tag LOCUS_01640 185113 186273 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058024.1 protein_id gnl|my_center|LOCUS_01640 186534 188075 gene locus_tag LOCUS_01650 gene guaA 186534 188075 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_01650 188167 191715 gene locus_tag LOCUS_01660 188167 191715 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_01660 191699 192652 gene locus_tag LOCUS_01670 191699 192652 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_01670 192708 194060 gene locus_tag LOCUS_01680 gene miaB 192708 194060 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392626.1 protein_id gnl|my_center|LOCUS_01680 194075 194602 gene locus_tag LOCUS_01690 194075 194602 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545067.1 protein_id gnl|my_center|LOCUS_01690 194606 195739 gene locus_tag LOCUS_01700 194606 195739 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392647.1 protein_id gnl|my_center|LOCUS_01700 195862 196119 gene locus_tag LOCUS_01710 195862 196119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 196142 196972 gene locus_tag LOCUS_01720 196142 196972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 197252 198553 gene locus_tag LOCUS_01730 197252 198553 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809685.1 protein_id gnl|my_center|LOCUS_01730 198693 199574 gene locus_tag LOCUS_01740 198693 199574 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_01740 199576 200574 gene locus_tag LOCUS_01750 199576 200574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 200529 201317 gene locus_tag LOCUS_01760 200529 201317 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085709.1 protein_id gnl|my_center|LOCUS_01760 201310 202050 gene locus_tag LOCUS_01770 201310 202050 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_01770 202055 202477 gene locus_tag LOCUS_01780 gene paaI 202055 202477 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391943.1 protein_id gnl|my_center|LOCUS_01780 202578 203315 gene locus_tag LOCUS_01790 202578 203315 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640897.1 protein_id gnl|my_center|LOCUS_01790 203408 205480 gene locus_tag LOCUS_01800 203408 205480 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229602.1 protein_id gnl|my_center|LOCUS_01800 205477 207195 gene locus_tag LOCUS_01810 205477 207195 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_01810 207188 208819 gene locus_tag LOCUS_01820 207188 208819 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083813.1 protein_id gnl|my_center|LOCUS_01820 208832 209293 gene locus_tag LOCUS_01830 208832 209293 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_01830 209290 210024 gene locus_tag LOCUS_01840 209290 210024 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812772.1 protein_id gnl|my_center|LOCUS_01840 210257 211426 gene locus_tag LOCUS_01850 210257 211426 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211204333.1 protein_id gnl|my_center|LOCUS_01850 211426 211866 gene locus_tag LOCUS_01860 211426 211866 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807885.1 protein_id gnl|my_center|LOCUS_01860 211863 212276 gene locus_tag LOCUS_01870 211863 212276 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896278.1 protein_id gnl|my_center|LOCUS_01870 212290 213903 gene locus_tag LOCUS_01880 212290 213903 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 protein_id gnl|my_center|LOCUS_01880 213906 215099 gene locus_tag LOCUS_01890 213906 215099 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064882.1 protein_id gnl|my_center|LOCUS_01890 215096 217393 gene locus_tag LOCUS_01900 215096 217393 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_01900 217489 217983 gene locus_tag LOCUS_01910 217489 217983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 218016 218339 gene locus_tag LOCUS_01920 218016 218339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 218341 220398 gene locus_tag LOCUS_01930 218341 220398 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_01930 220395 222140 gene locus_tag LOCUS_01940 220395 222140 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538203.1 protein_id gnl|my_center|LOCUS_01940 222137 223015 gene locus_tag LOCUS_01950 222137 223015 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090656.1 protein_id gnl|my_center|LOCUS_01950 223015 223932 gene locus_tag LOCUS_01960 223015 223932 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812443.1 protein_id gnl|my_center|LOCUS_01960 223959 225119 gene locus_tag LOCUS_01970 223959 225119 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089288.1 protein_id gnl|my_center|LOCUS_01970 225116 225895 gene locus_tag LOCUS_01980 225116 225895 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075839.1 protein_id gnl|my_center|LOCUS_01980 225912 226622 gene locus_tag LOCUS_01990 225912 226622 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173391.1 protein_id gnl|my_center|LOCUS_01990 226627 227787 gene locus_tag LOCUS_02000 226627 227787 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 protein_id gnl|my_center|LOCUS_02000 227784 229082 gene locus_tag LOCUS_02010 227784 229082 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545255.1 protein_id gnl|my_center|LOCUS_02010 229884 229222 gene locus_tag LOCUS_02020 229884 229222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 230342 229884 gene locus_tag LOCUS_02030 230342 229884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 230456 230947 gene locus_tag LOCUS_02040 230456 230947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 230971 232443 gene locus_tag LOCUS_02050 230971 232443 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940912.1 protein_id gnl|my_center|LOCUS_02050 233428 232430 gene locus_tag LOCUS_02060 233428 232430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 234036 233455 gene locus_tag LOCUS_02070 234036 233455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 234413 234973 gene locus_tag LOCUS_02080 234413 234973 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919832.1 protein_id gnl|my_center|LOCUS_02080 235137 237920 gene locus_tag LOCUS_02090 235137 237920 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141077.1 protein_id gnl|my_center|LOCUS_02090 237976 238563 gene locus_tag LOCUS_02100 237976 238563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 238589 239371 gene locus_tag LOCUS_02110 238589 239371 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174479.1 protein_id gnl|my_center|LOCUS_02110 239457 239381 gene locus_tag LOCUS_t00010 239457 239381 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 240180 239515 gene locus_tag LOCUS_02120 240180 239515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 241066 240173 gene locus_tag LOCUS_02130 241066 240173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 241368 241063 gene locus_tag LOCUS_02140 241368 241063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 241517 241441 gene locus_tag LOCUS_t00020 241517 241441 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 242223 241549 gene locus_tag LOCUS_02150 242223 241549 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942171.1 protein_id gnl|my_center|LOCUS_02150 242993 242220 gene locus_tag LOCUS_02160 gene surE 242993 242220 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942170.1 protein_id gnl|my_center|LOCUS_02160 243138 243062 gene locus_tag LOCUS_t00030 243138 243062 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 243548 243186 gene locus_tag LOCUS_02170 243548 243186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 243842 243561 gene locus_tag LOCUS_02180 243842 243561 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_02180 244186 243839 gene locus_tag LOCUS_02190 gene cutA 244186 243839 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545706.1 protein_id gnl|my_center|LOCUS_02190 245097 244183 gene locus_tag LOCUS_02200 245097 244183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 246581 245235 gene locus_tag LOCUS_02210 gene der 246581 245235 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_02210 247915 246578 gene locus_tag LOCUS_02220 247915 246578 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392836.1 protein_id gnl|my_center|LOCUS_02220 248467 247919 gene locus_tag LOCUS_02230 248467 247919 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532444.1 protein_id gnl|my_center|LOCUS_02230 249806 248553 gene locus_tag LOCUS_02240 gene hflX 249806 248553 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_02240 250792 249803 gene locus_tag LOCUS_02250 gene miaA 250792 249803 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_02250 252618 250879 gene locus_tag LOCUS_02260 gene mutL 252618 250879 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942644.1 protein_id gnl|my_center|LOCUS_02260 255206 252615 gene locus_tag LOCUS_02270 gene mutS 255206 252615 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_02270 255661 255203 gene locus_tag LOCUS_02280 255661 255203 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146469.1 protein_id gnl|my_center|LOCUS_02280 255970 255695 gene locus_tag LOCUS_02290 gene ihfB 255970 255695 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383532.1 protein_id gnl|my_center|LOCUS_02290 257016 256126 gene locus_tag LOCUS_02300 gene sppA 257016 256126 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941890.1 protein_id gnl|my_center|LOCUS_02300 258729 257020 gene locus_tag LOCUS_02310 258729 257020 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_02310 259416 258805 gene locus_tag LOCUS_02320 259416 258805 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_02320 260084 259398 gene locus_tag LOCUS_02330 gene cmk 260084 259398 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943242.1 protein_id gnl|my_center|LOCUS_02330 261406 260081 gene locus_tag LOCUS_02340 gene aroA 261406 260081 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392845.1 protein_id gnl|my_center|LOCUS_02340 262251 261403 gene locus_tag LOCUS_02350 262251 261403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 263363 262248 gene locus_tag LOCUS_02360 gene hisC 263363 262248 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_02360 264435 263374 gene locus_tag LOCUS_02370 gene pheA 264435 263374 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_02370 265124 264432 gene locus_tag LOCUS_02380 265124 264432 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_02380 265881 265147 gene locus_tag LOCUS_02390 265881 265147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 266680 265874 gene locus_tag LOCUS_02400 266680 265874 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_02400 267636 266677 gene locus_tag LOCUS_02410 gene trpS 267636 266677 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546811.1 protein_id gnl|my_center|LOCUS_02410 268447 267680 gene locus_tag LOCUS_02420 268447 267680 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_02420 269460 268444 gene locus_tag LOCUS_02430 gene waaC 269460 268444 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942882.1 protein_id gnl|my_center|LOCUS_02430 270038 269559 gene locus_tag LOCUS_02440 270038 269559 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258042.1 protein_id gnl|my_center|LOCUS_02440 271032 270022 gene locus_tag LOCUS_02450 gene rfaE1 271032 270022 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057610.1 protein_id gnl|my_center|LOCUS_02450 271589 271032 gene locus_tag LOCUS_02460 gene gmhB 271589 271032 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_02460 272762 271647 gene locus_tag LOCUS_02470 272762 271647 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545557.1 protein_id gnl|my_center|LOCUS_02470 273889 272759 gene locus_tag LOCUS_02480 273889 272759 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941297.1 protein_id gnl|my_center|LOCUS_02480 275022 273886 gene locus_tag LOCUS_02490 275022 273886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 276149 275019 gene locus_tag LOCUS_02500 276149 275019 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925739.1 protein_id gnl|my_center|LOCUS_02500 277225 276146 gene locus_tag LOCUS_02510 277225 276146 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546515.1 protein_id gnl|my_center|LOCUS_02510 278220 277222 gene locus_tag LOCUS_02520 gene waaF 278220 277222 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_02520 279353 278229 gene locus_tag LOCUS_02530 gene lpxK 279353 278229 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_02530 280653 279346 gene locus_tag LOCUS_02540 gene waaA 280653 279346 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891557.1 protein_id gnl|my_center|LOCUS_02540 281303 280650 gene locus_tag LOCUS_02550 281303 280650 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392265.1 protein_id gnl|my_center|LOCUS_02550 282460 281300 gene locus_tag LOCUS_02560 gene lpxB 282460 281300 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_02560 283265 282447 gene locus_tag LOCUS_02570 gene lpxI 283265 282447 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546653.1 protein_id gnl|my_center|LOCUS_02570 284275 283244 gene locus_tag LOCUS_02580 284275 283244 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140212.1 protein_id gnl|my_center|LOCUS_02580 285096 284272 gene locus_tag LOCUS_02590 gene lpxA 285096 284272 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921189.1 protein_id gnl|my_center|LOCUS_02590 286133 285093 gene locus_tag LOCUS_02600 gene lpxD 286133 285093 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098585.1 protein_id gnl|my_center|LOCUS_02600 286700 286134 gene locus_tag LOCUS_02610 286700 286134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 288998 286719 gene locus_tag LOCUS_02620 gene bamA 288998 286719 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_02620 291489 289042 gene locus_tag LOCUS_02630 gene clpC 291489 289042 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971179.1 protein_id gnl|my_center|LOCUS_02630 292314 291631 gene locus_tag LOCUS_02640 292314 291631 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_02640 293551 292307 gene locus_tag LOCUS_02650 293551 292307 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939648.1 protein_id gnl|my_center|LOCUS_02650 295104 293548 gene locus_tag LOCUS_02660 gene lysS 295104 293548 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_02660 296094 295111 gene locus_tag LOCUS_02670 gene prfB 296094 295111 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096001716.1 protein_id gnl|my_center|LOCUS_02670 297777 296203 gene locus_tag LOCUS_02680 gene lnt 297777 296203 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083613.1 protein_id gnl|my_center|LOCUS_02680 298453 297767 gene locus_tag LOCUS_02690 298453 297767 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259632.1 protein_id gnl|my_center|LOCUS_02690 298934 298518 gene locus_tag LOCUS_02700 gene nusB 298934 298518 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546543.1 protein_id gnl|my_center|LOCUS_02700 299450 298944 gene locus_tag LOCUS_02710 gene ribE 299450 298944 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258065.1 protein_id gnl|my_center|LOCUS_02710 300678 299452 gene locus_tag LOCUS_02720 300678 299452 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392434.1 protein_id gnl|my_center|LOCUS_02720 301268 300675 gene locus_tag LOCUS_02730 301268 300675 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459819.1 protein_id gnl|my_center|LOCUS_02730 302358 301270 gene locus_tag LOCUS_02740 gene ribD 302358 301270 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_02740 303332 302406 gene locus_tag LOCUS_02750 gene ftsY 303332 302406 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941793.1 protein_id gnl|my_center|LOCUS_02750 304162 303329 gene locus_tag LOCUS_02760 304162 303329 CDS product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037147.1 protein_id gnl|my_center|LOCUS_02760 307730 304176 gene locus_tag LOCUS_02770 gene smc 307730 304176 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941791.1 protein_id gnl|my_center|LOCUS_02770 310659 307852 gene locus_tag LOCUS_02780 gene secA 310659 307852 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942693.1 protein_id gnl|my_center|LOCUS_02780 312415 310703 gene locus_tag LOCUS_02790 gene recN 312415 310703 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_02790 313347 312490 gene locus_tag LOCUS_02800 313347 312490 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_02800 314063 313344 gene locus_tag LOCUS_02810 314063 313344 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393019.1 protein_id gnl|my_center|LOCUS_02810 316696 314189 gene locus_tag LOCUS_02820 316696 314189 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943866.1 protein_id gnl|my_center|LOCUS_02820 317500 316778 gene locus_tag LOCUS_02830 317500 316778 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941515.1 protein_id gnl|my_center|LOCUS_02830 318832 317528 gene locus_tag LOCUS_02840 318832 317528 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142579.1 protein_id gnl|my_center|LOCUS_02840 320175 318829 gene locus_tag LOCUS_02850 320175 318829 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142580.1 protein_id gnl|my_center|LOCUS_02850 320560 321246 gene locus_tag LOCUS_02860 320560 321246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 321337 322782 gene locus_tag LOCUS_02870 321337 322782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 323642 322971 gene locus_tag LOCUS_02880 gene phnE 323642 322971 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302225.1 protein_id gnl|my_center|LOCUS_02880 324463 323720 gene locus_tag LOCUS_02890 gene phnC 324463 323720 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368503.1 protein_id gnl|my_center|LOCUS_02890 324792 324460 gene locus_tag LOCUS_02900 324792 324460 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392126.1 protein_id gnl|my_center|LOCUS_02900 324871 324993 gene locus_tag LOCUS_02910 324871 324993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 325814 325071 gene locus_tag LOCUS_02920 325814 325071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 326698 325859 gene locus_tag LOCUS_02930 326698 325859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 327839 326712 gene locus_tag LOCUS_02940 327839 326712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 331231 327854 gene locus_tag LOCUS_02950 331231 327854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 333383 331725 gene locus_tag LOCUS_02960 333383 331725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 333929 334189 gene locus_tag LOCUS_02970 333929 334189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 335297 334527 gene locus_tag LOCUS_02980 335297 334527 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333519.1 protein_id gnl|my_center|LOCUS_02980 335676 335428 gene locus_tag LOCUS_02990 335676 335428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 336904 335888 gene locus_tag LOCUS_03000 336904 335888 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947956.1 protein_id gnl|my_center|LOCUS_03000 337143 336952 gene locus_tag LOCUS_03010 337143 336952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 337496 337167 gene locus_tag LOCUS_03020 337496 337167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 339063 337687 gene locus_tag LOCUS_03030 339063 337687 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_03030 340282 339056 gene locus_tag LOCUS_03040 340282 339056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 340214 340420 gene locus_tag LOCUS_03050 340214 340420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 340870 340481 gene locus_tag LOCUS_03060 340870 340481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 342544 341954 gene locus_tag LOCUS_03070 342544 341954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 342817 342614 gene locus_tag LOCUS_03080 342817 342614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 343174 342977 gene locus_tag LOCUS_03090 343174 342977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 343471 343178 gene locus_tag LOCUS_03100 343471 343178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 343986 343750 gene locus_tag LOCUS_03110 343986 343750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 343894 344085 gene locus_tag LOCUS_03120 343894 344085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 344603 344187 gene locus_tag LOCUS_03130 344603 344187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 346182 344611 gene locus_tag LOCUS_03140 gene lnt 346182 344611 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_03140 346499 346251 gene locus_tag LOCUS_03150 346499 346251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 346809 346525 gene locus_tag LOCUS_03160 346809 346525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 347046 346837 gene locus_tag LOCUS_03170 347046 346837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 347737 347213 gene locus_tag LOCUS_03180 347737 347213 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941975.1 protein_id gnl|my_center|LOCUS_03180 348201 347803 gene locus_tag LOCUS_03190 348201 347803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 349604 348198 gene locus_tag LOCUS_03200 349604 348198 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_03200 >Feature sequence002 2255 1350 gene locus_tag LOCUS_03210 2255 1350 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_03210 3199 2252 gene locus_tag LOCUS_03220 gene appB 3199 2252 CDS product oligopeptide ABC transporter permease AppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245828.1 protein_id gnl|my_center|LOCUS_03220 3740 3369 gene locus_tag LOCUS_03230 3740 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 4194 4119 gene locus_tag LOCUS_t00040 4194 4119 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5074 4247 gene locus_tag LOCUS_03240 5074 4247 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943067.1 protein_id gnl|my_center|LOCUS_03240 6399 5071 gene locus_tag LOCUS_03250 6399 5071 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_03250 7384 6440 gene locus_tag LOCUS_03260 gene speB 7384 6440 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112934.1 protein_id gnl|my_center|LOCUS_03260 8632 7406 gene locus_tag LOCUS_03270 8632 7406 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917693.1 protein_id gnl|my_center|LOCUS_03270 9006 8629 gene locus_tag LOCUS_03280 9006 8629 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259321.1 protein_id gnl|my_center|LOCUS_03280 10045 9011 gene locus_tag LOCUS_03290 10045 9011 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938852.1 protein_id gnl|my_center|LOCUS_03290 11477 10389 gene locus_tag LOCUS_03300 11477 10389 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027597.1 protein_id gnl|my_center|LOCUS_03300 12648 11485 gene locus_tag LOCUS_03310 12648 11485 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_03310 13547 12657 gene locus_tag LOCUS_03320 13547 12657 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969441.1 protein_id gnl|my_center|LOCUS_03320 14150 13560 gene locus_tag LOCUS_03330 14150 13560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 16189 14147 gene locus_tag LOCUS_03340 16189 14147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 17024 16215 gene locus_tag LOCUS_03350 17024 16215 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330362.1 protein_id gnl|my_center|LOCUS_03350 17969 17112 gene locus_tag LOCUS_03360 17969 17112 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_03360 20379 17983 gene locus_tag LOCUS_03370 20379 17983 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_03370 20885 20412 gene locus_tag LOCUS_03380 20885 20412 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_03380 22206 20944 gene locus_tag LOCUS_03390 gene larC 22206 20944 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393989.1 protein_id gnl|my_center|LOCUS_03390 23120 22275 gene locus_tag LOCUS_03400 gene larE 23120 22275 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393988.1 protein_id gnl|my_center|LOCUS_03400 24028 23117 gene locus_tag LOCUS_03410 24028 23117 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_03410 24947 24021 gene locus_tag LOCUS_03420 gene mtnP 24947 24021 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_03420 26299 24944 gene locus_tag LOCUS_03430 gene mtaB 26299 24944 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392125.1 protein_id gnl|my_center|LOCUS_03430 27366 26296 gene locus_tag LOCUS_03440 gene rlmN 27366 26296 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_03440 28831 27545 gene locus_tag LOCUS_03450 28831 27545 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938066.1 protein_id gnl|my_center|LOCUS_03450 29997 28828 gene locus_tag LOCUS_03460 29997 28828 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 protein_id gnl|my_center|LOCUS_03460 30250 30008 gene locus_tag LOCUS_03470 30250 30008 CDS product NIL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545388.1 protein_id gnl|my_center|LOCUS_03470 30561 30280 gene locus_tag LOCUS_03480 30561 30280 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_03480 31937 30678 gene locus_tag LOCUS_03490 gene thrC 31937 30678 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546459.1 protein_id gnl|my_center|LOCUS_03490 32113 34044 gene locus_tag LOCUS_03500 32113 34044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 34495 34208 gene locus_tag LOCUS_03510 34495 34208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 34512 36071 gene locus_tag LOCUS_03520 34512 36071 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965798.1 protein_id gnl|my_center|LOCUS_03520 36116 37078 gene locus_tag LOCUS_03530 36116 37078 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385051.1 protein_id gnl|my_center|LOCUS_03530 37068 37976 gene locus_tag LOCUS_03540 37068 37976 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085650.1 protein_id gnl|my_center|LOCUS_03540 38371 37979 gene locus_tag LOCUS_03550 38371 37979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 40258 38384 gene locus_tag LOCUS_03560 40258 38384 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271912.1 protein_id gnl|my_center|LOCUS_03560 41355 40291 gene locus_tag LOCUS_03570 41355 40291 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_03570 41942 41397 gene locus_tag LOCUS_03580 41942 41397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 42260 42721 gene locus_tag LOCUS_03590 42260 42721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03590 42850 43125 gene locus_tag LOCUS_03600 42850 43125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03600 43643 43302 gene locus_tag LOCUS_03610 43643 43302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 44114 43764 gene locus_tag LOCUS_03620 44114 43764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 45776 44283 gene locus_tag LOCUS_03630 45776 44283 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940921.1 protein_id gnl|my_center|LOCUS_03630 47225 45840 gene locus_tag LOCUS_03640 47225 45840 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928748.1 protein_id gnl|my_center|LOCUS_03640 47802 47275 gene locus_tag LOCUS_03650 47802 47275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 48750 47839 gene locus_tag LOCUS_03660 48750 47839 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085741.1 protein_id gnl|my_center|LOCUS_03660 49243 48764 gene locus_tag LOCUS_03670 49243 48764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 50128 49304 gene locus_tag LOCUS_03680 50128 49304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 50953 50162 gene locus_tag LOCUS_03690 50953 50162 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968528.1 protein_id gnl|my_center|LOCUS_03690 52077 51238 gene locus_tag LOCUS_03700 52077 51238 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973218.1 protein_id gnl|my_center|LOCUS_03700 52307 52822 gene locus_tag LOCUS_03710 52307 52822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 52823 55123 gene locus_tag LOCUS_03720 52823 55123 CDS product DNA polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943858.1 protein_id gnl|my_center|LOCUS_03720 55582 55253 gene locus_tag LOCUS_03730 55582 55253 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941979.1 protein_id gnl|my_center|LOCUS_03730 56597 55803 gene locus_tag LOCUS_03740 56597 55803 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064395.1 protein_id gnl|my_center|LOCUS_03740 57290 56640 gene locus_tag LOCUS_03750 57290 56640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 57942 57424 gene locus_tag LOCUS_03760 57942 57424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 57941 59143 gene locus_tag LOCUS_03770 57941 59143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 59168 60736 gene locus_tag LOCUS_03780 59168 60736 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582600.1 protein_id gnl|my_center|LOCUS_03780 60769 62301 gene locus_tag LOCUS_03790 60769 62301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 62301 63197 gene locus_tag LOCUS_03800 62301 63197 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_03800 63197 64123 gene locus_tag LOCUS_03810 63197 64123 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462197.1 protein_id gnl|my_center|LOCUS_03810 64855 64184 gene locus_tag LOCUS_03820 64855 64184 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175134.1 protein_id gnl|my_center|LOCUS_03820 65686 64859 gene locus_tag LOCUS_03830 65686 64859 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095630.1 protein_id gnl|my_center|LOCUS_03830 66708 65773 gene locus_tag LOCUS_03840 66708 65773 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250976.1 protein_id gnl|my_center|LOCUS_03840 66861 67217 gene locus_tag LOCUS_03850 66861 67217 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895682.1 protein_id gnl|my_center|LOCUS_03850 67205 67630 gene locus_tag LOCUS_03860 67205 67630 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140146.1 protein_id gnl|my_center|LOCUS_03860 67630 68253 gene locus_tag LOCUS_03870 67630 68253 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166172348.1 protein_id gnl|my_center|LOCUS_03870 68680 68198 gene locus_tag LOCUS_03880 68680 68198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 69669 68677 gene locus_tag LOCUS_03890 69669 68677 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089112.1 protein_id gnl|my_center|LOCUS_03890 70450 69683 gene locus_tag LOCUS_03900 70450 69683 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083661.1 protein_id gnl|my_center|LOCUS_03900 71031 70471 gene locus_tag LOCUS_03910 71031 70471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 71517 71098 gene locus_tag LOCUS_03920 71517 71098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 72210 71590 gene locus_tag LOCUS_03930 72210 71590 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062378.1 protein_id gnl|my_center|LOCUS_03930 73001 72210 gene locus_tag LOCUS_03940 73001 72210 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027133324.1 protein_id gnl|my_center|LOCUS_03940 74663 73110 gene locus_tag LOCUS_03950 74663 73110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 75465 74671 gene locus_tag LOCUS_03960 75465 74671 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_03960 76151 75465 gene locus_tag LOCUS_03970 76151 75465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 77354 76626 gene locus_tag LOCUS_03980 77354 76626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 79325 77592 gene locus_tag LOCUS_03990 79325 77592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 80099 79368 gene locus_tag LOCUS_04000 80099 79368 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253617.1 protein_id gnl|my_center|LOCUS_04000 80164 80994 gene locus_tag LOCUS_04010 80164 80994 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957337.1 protein_id gnl|my_center|LOCUS_04010 81021 81800 gene locus_tag LOCUS_04020 81021 81800 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479178.1 protein_id gnl|my_center|LOCUS_04020 81813 82244 gene locus_tag LOCUS_04030 81813 82244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 82966 82211 gene locus_tag LOCUS_04040 82966 82211 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583927.1 protein_id gnl|my_center|LOCUS_04040 83831 82989 gene locus_tag LOCUS_04050 83831 82989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 85411 84074 gene locus_tag LOCUS_04060 gene pmbA 85411 84074 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112740.1 protein_id gnl|my_center|LOCUS_04060 86844 85411 gene locus_tag LOCUS_04070 gene tldD 86844 85411 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098866.1 protein_id gnl|my_center|LOCUS_04070 87148 88554 gene locus_tag LOCUS_04080 87148 88554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 89918 88584 gene locus_tag LOCUS_04090 89918 88584 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439092.1 protein_id gnl|my_center|LOCUS_04090 91069 89936 gene locus_tag LOCUS_04100 gene thiO 91069 89936 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_04100 91686 91069 gene locus_tag LOCUS_04110 gene thiE 91686 91069 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941250.1 protein_id gnl|my_center|LOCUS_04110 92526 91741 gene locus_tag LOCUS_04120 92526 91741 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941251.1 protein_id gnl|my_center|LOCUS_04120 92850 92650 gene locus_tag LOCUS_04130 gene thiS 92850 92650 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_04130 94692 92866 gene locus_tag LOCUS_04140 94692 92866 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257128.1 protein_id gnl|my_center|LOCUS_04140 96037 94970 gene locus_tag LOCUS_04150 gene gcvT 96037 94970 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973526.1 protein_id gnl|my_center|LOCUS_04150 96074 96811 gene locus_tag LOCUS_04160 96074 96811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 96798 97544 gene locus_tag LOCUS_04170 96798 97544 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967134.1 protein_id gnl|my_center|LOCUS_04170 97585 97971 gene locus_tag LOCUS_04180 gene mutT 97585 97971 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932370.1 protein_id gnl|my_center|LOCUS_04180 99619 97958 gene locus_tag LOCUS_04190 99619 97958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 99507 99752 gene locus_tag LOCUS_04200 99507 99752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 100602 100177 gene locus_tag LOCUS_04210 100602 100177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 101105 100605 gene locus_tag LOCUS_04220 101105 100605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 101404 101102 gene locus_tag LOCUS_04230 101404 101102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 102524 101538 gene locus_tag LOCUS_04240 102524 101538 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975180.1 protein_id gnl|my_center|LOCUS_04240 102768 102541 gene locus_tag LOCUS_04250 102768 102541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 103509 102781 gene locus_tag LOCUS_04260 103509 102781 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089550.1 protein_id gnl|my_center|LOCUS_04260 104345 103512 gene locus_tag LOCUS_04270 104345 103512 CDS product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_04270 105004 104345 gene locus_tag LOCUS_04280 105004 104345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 105405 105001 gene locus_tag LOCUS_04290 105405 105001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 105959 105405 gene locus_tag LOCUS_04300 gene def 105959 105405 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268642.1 protein_id gnl|my_center|LOCUS_04300 106050 109292 gene locus_tag LOCUS_04310 106050 109292 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108722853.1 protein_id gnl|my_center|LOCUS_04310 109305 109904 gene locus_tag LOCUS_04320 109305 109904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 111470 109941 gene locus_tag LOCUS_04330 111470 109941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 112120 111467 gene locus_tag LOCUS_04340 112120 111467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 115574 112110 gene locus_tag LOCUS_04350 gene metH 115574 112110 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271582.1 protein_id gnl|my_center|LOCUS_04350 117349 115646 gene locus_tag LOCUS_04360 gene ilvD 117349 115646 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228538.1 protein_id gnl|my_center|LOCUS_04360 118239 117559 gene locus_tag LOCUS_04370 118239 117559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 119384 118236 gene locus_tag LOCUS_04380 119384 118236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 119809 119381 gene locus_tag LOCUS_04390 119809 119381 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_04390 120290 119820 gene locus_tag LOCUS_04400 120290 119820 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_04400 120515 121609 gene locus_tag LOCUS_04410 gene dctP 120515 121609 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_04410 123016 121673 gene locus_tag LOCUS_04420 123016 121673 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_04420 123611 123018 gene locus_tag LOCUS_04430 123611 123018 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807402.1 protein_id gnl|my_center|LOCUS_04430 123722 124825 gene locus_tag LOCUS_04440 gene mqnE 123722 124825 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546001.1 protein_id gnl|my_center|LOCUS_04440 124816 125901 gene locus_tag LOCUS_04450 gene mqnC 124816 125901 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872147.1 protein_id gnl|my_center|LOCUS_04450 126869 126042 gene locus_tag LOCUS_04460 126869 126042 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879200.1 protein_id gnl|my_center|LOCUS_04460 127559 127014 gene locus_tag LOCUS_04470 127559 127014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 127979 127623 gene locus_tag LOCUS_04480 127979 127623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 129407 128034 gene locus_tag LOCUS_04490 129407 128034 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545384.1 protein_id gnl|my_center|LOCUS_04490 130209 129808 gene locus_tag LOCUS_04500 130209 129808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 130233 131735 gene locus_tag LOCUS_04510 gene atoC 130233 131735 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125283.1 protein_id gnl|my_center|LOCUS_04510 131949 132503 gene locus_tag LOCUS_04520 131949 132503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 132516 133940 gene locus_tag LOCUS_04530 132516 133940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 133944 134771 gene locus_tag LOCUS_04540 133944 134771 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942629.1 protein_id gnl|my_center|LOCUS_04540 135040 136338 gene locus_tag LOCUS_04550 135040 136338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 136618 137988 gene locus_tag LOCUS_04560 136618 137988 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_04560 138032 140266 gene locus_tag LOCUS_04570 138032 140266 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918053.1 protein_id gnl|my_center|LOCUS_04570 140279 141595 gene locus_tag LOCUS_04580 140279 141595 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_04580 141605 142642 gene locus_tag LOCUS_04590 141605 142642 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876019.1 protein_id gnl|my_center|LOCUS_04590 142620 143480 gene locus_tag LOCUS_04600 142620 143480 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942624.1 protein_id gnl|my_center|LOCUS_04600 143477 144565 gene locus_tag LOCUS_04610 gene wecB 143477 144565 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060909.1 protein_id gnl|my_center|LOCUS_04610 144573 145595 gene locus_tag LOCUS_04620 144573 145595 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 protein_id gnl|my_center|LOCUS_04620 145605 146843 gene locus_tag LOCUS_04630 145605 146843 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259387.1 protein_id gnl|my_center|LOCUS_04630 146840 147943 gene locus_tag LOCUS_04640 146840 147943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 147940 149784 gene locus_tag LOCUS_04650 gene asnB 147940 149784 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_04650 149781 150785 gene locus_tag LOCUS_04660 149781 150785 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_04660 150804 152642 gene locus_tag LOCUS_04670 gene glmS 150804 152642 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940943.1 protein_id gnl|my_center|LOCUS_04670 152639 153892 gene locus_tag LOCUS_04680 152639 153892 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259387.1 protein_id gnl|my_center|LOCUS_04680 153898 154869 gene locus_tag LOCUS_04690 153898 154869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 154881 155819 gene locus_tag LOCUS_04700 154881 155819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 155816 157180 gene locus_tag LOCUS_04710 155816 157180 CDS product putative O-glycosylation ligase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390842.1 protein_id gnl|my_center|LOCUS_04710 157173 157955 gene locus_tag LOCUS_04720 157173 157955 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257972.1 protein_id gnl|my_center|LOCUS_04720 157965 159200 gene locus_tag LOCUS_04730 157965 159200 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257610.1 protein_id gnl|my_center|LOCUS_04730 159197 159637 gene locus_tag LOCUS_04740 159197 159637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 159639 161537 gene locus_tag LOCUS_04750 gene asnB 159639 161537 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_04750 161755 163644 gene locus_tag LOCUS_04760 161755 163644 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_04760 163641 164375 gene locus_tag LOCUS_04770 163641 164375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 164372 166435 gene locus_tag LOCUS_04780 gene prsK 164372 166435 CDS product PEP-CTERM system histidine kinase PrsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942586.1 protein_id gnl|my_center|LOCUS_04780 166438 167292 gene locus_tag LOCUS_04790 gene xrt 166438 167292 CDS product exosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176633.1 protein_id gnl|my_center|LOCUS_04790 167289 167948 gene locus_tag LOCUS_04800 167289 167948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 167965 169146 gene locus_tag LOCUS_04810 167965 169146 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120966.1 protein_id gnl|my_center|LOCUS_04810 169143 170333 gene locus_tag LOCUS_04820 169143 170333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 170377 171783 gene locus_tag LOCUS_04830 170377 171783 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021092.1 protein_id gnl|my_center|LOCUS_04830 171773 173221 gene locus_tag LOCUS_04840 gene prsR 171773 173221 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 protein_id gnl|my_center|LOCUS_04840 173244 174473 gene locus_tag LOCUS_04850 173244 174473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 174493 175770 gene locus_tag LOCUS_04860 174493 175770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 175767 176645 gene locus_tag LOCUS_04870 175767 176645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 176635 178533 gene locus_tag LOCUS_04880 176635 178533 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965497.1 protein_id gnl|my_center|LOCUS_04880 178593 178817 gene locus_tag LOCUS_04890 178593 178817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 178823 180004 gene locus_tag LOCUS_04900 178823 180004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 179574 179668 gene locus_tag LOCUS_t00050 179574 179668 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 181319 180048 gene locus_tag LOCUS_04910 181319 180048 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038479.1 protein_id gnl|my_center|LOCUS_04910 182581 181349 gene locus_tag LOCUS_04920 182581 181349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 183879 182638 gene locus_tag LOCUS_04930 183879 182638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 185012 183876 gene locus_tag LOCUS_04940 185012 183876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 185306 186406 gene locus_tag LOCUS_04950 185306 186406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 186403 187650 gene locus_tag LOCUS_04960 186403 187650 CDS product TIGR03087 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 protein_id gnl|my_center|LOCUS_04960 187647 188963 gene locus_tag LOCUS_04970 187647 188963 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027071.1 protein_id gnl|my_center|LOCUS_04970 188978 190111 gene locus_tag LOCUS_04980 188978 190111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 190128 190460 gene locus_tag LOCUS_04990 190128 190460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 190513 191109 gene locus_tag LOCUS_05000 190513 191109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 191268 191750 gene locus_tag LOCUS_05010 191268 191750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 191747 192709 gene locus_tag LOCUS_05020 191747 192709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 >Feature sequence003 848 132 gene locus_tag LOCUS_05030 gene tsaB 848 132 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_05030 944 1630 gene locus_tag LOCUS_05040 gene pyrE 944 1630 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083096.1 protein_id gnl|my_center|LOCUS_05040 1893 2768 gene locus_tag LOCUS_05050 1893 2768 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081244.1 protein_id gnl|my_center|LOCUS_05050 2900 3868 gene locus_tag LOCUS_05060 2900 3868 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838116.1 protein_id gnl|my_center|LOCUS_05060 3916 5100 gene locus_tag LOCUS_05070 3916 5100 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972198.1 protein_id gnl|my_center|LOCUS_05070 6718 5117 gene locus_tag LOCUS_05080 6718 5117 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083813.1 protein_id gnl|my_center|LOCUS_05080 7582 6743 gene locus_tag LOCUS_05090 7582 6743 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811978.1 protein_id gnl|my_center|LOCUS_05090 8546 7584 gene locus_tag LOCUS_05100 8546 7584 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083812.1 protein_id gnl|my_center|LOCUS_05100 9102 8602 gene locus_tag LOCUS_05110 gene nrdR 9102 8602 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_05110 10349 9099 gene locus_tag LOCUS_05120 10349 9099 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_05120 10831 10361 gene locus_tag LOCUS_05130 gene rpiB 10831 10361 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583174.1 protein_id gnl|my_center|LOCUS_05130 12392 11106 gene locus_tag LOCUS_05140 12392 11106 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986777.1 protein_id gnl|my_center|LOCUS_05140 13969 12389 gene locus_tag LOCUS_05150 13969 12389 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555126.1 protein_id gnl|my_center|LOCUS_05150 15207 13966 gene locus_tag LOCUS_05160 gene thiI 15207 13966 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173822.1 protein_id gnl|my_center|LOCUS_05160 16155 15346 gene locus_tag LOCUS_05170 16155 15346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941880.1 protein_id gnl|my_center|LOCUS_05170 16759 16157 gene locus_tag LOCUS_05180 16759 16157 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_05180 17373 16765 gene locus_tag LOCUS_05190 17373 16765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 18662 17370 gene locus_tag LOCUS_05200 gene purD 18662 17370 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968869.1 protein_id gnl|my_center|LOCUS_05200 19585 18659 gene locus_tag LOCUS_05210 19585 18659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 21228 19621 gene locus_tag LOCUS_05220 gene purH 21228 19621 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194285.1 protein_id gnl|my_center|LOCUS_05220 21860 21234 gene locus_tag LOCUS_05230 gene purN 21860 21234 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393541.1 protein_id gnl|my_center|LOCUS_05230 22059 21853 gene locus_tag LOCUS_05240 22059 21853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 23551 22142 gene locus_tag LOCUS_05250 gene purF 23551 22142 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_05250 25757 23532 gene locus_tag LOCUS_05260 gene purL 25757 23532 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 protein_id gnl|my_center|LOCUS_05260 26498 25785 gene locus_tag LOCUS_05270 gene purQ 26498 25785 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393545.1 protein_id gnl|my_center|LOCUS_05270 26969 26736 gene locus_tag LOCUS_05280 gene purS 26969 26736 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920350.1 protein_id gnl|my_center|LOCUS_05280 28370 27075 gene locus_tag LOCUS_05290 gene purB 28370 27075 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393548.1 protein_id gnl|my_center|LOCUS_05290 29637 28372 gene locus_tag LOCUS_05300 29637 28372 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_05300 31772 29637 gene locus_tag LOCUS_05310 gene pnp 31772 29637 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545734.1 protein_id gnl|my_center|LOCUS_05310 32136 31867 gene locus_tag LOCUS_05320 gene rpsO 32136 31867 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_05320 33305 32295 gene locus_tag LOCUS_05330 33305 32295 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404517.1 protein_id gnl|my_center|LOCUS_05330 34122 33205 gene locus_tag LOCUS_05340 gene truB 34122 33205 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203915.1 protein_id gnl|my_center|LOCUS_05340 35120 34119 gene locus_tag LOCUS_05350 35120 34119 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_05350 35485 35117 gene locus_tag LOCUS_05360 gene rbfA 35485 35117 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460392.1 protein_id gnl|my_center|LOCUS_05360 35924 35634 gene locus_tag LOCUS_05370 35924 35634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 38520 35926 gene locus_tag LOCUS_05380 38520 35926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 38690 38505 gene locus_tag LOCUS_05390 38690 38505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 40227 38800 gene locus_tag LOCUS_05400 40227 38800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 40718 40224 gene locus_tag LOCUS_05410 gene rimP 40718 40224 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460396.1 protein_id gnl|my_center|LOCUS_05410 42526 40823 gene locus_tag LOCUS_05420 42526 40823 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545094.1 protein_id gnl|my_center|LOCUS_05420 42864 42532 gene locus_tag LOCUS_05430 42864 42532 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_05430 43961 42873 gene locus_tag LOCUS_05440 gene ispG 43961 42873 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_05440 45375 44014 gene locus_tag LOCUS_05450 gene rseP 45375 44014 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930352.1 protein_id gnl|my_center|LOCUS_05450 46577 45372 gene locus_tag LOCUS_05460 46577 45372 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839296.1 protein_id gnl|my_center|LOCUS_05460 47443 46574 gene locus_tag LOCUS_05470 47443 46574 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583559.1 protein_id gnl|my_center|LOCUS_05470 48225 47443 gene locus_tag LOCUS_05480 48225 47443 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_05480 48864 48307 gene locus_tag LOCUS_05490 gene frr 48864 48307 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_05490 49620 48871 gene locus_tag LOCUS_05500 gene pyrH 49620 48871 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_05500 50225 49620 gene locus_tag LOCUS_05510 gene tsf 50225 49620 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545220.1 protein_id gnl|my_center|LOCUS_05510 51042 50266 gene locus_tag LOCUS_05520 gene rpsB 51042 50266 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_05520 52410 51196 gene locus_tag LOCUS_05530 gene argJ 52410 51196 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942692.1 protein_id gnl|my_center|LOCUS_05530 53477 52428 gene locus_tag LOCUS_05540 gene argC 53477 52428 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 protein_id gnl|my_center|LOCUS_05540 53888 53493 gene locus_tag LOCUS_05550 gene rpsI 53888 53493 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943504.1 protein_id gnl|my_center|LOCUS_05550 54344 53898 gene locus_tag LOCUS_05560 gene rplM 54344 53898 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081738.1 protein_id gnl|my_center|LOCUS_05560 55116 54433 gene locus_tag LOCUS_05570 gene nth 55116 54433 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013539.1 protein_id gnl|my_center|LOCUS_05570 57320 55116 gene locus_tag LOCUS_05580 57320 55116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 58042 57317 gene locus_tag LOCUS_05590 58042 57317 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920731.1 protein_id gnl|my_center|LOCUS_05590 58493 58086 gene locus_tag LOCUS_05600 58493 58086 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941198.1 protein_id gnl|my_center|LOCUS_05600 59656 58511 gene locus_tag LOCUS_05610 59656 58511 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020683.1 protein_id gnl|my_center|LOCUS_05610 60396 59653 gene locus_tag LOCUS_05620 60396 59653 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_05620 61842 60403 gene locus_tag LOCUS_05630 61842 60403 CDS product malate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338924.1 protein_id gnl|my_center|LOCUS_05630 61978 62559 gene locus_tag LOCUS_05640 61978 62559 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928835.1 protein_id gnl|my_center|LOCUS_05640 62773 64290 gene locus_tag LOCUS_05650 gene rpoD 62773 64290 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_05650 65916 64366 gene locus_tag LOCUS_05660 gene mmdA 65916 64366 CDS product methylmalonyl-CoA decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868010.1 protein_id gnl|my_center|LOCUS_05660 66515 66000 gene locus_tag LOCUS_05670 66515 66000 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874483.1 protein_id gnl|my_center|LOCUS_05670 66741 66526 gene locus_tag LOCUS_05680 66741 66526 CDS product biotin/lipoyl-binding carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877243.1 protein_id gnl|my_center|LOCUS_05680 68077 66734 gene locus_tag LOCUS_05690 68077 66734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 69048 68167 gene locus_tag LOCUS_05700 69048 68167 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810750.1 protein_id gnl|my_center|LOCUS_05700 70230 69250 gene locus_tag LOCUS_05710 70230 69250 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228044.1 protein_id gnl|my_center|LOCUS_05710 72161 70353 gene locus_tag LOCUS_05720 72161 70353 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090652.1 protein_id gnl|my_center|LOCUS_05720 72940 72161 gene locus_tag LOCUS_05730 72940 72161 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 protein_id gnl|my_center|LOCUS_05730 73766 73014 gene locus_tag LOCUS_05740 73766 73014 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088703.1 protein_id gnl|my_center|LOCUS_05740 75072 73876 gene locus_tag LOCUS_05750 75072 73876 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937886.1 protein_id gnl|my_center|LOCUS_05750 76358 75144 gene locus_tag LOCUS_05760 gene dinB 76358 75144 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937382.1 protein_id gnl|my_center|LOCUS_05760 76954 76385 gene locus_tag LOCUS_05770 76954 76385 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_05770 77136 76951 gene locus_tag LOCUS_05780 77136 76951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 77838 77200 gene locus_tag LOCUS_05790 gene cysE 77838 77200 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069591551.1 protein_id gnl|my_center|LOCUS_05790 78264 77887 gene locus_tag LOCUS_05800 78264 77887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 79418 78264 gene locus_tag LOCUS_05810 gene nifS 79418 78264 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_05810 79456 79773 gene locus_tag LOCUS_05820 79456 79773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 79778 80134 gene locus_tag LOCUS_05830 79778 80134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 80134 80364 gene locus_tag LOCUS_05840 80134 80364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 80720 80520 gene locus_tag LOCUS_05850 gene iscX 80720 80520 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142213.1 protein_id gnl|my_center|LOCUS_05850 81136 80717 gene locus_tag LOCUS_05860 81136 80717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 82959 81133 gene locus_tag LOCUS_05870 gene dnaK 82959 81133 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_05870 83524 82937 gene locus_tag LOCUS_05880 83524 82937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 83950 83624 gene locus_tag LOCUS_05890 gene iscA 83950 83624 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482998.1 protein_id gnl|my_center|LOCUS_05890 84407 83991 gene locus_tag LOCUS_05900 gene iscU 84407 83991 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812460.1 protein_id gnl|my_center|LOCUS_05900 85667 84441 gene locus_tag LOCUS_05910 85667 84441 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_05910 86118 85681 gene locus_tag LOCUS_05920 86118 85681 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394313.1 protein_id gnl|my_center|LOCUS_05920 87221 86235 gene locus_tag LOCUS_05930 gene galT 87221 86235 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943868.1 protein_id gnl|my_center|LOCUS_05930 87117 87377 gene locus_tag LOCUS_05940 87117 87377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 87378 87575 gene locus_tag LOCUS_05950 87378 87575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 88939 87584 gene locus_tag LOCUS_05960 88939 87584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 93314 88914 gene locus_tag LOCUS_05970 93314 88914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 94204 93311 gene locus_tag LOCUS_05980 94204 93311 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259249.1 protein_id gnl|my_center|LOCUS_05980 95678 94209 gene locus_tag LOCUS_05990 95678 94209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 96733 95696 gene locus_tag LOCUS_06000 96733 95696 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582647.1 protein_id gnl|my_center|LOCUS_06000 97891 96830 gene locus_tag LOCUS_06010 97891 96830 CDS product GPMC system family 4 glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039643499.1 protein_id gnl|my_center|LOCUS_06010 98114 98377 gene locus_tag LOCUS_06020 98114 98377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 99271 98432 gene locus_tag LOCUS_06030 gene phnE 99271 98432 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113152.1 protein_id gnl|my_center|LOCUS_06030 100119 99268 gene locus_tag LOCUS_06040 100119 99268 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103283.1 protein_id gnl|my_center|LOCUS_06040 100909 100082 gene locus_tag LOCUS_06050 100909 100082 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403548.1 protein_id gnl|my_center|LOCUS_06050 101805 100906 gene locus_tag LOCUS_06060 101805 100906 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707869.1 protein_id gnl|my_center|LOCUS_06060 102930 101938 gene locus_tag LOCUS_06070 gene selD 102930 101938 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301201.1 protein_id gnl|my_center|LOCUS_06070 103967 103065 gene locus_tag LOCUS_06080 103967 103065 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_06080 105420 104035 gene locus_tag LOCUS_06090 gene lpdA 105420 104035 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118277.1 protein_id gnl|my_center|LOCUS_06090 106763 105465 gene locus_tag LOCUS_06100 106763 105465 CDS product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174158.1 protein_id gnl|my_center|LOCUS_06100 107840 106860 gene locus_tag LOCUS_06110 107840 106860 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943294.1 protein_id gnl|my_center|LOCUS_06110 108973 107828 gene locus_tag LOCUS_06120 gene pdhA 108973 107828 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943293.1 protein_id gnl|my_center|LOCUS_06120 109279 109067 gene locus_tag LOCUS_06130 109279 109067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 109495 109283 gene locus_tag LOCUS_06140 109495 109283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 111353 109530 gene locus_tag LOCUS_06150 111353 109530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 112287 111382 gene locus_tag LOCUS_06160 gene thrB 112287 111382 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392818.1 protein_id gnl|my_center|LOCUS_06160 113024 112287 gene locus_tag LOCUS_06170 113024 112287 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941976.1 protein_id gnl|my_center|LOCUS_06170 113583 113035 gene locus_tag LOCUS_06180 113583 113035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 113655 114860 gene locus_tag LOCUS_06190 113655 114860 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392247.1 protein_id gnl|my_center|LOCUS_06190 114857 115897 gene locus_tag LOCUS_06200 gene pdxA 114857 115897 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392248.1 protein_id gnl|my_center|LOCUS_06200 116027 117817 gene locus_tag LOCUS_06210 116027 117817 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921386.1 protein_id gnl|my_center|LOCUS_06210 117868 118827 gene locus_tag LOCUS_06220 117868 118827 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084172.1 protein_id gnl|my_center|LOCUS_06220 118842 119783 gene locus_tag LOCUS_06230 118842 119783 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084173.1 protein_id gnl|my_center|LOCUS_06230 119811 121247 gene locus_tag LOCUS_06240 119811 121247 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256492.1 protein_id gnl|my_center|LOCUS_06240 122609 121281 gene locus_tag LOCUS_06250 122609 121281 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115891.1 protein_id gnl|my_center|LOCUS_06250 122994 122695 gene locus_tag LOCUS_06260 122994 122695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06260 123316 123089 gene locus_tag LOCUS_06270 123316 123089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 123625 123338 gene locus_tag LOCUS_06280 123625 123338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 124671 123625 gene locus_tag LOCUS_06290 124671 123625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_06290 125759 124716 gene locus_tag LOCUS_06300 125759 124716 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064421.1 protein_id gnl|my_center|LOCUS_06300 126030 127616 gene locus_tag LOCUS_06310 gene glgP 126030 127616 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964175.1 protein_id gnl|my_center|LOCUS_06310 128896 127658 gene locus_tag LOCUS_06320 128896 127658 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947610.1 protein_id gnl|my_center|LOCUS_06320 130071 128893 gene locus_tag LOCUS_06330 130071 128893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 130278 130439 gene locus_tag LOCUS_06340 130278 130439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 130447 131181 gene locus_tag LOCUS_06350 130447 131181 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975024.1 protein_id gnl|my_center|LOCUS_06350 132326 131265 gene locus_tag LOCUS_06360 132326 131265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 132799 133431 gene locus_tag LOCUS_06370 132799 133431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 133563 135620 gene locus_tag LOCUS_06380 133563 135620 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051509115.1 protein_id gnl|my_center|LOCUS_06380 135950 135594 gene locus_tag LOCUS_06390 135950 135594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 138033 136711 gene locus_tag LOCUS_06400 138033 136711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 138332 138736 gene locus_tag LOCUS_06410 138332 138736 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_06410 138804 139259 gene locus_tag LOCUS_06420 138804 139259 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285884.1 protein_id gnl|my_center|LOCUS_06420 139262 139714 gene locus_tag LOCUS_06430 139262 139714 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086611.1 protein_id gnl|my_center|LOCUS_06430 140272 139718 gene locus_tag LOCUS_06440 140272 139718 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872605.1 protein_id gnl|my_center|LOCUS_06440 140364 141587 gene locus_tag LOCUS_06450 140364 141587 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084676.1 protein_id gnl|my_center|LOCUS_06450 141957 141634 gene locus_tag LOCUS_06460 141957 141634 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087569.1 protein_id gnl|my_center|LOCUS_06460 142105 143742 gene locus_tag LOCUS_06470 142105 143742 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085891.1 protein_id gnl|my_center|LOCUS_06470 144875 143748 gene locus_tag LOCUS_06480 144875 143748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 145612 144899 gene locus_tag LOCUS_06490 145612 144899 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085225034.1 protein_id gnl|my_center|LOCUS_06490 147277 145622 gene locus_tag LOCUS_06500 147277 145622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 147351 149612 gene locus_tag LOCUS_06510 147351 149612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 149609 150091 gene locus_tag LOCUS_06520 149609 150091 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223004.1 protein_id gnl|my_center|LOCUS_06520 150093 151289 gene locus_tag LOCUS_06530 150093 151289 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064882.1 protein_id gnl|my_center|LOCUS_06530 151286 151612 gene locus_tag LOCUS_06540 151286 151612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 151860 152045 gene locus_tag LOCUS_06550 151860 152045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 151979 152644 gene locus_tag LOCUS_06560 151979 152644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 154278 152731 gene locus_tag LOCUS_06570 154278 152731 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085758.1 protein_id gnl|my_center|LOCUS_06570 154408 155010 gene locus_tag LOCUS_06580 154408 155010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 154965 155600 gene locus_tag LOCUS_06590 154965 155600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 155740 158022 gene locus_tag LOCUS_06600 155740 158022 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257971.1 protein_id gnl|my_center|LOCUS_06600 158889 158170 gene locus_tag LOCUS_06610 158889 158170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 158947 159930 gene locus_tag LOCUS_06620 158947 159930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 160882 159812 gene locus_tag LOCUS_06630 160882 159812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 161420 161013 gene locus_tag LOCUS_06640 161420 161013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 161948 162142 gene locus_tag LOCUS_06650 161948 162142 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895347.1 protein_id gnl|my_center|LOCUS_06650 162344 164302 gene locus_tag LOCUS_06660 162344 164302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 164461 165174 gene locus_tag LOCUS_06670 164461 165174 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238605.1 protein_id gnl|my_center|LOCUS_06670 165171 166394 gene locus_tag LOCUS_06680 165171 166394 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965994.1 protein_id gnl|my_center|LOCUS_06680 166457 167326 gene locus_tag LOCUS_06690 166457 167326 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064203.1 protein_id gnl|my_center|LOCUS_06690 167583 168548 gene locus_tag LOCUS_06700 167583 168548 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809842.1 protein_id gnl|my_center|LOCUS_06700 168526 169284 gene locus_tag LOCUS_06710 168526 169284 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809845.1 protein_id gnl|my_center|LOCUS_06710 169286 169981 gene locus_tag LOCUS_06720 169286 169981 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809848.1 protein_id gnl|my_center|LOCUS_06720 169991 171628 gene locus_tag LOCUS_06730 gene fadK 169991 171628 CDS product medium-chain fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302824.1 protein_id gnl|my_center|LOCUS_06730 171625 172509 gene locus_tag LOCUS_06740 gene couO 171625 172509 CDS product 4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225127.1 protein_id gnl|my_center|LOCUS_06740 172512 173303 gene locus_tag LOCUS_06750 172512 173303 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903597.1 protein_id gnl|my_center|LOCUS_06750 173303 174133 gene locus_tag LOCUS_06760 173303 174133 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807958.1 protein_id gnl|my_center|LOCUS_06760 175418 174270 gene locus_tag LOCUS_06770 175418 174270 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392827.1 protein_id gnl|my_center|LOCUS_06770 176040 175402 gene locus_tag LOCUS_06780 176040 175402 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391930.1 protein_id gnl|my_center|LOCUS_06780 177074 176256 gene locus_tag LOCUS_06790 177074 176256 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404610.1 protein_id gnl|my_center|LOCUS_06790 >Feature sequence004 58 894 gene locus_tag LOCUS_06800 58 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 897 1763 gene locus_tag LOCUS_06810 897 1763 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525137.1 protein_id gnl|my_center|LOCUS_06810 1753 2673 gene locus_tag LOCUS_06820 1753 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 2663 3601 gene locus_tag LOCUS_06830 2663 3601 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920945.1 protein_id gnl|my_center|LOCUS_06830 3772 4869 gene locus_tag LOCUS_06840 3772 4869 CDS product DUF4325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682079.1 protein_id gnl|my_center|LOCUS_06840 5157 6026 gene locus_tag LOCUS_06850 5157 6026 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810287.1 protein_id gnl|my_center|LOCUS_06850 6035 7477 gene locus_tag LOCUS_06860 6035 7477 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031537.1 protein_id gnl|my_center|LOCUS_06860 7509 8642 gene locus_tag LOCUS_06870 7509 8642 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256918.1 protein_id gnl|my_center|LOCUS_06870 8701 9897 gene locus_tag LOCUS_06880 8701 9897 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086714.1 protein_id gnl|my_center|LOCUS_06880 11791 9815 gene locus_tag LOCUS_06890 11791 9815 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086713.1 protein_id gnl|my_center|LOCUS_06890 12140 11829 gene locus_tag LOCUS_06900 12140 11829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 12993 12196 gene locus_tag LOCUS_06910 12993 12196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 14583 13048 gene locus_tag LOCUS_06920 14583 13048 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228677.1 protein_id gnl|my_center|LOCUS_06920 14768 16078 gene locus_tag LOCUS_06930 14768 16078 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258704.1 protein_id gnl|my_center|LOCUS_06930 16272 17207 gene locus_tag LOCUS_06940 16272 17207 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_06940 17325 18254 gene locus_tag LOCUS_06950 17325 18254 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_06950 18251 18421 gene locus_tag LOCUS_06960 18251 18421 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937959.1 protein_id gnl|my_center|LOCUS_06960 18583 19482 gene locus_tag LOCUS_06970 18583 19482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 19526 21316 gene locus_tag LOCUS_06980 gene lepA 19526 21316 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816487.1 protein_id gnl|my_center|LOCUS_06980 21316 21993 gene locus_tag LOCUS_06990 gene lepB 21316 21993 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941922.1 protein_id gnl|my_center|LOCUS_06990 21954 23156 gene locus_tag LOCUS_07000 gene hemW 21954 23156 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940708.1 protein_id gnl|my_center|LOCUS_07000 23184 24233 gene locus_tag LOCUS_07010 gene hrcA 23184 24233 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_07010 24299 24880 gene locus_tag LOCUS_07020 gene grpE 24299 24880 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940710.1 protein_id gnl|my_center|LOCUS_07020 24884 25987 gene locus_tag LOCUS_07030 gene dnaJ 24884 25987 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067592.1 protein_id gnl|my_center|LOCUS_07030 25987 26871 gene locus_tag LOCUS_07040 25987 26871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 26879 27658 gene locus_tag LOCUS_07050 26879 27658 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194189.1 protein_id gnl|my_center|LOCUS_07050 27832 28239 gene locus_tag LOCUS_07060 27832 28239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07060 28258 28761 gene locus_tag LOCUS_07070 28258 28761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07070 28837 29421 gene locus_tag LOCUS_07080 28837 29421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 29421 31658 gene locus_tag LOCUS_07090 29421 31658 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_07090 31678 33045 gene locus_tag LOCUS_07100 31678 33045 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940194.1 protein_id gnl|my_center|LOCUS_07100 33834 33082 gene locus_tag LOCUS_07110 33834 33082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 33954 34577 gene locus_tag LOCUS_07120 gene pyrR 33954 34577 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257759.1 protein_id gnl|my_center|LOCUS_07120 34897 35823 gene locus_tag LOCUS_07130 34897 35823 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941926.1 protein_id gnl|my_center|LOCUS_07130 35820 37094 gene locus_tag LOCUS_07140 35820 37094 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_07140 37091 38218 gene locus_tag LOCUS_07150 gene carA 37091 38218 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_07150 38226 38495 gene locus_tag LOCUS_07160 38226 38495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 38502 41714 gene locus_tag LOCUS_07170 gene carB 38502 41714 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941931.1 protein_id gnl|my_center|LOCUS_07170 41701 42423 gene locus_tag LOCUS_07180 gene pyrF 41701 42423 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_07180 42446 43327 gene locus_tag LOCUS_07190 42446 43327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 43339 43854 gene locus_tag LOCUS_07200 gene hpt 43339 43854 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359412.1 protein_id gnl|my_center|LOCUS_07200 44299 43904 gene locus_tag LOCUS_07210 44299 43904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 45965 44535 gene locus_tag LOCUS_07220 45965 44535 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_07220 46785 45970 gene locus_tag LOCUS_07230 46785 45970 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815977.1 protein_id gnl|my_center|LOCUS_07230 47573 46782 gene locus_tag LOCUS_07240 47573 46782 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083244.1 protein_id gnl|my_center|LOCUS_07240 48670 47576 gene locus_tag LOCUS_07250 48670 47576 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815974.1 protein_id gnl|my_center|LOCUS_07250 48886 49770 gene locus_tag LOCUS_07260 48886 49770 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_07260 49770 50390 gene locus_tag LOCUS_07270 gene gmk 49770 50390 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942878.1 protein_id gnl|my_center|LOCUS_07270 50390 50602 gene locus_tag LOCUS_07280 50390 50602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 50607 51857 gene locus_tag LOCUS_07290 gene coaBC 50607 51857 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_07290 51879 52562 gene locus_tag LOCUS_07300 51879 52562 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_07300 52559 54340 gene locus_tag LOCUS_07310 52559 54340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 54386 54907 gene locus_tag LOCUS_07320 gene def 54386 54907 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545479.1 protein_id gnl|my_center|LOCUS_07320 55067 55996 gene locus_tag LOCUS_07330 gene fmt 55067 55996 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392417.1 protein_id gnl|my_center|LOCUS_07330 55993 57351 gene locus_tag LOCUS_07340 gene rsmB 55993 57351 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392419.1 protein_id gnl|my_center|LOCUS_07340 57410 58072 gene locus_tag LOCUS_07350 gene rpe 57410 58072 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232058.1 protein_id gnl|my_center|LOCUS_07350 58132 59475 gene locus_tag LOCUS_07360 gene ffh 58132 59475 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546620.1 protein_id gnl|my_center|LOCUS_07360 59500 59748 gene locus_tag LOCUS_07370 gene rpsP 59500 59748 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_07370 59801 60031 gene locus_tag LOCUS_07380 59801 60031 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_07380 60072 60623 gene locus_tag LOCUS_07390 gene rimM 60072 60623 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223850.1 protein_id gnl|my_center|LOCUS_07390 60620 61366 gene locus_tag LOCUS_07400 gene trmD 60620 61366 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941307.1 protein_id gnl|my_center|LOCUS_07400 61382 61762 gene locus_tag LOCUS_07410 gene rplS 61382 61762 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813207.1 protein_id gnl|my_center|LOCUS_07410 61836 62399 gene locus_tag LOCUS_07420 61836 62399 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941310.1 protein_id gnl|my_center|LOCUS_07420 62432 62812 gene locus_tag LOCUS_07430 62432 62812 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_07430 62940 63866 gene locus_tag LOCUS_07440 62940 63866 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931057.1 protein_id gnl|my_center|LOCUS_07440 63880 64365 gene locus_tag LOCUS_07450 63880 64365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 64470 65744 gene locus_tag LOCUS_07460 64470 65744 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533446.1 protein_id gnl|my_center|LOCUS_07460 65759 67069 gene locus_tag LOCUS_07470 65759 67069 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025324024.1 protein_id gnl|my_center|LOCUS_07470 67071 67862 gene locus_tag LOCUS_07480 67071 67862 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088973.1 protein_id gnl|my_center|LOCUS_07480 67862 68569 gene locus_tag LOCUS_07490 67862 68569 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966750.1 protein_id gnl|my_center|LOCUS_07490 68572 69444 gene locus_tag LOCUS_07500 68572 69444 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528443.1 protein_id gnl|my_center|LOCUS_07500 69468 70424 gene locus_tag LOCUS_07510 69468 70424 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809842.1 protein_id gnl|my_center|LOCUS_07510 71028 70477 gene locus_tag LOCUS_07520 71028 70477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 71176 72693 gene locus_tag LOCUS_07530 71176 72693 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_07530 73307 74335 gene locus_tag LOCUS_07540 73307 74335 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886863.1 protein_id gnl|my_center|LOCUS_07540 74341 74712 gene locus_tag LOCUS_07550 74341 74712 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877699.1 protein_id gnl|my_center|LOCUS_07550 74728 75003 gene locus_tag LOCUS_07560 74728 75003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 75014 75316 gene locus_tag LOCUS_07570 75014 75316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 75253 75483 gene locus_tag LOCUS_07580 75253 75483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 75477 77216 gene locus_tag LOCUS_07590 75477 77216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 77218 78645 gene locus_tag LOCUS_07600 77218 78645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 78675 78935 gene locus_tag LOCUS_07610 78675 78935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 78973 79260 gene locus_tag LOCUS_07620 78973 79260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 79289 80722 gene locus_tag LOCUS_07630 79289 80722 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141135.1 protein_id gnl|my_center|LOCUS_07630 80719 82245 gene locus_tag LOCUS_07640 80719 82245 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_07640 82361 83098 gene locus_tag LOCUS_07650 82361 83098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 84279 83278 gene locus_tag LOCUS_07660 84279 83278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 84612 84851 gene locus_tag LOCUS_07670 gene tusA 84612 84851 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015099.1 protein_id gnl|my_center|LOCUS_07670 84873 85073 gene locus_tag LOCUS_07680 84873 85073 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810507.1 protein_id gnl|my_center|LOCUS_07680 85079 86467 gene locus_tag LOCUS_07690 gene cobB 85079 86467 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393130.1 protein_id gnl|my_center|LOCUS_07690 86464 86817 gene locus_tag LOCUS_07700 86464 86817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 86883 88001 gene locus_tag LOCUS_07710 86883 88001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 88024 88713 gene locus_tag LOCUS_07720 88024 88713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 88710 89357 gene locus_tag LOCUS_07730 88710 89357 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234939667.1 protein_id gnl|my_center|LOCUS_07730 89407 89754 gene locus_tag LOCUS_07740 89407 89754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 89765 90061 gene locus_tag LOCUS_07750 gene tusB 89765 90061 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932538.1 protein_id gnl|my_center|LOCUS_07750 90098 91510 gene locus_tag LOCUS_07760 90098 91510 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541900.1 protein_id gnl|my_center|LOCUS_07760 91510 92562 gene locus_tag LOCUS_07770 gene dsrB 91510 92562 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810503.1 protein_id gnl|my_center|LOCUS_07770 92596 92913 gene locus_tag LOCUS_07780 92596 92913 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393134.1 protein_id gnl|my_center|LOCUS_07780 92932 93507 gene locus_tag LOCUS_07790 92932 93507 CDS product RsbRD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393113.1 protein_id gnl|my_center|LOCUS_07790 93504 94496 gene locus_tag LOCUS_07800 gene dsrM 93504 94496 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393108.1 protein_id gnl|my_center|LOCUS_07800 94499 96118 gene locus_tag LOCUS_07810 94499 96118 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393112.1 protein_id gnl|my_center|LOCUS_07810 96111 96506 gene locus_tag LOCUS_07820 gene dsrJ 96111 96506 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393111.1 protein_id gnl|my_center|LOCUS_07820 96503 97270 gene locus_tag LOCUS_07830 96503 97270 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393110.1 protein_id gnl|my_center|LOCUS_07830 97289 98488 gene locus_tag LOCUS_07840 gene nrfD 97289 98488 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272193.1 protein_id gnl|my_center|LOCUS_07840 98485 98982 gene locus_tag LOCUS_07850 98485 98982 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963442.1 protein_id gnl|my_center|LOCUS_07850 98986 99615 gene locus_tag LOCUS_07860 98986 99615 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 protein_id gnl|my_center|LOCUS_07860 99621 100415 gene locus_tag LOCUS_07870 99621 100415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 100595 102786 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttcagtcccctcctcatcggggaacgacgtgcgac 103555 102935 gene locus_tag LOCUS_07880 gene cas4 103555 102935 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258805.1 protein_id gnl|my_center|LOCUS_07880 103838 103548 gene locus_tag LOCUS_07890 103838 103548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 104173 103832 gene locus_tag LOCUS_07900 104173 103832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07900 105001 104183 gene locus_tag LOCUS_07910 105001 104183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07910 105188 104994 gene locus_tag LOCUS_07920 105188 104994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 105712 105242 gene locus_tag LOCUS_07930 105712 105242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 106157 105963 gene locus_tag LOCUS_07940 106157 105963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07940 106441 106106 gene locus_tag LOCUS_07950 106441 106106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 106719 106438 gene locus_tag LOCUS_07960 106719 106438 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202715939.1 protein_id gnl|my_center|LOCUS_07960 106815 107108 gene locus_tag LOCUS_07970 106815 107108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 107945 107136 gene locus_tag LOCUS_07980 107945 107136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 108956 107949 gene locus_tag LOCUS_07990 108956 107949 CDS product DevR family CRISPR-associated autoregulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255977.1 protein_id gnl|my_center|LOCUS_07990 110779 108983 gene locus_tag LOCUS_08000 110779 108983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 113207 110772 gene locus_tag LOCUS_08010 113207 110772 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255980.1 protein_id gnl|my_center|LOCUS_08010 113668 113207 gene locus_tag LOCUS_08020 113668 113207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 115123 113765 gene locus_tag LOCUS_08030 115123 113765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 116121 115120 gene locus_tag LOCUS_08040 gene cas6 116121 115120 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545643.1 protein_id gnl|my_center|LOCUS_08040 116394 116972 gene locus_tag LOCUS_08050 116394 116972 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941667.1 protein_id gnl|my_center|LOCUS_08050 116972 117403 gene locus_tag LOCUS_08060 116972 117403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 118168 117497 gene locus_tag LOCUS_08070 118168 117497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 120699 118270 gene locus_tag LOCUS_08080 gene lon 120699 118270 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_08080 121124 120738 gene locus_tag LOCUS_08090 121124 120738 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880418.1 protein_id gnl|my_center|LOCUS_08090 122134 121121 gene locus_tag LOCUS_08100 122134 121121 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227756.1 protein_id gnl|my_center|LOCUS_08100 124150 122237 gene locus_tag LOCUS_08110 gene dnaK 124150 122237 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_08110 124406 125056 gene locus_tag LOCUS_08120 124406 125056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 125509 125075 gene locus_tag LOCUS_08130 125509 125075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 125685 126509 gene locus_tag LOCUS_08140 gene mazG 125685 126509 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941834.1 protein_id gnl|my_center|LOCUS_08140 126506 127042 gene locus_tag LOCUS_08150 126506 127042 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925475.1 protein_id gnl|my_center|LOCUS_08150 127076 128812 gene locus_tag LOCUS_08160 gene pilB 127076 128812 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_08160 128849 129976 gene locus_tag LOCUS_08170 128849 129976 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_08170 129989 131188 gene locus_tag LOCUS_08180 129989 131188 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_08180 131199 132845 gene locus_tag LOCUS_08190 131199 132845 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_08190 132946 134340 gene locus_tag LOCUS_08200 132946 134340 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_08200 134617 135021 gene locus_tag LOCUS_08210 134617 135021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 >Feature sequence005 77 1345 gene locus_tag LOCUS_08220 gene fldB 77 1345 CDS product phenyllactyl-CoA dehydratase subunit FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048237.1 protein_id gnl|my_center|LOCUS_08220 1368 4106 gene locus_tag LOCUS_08230 1368 4106 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879871.1 protein_id gnl|my_center|LOCUS_08230 4106 4741 gene locus_tag LOCUS_08240 4106 4741 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879872.1 protein_id gnl|my_center|LOCUS_08240 4745 5623 gene locus_tag LOCUS_08250 4745 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 5620 6429 gene locus_tag LOCUS_08260 5620 6429 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_08260 6432 7232 gene locus_tag LOCUS_08270 6432 7232 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_08270 7243 7695 gene locus_tag LOCUS_08280 7243 7695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 7747 8304 gene locus_tag LOCUS_08290 7747 8304 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250928.1 protein_id gnl|my_center|LOCUS_08290 8408 9991 gene locus_tag LOCUS_08300 8408 9991 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_08300 9988 11172 gene locus_tag LOCUS_08310 gene porA 9988 11172 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877345.1 protein_id gnl|my_center|LOCUS_08310 11172 12059 gene locus_tag LOCUS_08320 gene porB 11172 12059 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496444.1 protein_id gnl|my_center|LOCUS_08320 12056 13369 gene locus_tag LOCUS_08330 12056 13369 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162490120.1 protein_id gnl|my_center|LOCUS_08330 13366 14136 gene locus_tag LOCUS_08340 13366 14136 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085429.1 protein_id gnl|my_center|LOCUS_08340 14153 14926 gene locus_tag LOCUS_08350 14153 14926 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815607.1 protein_id gnl|my_center|LOCUS_08350 14952 15131 gene locus_tag LOCUS_08360 14952 15131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 15199 16050 gene locus_tag LOCUS_08370 15199 16050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 16065 16589 gene locus_tag LOCUS_08380 16065 16589 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943299.1 protein_id gnl|my_center|LOCUS_08380 17135 16695 gene locus_tag LOCUS_08390 17135 16695 CDS product DUF4149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880186.1 protein_id gnl|my_center|LOCUS_08390 17181 17966 gene locus_tag LOCUS_08400 17181 17966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 18855 17917 gene locus_tag LOCUS_08410 18855 17917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 19533 19003 gene locus_tag LOCUS_08420 19533 19003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 19583 21517 gene locus_tag LOCUS_08430 19583 21517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 21725 21525 gene locus_tag LOCUS_08440 21725 21525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 22489 21755 gene locus_tag LOCUS_08450 22489 21755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 24009 22714 gene locus_tag LOCUS_08460 gene nrfD 24009 22714 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272584.1 protein_id gnl|my_center|LOCUS_08460 24986 24228 gene locus_tag LOCUS_08470 24986 24228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 25405 25025 gene locus_tag LOCUS_08480 25405 25025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 26960 25596 gene locus_tag LOCUS_08490 26960 25596 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_08490 28530 26950 gene locus_tag LOCUS_08500 28530 26950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 29683 28814 gene locus_tag LOCUS_08510 29683 28814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 30822 29677 gene locus_tag LOCUS_08520 30822 29677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 32079 31015 gene locus_tag LOCUS_08530 gene nirK 32079 31015 CDS product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257443.1 protein_id gnl|my_center|LOCUS_08530 32696 32283 gene locus_tag LOCUS_08540 32696 32283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 33997 32693 gene locus_tag LOCUS_08550 33997 32693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327928.1 protein_id gnl|my_center|LOCUS_08550 34818 33994 gene locus_tag LOCUS_08560 34818 33994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 35216 34815 gene locus_tag LOCUS_08570 35216 34815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 35776 35333 gene locus_tag LOCUS_08580 35776 35333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 36503 35802 gene locus_tag LOCUS_08590 36503 35802 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880279.1 protein_id gnl|my_center|LOCUS_08590 36683 39370 gene locus_tag LOCUS_08600 36683 39370 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139455818.1 protein_id gnl|my_center|LOCUS_08600 39418 39771 gene locus_tag LOCUS_08610 39418 39771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 39775 40221 gene locus_tag LOCUS_08620 39775 40221 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258548.1 protein_id gnl|my_center|LOCUS_08620 40252 41391 gene locus_tag LOCUS_08630 40252 41391 CDS product Vms1/Ankzf1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546631.1 protein_id gnl|my_center|LOCUS_08630 41570 42766 gene locus_tag LOCUS_08640 41570 42766 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941586.1 protein_id gnl|my_center|LOCUS_08640 42794 43189 gene locus_tag LOCUS_08650 42794 43189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 43194 45572 gene locus_tag LOCUS_08660 43194 45572 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_08660 46520 45588 gene locus_tag LOCUS_08670 gene rtcA 46520 45588 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112809.1 protein_id gnl|my_center|LOCUS_08670 46419 46694 gene locus_tag LOCUS_08680 46419 46694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 47365 46673 gene locus_tag LOCUS_08690 47365 46673 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087416.1 protein_id gnl|my_center|LOCUS_08690 47665 48030 gene locus_tag LOCUS_08700 47665 48030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 48009 48317 gene locus_tag LOCUS_08710 48009 48317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 48328 49245 gene locus_tag LOCUS_08720 48328 49245 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966251.1 protein_id gnl|my_center|LOCUS_08720 49305 51035 gene locus_tag LOCUS_08730 gene acsA 49305 51035 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862095.1 protein_id gnl|my_center|LOCUS_08730 51036 52040 gene locus_tag LOCUS_08740 gene pdhA 51036 52040 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943082.1 protein_id gnl|my_center|LOCUS_08740 52028 53011 gene locus_tag LOCUS_08750 52028 53011 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257842.1 protein_id gnl|my_center|LOCUS_08750 53004 54143 gene locus_tag LOCUS_08760 53004 54143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 54140 54409 gene locus_tag LOCUS_08770 54140 54409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 54574 56190 gene locus_tag LOCUS_08780 gene groL 54574 56190 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087406.1 protein_id gnl|my_center|LOCUS_08780 56212 57336 gene locus_tag LOCUS_08790 gene ald 56212 57336 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227783.1 protein_id gnl|my_center|LOCUS_08790 57336 57974 gene locus_tag LOCUS_08800 57336 57974 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228227.1 protein_id gnl|my_center|LOCUS_08800 57971 58681 gene locus_tag LOCUS_08810 57971 58681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 58696 59190 gene locus_tag LOCUS_08820 58696 59190 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933541.1 protein_id gnl|my_center|LOCUS_08820 62003 59193 gene locus_tag LOCUS_08830 62003 59193 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958545.1 protein_id gnl|my_center|LOCUS_08830 62241 63974 gene locus_tag LOCUS_08840 62241 63974 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251940.1 protein_id gnl|my_center|LOCUS_08840 64114 64332 gene locus_tag LOCUS_08850 64114 64332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 64496 64939 gene locus_tag LOCUS_08860 64496 64939 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582602.1 protein_id gnl|my_center|LOCUS_08860 65090 66292 gene locus_tag LOCUS_08870 65090 66292 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941060.1 protein_id gnl|my_center|LOCUS_08870 66289 69483 gene locus_tag LOCUS_08880 66289 69483 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941062.1 protein_id gnl|my_center|LOCUS_08880 69495 69878 gene locus_tag LOCUS_08890 69495 69878 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930621.1 protein_id gnl|my_center|LOCUS_08890 69904 70332 gene locus_tag LOCUS_08900 69904 70332 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020323.1 protein_id gnl|my_center|LOCUS_08900 70402 71847 gene locus_tag LOCUS_08910 70402 71847 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942327.1 protein_id gnl|my_center|LOCUS_08910 73287 71926 gene locus_tag LOCUS_08920 73287 71926 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_08920 72213 72294 gene locus_tag LOCUS_t00060 72213 72294 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 75043 73280 gene locus_tag LOCUS_08930 75043 73280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 75625 75209 gene locus_tag LOCUS_08940 75625 75209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 78244 75836 gene locus_tag LOCUS_08950 78244 75836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 78611 78249 gene locus_tag LOCUS_08960 78611 78249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 79868 78705 gene locus_tag LOCUS_08970 79868 78705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 80118 81653 gene locus_tag LOCUS_08980 80118 81653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 81650 83041 gene locus_tag LOCUS_08990 81650 83041 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_08990 83382 83753 gene locus_tag LOCUS_09000 83382 83753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 83747 84841 gene locus_tag LOCUS_09010 83747 84841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 84838 86076 gene locus_tag LOCUS_09020 84838 86076 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943140.1 protein_id gnl|my_center|LOCUS_09020 86158 87189 gene locus_tag LOCUS_09030 86158 87189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 87221 88246 gene locus_tag LOCUS_09040 gene omcS 87221 88246 CDS product c-type cytochrome OmcS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943141.1 protein_id gnl|my_center|LOCUS_09040 88246 89658 gene locus_tag LOCUS_09050 88246 89658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943137.1 protein_id gnl|my_center|LOCUS_09050 89655 91247 gene locus_tag LOCUS_09060 89655 91247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 91305 93491 gene locus_tag LOCUS_09070 91305 93491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 93466 94065 gene locus_tag LOCUS_09080 93466 94065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 94089 95168 gene locus_tag LOCUS_09090 94089 95168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 95168 96865 gene locus_tag LOCUS_09100 95168 96865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 96862 98865 gene locus_tag LOCUS_09110 96862 98865 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044893.1 protein_id gnl|my_center|LOCUS_09110 98844 100118 gene locus_tag LOCUS_09120 98844 100118 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039643456.1 protein_id gnl|my_center|LOCUS_09120 100338 100667 gene locus_tag LOCUS_09130 100338 100667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 100766 102706 gene locus_tag LOCUS_09140 100766 102706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 102945 104147 gene locus_tag LOCUS_09150 102945 104147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 104151 105428 gene locus_tag LOCUS_09160 104151 105428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 105521 105895 gene locus_tag LOCUS_09170 105521 105895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 105898 106995 gene locus_tag LOCUS_09180 105898 106995 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931995.1 protein_id gnl|my_center|LOCUS_09180 107081 107446 gene locus_tag LOCUS_09190 107081 107446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 107547 108848 gene locus_tag LOCUS_09200 107547 108848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09200 108845 109663 gene locus_tag LOCUS_09210 108845 109663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09210 109681 110601 gene locus_tag LOCUS_09220 109681 110601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 110598 111944 gene locus_tag LOCUS_09230 110598 111944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 112050 113504 gene locus_tag LOCUS_09240 112050 113504 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943547.1 protein_id gnl|my_center|LOCUS_09240 113473 114816 gene locus_tag LOCUS_09250 gene zraR 113473 114816 CDS product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368806.1 protein_id gnl|my_center|LOCUS_09250 114881 115108 gene locus_tag LOCUS_09260 114881 115108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 115306 115740 gene locus_tag LOCUS_09270 115306 115740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 115787 118696 gene locus_tag LOCUS_09280 115787 118696 CDS product tetrathionate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462223.1 protein_id gnl|my_center|LOCUS_09280 118712 119287 gene locus_tag LOCUS_09290 118712 119287 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250378.1 protein_id gnl|my_center|LOCUS_09290 119284 119997 gene locus_tag LOCUS_09300 119284 119997 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392892.1 protein_id gnl|my_center|LOCUS_09300 119997 120518 gene locus_tag LOCUS_09310 119997 120518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 120878 121525 gene locus_tag LOCUS_09320 120878 121525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 121560 122294 gene locus_tag LOCUS_09330 121560 122294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 122291 123088 gene locus_tag LOCUS_09340 122291 123088 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940747.1 protein_id gnl|my_center|LOCUS_09340 >Feature sequence006 58 561 gene locus_tag LOCUS_09350 gene rimI 58 561 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938967.1 protein_id gnl|my_center|LOCUS_09350 698 1348 gene locus_tag LOCUS_09360 698 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 1484 2446 gene locus_tag LOCUS_09370 gene meaB 1484 2446 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867373.1 protein_id gnl|my_center|LOCUS_09370 2574 4598 gene locus_tag LOCUS_09380 2574 4598 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271989.1 protein_id gnl|my_center|LOCUS_09380 4595 4942 gene locus_tag LOCUS_09390 4595 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 4963 6738 gene locus_tag LOCUS_09400 4963 6738 CDS product 3-oxoacid CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414123.1 protein_id gnl|my_center|LOCUS_09400 6878 8284 gene locus_tag LOCUS_09410 6878 8284 CDS product hydroxymethylglutaryl-CoA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919307.1 protein_id gnl|my_center|LOCUS_09410 8684 9838 gene locus_tag LOCUS_09420 8684 9838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 10076 10993 gene locus_tag LOCUS_09430 gene cas6 10076 10993 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545643.1 protein_id gnl|my_center|LOCUS_09430 11011 12147 gene locus_tag LOCUS_09440 11011 12147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 12162 14948 gene locus_tag LOCUS_09450 12162 14948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 14945 16105 gene locus_tag LOCUS_09460 14945 16105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 16113 17045 gene locus_tag LOCUS_09470 gene cmr4 16113 17045 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229141.1 protein_id gnl|my_center|LOCUS_09470 17042 17407 gene locus_tag LOCUS_09480 17042 17407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 17404 18723 gene locus_tag LOCUS_09490 17404 18723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 18716 20002 gene locus_tag LOCUS_09500 18716 20002 CDS product TIGR02710 family CRISPR-associated CARF protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229155.1 protein_id gnl|my_center|LOCUS_09500 20122 22008 gene locus_tag LOCUS_09510 20122 22008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 22005 23057 gene locus_tag LOCUS_09520 gene cas1 22005 23057 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256457.1 protein_id gnl|my_center|LOCUS_09520 23062 23349 gene locus_tag LOCUS_09530 23062 23349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 23566 24269 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gaccgaatggacgccccgaacgaaaggggattacgac 24555 26006 gene locus_tag LOCUS_09540 gene tcuA 24555 26006 CDS product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813511.1 protein_id gnl|my_center|LOCUS_09540 26049 26873 gene locus_tag LOCUS_09550 26049 26873 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965978.1 protein_id gnl|my_center|LOCUS_09550 26905 27855 gene locus_tag LOCUS_09560 26905 27855 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888286.1 protein_id gnl|my_center|LOCUS_09560 27974 29812 gene locus_tag LOCUS_09570 27974 29812 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_09570 30619 29855 gene locus_tag LOCUS_09580 30619 29855 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729564.1 protein_id gnl|my_center|LOCUS_09580 30926 31636 gene locus_tag LOCUS_09590 30926 31636 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019249123.1 protein_id gnl|my_center|LOCUS_09590 31629 33326 gene locus_tag LOCUS_09600 31629 33326 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250100.1 protein_id gnl|my_center|LOCUS_09600 33339 33752 gene locus_tag LOCUS_09610 33339 33752 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_09610 33822 33995 gene locus_tag LOCUS_09620 33822 33995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 34107 35099 gene locus_tag LOCUS_09630 34107 35099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 35179 36063 gene locus_tag LOCUS_09640 35179 36063 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479942.1 protein_id gnl|my_center|LOCUS_09640 36067 36954 gene locus_tag LOCUS_09650 36067 36954 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948215.1 protein_id gnl|my_center|LOCUS_09650 36954 37712 gene locus_tag LOCUS_09660 36954 37712 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965992.1 protein_id gnl|my_center|LOCUS_09660 37702 38427 gene locus_tag LOCUS_09670 37702 38427 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937857.1 protein_id gnl|my_center|LOCUS_09670 38518 39558 gene locus_tag LOCUS_09680 38518 39558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 39636 40427 gene locus_tag LOCUS_09690 gene menB 39636 40427 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229054.1 protein_id gnl|my_center|LOCUS_09690 40476 41870 gene locus_tag LOCUS_09700 40476 41870 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040324.1 protein_id gnl|my_center|LOCUS_09700 41891 43060 gene locus_tag LOCUS_09710 41891 43060 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878787.1 protein_id gnl|my_center|LOCUS_09710 43137 43463 gene locus_tag LOCUS_09720 43137 43463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 43478 44998 gene locus_tag LOCUS_09730 43478 44998 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086603.1 protein_id gnl|my_center|LOCUS_09730 45084 46400 gene locus_tag LOCUS_09740 45084 46400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 46441 47751 gene locus_tag LOCUS_09750 46441 47751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 48485 47820 gene locus_tag LOCUS_09760 48485 47820 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977465.1 protein_id gnl|my_center|LOCUS_09760 48688 50112 gene locus_tag LOCUS_09770 48688 50112 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112543.1 protein_id gnl|my_center|LOCUS_09770 50204 51022 gene locus_tag LOCUS_09780 50204 51022 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090527.1 protein_id gnl|my_center|LOCUS_09780 51058 51525 gene locus_tag LOCUS_09790 51058 51525 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_09790 51700 52014 gene locus_tag LOCUS_09800 51700 52014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 52042 54642 gene locus_tag LOCUS_09810 52042 54642 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187995.1 protein_id gnl|my_center|LOCUS_09810 54651 55244 gene locus_tag LOCUS_09820 54651 55244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 55260 56159 gene locus_tag LOCUS_09830 gene nrfD 55260 56159 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879873.1 protein_id gnl|my_center|LOCUS_09830 56170 56739 gene locus_tag LOCUS_09840 gene porC 56170 56739 CDS product pyruvate synthase subunit PorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892553.1 protein_id gnl|my_center|LOCUS_09840 56726 56995 gene locus_tag LOCUS_09850 56726 56995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 56992 58179 gene locus_tag LOCUS_09860 56992 58179 CDS product pyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393422.1 protein_id gnl|my_center|LOCUS_09860 58183 59439 gene locus_tag LOCUS_09870 58183 59439 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941893.1 protein_id gnl|my_center|LOCUS_09870 59436 60782 gene locus_tag LOCUS_09880 59436 60782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 60772 61503 gene locus_tag LOCUS_09890 60772 61503 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977110.1 protein_id gnl|my_center|LOCUS_09890 61591 62451 gene locus_tag LOCUS_09900 61591 62451 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326902.1 protein_id gnl|my_center|LOCUS_09900 62453 64417 gene locus_tag LOCUS_09910 62453 64417 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877962.1 protein_id gnl|my_center|LOCUS_09910 64422 65192 gene locus_tag LOCUS_09920 64422 65192 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225418.1 protein_id gnl|my_center|LOCUS_09920 65342 65851 gene locus_tag LOCUS_09930 65342 65851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 66901 65888 gene locus_tag LOCUS_09940 66901 65888 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165476103.1 protein_id gnl|my_center|LOCUS_09940 70183 66917 gene locus_tag LOCUS_09950 70183 66917 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975826.1 protein_id gnl|my_center|LOCUS_09950 70423 71610 gene locus_tag LOCUS_09960 70423 71610 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064155.1 protein_id gnl|my_center|LOCUS_09960 71797 72198 gene locus_tag LOCUS_09970 71797 72198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 72336 73283 gene locus_tag LOCUS_09980 72336 73283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 73316 74299 gene locus_tag LOCUS_09990 73316 74299 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810884.1 protein_id gnl|my_center|LOCUS_09990 74304 76277 gene locus_tag LOCUS_10000 74304 76277 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957058.1 protein_id gnl|my_center|LOCUS_10000 76290 77075 gene locus_tag LOCUS_10010 76290 77075 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064266.1 protein_id gnl|my_center|LOCUS_10010 77085 77672 gene locus_tag LOCUS_10020 77085 77672 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943986.1 protein_id gnl|my_center|LOCUS_10020 77669 78451 gene locus_tag LOCUS_10030 77669 78451 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390005.1 protein_id gnl|my_center|LOCUS_10030 78436 79140 gene locus_tag LOCUS_10040 78436 79140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 79659 79159 gene locus_tag LOCUS_10050 79659 79159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 80651 79704 gene locus_tag LOCUS_10060 gene sppA 80651 79704 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941487.1 protein_id gnl|my_center|LOCUS_10060 81121 80753 gene locus_tag LOCUS_10070 81121 80753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 81153 81530 gene locus_tag LOCUS_10080 81153 81530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 81541 82512 gene locus_tag LOCUS_10090 81541 82512 CDS product threo-3-hydroxy-L-aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090528.1 protein_id gnl|my_center|LOCUS_10090 82609 83235 gene locus_tag LOCUS_10100 82609 83235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 83297 83899 gene locus_tag LOCUS_10110 83297 83899 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742222.1 protein_id gnl|my_center|LOCUS_10110 83918 84697 gene locus_tag LOCUS_10120 83918 84697 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036719.1 protein_id gnl|my_center|LOCUS_10120 84742 85491 gene locus_tag LOCUS_10130 gene fabG 84742 85491 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392772.1 protein_id gnl|my_center|LOCUS_10130 85532 85852 gene locus_tag LOCUS_10140 85532 85852 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087993.1 protein_id gnl|my_center|LOCUS_10140 85984 87324 gene locus_tag LOCUS_10150 85984 87324 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878473.1 protein_id gnl|my_center|LOCUS_10150 87321 88670 gene locus_tag LOCUS_10160 87321 88670 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878474.1 protein_id gnl|my_center|LOCUS_10160 88780 89880 gene locus_tag LOCUS_10170 gene phaC 88780 89880 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206330.1 protein_id gnl|my_center|LOCUS_10170 89915 90442 gene locus_tag LOCUS_10180 89915 90442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 90439 91086 gene locus_tag LOCUS_10190 90439 91086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 91822 91079 gene locus_tag LOCUS_10200 gene fabG 91822 91079 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257346.1 protein_id gnl|my_center|LOCUS_10200 91948 92457 gene locus_tag LOCUS_10210 gene phaR 91948 92457 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083059.1 protein_id gnl|my_center|LOCUS_10210 92962 92513 gene locus_tag LOCUS_10220 92962 92513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 93093 93800 gene locus_tag LOCUS_10230 93093 93800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 93797 94114 gene locus_tag LOCUS_10240 93797 94114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 94272 95777 gene locus_tag LOCUS_10250 94272 95777 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392040.1 protein_id gnl|my_center|LOCUS_10250 95791 97584 gene locus_tag LOCUS_10260 95791 97584 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485037.1 protein_id gnl|my_center|LOCUS_10260 97641 98660 gene locus_tag LOCUS_10270 97641 98660 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113026.1 protein_id gnl|my_center|LOCUS_10270 98686 98871 gene locus_tag LOCUS_10280 98686 98871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 98968 101427 gene locus_tag LOCUS_10290 98968 101427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 101424 103778 gene locus_tag LOCUS_10300 101424 103778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 104140 103775 gene locus_tag LOCUS_10310 gene queF 104140 103775 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546535.1 protein_id gnl|my_center|LOCUS_10310 105498 104173 gene locus_tag LOCUS_10320 105498 104173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 106607 105723 gene locus_tag LOCUS_10330 106607 105723 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530905.1 protein_id gnl|my_center|LOCUS_10330 106674 107753 gene locus_tag LOCUS_10340 gene ychF 106674 107753 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256516.1 protein_id gnl|my_center|LOCUS_10340 108500 107757 gene locus_tag LOCUS_10350 108500 107757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 109397 108516 gene locus_tag LOCUS_10360 109397 108516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 111247 109394 gene locus_tag LOCUS_10370 111247 109394 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460092.1 protein_id gnl|my_center|LOCUS_10370 111362 112288 gene locus_tag LOCUS_10380 gene oppB 111362 112288 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388349.1 protein_id gnl|my_center|LOCUS_10380 112334 113395 gene locus_tag LOCUS_10390 112334 113395 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583036.1 protein_id gnl|my_center|LOCUS_10390 113416 115146 gene locus_tag LOCUS_10400 113416 115146 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256915.1 protein_id gnl|my_center|LOCUS_10400 115269 115448 gene locus_tag LOCUS_10410 115269 115448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 115459 116910 gene locus_tag LOCUS_10420 115459 116910 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090641.1 protein_id gnl|my_center|LOCUS_10420 116907 117095 gene locus_tag LOCUS_10430 116907 117095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 117119 117397 gene locus_tag LOCUS_10440 117119 117397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 >Feature sequence007 144 962 gene locus_tag LOCUS_10450 144 962 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173998.1 protein_id gnl|my_center|LOCUS_10450 2156 1020 gene locus_tag LOCUS_10460 2156 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 2518 2153 gene locus_tag LOCUS_10470 2518 2153 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544974.1 protein_id gnl|my_center|LOCUS_10470 5157 2515 gene locus_tag LOCUS_10480 5157 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 5540 5154 gene locus_tag LOCUS_10490 5540 5154 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544974.1 protein_id gnl|my_center|LOCUS_10490 7954 5537 gene locus_tag LOCUS_10500 7954 5537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 8254 10623 gene locus_tag LOCUS_10510 8254 10623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 10854 12509 gene locus_tag LOCUS_10520 10854 12509 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102517.1 protein_id gnl|my_center|LOCUS_10520 12532 13968 gene locus_tag LOCUS_10530 12532 13968 CDS product 4-hydroxyphenylacetate 3-hydroxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846143.1 protein_id gnl|my_center|LOCUS_10530 14116 14379 gene locus_tag LOCUS_10540 14116 14379 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739893.1 protein_id gnl|my_center|LOCUS_10540 14624 14403 gene locus_tag LOCUS_10550 14624 14403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 14808 14732 gene locus_tag LOCUS_t00070 14808 14732 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 15082 15699 gene locus_tag LOCUS_10560 15082 15699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 16531 15719 gene locus_tag LOCUS_10570 16531 15719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 17049 16531 gene locus_tag LOCUS_10580 17049 16531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 17955 17050 gene locus_tag LOCUS_10590 17955 17050 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869030.1 protein_id gnl|my_center|LOCUS_10590 18890 17931 gene locus_tag LOCUS_10600 18890 17931 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037020.1 protein_id gnl|my_center|LOCUS_10600 19834 18887 gene locus_tag LOCUS_10610 19834 18887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10610 20769 19831 gene locus_tag LOCUS_10620 gene arnC 20769 19831 CDS product undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704926.1 protein_id gnl|my_center|LOCUS_10620 22042 20759 gene locus_tag LOCUS_10630 gene fabF 22042 20759 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227920.1 protein_id gnl|my_center|LOCUS_10630 22808 22053 gene locus_tag LOCUS_10640 gene fabL 22808 22053 CDS product enoyl-[acyl-carrier-protein] reductase FabL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223262.1 protein_id gnl|my_center|LOCUS_10640 23290 22805 gene locus_tag LOCUS_10650 gene fabZ 23290 22805 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946258.1 protein_id gnl|my_center|LOCUS_10650 23915 23307 gene locus_tag LOCUS_10660 23915 23307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 24678 23932 gene locus_tag LOCUS_10670 gene fabG 24678 23932 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392464.1 protein_id gnl|my_center|LOCUS_10670 25912 24668 gene locus_tag LOCUS_10680 25912 24668 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528392.1 protein_id gnl|my_center|LOCUS_10680 26361 25924 gene locus_tag LOCUS_10690 26361 25924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 26741 26361 gene locus_tag LOCUS_10700 26741 26361 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679605.1 protein_id gnl|my_center|LOCUS_10700 29220 26776 gene locus_tag LOCUS_10710 29220 26776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 30068 29325 gene locus_tag LOCUS_10720 30068 29325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 31429 30065 gene locus_tag LOCUS_10730 31429 30065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 32628 31426 gene locus_tag LOCUS_10740 gene pseC 32628 31426 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869432.1 protein_id gnl|my_center|LOCUS_10740 33964 32786 gene locus_tag LOCUS_10750 33964 32786 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_10750 35198 33969 gene locus_tag LOCUS_10760 35198 33969 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028853.1 protein_id gnl|my_center|LOCUS_10760 37141 35387 gene locus_tag LOCUS_10770 37141 35387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 38425 37256 gene locus_tag LOCUS_10780 38425 37256 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870036.1 protein_id gnl|my_center|LOCUS_10780 39205 38444 gene locus_tag LOCUS_10790 gene hisF 39205 38444 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391341.1 protein_id gnl|my_center|LOCUS_10790 39841 39224 gene locus_tag LOCUS_10800 gene hisH 39841 39224 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391343.1 protein_id gnl|my_center|LOCUS_10800 41010 39838 gene locus_tag LOCUS_10810 41010 39838 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869425.1 protein_id gnl|my_center|LOCUS_10810 41588 41007 gene locus_tag LOCUS_10820 41588 41007 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925129.1 protein_id gnl|my_center|LOCUS_10820 42916 41612 gene locus_tag LOCUS_10830 42916 41612 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613585.1 protein_id gnl|my_center|LOCUS_10830 43682 42897 gene locus_tag LOCUS_10840 43682 42897 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_10840 44686 43679 gene locus_tag LOCUS_10850 44686 43679 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_10850 45747 44683 gene locus_tag LOCUS_10860 gene pseI 45747 44683 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987011.1 protein_id gnl|my_center|LOCUS_10860 46910 45762 gene locus_tag LOCUS_10870 gene pseG 46910 45762 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867753.1 protein_id gnl|my_center|LOCUS_10870 48087 46933 gene locus_tag LOCUS_10880 48087 46933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 48676 48128 gene locus_tag LOCUS_10890 48676 48128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 50654 48801 gene locus_tag LOCUS_10900 50654 48801 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582947.1 protein_id gnl|my_center|LOCUS_10900 51766 50651 gene locus_tag LOCUS_10910 51766 50651 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_10910 52568 51741 gene locus_tag LOCUS_10920 52568 51741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 53603 52578 gene locus_tag LOCUS_10930 53603 52578 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529315.1 protein_id gnl|my_center|LOCUS_10930 54595 53600 gene locus_tag LOCUS_10940 gene pdhA 54595 53600 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_10940 55229 54621 gene locus_tag LOCUS_10950 gene wlbG 55229 54621 CDS product O-antigen biosynthesis protein WlbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807105.1 protein_id gnl|my_center|LOCUS_10950 55871 55275 gene locus_tag LOCUS_10960 gene wlbG 55871 55275 CDS product O-antigen biosynthesis protein WlbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038693.1 protein_id gnl|my_center|LOCUS_10960 57038 55878 gene locus_tag LOCUS_10970 gene pseC 57038 55878 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_10970 57736 57035 gene locus_tag LOCUS_10980 57736 57035 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820420.1 protein_id gnl|my_center|LOCUS_10980 58641 57733 gene locus_tag LOCUS_10990 58641 57733 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402846.1 protein_id gnl|my_center|LOCUS_10990 59978 58638 gene locus_tag LOCUS_11000 59978 58638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 61333 59975 gene locus_tag LOCUS_11010 61333 59975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 62146 61334 gene locus_tag LOCUS_11020 62146 61334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 63054 62143 gene locus_tag LOCUS_11030 63054 62143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 63755 63051 gene locus_tag LOCUS_11040 63755 63051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 64615 63752 gene locus_tag LOCUS_11050 64615 63752 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942624.1 protein_id gnl|my_center|LOCUS_11050 65778 64615 gene locus_tag LOCUS_11060 65778 64615 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550082.1 protein_id gnl|my_center|LOCUS_11060 66938 65775 gene locus_tag LOCUS_11070 66938 65775 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039508.1 protein_id gnl|my_center|LOCUS_11070 67929 67027 gene locus_tag LOCUS_11080 67929 67027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 69028 68147 gene locus_tag LOCUS_11090 69028 68147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 69681 69100 gene locus_tag LOCUS_11100 69681 69100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 70987 69755 gene locus_tag LOCUS_11110 70987 69755 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957837.1 protein_id gnl|my_center|LOCUS_11110 71674 71021 gene locus_tag LOCUS_11120 71674 71021 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024068.1 protein_id gnl|my_center|LOCUS_11120 72207 71671 gene locus_tag LOCUS_11130 72207 71671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 72115 72735 gene locus_tag LOCUS_11140 72115 72735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 74067 72922 gene locus_tag LOCUS_11150 74067 72922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 75818 74058 gene locus_tag LOCUS_11160 75818 74058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 76881 75865 gene locus_tag LOCUS_11170 76881 75865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 78179 76878 gene locus_tag LOCUS_11180 78179 76878 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707841.1 protein_id gnl|my_center|LOCUS_11180 79320 78163 gene locus_tag LOCUS_11190 79320 78163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 80963 79320 gene locus_tag LOCUS_11200 80963 79320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 82081 80960 gene locus_tag LOCUS_11210 82081 80960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289248.1 protein_id gnl|my_center|LOCUS_11210 82956 82078 gene locus_tag LOCUS_11220 gene rfbD 82956 82078 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877394.1 protein_id gnl|my_center|LOCUS_11220 83343 82975 gene locus_tag LOCUS_11230 83343 82975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 85200 83362 gene locus_tag LOCUS_11240 85200 83362 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928959.1 protein_id gnl|my_center|LOCUS_11240 86592 85225 gene locus_tag LOCUS_11250 86592 85225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 87600 86596 gene locus_tag LOCUS_11260 87600 86596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 88361 87594 gene locus_tag LOCUS_11270 88361 87594 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088738.1 protein_id gnl|my_center|LOCUS_11270 89029 88358 gene locus_tag LOCUS_11280 89029 88358 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942616.1 protein_id gnl|my_center|LOCUS_11280 90119 89058 gene locus_tag LOCUS_11290 gene neuB 90119 89058 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066398080.1 protein_id gnl|my_center|LOCUS_11290 90890 90138 gene locus_tag LOCUS_11300 90890 90138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 91494 90913 gene locus_tag LOCUS_11310 91494 90913 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925129.1 protein_id gnl|my_center|LOCUS_11310 92588 91497 gene locus_tag LOCUS_11320 92588 91497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 93840 92560 gene locus_tag LOCUS_11330 93840 92560 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_11330 94792 93848 gene locus_tag LOCUS_11340 94792 93848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 95578 94793 gene locus_tag LOCUS_11350 95578 94793 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_11350 96631 95615 gene locus_tag LOCUS_11360 gene pseB 96631 95615 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867763.1 protein_id gnl|my_center|LOCUS_11360 97189 96683 gene locus_tag LOCUS_11370 97189 96683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 98036 97314 gene locus_tag LOCUS_11380 98036 97314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 98300 100054 gene locus_tag LOCUS_11390 98300 100054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 100718 100125 gene locus_tag LOCUS_11400 100718 100125 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546348.1 protein_id gnl|my_center|LOCUS_11400 102376 100847 gene locus_tag LOCUS_11410 102376 100847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 102667 102386 gene locus_tag LOCUS_11420 102667 102386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 103950 102664 gene locus_tag LOCUS_11430 gene eno 103950 102664 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942923.1 protein_id gnl|my_center|LOCUS_11430 105067 104174 gene locus_tag LOCUS_11440 105067 104174 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_11440 105303 105064 gene locus_tag LOCUS_11450 105303 105064 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942410.1 protein_id gnl|my_center|LOCUS_11450 106639 105284 gene locus_tag LOCUS_11460 gene xseA 106639 105284 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_11460 107503 106649 gene locus_tag LOCUS_11470 gene folD 107503 106649 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_11470 108309 107515 gene locus_tag LOCUS_11480 108309 107515 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_11480 108992 108312 gene locus_tag LOCUS_11490 108992 108312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 >Feature sequence008 873 169 gene locus_tag LOCUS_11500 873 169 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027942.1 protein_id gnl|my_center|LOCUS_11500 1398 943 gene locus_tag LOCUS_11510 1398 943 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041322286.1 protein_id gnl|my_center|LOCUS_11510 1673 2038 gene locus_tag LOCUS_11520 1673 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 2459 3160 gene locus_tag LOCUS_11530 2459 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142339.1 protein_id gnl|my_center|LOCUS_11530 3173 6241 gene locus_tag LOCUS_11540 3173 6241 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942996.1 protein_id gnl|my_center|LOCUS_11540 6238 8070 gene locus_tag LOCUS_11550 gene treZ 6238 8070 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388264.1 protein_id gnl|my_center|LOCUS_11550 9263 7986 gene locus_tag LOCUS_11560 gene glgA 9263 7986 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258925.1 protein_id gnl|my_center|LOCUS_11560 9262 9921 gene locus_tag LOCUS_11570 9262 9921 CDS product DUF5752 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978371.1 protein_id gnl|my_center|LOCUS_11570 9921 11120 gene locus_tag LOCUS_11580 9921 11120 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978370.1 protein_id gnl|my_center|LOCUS_11580 11136 12374 gene locus_tag LOCUS_11590 11136 12374 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080054.1 protein_id gnl|my_center|LOCUS_11590 12371 14371 gene locus_tag LOCUS_11600 12371 14371 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389479.1 protein_id gnl|my_center|LOCUS_11600 14378 16057 gene locus_tag LOCUS_11610 14378 16057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11610 16071 17576 gene locus_tag LOCUS_11620 16071 17576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11620 18630 17659 gene locus_tag LOCUS_11630 18630 17659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 18946 18677 gene locus_tag LOCUS_11640 18946 18677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 19279 20040 gene locus_tag LOCUS_11650 19279 20040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 21114 20086 gene locus_tag LOCUS_11660 21114 20086 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545596.1 protein_id gnl|my_center|LOCUS_11660 22343 21111 gene locus_tag LOCUS_11670 22343 21111 CDS product CBU_0513 family Dot/Icm type IV secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957626.1 protein_id gnl|my_center|LOCUS_11670 22730 22395 gene locus_tag LOCUS_11680 22730 22395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 23410 23015 gene locus_tag LOCUS_11690 23410 23015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 24321 23551 gene locus_tag LOCUS_11700 24321 23551 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939613.1 protein_id gnl|my_center|LOCUS_11700 24979 24323 gene locus_tag LOCUS_11710 24979 24323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 25820 25014 gene locus_tag LOCUS_11720 25820 25014 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939615.1 protein_id gnl|my_center|LOCUS_11720 26574 25846 gene locus_tag LOCUS_11730 26574 25846 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031213610.1 protein_id gnl|my_center|LOCUS_11730 27932 26571 gene locus_tag LOCUS_11740 27932 26571 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222229.1 protein_id gnl|my_center|LOCUS_11740 28645 27947 gene locus_tag LOCUS_11750 28645 27947 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_11750 28884 29564 gene locus_tag LOCUS_11760 28884 29564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 29934 29461 gene locus_tag LOCUS_11770 29934 29461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 30016 30450 gene locus_tag LOCUS_11780 30016 30450 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094294.1 protein_id gnl|my_center|LOCUS_11780 30503 30688 gene locus_tag LOCUS_11790 30503 30688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 30739 31434 gene locus_tag LOCUS_11800 30739 31434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 32454 31435 gene locus_tag LOCUS_11810 32454 31435 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_11810 32780 32481 gene locus_tag LOCUS_11820 32780 32481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 33994 32777 gene locus_tag LOCUS_11830 33994 32777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 35419 34022 gene locus_tag LOCUS_11840 35419 34022 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910880.1 protein_id gnl|my_center|LOCUS_11840 36531 35413 gene locus_tag LOCUS_11850 36531 35413 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937589.1 protein_id gnl|my_center|LOCUS_11850 37522 36554 gene locus_tag LOCUS_11860 37522 36554 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257839.1 protein_id gnl|my_center|LOCUS_11860 38719 37580 gene locus_tag LOCUS_11870 38719 37580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 39533 38739 gene locus_tag LOCUS_11880 39533 38739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 40402 39530 gene locus_tag LOCUS_11890 40402 39530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 41337 40399 gene locus_tag LOCUS_11900 41337 40399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 42186 41359 gene locus_tag LOCUS_11910 42186 41359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 43337 42189 gene locus_tag LOCUS_11920 43337 42189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 44125 43337 gene locus_tag LOCUS_11930 44125 43337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 45270 44122 gene locus_tag LOCUS_11940 45270 44122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 45937 45275 gene locus_tag LOCUS_11950 45937 45275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 47232 45934 gene locus_tag LOCUS_11960 47232 45934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 48014 47229 gene locus_tag LOCUS_11970 48014 47229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 48835 48035 gene locus_tag LOCUS_11980 48835 48035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 49998 48832 gene locus_tag LOCUS_11990 49998 48832 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403377.1 protein_id gnl|my_center|LOCUS_11990 50981 49995 gene locus_tag LOCUS_12000 50981 49995 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403376.1 protein_id gnl|my_center|LOCUS_12000 52266 50974 gene locus_tag LOCUS_12010 52266 50974 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867672.1 protein_id gnl|my_center|LOCUS_12010 53434 52358 gene locus_tag LOCUS_12020 53434 52358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 54590 53424 gene locus_tag LOCUS_12030 gene neuC 54590 53424 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088732.1 protein_id gnl|my_center|LOCUS_12030 55648 54587 gene locus_tag LOCUS_12040 gene neuB 55648 54587 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392277.1 protein_id gnl|my_center|LOCUS_12040 57609 55645 gene locus_tag LOCUS_12050 57609 55645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 58250 57606 gene locus_tag LOCUS_12060 58250 57606 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403382.1 protein_id gnl|my_center|LOCUS_12060 58986 58258 gene locus_tag LOCUS_12070 58986 58258 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392279.1 protein_id gnl|my_center|LOCUS_12070 59974 58991 gene locus_tag LOCUS_12080 59974 58991 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161951924.1 protein_id gnl|my_center|LOCUS_12080 61542 59989 gene locus_tag LOCUS_12090 61542 59989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 62584 61535 gene locus_tag LOCUS_12100 62584 61535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 62873 62559 gene locus_tag LOCUS_12110 62873 62559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 64756 62897 gene locus_tag LOCUS_12120 64756 62897 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258732.1 protein_id gnl|my_center|LOCUS_12120 65385 64753 gene locus_tag LOCUS_12130 65385 64753 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545744.1 protein_id gnl|my_center|LOCUS_12130 65550 66500 gene locus_tag LOCUS_12140 65550 66500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 67308 66532 gene locus_tag LOCUS_12150 67308 66532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 68122 67289 gene locus_tag LOCUS_12160 68122 67289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 69715 68147 gene locus_tag LOCUS_12170 69715 68147 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940275.1 protein_id gnl|my_center|LOCUS_12170 71191 70148 gene locus_tag LOCUS_12180 71191 70148 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259507.1 protein_id gnl|my_center|LOCUS_12180 72257 71208 gene locus_tag LOCUS_12190 gene pdhA 72257 71208 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_12190 73369 72437 gene locus_tag LOCUS_12200 73369 72437 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088176.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12200 74481 73366 gene locus_tag LOCUS_12210 74481 73366 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088176.1 protein_id gnl|my_center|LOCUS_12210 75484 74483 gene locus_tag LOCUS_12220 75484 74483 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088171.1 protein_id gnl|my_center|LOCUS_12220 76131 75607 gene locus_tag LOCUS_12230 76131 75607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 76661 76134 gene locus_tag LOCUS_12240 76661 76134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 76757 77653 gene locus_tag LOCUS_12250 76757 77653 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402846.1 protein_id gnl|my_center|LOCUS_12250 79344 77659 gene locus_tag LOCUS_12260 79344 77659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 80018 79452 gene locus_tag LOCUS_12270 80018 79452 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088168.1 protein_id gnl|my_center|LOCUS_12270 81547 80015 gene locus_tag LOCUS_12280 81547 80015 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088170.1 protein_id gnl|my_center|LOCUS_12280 82547 81558 gene locus_tag LOCUS_12290 82547 81558 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088169.1 protein_id gnl|my_center|LOCUS_12290 84251 82587 gene locus_tag LOCUS_12300 84251 82587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 86922 84379 gene locus_tag LOCUS_12310 86922 84379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 87761 86919 gene locus_tag LOCUS_12320 87761 86919 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086015.1 protein_id gnl|my_center|LOCUS_12320 88665 87754 gene locus_tag LOCUS_12330 88665 87754 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086014.1 protein_id gnl|my_center|LOCUS_12330 90238 88724 gene locus_tag LOCUS_12340 90238 88724 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531218.1 protein_id gnl|my_center|LOCUS_12340 91173 90235 gene locus_tag LOCUS_12350 91173 90235 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_12350 91382 92920 gene locus_tag LOCUS_12360 91382 92920 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267554.1 protein_id gnl|my_center|LOCUS_12360 93018 93938 gene locus_tag LOCUS_12370 93018 93938 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385604.1 protein_id gnl|my_center|LOCUS_12370 93935 94858 gene locus_tag LOCUS_12380 93935 94858 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538206.1 protein_id gnl|my_center|LOCUS_12380 95293 94928 gene locus_tag LOCUS_12390 95293 94928 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082961.1 protein_id gnl|my_center|LOCUS_12390 95488 96966 gene locus_tag LOCUS_12400 95488 96966 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816379.1 protein_id gnl|my_center|LOCUS_12400 96963 97355 gene locus_tag LOCUS_12410 96963 97355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 97376 98005 gene locus_tag LOCUS_12420 97376 98005 CDS product YktB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232300.1 protein_id gnl|my_center|LOCUS_12420 98005 98658 gene locus_tag LOCUS_12430 98005 98658 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927183.1 protein_id gnl|my_center|LOCUS_12430 98655 99266 gene locus_tag LOCUS_12440 98655 99266 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140820.1 protein_id gnl|my_center|LOCUS_12440 100226 99360 gene locus_tag LOCUS_12450 100226 99360 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742057.1 protein_id gnl|my_center|LOCUS_12450 100384 101703 gene locus_tag LOCUS_12460 100384 101703 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089187.1 protein_id gnl|my_center|LOCUS_12460 101765 102496 gene locus_tag LOCUS_12470 101765 102496 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921642.1 protein_id gnl|my_center|LOCUS_12470 102493 103203 gene locus_tag LOCUS_12480 102493 103203 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089217.1 protein_id gnl|my_center|LOCUS_12480 >Feature sequence009 469 1110 gene locus_tag LOCUS_12490 469 1110 CDS product EpsI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176634.1 protein_id gnl|my_center|LOCUS_12490 1588 1235 gene locus_tag LOCUS_12500 1588 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 1843 1601 gene locus_tag LOCUS_12510 1843 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 2134 4305 gene locus_tag LOCUS_12520 2134 4305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 5499 4411 gene locus_tag LOCUS_12530 5499 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 5951 5712 gene locus_tag LOCUS_12540 5951 5712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 6629 7192 gene locus_tag LOCUS_12550 6629 7192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 7844 8095 gene locus_tag LOCUS_12560 7844 8095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 8310 8071 gene locus_tag LOCUS_12570 8310 8071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 8715 9056 gene locus_tag LOCUS_12580 8715 9056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 9557 9321 gene locus_tag LOCUS_12590 9557 9321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 9635 9895 gene locus_tag LOCUS_12600 9635 9895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12600 9923 10153 gene locus_tag LOCUS_12610 9923 10153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12610 10211 10498 gene locus_tag LOCUS_12620 10211 10498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 10495 10890 gene locus_tag LOCUS_12630 10495 10890 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_12630 10946 11137 gene locus_tag LOCUS_12640 10946 11137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 11771 12130 gene locus_tag LOCUS_12650 11771 12130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 14127 13882 gene locus_tag LOCUS_12660 14127 13882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 14282 14130 gene locus_tag LOCUS_12670 14282 14130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 14591 14436 gene locus_tag LOCUS_12680 14591 14436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 14603 16873 gene locus_tag LOCUS_12690 14603 16873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 17310 17651 gene locus_tag LOCUS_12700 17310 17651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 18151 19023 gene locus_tag LOCUS_12710 18151 19023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 19501 19181 gene locus_tag LOCUS_12720 19501 19181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 20539 19517 gene locus_tag LOCUS_12730 gene moaA 20539 19517 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417297.1 protein_id gnl|my_center|LOCUS_12730 20841 20536 gene locus_tag LOCUS_12740 20841 20536 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256599.1 protein_id gnl|my_center|LOCUS_12740 22553 20829 gene locus_tag LOCUS_12750 22553 20829 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_12750 23337 22894 gene locus_tag LOCUS_12760 23337 22894 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023127.1 protein_id gnl|my_center|LOCUS_12760 23465 23376 gene locus_tag LOCUS_t00080 23465 23376 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 23571 23496 gene locus_tag LOCUS_t00090 23571 23496 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 23691 23617 gene locus_tag LOCUS_t00100 23691 23617 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 24755 23742 gene locus_tag LOCUS_12770 gene galT 24755 23742 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546259.1 protein_id gnl|my_center|LOCUS_12770 25755 24748 gene locus_tag LOCUS_12780 25755 24748 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_12780 26365 25769 gene locus_tag LOCUS_12790 gene plsY 26365 25769 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392834.1 protein_id gnl|my_center|LOCUS_12790 26937 26362 gene locus_tag LOCUS_12800 26937 26362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 27701 26934 gene locus_tag LOCUS_12810 27701 26934 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773678.1 protein_id gnl|my_center|LOCUS_12810 28928 27720 gene locus_tag LOCUS_12820 28928 27720 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227831.1 protein_id gnl|my_center|LOCUS_12820 29851 28940 gene locus_tag LOCUS_12830 gene argF 29851 28940 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257452.1 protein_id gnl|my_center|LOCUS_12830 31047 29848 gene locus_tag LOCUS_12840 31047 29848 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_12840 31976 31095 gene locus_tag LOCUS_12850 gene argB 31976 31095 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121716.1 protein_id gnl|my_center|LOCUS_12850 33346 31994 gene locus_tag LOCUS_12860 gene hslU 33346 31994 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880072.1 protein_id gnl|my_center|LOCUS_12860 33959 33405 gene locus_tag LOCUS_12870 gene hslV 33959 33405 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938868.1 protein_id gnl|my_center|LOCUS_12870 34828 33956 gene locus_tag LOCUS_12880 gene xerC 34828 33956 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941160.1 protein_id gnl|my_center|LOCUS_12880 37119 34861 gene locus_tag LOCUS_12890 gene topA 37119 34861 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_12890 38138 37131 gene locus_tag LOCUS_12900 gene dprA 38138 37131 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_12900 39007 38222 gene locus_tag LOCUS_12910 gene ybgF 39007 38222 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943188.1 protein_id gnl|my_center|LOCUS_12910 39095 40090 gene locus_tag LOCUS_12920 39095 40090 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829995.1 protein_id gnl|my_center|LOCUS_12920 41353 40130 gene locus_tag LOCUS_12930 41353 40130 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_12930 42631 41507 gene locus_tag LOCUS_12940 42631 41507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 43131 42628 gene locus_tag LOCUS_12950 43131 42628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 43643 43131 gene locus_tag LOCUS_12960 43643 43131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 45006 43645 gene locus_tag LOCUS_12970 gene nrfD 45006 43645 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063680.1 protein_id gnl|my_center|LOCUS_12970 47987 45003 gene locus_tag LOCUS_12980 47987 45003 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372295.1 protein_id gnl|my_center|LOCUS_12980 48382 47984 gene locus_tag LOCUS_12990 48382 47984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 49719 48511 gene locus_tag LOCUS_13000 gene hemL 49719 48511 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 protein_id gnl|my_center|LOCUS_13000 49874 50065 gene locus_tag LOCUS_13010 49874 50065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 50273 50052 gene locus_tag LOCUS_13020 50273 50052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 50833 50531 gene locus_tag LOCUS_13030 50833 50531 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056827.1 protein_id gnl|my_center|LOCUS_13030 51742 50849 gene locus_tag LOCUS_13040 gene cysK 51742 50849 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393208.1 protein_id gnl|my_center|LOCUS_13040 52268 51822 gene locus_tag LOCUS_13050 52268 51822 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141918.1 protein_id gnl|my_center|LOCUS_13050 53264 52281 gene locus_tag LOCUS_13060 gene hemB 53264 52281 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 protein_id gnl|my_center|LOCUS_13060 54176 53268 gene locus_tag LOCUS_13070 54176 53268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 55081 54173 gene locus_tag LOCUS_13080 gene hemC 55081 54173 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258453.1 protein_id gnl|my_center|LOCUS_13080 56367 55078 gene locus_tag LOCUS_13090 gene hemA 56367 55078 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_13090 57173 56367 gene locus_tag LOCUS_13100 gene ccsB 57173 56367 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_13100 58051 57293 gene locus_tag LOCUS_13110 gene fdhD 58051 57293 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393662.1 protein_id gnl|my_center|LOCUS_13110 58855 58112 gene locus_tag LOCUS_13120 gene truA 58855 58112 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118979.1 protein_id gnl|my_center|LOCUS_13120 59889 58888 gene locus_tag LOCUS_13130 59889 58888 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545714.1 protein_id gnl|my_center|LOCUS_13130 60993 59908 gene locus_tag LOCUS_13140 gene leuB 60993 59908 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880105.1 protein_id gnl|my_center|LOCUS_13140 62576 60996 gene locus_tag LOCUS_13150 62576 60996 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393738.1 protein_id gnl|my_center|LOCUS_13150 63375 62566 gene locus_tag LOCUS_13160 gene pssA 63375 62566 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_13160 64081 63530 gene locus_tag LOCUS_13170 64081 63530 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545974.1 protein_id gnl|my_center|LOCUS_13170 65118 64429 gene locus_tag LOCUS_13180 65118 64429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13180 65477 65049 gene locus_tag LOCUS_13190 65477 65049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13190 66089 65499 gene locus_tag LOCUS_13200 gene ilvN 66089 65499 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_13200 67951 66197 gene locus_tag LOCUS_13210 gene ilvB 67951 66197 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545836.1 protein_id gnl|my_center|LOCUS_13210 68851 67964 gene locus_tag LOCUS_13220 68851 67964 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461122.1 protein_id gnl|my_center|LOCUS_13220 71471 68844 gene locus_tag LOCUS_13230 gene ppdK 71471 68844 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546740.1 protein_id gnl|my_center|LOCUS_13230 71470 71616 gene locus_tag LOCUS_13240 71470 71616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 72523 71744 gene locus_tag LOCUS_13250 72523 71744 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393787.1 protein_id gnl|my_center|LOCUS_13250 73215 72520 gene locus_tag LOCUS_13260 73215 72520 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039878.1 protein_id gnl|my_center|LOCUS_13260 74755 73238 gene locus_tag LOCUS_13270 74755 73238 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113695.1 protein_id gnl|my_center|LOCUS_13270 75303 74842 gene locus_tag LOCUS_13280 75303 74842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 76329 75343 gene locus_tag LOCUS_13290 76329 75343 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966990.1 protein_id gnl|my_center|LOCUS_13290 77513 76494 gene locus_tag LOCUS_13300 77513 76494 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393097.1 protein_id gnl|my_center|LOCUS_13300 78840 77611 gene locus_tag LOCUS_13310 78840 77611 CDS product oxalate oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393098.1 protein_id gnl|my_center|LOCUS_13310 80190 78982 gene locus_tag LOCUS_13320 80190 78982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 81042 80347 gene locus_tag LOCUS_13330 gene pdxT 81042 80347 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391559.1 protein_id gnl|my_center|LOCUS_13330 82057 81176 gene locus_tag LOCUS_13340 gene pdxS 82057 81176 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583836.1 protein_id gnl|my_center|LOCUS_13340 83619 82456 gene locus_tag LOCUS_13350 83619 82456 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941612.1 protein_id gnl|my_center|LOCUS_13350 85174 83639 gene locus_tag LOCUS_13360 85174 83639 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940212.1 protein_id gnl|my_center|LOCUS_13360 85289 86020 gene locus_tag LOCUS_13370 85289 86020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 86246 86428 gene locus_tag LOCUS_13380 86246 86428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 86443 86751 gene locus_tag LOCUS_13390 86443 86751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 86757 86933 gene locus_tag LOCUS_13400 86757 86933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 86930 87706 gene locus_tag LOCUS_13410 86930 87706 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031328.1 protein_id gnl|my_center|LOCUS_13410 >Feature sequence010 1239 880 gene locus_tag LOCUS_13420 gene rplT 1239 880 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138366.1 protein_id gnl|my_center|LOCUS_13420 1456 1259 gene locus_tag LOCUS_13430 gene rpmI 1456 1259 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 protein_id gnl|my_center|LOCUS_13430 1942 1466 gene locus_tag LOCUS_13440 gene infC 1942 1466 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942163.1 protein_id gnl|my_center|LOCUS_13440 3804 2008 gene locus_tag LOCUS_13450 gene thrS 3804 2008 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213295.1 protein_id gnl|my_center|LOCUS_13450 4005 3931 gene locus_tag LOCUS_t00110 4005 3931 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5076 4087 gene locus_tag LOCUS_13460 5076 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 6173 5157 gene locus_tag LOCUS_13470 gene aroF 6173 5157 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943764.1 protein_id gnl|my_center|LOCUS_13470 7433 6417 gene locus_tag LOCUS_13480 gene aroF 7433 6417 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943764.1 protein_id gnl|my_center|LOCUS_13480 8481 7753 gene locus_tag LOCUS_13490 8481 7753 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545867.1 protein_id gnl|my_center|LOCUS_13490 9580 8519 gene locus_tag LOCUS_13500 9580 8519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 10005 9658 gene locus_tag LOCUS_13510 10005 9658 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941172.1 protein_id gnl|my_center|LOCUS_13510 10445 10008 gene locus_tag LOCUS_13520 10445 10008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 11830 10391 gene locus_tag LOCUS_13530 11830 10391 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879446.1 protein_id gnl|my_center|LOCUS_13530 12234 11830 gene locus_tag LOCUS_13540 12234 11830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 12907 12242 gene locus_tag LOCUS_13550 12907 12242 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257183.1 protein_id gnl|my_center|LOCUS_13550 14196 12949 gene locus_tag LOCUS_13560 14196 12949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 14707 14201 gene locus_tag LOCUS_13570 14707 14201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 14970 14749 gene locus_tag LOCUS_13580 14970 14749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 15347 15598 gene locus_tag LOCUS_13590 15347 15598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 16732 16654 gene locus_tag LOCUS_t00120 16732 16654 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 18010 16823 gene locus_tag LOCUS_13600 18010 16823 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114496.1 protein_id gnl|my_center|LOCUS_13600 18249 18638 gene locus_tag LOCUS_13610 18249 18638 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259566.1 protein_id gnl|my_center|LOCUS_13610 21014 18876 gene locus_tag LOCUS_13620 21014 18876 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878706.1 protein_id gnl|my_center|LOCUS_13620 21809 21018 gene locus_tag LOCUS_13630 21809 21018 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048188.1 protein_id gnl|my_center|LOCUS_13630 22710 21859 gene locus_tag LOCUS_13640 22710 21859 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_13640 25316 22752 gene locus_tag LOCUS_13650 25316 22752 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063974.1 protein_id gnl|my_center|LOCUS_13650 26367 25351 gene locus_tag LOCUS_13660 26367 25351 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063973.1 protein_id gnl|my_center|LOCUS_13660 26578 26375 gene locus_tag LOCUS_13670 26578 26375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 27848 26823 gene locus_tag LOCUS_13680 gene tdh 27848 26823 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031190.1 protein_id gnl|my_center|LOCUS_13680 28068 28262 gene locus_tag LOCUS_13690 28068 28262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 30155 28356 gene locus_tag LOCUS_13700 30155 28356 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965642.1 protein_id gnl|my_center|LOCUS_13700 31413 30211 gene locus_tag LOCUS_13710 31413 30211 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436463.1 protein_id gnl|my_center|LOCUS_13710 31918 31481 gene locus_tag LOCUS_13720 31918 31481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 33417 32035 gene locus_tag LOCUS_13730 33417 32035 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086313.1 protein_id gnl|my_center|LOCUS_13730 35886 33445 gene locus_tag LOCUS_13740 35886 33445 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921440.1 protein_id gnl|my_center|LOCUS_13740 36359 35883 gene locus_tag LOCUS_13750 36359 35883 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730866.1 protein_id gnl|my_center|LOCUS_13750 37236 36352 gene locus_tag LOCUS_13760 37236 36352 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_13760 38246 37233 gene locus_tag LOCUS_13770 38246 37233 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 protein_id gnl|my_center|LOCUS_13770 39030 38251 gene locus_tag LOCUS_13780 39030 38251 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728415.1 protein_id gnl|my_center|LOCUS_13780 40058 39027 gene locus_tag LOCUS_13790 40058 39027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 40915 40088 gene locus_tag LOCUS_13800 40915 40088 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049748363.1 protein_id gnl|my_center|LOCUS_13800 41685 40912 gene locus_tag LOCUS_13810 41685 40912 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_13810 42417 41710 gene locus_tag LOCUS_13820 42417 41710 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728466.1 protein_id gnl|my_center|LOCUS_13820 42668 44257 gene locus_tag LOCUS_13830 42668 44257 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101804536.1 protein_id gnl|my_center|LOCUS_13830 44271 45284 gene locus_tag LOCUS_13840 44271 45284 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096543.1 protein_id gnl|my_center|LOCUS_13840 45304 46209 gene locus_tag LOCUS_13850 45304 46209 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338504.1 protein_id gnl|my_center|LOCUS_13850 46245 47369 gene locus_tag LOCUS_13860 46245 47369 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228417.1 protein_id gnl|my_center|LOCUS_13860 47725 47650 gene locus_tag LOCUS_t00130 47725 47650 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 51515 47925 gene locus_tag LOCUS_13870 51515 47925 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087804.1 protein_id gnl|my_center|LOCUS_13870 52916 51588 gene locus_tag LOCUS_13880 52916 51588 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943920.1 protein_id gnl|my_center|LOCUS_13880 54240 52909 gene locus_tag LOCUS_13890 54240 52909 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943919.1 protein_id gnl|my_center|LOCUS_13890 54878 54252 gene locus_tag LOCUS_13900 gene cobC 54878 54252 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_13900 56543 55029 gene locus_tag LOCUS_13910 56543 55029 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114317.1 protein_id gnl|my_center|LOCUS_13910 57583 56567 gene locus_tag LOCUS_13920 gene mtnA 57583 56567 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460451.1 protein_id gnl|my_center|LOCUS_13920 57879 57580 gene locus_tag LOCUS_13930 57879 57580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 58397 57888 gene locus_tag LOCUS_13940 58397 57888 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228028.1 protein_id gnl|my_center|LOCUS_13940 58674 58408 gene locus_tag LOCUS_13950 58674 58408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 59497 58676 gene locus_tag LOCUS_13960 gene proC 59497 58676 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_13960 60219 59494 gene locus_tag LOCUS_13970 60219 59494 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_13970 60987 60247 gene locus_tag LOCUS_13980 gene pgeF 60987 60247 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940760.1 protein_id gnl|my_center|LOCUS_13980 62178 61027 gene locus_tag LOCUS_13990 gene ftsZ 62178 61027 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069588917.1 protein_id gnl|my_center|LOCUS_13990 63612 62380 gene locus_tag LOCUS_14000 gene ftsA 63612 62380 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_14000 64487 63621 gene locus_tag LOCUS_14010 64487 63621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 65397 64516 gene locus_tag LOCUS_14020 gene murB 65397 64516 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392364.1 protein_id gnl|my_center|LOCUS_14020 66798 65401 gene locus_tag LOCUS_14030 gene murC 66798 65401 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_14030 67905 66805 gene locus_tag LOCUS_14040 gene spoVE 67905 66805 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460697.1 protein_id gnl|my_center|LOCUS_14040 69497 67905 gene locus_tag LOCUS_14050 gene murD 69497 67905 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_14050 70586 69507 gene locus_tag LOCUS_14060 gene mraY 70586 69507 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_14060 71971 70586 gene locus_tag LOCUS_14070 71971 70586 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943698.1 protein_id gnl|my_center|LOCUS_14070 73476 71986 gene locus_tag LOCUS_14080 73476 71986 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_14080 75497 73488 gene locus_tag LOCUS_14090 75497 73488 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_14090 75995 75528 gene locus_tag LOCUS_14100 75995 75528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 76897 75992 gene locus_tag LOCUS_14110 gene rsmH 76897 75992 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_14110 77344 76904 gene locus_tag LOCUS_14120 gene mraZ 77344 76904 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625480.1 protein_id gnl|my_center|LOCUS_14120 78412 77627 gene locus_tag LOCUS_14130 78412 77627 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_14130 79039 78497 gene locus_tag LOCUS_14140 79039 78497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 79600 79154 gene locus_tag LOCUS_14150 79600 79154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 81181 79739 gene locus_tag LOCUS_14160 81181 79739 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028604.1 protein_id gnl|my_center|LOCUS_14160 82218 81313 gene locus_tag LOCUS_14170 82218 81313 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172662.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence011 811 302 gene locus_tag LOCUS_14180 811 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 1586 2200 gene locus_tag LOCUS_14190 1586 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814756.1 protein_id gnl|my_center|LOCUS_14190 2197 3369 gene locus_tag LOCUS_14200 2197 3369 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040670.1 protein_id gnl|my_center|LOCUS_14200 3597 3869 gene locus_tag LOCUS_14210 3597 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 4368 3919 gene locus_tag LOCUS_14220 4368 3919 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_14220 5189 4368 gene locus_tag LOCUS_14230 5189 4368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 5820 5224 gene locus_tag LOCUS_14240 5820 5224 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682263.1 protein_id gnl|my_center|LOCUS_14240 7420 5843 gene locus_tag LOCUS_14250 7420 5843 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400663.1 protein_id gnl|my_center|LOCUS_14250 8874 7417 gene locus_tag LOCUS_14260 8874 7417 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181950125.1 protein_id gnl|my_center|LOCUS_14260 9695 9039 gene locus_tag LOCUS_14270 9695 9039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004542749.1 protein_id gnl|my_center|LOCUS_14270 10649 9699 gene locus_tag LOCUS_14280 10649 9699 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900802.1 protein_id gnl|my_center|LOCUS_14280 12661 10637 gene locus_tag LOCUS_14290 gene hyfB 12661 10637 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393678.1 protein_id gnl|my_center|LOCUS_14290 13278 12772 gene locus_tag LOCUS_14300 13278 12772 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089084.1 protein_id gnl|my_center|LOCUS_14300 13632 13279 gene locus_tag LOCUS_14310 13632 13279 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785422.1 protein_id gnl|my_center|LOCUS_14310 13849 14523 gene locus_tag LOCUS_14320 13849 14523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 14514 14768 gene locus_tag LOCUS_14330 14514 14768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 14833 15324 gene locus_tag LOCUS_14340 14833 15324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 16747 15398 gene locus_tag LOCUS_14350 16747 15398 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122716.1 protein_id gnl|my_center|LOCUS_14350 18126 16747 gene locus_tag LOCUS_14360 18126 16747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 18366 19583 gene locus_tag LOCUS_14370 18366 19583 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900438.1 protein_id gnl|my_center|LOCUS_14370 19580 20707 gene locus_tag LOCUS_14380 19580 20707 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225683.1 protein_id gnl|my_center|LOCUS_14380 20704 21945 gene locus_tag LOCUS_14390 20704 21945 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093005186.1 protein_id gnl|my_center|LOCUS_14390 22095 22958 gene locus_tag LOCUS_14400 22095 22958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 23743 23111 gene locus_tag LOCUS_14410 23743 23111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 24759 23797 gene locus_tag LOCUS_14420 24759 23797 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226472.1 protein_id gnl|my_center|LOCUS_14420 25399 24770 gene locus_tag LOCUS_14430 25399 24770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 25700 25431 gene locus_tag LOCUS_14440 25700 25431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 25707 26756 gene locus_tag LOCUS_14450 25707 26756 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385047.1 protein_id gnl|my_center|LOCUS_14450 28396 26780 gene locus_tag LOCUS_14460 gene ggt 28396 26780 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808651.1 protein_id gnl|my_center|LOCUS_14460 29167 28577 gene locus_tag LOCUS_14470 29167 28577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 29778 29164 gene locus_tag LOCUS_14480 29778 29164 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404046.1 protein_id gnl|my_center|LOCUS_14480 29838 30278 gene locus_tag LOCUS_14490 29838 30278 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887201.1 protein_id gnl|my_center|LOCUS_14490 32355 30307 gene locus_tag LOCUS_14500 32355 30307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 33283 32357 gene locus_tag LOCUS_14510 33283 32357 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644821.1 protein_id gnl|my_center|LOCUS_14510 34524 33559 gene locus_tag LOCUS_14520 34524 33559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 36152 34830 gene locus_tag LOCUS_14530 36152 34830 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459193.1 protein_id gnl|my_center|LOCUS_14530 37465 36182 gene locus_tag LOCUS_14540 37465 36182 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809811.1 protein_id gnl|my_center|LOCUS_14540 37930 37469 gene locus_tag LOCUS_14550 37930 37469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 39104 38073 gene locus_tag LOCUS_14560 39104 38073 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064210.1 protein_id gnl|my_center|LOCUS_14560 40441 39161 gene locus_tag LOCUS_14570 40441 39161 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809811.1 protein_id gnl|my_center|LOCUS_14570 41132 40668 gene locus_tag LOCUS_14580 41132 40668 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566024.1 protein_id gnl|my_center|LOCUS_14580 42158 41148 gene locus_tag LOCUS_14590 42158 41148 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064210.1 protein_id gnl|my_center|LOCUS_14590 43665 42592 gene locus_tag LOCUS_14600 43665 42592 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222574.1 protein_id gnl|my_center|LOCUS_14600 44641 43682 gene locus_tag LOCUS_14610 44641 43682 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810287.1 protein_id gnl|my_center|LOCUS_14610 45518 44652 gene locus_tag LOCUS_14620 45518 44652 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810287.1 protein_id gnl|my_center|LOCUS_14620 46652 45624 gene locus_tag LOCUS_14630 46652 45624 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222574.1 protein_id gnl|my_center|LOCUS_14630 46997 46656 gene locus_tag LOCUS_14640 46997 46656 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836570.1 protein_id gnl|my_center|LOCUS_14640 47366 47082 gene locus_tag LOCUS_14650 gene pduA 47366 47082 CDS product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732738.1 protein_id gnl|my_center|LOCUS_14650 48207 47437 gene locus_tag LOCUS_14660 48207 47437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 48704 48432 gene locus_tag LOCUS_14670 48704 48432 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462304.1 protein_id gnl|my_center|LOCUS_14670 49470 48817 gene locus_tag LOCUS_14680 49470 48817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 50153 51220 gene locus_tag LOCUS_14690 50153 51220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 52659 51829 gene locus_tag LOCUS_14700 52659 51829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 53945 53007 gene locus_tag LOCUS_14710 53945 53007 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742066.1 protein_id gnl|my_center|LOCUS_14710 53992 54822 gene locus_tag LOCUS_14720 53992 54822 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727392.1 protein_id gnl|my_center|LOCUS_14720 55023 55286 gene locus_tag LOCUS_14730 55023 55286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 55292 55561 gene locus_tag LOCUS_14740 55292 55561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 56593 55640 gene locus_tag LOCUS_14750 56593 55640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 56645 57622 gene locus_tag LOCUS_14760 gene waaF 56645 57622 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_14760 57645 58181 gene locus_tag LOCUS_14770 57645 58181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 58547 58206 gene locus_tag LOCUS_14780 58547 58206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 59970 58660 gene locus_tag LOCUS_14790 59970 58660 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893543.1 protein_id gnl|my_center|LOCUS_14790 60878 59973 gene locus_tag LOCUS_14800 60878 59973 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 protein_id gnl|my_center|LOCUS_14800 61044 62075 gene locus_tag LOCUS_14810 61044 62075 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114147.1 protein_id gnl|my_center|LOCUS_14810 62091 64034 gene locus_tag LOCUS_14820 62091 64034 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271912.1 protein_id gnl|my_center|LOCUS_14820 64031 64435 gene locus_tag LOCUS_14830 64031 64435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 64458 65813 gene locus_tag LOCUS_14840 64458 65813 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086313.1 protein_id gnl|my_center|LOCUS_14840 65813 67237 gene locus_tag LOCUS_14850 65813 67237 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228252.1 protein_id gnl|my_center|LOCUS_14850 68168 67230 gene locus_tag LOCUS_14860 68168 67230 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256581.1 protein_id gnl|my_center|LOCUS_14860 68575 68165 gene locus_tag LOCUS_14870 68575 68165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 68657 69370 gene locus_tag LOCUS_14880 gene tenA 68657 69370 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877712.1 protein_id gnl|my_center|LOCUS_14880 69381 69629 gene locus_tag LOCUS_14890 69381 69629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 69633 70088 gene locus_tag LOCUS_14900 69633 70088 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186182.1 protein_id gnl|my_center|LOCUS_14900 70151 70393 gene locus_tag LOCUS_14910 70151 70393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 71375 70374 gene locus_tag LOCUS_14920 71375 70374 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242776.1 protein_id gnl|my_center|LOCUS_14920 73767 71635 gene locus_tag LOCUS_14930 73767 71635 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_14930 75359 73764 gene locus_tag LOCUS_14940 75359 73764 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083813.1 protein_id gnl|my_center|LOCUS_14940 76304 75417 gene locus_tag LOCUS_14950 76304 75417 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172662.1 protein_id gnl|my_center|LOCUS_14950 77316 76354 gene locus_tag LOCUS_14960 77316 76354 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383546.1 protein_id gnl|my_center|LOCUS_14960 77753 77310 gene locus_tag LOCUS_14970 77753 77310 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_14970 78308 77757 gene locus_tag LOCUS_14980 78308 77757 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942116.1 protein_id gnl|my_center|LOCUS_14980 79173 78313 gene locus_tag LOCUS_14990 79173 78313 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083245.1 protein_id gnl|my_center|LOCUS_14990 80366 79191 gene locus_tag LOCUS_15000 80366 79191 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867628.1 protein_id gnl|my_center|LOCUS_15000 80583 80359 gene locus_tag LOCUS_15010 80583 80359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 81425 80622 gene locus_tag LOCUS_15020 81425 80622 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391918.1 protein_id gnl|my_center|LOCUS_15020 >Feature sequence012 1370 507 gene locus_tag LOCUS_15030 1370 507 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729794.1 protein_id gnl|my_center|LOCUS_15030 3404 1371 gene locus_tag LOCUS_15040 3404 1371 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726854.1 protein_id gnl|my_center|LOCUS_15040 5004 3409 gene locus_tag LOCUS_15050 5004 3409 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466887.1 protein_id gnl|my_center|LOCUS_15050 5734 5297 gene locus_tag LOCUS_15060 5734 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 6806 5760 gene locus_tag LOCUS_15070 6806 5760 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229262.1 protein_id gnl|my_center|LOCUS_15070 8034 6838 gene locus_tag LOCUS_15080 8034 6838 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402774.1 protein_id gnl|my_center|LOCUS_15080 9211 8069 gene locus_tag LOCUS_15090 gene acdA 9211 8069 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_15090 9992 9222 gene locus_tag LOCUS_15100 9992 9222 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331316.1 protein_id gnl|my_center|LOCUS_15100 10196 10864 gene locus_tag LOCUS_15110 10196 10864 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019249123.1 protein_id gnl|my_center|LOCUS_15110 10848 12539 gene locus_tag LOCUS_15120 10848 12539 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257715.1 protein_id gnl|my_center|LOCUS_15120 12544 12936 gene locus_tag LOCUS_15130 12544 12936 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846721.1 protein_id gnl|my_center|LOCUS_15130 12950 14455 gene locus_tag LOCUS_15140 12950 14455 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031160740.1 protein_id gnl|my_center|LOCUS_15140 14562 14798 gene locus_tag LOCUS_15150 14562 14798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 15536 14802 gene locus_tag LOCUS_15160 15536 14802 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208084.1 protein_id gnl|my_center|LOCUS_15160 16876 15533 gene locus_tag LOCUS_15170 16876 15533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 17442 16933 gene locus_tag LOCUS_15180 17442 16933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 17618 18976 gene locus_tag LOCUS_15190 17618 18976 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063670.1 protein_id gnl|my_center|LOCUS_15190 20162 19182 gene locus_tag LOCUS_15200 20162 19182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 20898 20182 gene locus_tag LOCUS_15210 20898 20182 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 protein_id gnl|my_center|LOCUS_15210 21542 20895 gene locus_tag LOCUS_15220 21542 20895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 22998 21520 gene locus_tag LOCUS_15230 22998 21520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 23713 23009 gene locus_tag LOCUS_15240 23713 23009 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227934.1 protein_id gnl|my_center|LOCUS_15240 24869 23946 gene locus_tag LOCUS_15250 24869 23946 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546311.1 protein_id gnl|my_center|LOCUS_15250 25744 24866 gene locus_tag LOCUS_15260 25744 24866 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039248.1 protein_id gnl|my_center|LOCUS_15260 27003 25822 gene locus_tag LOCUS_15270 27003 25822 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546283.1 protein_id gnl|my_center|LOCUS_15270 27995 27111 gene locus_tag LOCUS_15280 27995 27111 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531969.1 protein_id gnl|my_center|LOCUS_15280 28451 27999 gene locus_tag LOCUS_15290 28451 27999 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531968.1 protein_id gnl|my_center|LOCUS_15290 28646 29875 gene locus_tag LOCUS_15300 28646 29875 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807943.1 protein_id gnl|my_center|LOCUS_15300 29913 30785 gene locus_tag LOCUS_15310 29913 30785 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_15310 30778 31743 gene locus_tag LOCUS_15320 30778 31743 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965773.1 protein_id gnl|my_center|LOCUS_15320 31740 32471 gene locus_tag LOCUS_15330 31740 32471 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085709.1 protein_id gnl|my_center|LOCUS_15330 32473 33975 gene locus_tag LOCUS_15340 32473 33975 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064334.1 protein_id gnl|my_center|LOCUS_15340 33972 34592 gene locus_tag LOCUS_15350 33972 34592 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919054.1 protein_id gnl|my_center|LOCUS_15350 34592 35296 gene locus_tag LOCUS_15360 34592 35296 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256822.1 protein_id gnl|my_center|LOCUS_15360 35302 35883 gene locus_tag LOCUS_15370 35302 35883 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265800.1 protein_id gnl|my_center|LOCUS_15370 36065 37192 gene locus_tag LOCUS_15380 36065 37192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 37676 37200 gene locus_tag LOCUS_15390 gene greA 37676 37200 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192392.1 protein_id gnl|my_center|LOCUS_15390 37777 39099 gene locus_tag LOCUS_15400 37777 39099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 39099 42422 gene locus_tag LOCUS_15410 gene muxC 39099 42422 CDS product multidrug efflux RND transporter permease subunit MuxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089914.1 protein_id gnl|my_center|LOCUS_15410 42963 42412 gene locus_tag LOCUS_15420 42963 42412 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941232.1 protein_id gnl|my_center|LOCUS_15420 44888 42975 gene locus_tag LOCUS_15430 44888 42975 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938364.1 protein_id gnl|my_center|LOCUS_15430 45924 45166 gene locus_tag LOCUS_15440 45924 45166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 46773 45928 gene locus_tag LOCUS_15450 46773 45928 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583949.1 protein_id gnl|my_center|LOCUS_15450 47998 46778 gene locus_tag LOCUS_15460 47998 46778 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393028.1 protein_id gnl|my_center|LOCUS_15460 47916 48410 gene locus_tag LOCUS_15470 47916 48410 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337321.1 protein_id gnl|my_center|LOCUS_15470 49588 48389 gene locus_tag LOCUS_15480 49588 48389 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246425.1 protein_id gnl|my_center|LOCUS_15480 50803 49667 gene locus_tag LOCUS_15490 50803 49667 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259270.1 protein_id gnl|my_center|LOCUS_15490 50975 50796 gene locus_tag LOCUS_15500 50975 50796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 51212 50991 gene locus_tag LOCUS_15510 51212 50991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 51474 52637 gene locus_tag LOCUS_15520 51474 52637 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 protein_id gnl|my_center|LOCUS_15520 52655 54394 gene locus_tag LOCUS_15530 52655 54394 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902654.1 protein_id gnl|my_center|LOCUS_15530 54404 55396 gene locus_tag LOCUS_15540 54404 55396 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224046.1 protein_id gnl|my_center|LOCUS_15540 55393 57027 gene locus_tag LOCUS_15550 55393 57027 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 protein_id gnl|my_center|LOCUS_15550 58411 57035 gene locus_tag LOCUS_15560 58411 57035 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931053.1 protein_id gnl|my_center|LOCUS_15560 58645 60630 gene locus_tag LOCUS_15570 58645 60630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 61160 60672 gene locus_tag LOCUS_15580 61160 60672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 62589 61186 gene locus_tag LOCUS_15590 62589 61186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 63620 62604 gene locus_tag LOCUS_15600 63620 62604 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639891.1 protein_id gnl|my_center|LOCUS_15600 64624 63626 gene locus_tag LOCUS_15610 gene rfbB 64624 63626 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_15610 65157 64621 gene locus_tag LOCUS_15620 65157 64621 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889303.1 protein_id gnl|my_center|LOCUS_15620 66262 65171 gene locus_tag LOCUS_15630 66262 65171 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_15630 66628 67548 gene locus_tag LOCUS_15640 gene moeB 66628 67548 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970838.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15640 67570 67851 gene locus_tag LOCUS_15650 67570 67851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15650 68428 70323 gene locus_tag LOCUS_15660 68428 70323 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528520.1 protein_id gnl|my_center|LOCUS_15660 70320 77684 gene locus_tag LOCUS_15670 70320 77684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15670 77681 78484 gene locus_tag LOCUS_15680 77681 78484 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141949.1 protein_id gnl|my_center|LOCUS_15680 78499 79284 gene locus_tag LOCUS_15690 78499 79284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 79379 79798 gene locus_tag LOCUS_15700 79379 79798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 79806 81332 gene locus_tag LOCUS_15710 79806 81332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 >Feature sequence013 538 1812 gene locus_tag LOCUS_15720 538 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 2811 2563 gene locus_tag LOCUS_15730 2811 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 4708 3164 gene locus_tag LOCUS_15740 4708 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 7811 4698 gene locus_tag LOCUS_15750 7811 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 8831 8016 gene locus_tag LOCUS_15760 8831 8016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 12572 9246 gene locus_tag LOCUS_15770 12572 9246 CDS product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063831.1 protein_id gnl|my_center|LOCUS_15770 12754 13788 gene locus_tag LOCUS_15780 12754 13788 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140590772.1 protein_id gnl|my_center|LOCUS_15780 15677 13842 gene locus_tag LOCUS_15790 15677 13842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 16508 18043 gene locus_tag LOCUS_15800 16508 18043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 18734 18153 gene locus_tag LOCUS_15810 18734 18153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 18943 19347 gene locus_tag LOCUS_15820 gene ssb 18943 19347 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545299.1 protein_id gnl|my_center|LOCUS_15820 19344 19580 gene locus_tag LOCUS_15830 19344 19580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 19577 20350 gene locus_tag LOCUS_15840 19577 20350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 20429 21235 gene locus_tag LOCUS_15850 20429 21235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 21775 21239 gene locus_tag LOCUS_15860 21775 21239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 21683 22036 gene locus_tag LOCUS_15870 21683 22036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 23090 23512 gene locus_tag LOCUS_15880 23090 23512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15880 23434 24717 gene locus_tag LOCUS_15890 23434 24717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15890 24714 26615 gene locus_tag LOCUS_15900 24714 26615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 26612 30844 gene locus_tag LOCUS_15910 26612 30844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 30828 33722 gene locus_tag LOCUS_15920 30828 33722 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 protein_id gnl|my_center|LOCUS_15920 33719 34312 gene locus_tag LOCUS_15930 33719 34312 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_15930 34309 34524 gene locus_tag LOCUS_15940 34309 34524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 34529 37894 gene locus_tag LOCUS_15950 34529 37894 CDS product Swt1 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258561.1 protein_id gnl|my_center|LOCUS_15950 38428 39201 gene locus_tag LOCUS_15960 38428 39201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 39570 39776 gene locus_tag LOCUS_15970 39570 39776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 39955 41028 gene locus_tag LOCUS_15980 39955 41028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 41742 42818 gene locus_tag LOCUS_15990 41742 42818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 43159 42845 gene locus_tag LOCUS_16000 43159 42845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 43285 43382 gene locus_tag LOCUS_t00140 43285 43382 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 43354 43974 gene locus_tag LOCUS_16010 43354 43974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 43984 44487 gene locus_tag LOCUS_16020 43984 44487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 44493 44780 gene locus_tag LOCUS_16030 44493 44780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 44764 46185 gene locus_tag LOCUS_16040 gene selA 44764 46185 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943980.1 protein_id gnl|my_center|LOCUS_16040 46186 48087 gene locus_tag LOCUS_16050 gene selB 46186 48087 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_16050 47305 47209 gene locus_tag LOCUS_t00150 47305 47209 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 48184 48372 gene locus_tag LOCUS_16060 48184 48372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 48400 49356 gene locus_tag LOCUS_16070 48400 49356 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030775.1 protein_id gnl|my_center|LOCUS_16070 49353 51029 gene locus_tag LOCUS_16080 49353 51029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 51026 52546 gene locus_tag LOCUS_16090 51026 52546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257117.1 protein_id gnl|my_center|LOCUS_16090 52592 53206 gene locus_tag LOCUS_16100 52592 53206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 53242 53829 gene locus_tag LOCUS_16110 53242 53829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 53894 56743 gene locus_tag LOCUS_16120 gene ileS 53894 56743 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943758.1 protein_id gnl|my_center|LOCUS_16120 56740 57228 gene locus_tag LOCUS_16130 gene lspA 56740 57228 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943757.1 protein_id gnl|my_center|LOCUS_16130 57257 57526 gene locus_tag LOCUS_16140 57257 57526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 57562 58389 gene locus_tag LOCUS_16150 57562 58389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 58772 58503 gene locus_tag LOCUS_16160 58772 58503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_16160 58987 58769 gene locus_tag LOCUS_16170 58987 58769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 59114 59734 gene locus_tag LOCUS_16180 59114 59734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 59833 60030 gene locus_tag LOCUS_16190 59833 60030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 60390 61346 gene locus_tag LOCUS_16200 60390 61346 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542473.1 protein_id gnl|my_center|LOCUS_16200 61462 62865 gene locus_tag LOCUS_16210 gene glmU 61462 62865 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391623.1 protein_id gnl|my_center|LOCUS_16210 62905 64743 gene locus_tag LOCUS_16220 gene glmS 62905 64743 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940943.1 protein_id gnl|my_center|LOCUS_16220 64794 66986 gene locus_tag LOCUS_16230 gene pcrA 64794 66986 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542538.1 protein_id gnl|my_center|LOCUS_16230 67026 67325 gene locus_tag LOCUS_16240 gene gatC 67026 67325 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_16240 67329 68798 gene locus_tag LOCUS_16250 gene gatA 67329 68798 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_16250 68855 70303 gene locus_tag LOCUS_16260 gene gatB 68855 70303 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393504.1 protein_id gnl|my_center|LOCUS_16260 70330 71001 gene locus_tag LOCUS_16270 gene ftsE 70330 71001 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815584.1 protein_id gnl|my_center|LOCUS_16270 71069 71953 gene locus_tag LOCUS_16280 gene ftsX 71069 71953 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942418.1 protein_id gnl|my_center|LOCUS_16280 71950 73158 gene locus_tag LOCUS_16290 71950 73158 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942417.1 protein_id gnl|my_center|LOCUS_16290 73190 74482 gene locus_tag LOCUS_16300 73190 74482 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_16300 74501 75385 gene locus_tag LOCUS_16310 74501 75385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 75394 76395 gene locus_tag LOCUS_16320 gene tsaD 75394 76395 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942510.1 protein_id gnl|my_center|LOCUS_16320 76409 77494 gene locus_tag LOCUS_16330 gene gnfL 76409 77494 CDS product nitrogen fixation sensor histidine kinase GnfL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941669.1 protein_id gnl|my_center|LOCUS_16330 77710 79143 gene locus_tag LOCUS_16340 gene gnfM 77710 79143 CDS product nitrogen fixation sigma-54 dependent transcriptional regulator GnfM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941668.1 protein_id gnl|my_center|LOCUS_16340 79200 79436 gene locus_tag LOCUS_16350 79200 79436 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979944.1 protein_id gnl|my_center|LOCUS_16350 80649 79441 gene locus_tag LOCUS_16360 80649 79441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 >Feature sequence014 1819 1619 gene locus_tag LOCUS_16370 1819 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16370 1991 1833 gene locus_tag LOCUS_16380 1991 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 2063 2257 gene locus_tag LOCUS_16390 2063 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 2660 2881 gene locus_tag LOCUS_16400 2660 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 4636 2915 gene locus_tag LOCUS_16410 4636 2915 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080010.1 protein_id gnl|my_center|LOCUS_16410 5535 4651 gene locus_tag LOCUS_16420 5535 4651 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877324.1 protein_id gnl|my_center|LOCUS_16420 5565 5753 gene locus_tag LOCUS_16430 5565 5753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 6817 5771 gene locus_tag LOCUS_16440 6817 5771 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922313.1 protein_id gnl|my_center|LOCUS_16440 7275 6856 gene locus_tag LOCUS_16450 7275 6856 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_16450 8357 7272 gene locus_tag LOCUS_16460 gene arsB 8357 7272 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421624.1 protein_id gnl|my_center|LOCUS_16460 9172 8354 gene locus_tag LOCUS_16470 9172 8354 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461623.1 protein_id gnl|my_center|LOCUS_16470 9539 9231 gene locus_tag LOCUS_16480 9539 9231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 10705 9605 gene locus_tag LOCUS_16490 10705 9605 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208869.1 protein_id gnl|my_center|LOCUS_16490 11007 10702 gene locus_tag LOCUS_16500 11007 10702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 11857 11021 gene locus_tag LOCUS_16510 11857 11021 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185533.1 protein_id gnl|my_center|LOCUS_16510 12518 11892 gene locus_tag LOCUS_16520 gene ureG 12518 11892 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238762.1 protein_id gnl|my_center|LOCUS_16520 13204 12515 gene locus_tag LOCUS_16530 13204 12515 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013380.1 protein_id gnl|my_center|LOCUS_16530 13700 13197 gene locus_tag LOCUS_16540 13700 13197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 15423 13708 gene locus_tag LOCUS_16550 gene ureC 15423 13708 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186033.1 protein_id gnl|my_center|LOCUS_16550 15800 15411 gene locus_tag LOCUS_16560 15800 15411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16560 16099 15797 gene locus_tag LOCUS_16570 16099 15797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16570 16829 16107 gene locus_tag LOCUS_16580 gene urtE 16829 16107 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056966.1 protein_id gnl|my_center|LOCUS_16580 17718 16813 gene locus_tag LOCUS_16590 gene urtD 17718 16813 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056965.1 protein_id gnl|my_center|LOCUS_16590 18845 17715 gene locus_tag LOCUS_16600 gene urtC 18845 17715 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976303.1 protein_id gnl|my_center|LOCUS_16600 20532 18832 gene locus_tag LOCUS_16610 gene urtB 20532 18832 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763115.1 protein_id gnl|my_center|LOCUS_16610 21841 20543 gene locus_tag LOCUS_16620 gene urtA 21841 20543 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269025.1 protein_id gnl|my_center|LOCUS_16620 22699 22127 gene locus_tag LOCUS_16630 22699 22127 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258090.1 protein_id gnl|my_center|LOCUS_16630 24252 22828 gene locus_tag LOCUS_16640 gene glnA 24252 22828 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_16640 26076 24643 gene locus_tag LOCUS_16650 26076 24643 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211292884.1 protein_id gnl|my_center|LOCUS_16650 26473 26135 gene locus_tag LOCUS_16660 26473 26135 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_16660 27028 26642 gene locus_tag LOCUS_16670 27028 26642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 28585 27227 gene locus_tag LOCUS_16680 28585 27227 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941040.1 protein_id gnl|my_center|LOCUS_16680 28943 29377 gene locus_tag LOCUS_16690 28943 29377 CDS product TIGR03668 family PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226497.1 protein_id gnl|my_center|LOCUS_16690 29374 30561 gene locus_tag LOCUS_16700 29374 30561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 30578 31849 gene locus_tag LOCUS_16710 gene cofH 30578 31849 CDS product 5-amino-6-(D-ribitylamino)uracil--L-tyrosine 4-hydroxyphenyl transferase CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060905.1 protein_id gnl|my_center|LOCUS_16710 32001 32288 gene locus_tag LOCUS_16720 32001 32288 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093079.1 protein_id gnl|my_center|LOCUS_16720 32275 32772 gene locus_tag LOCUS_16730 32275 32772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 32774 33700 gene locus_tag LOCUS_16740 gene cofD 32774 33700 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_16740 33697 34374 gene locus_tag LOCUS_16750 33697 34374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 34374 35126 gene locus_tag LOCUS_16760 gene cofE 34374 35126 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259452.1 protein_id gnl|my_center|LOCUS_16760 35236 35901 gene locus_tag LOCUS_16770 gene npdG 35236 35901 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060779.1 protein_id gnl|my_center|LOCUS_16770 35891 36970 gene locus_tag LOCUS_16780 35891 36970 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039574.1 protein_id gnl|my_center|LOCUS_16780 37891 36986 gene locus_tag LOCUS_16790 37891 36986 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122709.1 protein_id gnl|my_center|LOCUS_16790 39162 37978 gene locus_tag LOCUS_16800 gene nifS 39162 37978 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868962.1 protein_id gnl|my_center|LOCUS_16800 39418 39167 gene locus_tag LOCUS_16810 gene tusA 39418 39167 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015099.1 protein_id gnl|my_center|LOCUS_16810 39561 40583 gene locus_tag LOCUS_16820 39561 40583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 41125 40529 gene locus_tag LOCUS_16830 41125 40529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 41140 41571 gene locus_tag LOCUS_16840 41140 41571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 41699 42277 gene locus_tag LOCUS_16850 41699 42277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 42403 42648 gene locus_tag LOCUS_16860 42403 42648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 42897 43364 gene locus_tag LOCUS_16870 42897 43364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 45367 43715 gene locus_tag LOCUS_16880 45367 43715 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941764.1 protein_id gnl|my_center|LOCUS_16880 46668 45364 gene locus_tag LOCUS_16890 46668 45364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 46564 46956 gene locus_tag LOCUS_16900 46564 46956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 47024 48178 gene locus_tag LOCUS_16910 47024 48178 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 protein_id gnl|my_center|LOCUS_16910 48171 48551 gene locus_tag LOCUS_16920 48171 48551 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965765.1 protein_id gnl|my_center|LOCUS_16920 48732 50387 gene locus_tag LOCUS_16930 48732 50387 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868766.1 protein_id gnl|my_center|LOCUS_16930 50439 51380 gene locus_tag LOCUS_16940 50439 51380 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_16940 51392 52297 gene locus_tag LOCUS_16950 51392 52297 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172662.1 protein_id gnl|my_center|LOCUS_16950 52323 53849 gene locus_tag LOCUS_16960 52323 53849 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085735.1 protein_id gnl|my_center|LOCUS_16960 54998 53874 gene locus_tag LOCUS_16970 54998 53874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225442.1 protein_id gnl|my_center|LOCUS_16970 55136 56683 gene locus_tag LOCUS_16980 55136 56683 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972898.1 protein_id gnl|my_center|LOCUS_16980 56709 57653 gene locus_tag LOCUS_16990 56709 57653 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064673.1 protein_id gnl|my_center|LOCUS_16990 57650 58564 gene locus_tag LOCUS_17000 57650 58564 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724711.1 protein_id gnl|my_center|LOCUS_17000 59512 58574 gene locus_tag LOCUS_17010 59512 58574 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089835.1 protein_id gnl|my_center|LOCUS_17010 59762 60730 gene locus_tag LOCUS_17020 gene prpB 59762 60730 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763428.1 protein_id gnl|my_center|LOCUS_17020 60867 62126 gene locus_tag LOCUS_17030 60867 62126 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039303.1 protein_id gnl|my_center|LOCUS_17030 62143 63009 gene locus_tag LOCUS_17040 62143 63009 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064203.1 protein_id gnl|my_center|LOCUS_17040 63006 63983 gene locus_tag LOCUS_17050 63006 63983 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040564.1 protein_id gnl|my_center|LOCUS_17050 63952 64692 gene locus_tag LOCUS_17060 63952 64692 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088973.1 protein_id gnl|my_center|LOCUS_17060 64692 65423 gene locus_tag LOCUS_17070 64692 65423 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039306.1 protein_id gnl|my_center|LOCUS_17070 66245 65472 gene locus_tag LOCUS_17080 gene hisN 66245 65472 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222889.1 protein_id gnl|my_center|LOCUS_17080 66619 66236 gene locus_tag LOCUS_17090 66619 66236 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463606.1 protein_id gnl|my_center|LOCUS_17090 66826 67242 gene locus_tag LOCUS_17100 66826 67242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 67230 67733 gene locus_tag LOCUS_17110 67230 67733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 68493 67765 gene locus_tag LOCUS_17120 68493 67765 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337347.1 protein_id gnl|my_center|LOCUS_17120 68622 69014 gene locus_tag LOCUS_17130 68622 69014 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171561.1 protein_id gnl|my_center|LOCUS_17130 69024 70400 gene locus_tag LOCUS_17140 69024 70400 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937988.1 protein_id gnl|my_center|LOCUS_17140 70412 71638 gene locus_tag LOCUS_17150 70412 71638 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_17150 71686 72828 gene locus_tag LOCUS_17160 71686 72828 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250076.1 protein_id gnl|my_center|LOCUS_17160 72828 74210 gene locus_tag LOCUS_17170 72828 74210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 74684 74454 gene locus_tag LOCUS_17180 74684 74454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 75156 74671 gene locus_tag LOCUS_17190 75156 74671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 75282 76370 gene locus_tag LOCUS_17200 75282 76370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 76367 77350 gene locus_tag LOCUS_17210 76367 77350 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229398.1 protein_id gnl|my_center|LOCUS_17210 77362 77643 gene locus_tag LOCUS_17220 77362 77643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17220 77647 77958 gene locus_tag LOCUS_17230 77647 77958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17230 >Feature sequence015 222 920 gene locus_tag LOCUS_17240 222 920 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_17240 1430 2857 gene locus_tag LOCUS_17250 gene gltX 1430 2857 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545418.1 protein_id gnl|my_center|LOCUS_17250 3119 3748 gene locus_tag LOCUS_17260 3119 3748 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256529.1 protein_id gnl|my_center|LOCUS_17260 3756 5360 gene locus_tag LOCUS_17270 3756 5360 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393317.1 protein_id gnl|my_center|LOCUS_17270 5370 6863 gene locus_tag LOCUS_17280 gene glgA 5370 6863 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_17280 6883 7221 gene locus_tag LOCUS_17290 6883 7221 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218119.1 protein_id gnl|my_center|LOCUS_17290 7272 10334 gene locus_tag LOCUS_17300 gene glnE 7272 10334 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943989.1 protein_id gnl|my_center|LOCUS_17300 10342 10647 gene locus_tag LOCUS_17310 10342 10647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 10811 11074 gene locus_tag LOCUS_17320 10811 11074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 11211 11447 gene locus_tag LOCUS_17330 11211 11447 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259539.1 protein_id gnl|my_center|LOCUS_17330 11428 11778 gene locus_tag LOCUS_17340 11428 11778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 11810 15649 gene locus_tag LOCUS_17350 11810 15649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 15646 16278 gene locus_tag LOCUS_17360 gene coaE 15646 16278 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219305.1 protein_id gnl|my_center|LOCUS_17360 16275 17156 gene locus_tag LOCUS_17370 gene rsmA 16275 17156 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391600.1 protein_id gnl|my_center|LOCUS_17370 18209 17280 gene locus_tag LOCUS_17380 18209 17280 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393755.1 protein_id gnl|my_center|LOCUS_17380 18885 18373 gene locus_tag LOCUS_17390 18885 18373 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390931.1 protein_id gnl|my_center|LOCUS_17390 19331 18900 gene locus_tag LOCUS_17400 19331 18900 CDS product DUF1924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337164.1 protein_id gnl|my_center|LOCUS_17400 20473 19328 gene locus_tag LOCUS_17410 20473 19328 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337165.1 protein_id gnl|my_center|LOCUS_17410 20581 20913 gene locus_tag LOCUS_17420 20581 20913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 20913 21593 gene locus_tag LOCUS_17430 20913 21593 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085905.1 protein_id gnl|my_center|LOCUS_17430 21644 22981 gene locus_tag LOCUS_17440 21644 22981 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920606.1 protein_id gnl|my_center|LOCUS_17440 23099 24802 gene locus_tag LOCUS_17450 23099 24802 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943734.1 protein_id gnl|my_center|LOCUS_17450 24956 27178 gene locus_tag LOCUS_17460 24956 27178 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943733.1 protein_id gnl|my_center|LOCUS_17460 27333 28034 gene locus_tag LOCUS_17470 gene lolA 27333 28034 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938957.1 protein_id gnl|my_center|LOCUS_17470 28065 28562 gene locus_tag LOCUS_17480 28065 28562 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943822.1 protein_id gnl|my_center|LOCUS_17480 29118 30026 gene locus_tag LOCUS_17490 29118 30026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 30135 32117 gene locus_tag LOCUS_17500 30135 32117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 32454 33326 gene locus_tag LOCUS_17510 32454 33326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 33962 35053 gene locus_tag LOCUS_17520 33962 35053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 35126 37177 gene locus_tag LOCUS_17530 35126 37177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 37193 38503 gene locus_tag LOCUS_17540 gene rimO 37193 38503 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_17540 38627 39001 gene locus_tag LOCUS_17550 38627 39001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 38998 40233 gene locus_tag LOCUS_17560 38998 40233 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940819.1 protein_id gnl|my_center|LOCUS_17560 40233 40829 gene locus_tag LOCUS_17570 gene thpR 40233 40829 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583814.1 protein_id gnl|my_center|LOCUS_17570 40992 42047 gene locus_tag LOCUS_17580 gene recA 40992 42047 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_17580 42057 43241 gene locus_tag LOCUS_17590 42057 43241 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_17590 43244 43795 gene locus_tag LOCUS_17600 43244 43795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 43845 46535 gene locus_tag LOCUS_17610 gene alaS 43845 46535 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393146.1 protein_id gnl|my_center|LOCUS_17610 47841 46663 gene locus_tag LOCUS_17620 47841 46663 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943264.1 protein_id gnl|my_center|LOCUS_17620 48630 47863 gene locus_tag LOCUS_17630 48630 47863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 49635 48778 gene locus_tag LOCUS_17640 gene speB 49635 48778 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393315.1 protein_id gnl|my_center|LOCUS_17640 50118 49636 gene locus_tag LOCUS_17650 50118 49636 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869814.1 protein_id gnl|my_center|LOCUS_17650 50407 50799 gene locus_tag LOCUS_17660 gene speD 50407 50799 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545906.1 protein_id gnl|my_center|LOCUS_17660 50799 51719 gene locus_tag LOCUS_17670 gene speE 50799 51719 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583812.1 protein_id gnl|my_center|LOCUS_17670 51837 52319 gene locus_tag LOCUS_17680 51837 52319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 53298 52327 gene locus_tag LOCUS_17690 53298 52327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 53349 54038 gene locus_tag LOCUS_17700 53349 54038 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939611.1 protein_id gnl|my_center|LOCUS_17700 55068 54013 gene locus_tag LOCUS_17710 gene murG 55068 54013 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724779.1 protein_id gnl|my_center|LOCUS_17710 56020 55241 gene locus_tag LOCUS_17720 56020 55241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 57188 56064 gene locus_tag LOCUS_17730 57188 56064 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256645.1 protein_id gnl|my_center|LOCUS_17730 58436 57201 gene locus_tag LOCUS_17740 58436 57201 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943128.1 protein_id gnl|my_center|LOCUS_17740 59800 58433 gene locus_tag LOCUS_17750 59800 58433 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256327.1 protein_id gnl|my_center|LOCUS_17750 60432 59797 gene locus_tag LOCUS_17760 60432 59797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 61779 60532 gene locus_tag LOCUS_17770 gene chrA 61779 60532 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184001.1 protein_id gnl|my_center|LOCUS_17770 62165 61776 gene locus_tag LOCUS_17780 62165 61776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 62315 63109 gene locus_tag LOCUS_17790 62315 63109 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963620.1 protein_id gnl|my_center|LOCUS_17790 64142 63132 gene locus_tag LOCUS_17800 64142 63132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 64364 64155 gene locus_tag LOCUS_17810 64364 64155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 64629 65156 gene locus_tag LOCUS_17820 64629 65156 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_17820 65153 66130 gene locus_tag LOCUS_17830 65153 66130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 66214 67623 gene locus_tag LOCUS_17840 66214 67623 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943931.1 protein_id gnl|my_center|LOCUS_17840 67815 69209 gene locus_tag LOCUS_17850 67815 69209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 69206 72208 gene locus_tag LOCUS_17860 69206 72208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 72549 72220 gene locus_tag LOCUS_17870 72549 72220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 72750 72622 gene locus_tag LOCUS_17880 72750 72622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 72823 74640 gene locus_tag LOCUS_17890 72823 74640 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_17890 74648 74723 gene locus_tag LOCUS_t00160 74648 74723 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 74893 76248 gene locus_tag LOCUS_17900 74893 76248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 76533 76360 gene locus_tag LOCUS_17910 76533 76360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 77177 76530 gene locus_tag LOCUS_17920 77177 76530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 >Feature sequence016 1415 885 gene locus_tag LOCUS_17930 1415 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 1927 1502 gene locus_tag LOCUS_17940 1927 1502 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729083.1 protein_id gnl|my_center|LOCUS_17940 2735 2001 gene locus_tag LOCUS_17950 2735 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 3841 2735 gene locus_tag LOCUS_17960 3841 2735 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970499.1 protein_id gnl|my_center|LOCUS_17960 4998 3838 gene locus_tag LOCUS_17970 4998 3838 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707194.1 protein_id gnl|my_center|LOCUS_17970 5848 4991 gene locus_tag LOCUS_17980 5848 4991 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385673.1 protein_id gnl|my_center|LOCUS_17980 6944 5979 gene locus_tag LOCUS_17990 6944 5979 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385674.1 protein_id gnl|my_center|LOCUS_17990 8639 7056 gene locus_tag LOCUS_18000 8639 7056 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383585.1 protein_id gnl|my_center|LOCUS_18000 9166 10242 gene locus_tag LOCUS_18010 9166 10242 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064652.1 protein_id gnl|my_center|LOCUS_18010 10792 10322 gene locus_tag LOCUS_18020 10792 10322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 11786 10806 gene locus_tag LOCUS_18030 11786 10806 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105383.1 protein_id gnl|my_center|LOCUS_18030 12787 11783 gene locus_tag LOCUS_18040 12787 11783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 14361 12892 gene locus_tag LOCUS_18050 14361 12892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18050 14859 14446 gene locus_tag LOCUS_18060 14859 14446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18060 15199 15624 gene locus_tag LOCUS_18070 15199 15624 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119547.1 protein_id gnl|my_center|LOCUS_18070 17670 15784 gene locus_tag LOCUS_18080 17670 15784 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957058.1 protein_id gnl|my_center|LOCUS_18080 18680 17706 gene locus_tag LOCUS_18090 18680 17706 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528641.1 protein_id gnl|my_center|LOCUS_18090 20898 18673 gene locus_tag LOCUS_18100 20898 18673 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086230.1 protein_id gnl|my_center|LOCUS_18100 21952 20876 gene locus_tag LOCUS_18110 21952 20876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083926.1 protein_id gnl|my_center|LOCUS_18110 23474 21984 gene locus_tag LOCUS_18120 23474 21984 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226376432.1 protein_id gnl|my_center|LOCUS_18120 25649 23583 gene locus_tag LOCUS_18130 25649 23583 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229602.1 protein_id gnl|my_center|LOCUS_18130 26314 25685 gene locus_tag LOCUS_18140 26314 25685 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063695.1 protein_id gnl|my_center|LOCUS_18140 27374 26742 gene locus_tag LOCUS_18150 27374 26742 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206326.1 protein_id gnl|my_center|LOCUS_18150 28610 27411 gene locus_tag LOCUS_18160 28610 27411 CDS product selenium-binding family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977998.1 protein_id gnl|my_center|LOCUS_18160 30715 28607 gene locus_tag LOCUS_18170 30715 28607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 31321 30725 gene locus_tag LOCUS_18180 31321 30725 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896181.1 protein_id gnl|my_center|LOCUS_18180 31757 31407 gene locus_tag LOCUS_18190 31757 31407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 31930 32292 gene locus_tag LOCUS_18200 31930 32292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 33031 33315 gene locus_tag LOCUS_18210 33031 33315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 33308 33655 gene locus_tag LOCUS_18220 33308 33655 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190909147.1 protein_id gnl|my_center|LOCUS_18220 34003 34200 gene locus_tag LOCUS_18230 34003 34200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 34456 34381 gene locus_tag LOCUS_t00170 34456 34381 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 35249 34569 gene locus_tag LOCUS_18240 35249 34569 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021673.1 protein_id gnl|my_center|LOCUS_18240 36505 35252 gene locus_tag LOCUS_18250 36505 35252 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975247.1 protein_id gnl|my_center|LOCUS_18250 37727 36507 gene locus_tag LOCUS_18260 37727 36507 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941617.1 protein_id gnl|my_center|LOCUS_18260 38083 37760 gene locus_tag LOCUS_18270 38083 37760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 39429 38086 gene locus_tag LOCUS_18280 39429 38086 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259633.1 protein_id gnl|my_center|LOCUS_18280 40313 39426 gene locus_tag LOCUS_18290 40313 39426 CDS product DUF4392 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011011337.1 protein_id gnl|my_center|LOCUS_18290 40908 40327 gene locus_tag LOCUS_18300 40908 40327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 42506 40911 gene locus_tag LOCUS_18310 gene ggt 42506 40911 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528519.1 protein_id gnl|my_center|LOCUS_18310 43527 42508 gene locus_tag LOCUS_18320 43527 42508 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_18320 43603 44520 gene locus_tag LOCUS_18330 gene ftcD 43603 44520 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681237.1 protein_id gnl|my_center|LOCUS_18330 45918 44530 gene locus_tag LOCUS_18340 45918 44530 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224497204.1 protein_id gnl|my_center|LOCUS_18340 47184 46297 gene locus_tag LOCUS_18350 47184 46297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 49603 47198 gene locus_tag LOCUS_18360 49603 47198 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992271.1 protein_id gnl|my_center|LOCUS_18360 49901 49620 gene locus_tag LOCUS_18370 49901 49620 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349637.1 protein_id gnl|my_center|LOCUS_18370 50274 51188 gene locus_tag LOCUS_18380 50274 51188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 51710 51330 gene locus_tag LOCUS_18390 51710 51330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 53252 51723 gene locus_tag LOCUS_18400 gene rng 53252 51723 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_18400 54390 53299 gene locus_tag LOCUS_18410 gene rodA 54390 53299 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_18410 56186 54387 gene locus_tag LOCUS_18420 gene mrdA 56186 54387 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_18420 56677 56183 gene locus_tag LOCUS_18430 56677 56183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 57516 56674 gene locus_tag LOCUS_18440 gene mreC 57516 56674 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942723.1 protein_id gnl|my_center|LOCUS_18440 58597 57566 gene locus_tag LOCUS_18450 58597 57566 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_18450 60012 58729 gene locus_tag LOCUS_18460 60012 58729 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389892.1 protein_id gnl|my_center|LOCUS_18460 60480 60013 gene locus_tag LOCUS_18470 60480 60013 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938007.1 protein_id gnl|my_center|LOCUS_18470 61521 60499 gene locus_tag LOCUS_18480 gene dctP 61521 60499 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389894.1 protein_id gnl|my_center|LOCUS_18480 61844 62044 gene locus_tag LOCUS_18490 61844 62044 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_18490 62386 62586 gene locus_tag LOCUS_18500 62386 62586 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_18500 63334 63035 gene locus_tag LOCUS_18510 63334 63035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 63864 63460 gene locus_tag LOCUS_18520 gene copC 63864 63460 CDS product copper homeostasis periplasmic binding protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530770.1 protein_id gnl|my_center|LOCUS_18520 64172 63861 gene locus_tag LOCUS_18530 64172 63861 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092213181.1 protein_id gnl|my_center|LOCUS_18530 66118 64172 gene locus_tag LOCUS_18540 66118 64172 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_18540 66530 66135 gene locus_tag LOCUS_18550 66530 66135 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112247.1 protein_id gnl|my_center|LOCUS_18550 66691 66530 gene locus_tag LOCUS_18560 66691 66530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 66892 66704 gene locus_tag LOCUS_18570 66892 66704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 67434 66892 gene locus_tag LOCUS_18580 67434 66892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 68996 67440 gene locus_tag LOCUS_18590 68996 67440 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258986.1 protein_id gnl|my_center|LOCUS_18590 69322 68996 gene locus_tag LOCUS_18600 69322 68996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 70239 69319 gene locus_tag LOCUS_18610 70239 69319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 70352 71140 gene locus_tag LOCUS_18620 70352 71140 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222968.1 protein_id gnl|my_center|LOCUS_18620 72976 71147 gene locus_tag LOCUS_18630 72976 71147 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256059.1 protein_id gnl|my_center|LOCUS_18630 74484 73117 gene locus_tag LOCUS_18640 gene dnaB 74484 73117 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941663.1 protein_id gnl|my_center|LOCUS_18640 74930 74487 gene locus_tag LOCUS_18650 gene rplI 74930 74487 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_18650 75609 75205 gene locus_tag LOCUS_18660 75609 75205 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_18660 75962 75609 gene locus_tag LOCUS_18670 75962 75609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 <77296 76205 gene locus_tag LOCUS_18680 <77296 76205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545192.1:chaperonin GroEL >Feature sequence017 <1 631 gene locus_tag LOCUS_18690 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000998048.1:IS66-like element ISEc8 family transposase 1051 683 gene locus_tag LOCUS_18700 1051 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 3870 1129 gene locus_tag LOCUS_18710 3870 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 3761 4306 gene locus_tag LOCUS_18720 3761 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 5453 4287 gene locus_tag LOCUS_18730 5453 4287 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035901.1 protein_id gnl|my_center|LOCUS_18730 7210 5519 gene locus_tag LOCUS_18740 7210 5519 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_18740 10127 7257 gene locus_tag LOCUS_18750 10127 7257 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943139.1 protein_id gnl|my_center|LOCUS_18750 11363 10239 gene locus_tag LOCUS_18760 11363 10239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 11805 15014 gene locus_tag LOCUS_18770 11805 15014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 15086 15595 gene locus_tag LOCUS_18780 gene aroQ 15086 15595 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_18780 15775 16821 gene locus_tag LOCUS_18790 15775 16821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 16829 18352 gene locus_tag LOCUS_18800 16829 18352 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231527.1 protein_id gnl|my_center|LOCUS_18800 18375 19121 gene locus_tag LOCUS_18810 gene cobS 18375 19121 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257084.1 protein_id gnl|my_center|LOCUS_18810 19193 19825 gene locus_tag LOCUS_18820 gene cobC 19193 19825 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_18820 19854 21482 gene locus_tag LOCUS_18830 19854 21482 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868766.1 protein_id gnl|my_center|LOCUS_18830 21507 22457 gene locus_tag LOCUS_18840 21507 22457 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836213.1 protein_id gnl|my_center|LOCUS_18840 22450 23295 gene locus_tag LOCUS_18850 22450 23295 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368523.1 protein_id gnl|my_center|LOCUS_18850 23331 24317 gene locus_tag LOCUS_18860 23331 24317 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259508.1 protein_id gnl|my_center|LOCUS_18860 24469 25440 gene locus_tag LOCUS_18870 24469 25440 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815527.1 protein_id gnl|my_center|LOCUS_18870 25741 25920 gene locus_tag LOCUS_18880 25741 25920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 26017 26592 gene locus_tag LOCUS_18890 26017 26592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 26597 28180 gene locus_tag LOCUS_18900 26597 28180 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902740.1 protein_id gnl|my_center|LOCUS_18900 28621 28199 gene locus_tag LOCUS_18910 28621 28199 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089292.1 protein_id gnl|my_center|LOCUS_18910 29360 28647 gene locus_tag LOCUS_18920 29360 28647 CDS product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838970.1 protein_id gnl|my_center|LOCUS_18920 29499 29864 gene locus_tag LOCUS_18930 29499 29864 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535776.1 protein_id gnl|my_center|LOCUS_18930 29889 31886 gene locus_tag LOCUS_18940 29889 31886 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_18940 31930 32181 gene locus_tag LOCUS_18950 31930 32181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 33435 32260 gene locus_tag LOCUS_18960 33435 32260 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064468.1 protein_id gnl|my_center|LOCUS_18960 33720 34511 gene locus_tag LOCUS_18970 33720 34511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 34811 35374 gene locus_tag LOCUS_18980 gene cobU 34811 35374 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938306.1 protein_id gnl|my_center|LOCUS_18980 35349 36425 gene locus_tag LOCUS_18990 gene cobT 35349 36425 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541537.1 protein_id gnl|my_center|LOCUS_18990 36422 37828 gene locus_tag LOCUS_19000 36422 37828 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943636.1 protein_id gnl|my_center|LOCUS_19000 37825 38721 gene locus_tag LOCUS_19010 37825 38721 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583782.1 protein_id gnl|my_center|LOCUS_19010 38718 39833 gene locus_tag LOCUS_19020 38718 39833 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187546.1 protein_id gnl|my_center|LOCUS_19020 39830 40660 gene locus_tag LOCUS_19030 39830 40660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 40932 42821 gene locus_tag LOCUS_19040 gene btuB 40932 42821 CDS product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591414.1 protein_id gnl|my_center|LOCUS_19040 42832 43485 gene locus_tag LOCUS_19050 42832 43485 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031658.1 protein_id gnl|my_center|LOCUS_19050 43482 44450 gene locus_tag LOCUS_19060 43482 44450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 44461 45372 gene locus_tag LOCUS_19070 gene cbiB 44461 45372 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258432.1 protein_id gnl|my_center|LOCUS_19070 45728 47440 gene locus_tag LOCUS_19080 gene argS 45728 47440 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938544.1 protein_id gnl|my_center|LOCUS_19080 47566 48261 gene locus_tag LOCUS_19090 47566 48261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 48283 48819 gene locus_tag LOCUS_19100 gene hpt 48283 48819 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817255.1 protein_id gnl|my_center|LOCUS_19100 48859 50679 gene locus_tag LOCUS_19110 gene ftsH 48859 50679 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_19110 50864 51727 gene locus_tag LOCUS_19120 gene folP 50864 51727 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250112.1 protein_id gnl|my_center|LOCUS_19120 51732 52556 gene locus_tag LOCUS_19130 gene cdaA 51732 52556 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_19130 52553 53254 gene locus_tag LOCUS_19140 52553 53254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 53251 54603 gene locus_tag LOCUS_19150 gene glmM 53251 54603 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461863.1 protein_id gnl|my_center|LOCUS_19150 54604 55017 gene locus_tag LOCUS_19160 gene acpS 54604 55017 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873555.1 protein_id gnl|my_center|LOCUS_19160 55022 55771 gene locus_tag LOCUS_19170 55022 55771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 55774 57375 gene locus_tag LOCUS_19180 55774 57375 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_19180 57390 57821 gene locus_tag LOCUS_19190 gene tsaE 57390 57821 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393647.1 protein_id gnl|my_center|LOCUS_19190 57814 59139 gene locus_tag LOCUS_19200 57814 59139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 59182 59868 gene locus_tag LOCUS_19210 gene radC 59182 59868 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405057.1 protein_id gnl|my_center|LOCUS_19210 59882 60325 gene locus_tag LOCUS_19220 59882 60325 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337321.1 protein_id gnl|my_center|LOCUS_19220 60553 60311 gene locus_tag LOCUS_19230 60553 60311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 61879 60890 gene locus_tag LOCUS_19240 61879 60890 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259753.1 protein_id gnl|my_center|LOCUS_19240 62002 62418 gene locus_tag LOCUS_19250 62002 62418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 62415 62849 gene locus_tag LOCUS_19260 62415 62849 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545804.1 protein_id gnl|my_center|LOCUS_19260 62934 63009 gene locus_tag LOCUS_t00180 62934 63009 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 63302 66523 gene locus_tag LOCUS_19270 63302 66523 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787323.1 protein_id gnl|my_center|LOCUS_19270 66526 69717 gene locus_tag LOCUS_19280 66526 69717 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787323.1 protein_id gnl|my_center|LOCUS_19280 70430 70002 gene locus_tag LOCUS_19290 70430 70002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 70489 70962 gene locus_tag LOCUS_19300 70489 70962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 71395 72933 gene locus_tag LOCUS_19310 71395 72933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 72930 74315 gene locus_tag LOCUS_19320 72930 74315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 >Feature sequence018 1731 1579 gene locus_tag LOCUS_19330 1731 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 2583 2017 gene locus_tag LOCUS_19340 2583 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 3337 2606 gene locus_tag LOCUS_19350 3337 2606 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086690.1 protein_id gnl|my_center|LOCUS_19350 5165 3420 gene locus_tag LOCUS_19360 5165 3420 CDS product putative 2-aminoethylphosphonate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975827.1 protein_id gnl|my_center|LOCUS_19360 6267 5170 gene locus_tag LOCUS_19370 6267 5170 CDS product putative 2-aminoethylphosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527142.1 protein_id gnl|my_center|LOCUS_19370 8084 6264 gene locus_tag LOCUS_19380 gene recQ 8084 6264 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941564.1 protein_id gnl|my_center|LOCUS_19380 9268 8249 gene locus_tag LOCUS_19390 9268 8249 CDS product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061793.1 protein_id gnl|my_center|LOCUS_19390 10105 9341 gene locus_tag LOCUS_19400 10105 9341 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192728.1 protein_id gnl|my_center|LOCUS_19400 10332 10168 gene locus_tag LOCUS_19410 10332 10168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 11357 10809 gene locus_tag LOCUS_19420 11357 10809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 12410 11502 gene locus_tag LOCUS_19430 12410 11502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 13273 12851 gene locus_tag LOCUS_19440 13273 12851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 13611 16991 gene locus_tag LOCUS_19450 13611 16991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 18443 17079 gene locus_tag LOCUS_19460 18443 17079 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529682.1 protein_id gnl|my_center|LOCUS_19460 19829 18600 gene locus_tag LOCUS_19470 gene phnA 19829 18600 CDS product phosphonoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199121.1 protein_id gnl|my_center|LOCUS_19470 20999 19845 gene locus_tag LOCUS_19480 20999 19845 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257004.1 protein_id gnl|my_center|LOCUS_19480 21458 21009 gene locus_tag LOCUS_19490 21458 21009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 22703 21459 gene locus_tag LOCUS_19500 gene fabF 22703 21459 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_19500 22968 22732 gene locus_tag LOCUS_19510 gene acpP 22968 22732 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_19510 23799 23044 gene locus_tag LOCUS_19520 gene fabG 23799 23044 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_19520 24923 23796 gene locus_tag LOCUS_19530 gene fabD 24923 23796 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_19530 25911 24931 gene locus_tag LOCUS_19540 25911 24931 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942246.1 protein_id gnl|my_center|LOCUS_19540 26933 25908 gene locus_tag LOCUS_19550 gene plsX 26933 25908 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942245.1 protein_id gnl|my_center|LOCUS_19550 27140 26958 gene locus_tag LOCUS_19560 gene rpmF 27140 26958 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942244.1 protein_id gnl|my_center|LOCUS_19560 27717 27205 gene locus_tag LOCUS_19570 27717 27205 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545391.1 protein_id gnl|my_center|LOCUS_19570 27895 28746 gene locus_tag LOCUS_19580 gene htpX 27895 28746 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942212.1 protein_id gnl|my_center|LOCUS_19580 28814 29530 gene locus_tag LOCUS_19590 28814 29530 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_19590 29592 30272 gene locus_tag LOCUS_19600 29592 30272 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183956994.1 protein_id gnl|my_center|LOCUS_19600 30286 30945 gene locus_tag LOCUS_19610 gene ccsA 30286 30945 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228656.1 protein_id gnl|my_center|LOCUS_19610 30938 31090 gene locus_tag LOCUS_19620 30938 31090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 31087 31533 gene locus_tag LOCUS_19630 gene ccmE 31087 31533 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228655.1 protein_id gnl|my_center|LOCUS_19630 31797 33743 gene locus_tag LOCUS_19640 31797 33743 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_19640 33740 34279 gene locus_tag LOCUS_19650 33740 34279 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228653.1 protein_id gnl|my_center|LOCUS_19650 34276 34752 gene locus_tag LOCUS_19660 34276 34752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 34814 35821 gene locus_tag LOCUS_19670 34814 35821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 35926 36963 gene locus_tag LOCUS_19680 35926 36963 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256232.1 protein_id gnl|my_center|LOCUS_19680 37124 38638 gene locus_tag LOCUS_19690 37124 38638 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256231.1 protein_id gnl|my_center|LOCUS_19690 38711 40726 gene locus_tag LOCUS_19700 gene ligA 38711 40726 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393509.1 protein_id gnl|my_center|LOCUS_19700 40723 41376 gene locus_tag LOCUS_19710 40723 41376 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337477.1 protein_id gnl|my_center|LOCUS_19710 41614 42309 gene locus_tag LOCUS_19720 41614 42309 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157334022.1 protein_id gnl|my_center|LOCUS_19720 42523 43014 gene locus_tag LOCUS_19730 42523 43014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 43395 43856 gene locus_tag LOCUS_19740 43395 43856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 43867 45168 gene locus_tag LOCUS_19750 43867 45168 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860380.1 protein_id gnl|my_center|LOCUS_19750 45904 45215 gene locus_tag LOCUS_19760 45904 45215 CDS product fumarate hydratase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339079.1 protein_id gnl|my_center|LOCUS_19760 46839 45904 gene locus_tag LOCUS_19770 46839 45904 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339080.1 protein_id gnl|my_center|LOCUS_19770 48457 46868 gene locus_tag LOCUS_19780 gene cimA 48457 46868 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546272.1 protein_id gnl|my_center|LOCUS_19780 49671 48505 gene locus_tag LOCUS_19790 49671 48505 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064882.1 protein_id gnl|my_center|LOCUS_19790 50176 49748 gene locus_tag LOCUS_19800 50176 49748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 51300 50173 gene locus_tag LOCUS_19810 51300 50173 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902657.1 protein_id gnl|my_center|LOCUS_19810 51625 51332 gene locus_tag LOCUS_19820 51625 51332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 52110 51844 gene locus_tag LOCUS_19830 52110 51844 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406185.1 protein_id gnl|my_center|LOCUS_19830 53280 52381 gene locus_tag LOCUS_19840 53280 52381 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172662.1 protein_id gnl|my_center|LOCUS_19840 54239 53286 gene locus_tag LOCUS_19850 54239 53286 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_19850 55878 54301 gene locus_tag LOCUS_19860 55878 54301 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083813.1 protein_id gnl|my_center|LOCUS_19860 57016 56042 gene locus_tag LOCUS_19870 57016 56042 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_19870 58005 57013 gene locus_tag LOCUS_19880 58005 57013 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_19880 59297 58035 gene locus_tag LOCUS_19890 59297 58035 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257201.1 protein_id gnl|my_center|LOCUS_19890 60280 59294 gene locus_tag LOCUS_19900 60280 59294 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533209.1 protein_id gnl|my_center|LOCUS_19900 60673 60287 gene locus_tag LOCUS_19910 60673 60287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 61768 60713 gene locus_tag LOCUS_19920 61768 60713 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172854.1 protein_id gnl|my_center|LOCUS_19920 62268 61846 gene locus_tag LOCUS_19930 62268 61846 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003497910.1 protein_id gnl|my_center|LOCUS_19930 62738 62301 gene locus_tag LOCUS_19940 62738 62301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 63595 62792 gene locus_tag LOCUS_19950 63595 62792 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222374.1 protein_id gnl|my_center|LOCUS_19950 64182 63616 gene locus_tag LOCUS_19960 64182 63616 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227724.1 protein_id gnl|my_center|LOCUS_19960 64964 64287 gene locus_tag LOCUS_19970 64964 64287 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428771.1 protein_id gnl|my_center|LOCUS_19970 66149 65154 gene locus_tag LOCUS_19980 66149 65154 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966164.1 protein_id gnl|my_center|LOCUS_19980 66517 66993 gene locus_tag LOCUS_19990 66517 66993 CDS product hypoxia response transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900026.1 protein_id gnl|my_center|LOCUS_19990 66999 67172 gene locus_tag LOCUS_20000 66999 67172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 67861 67487 gene locus_tag LOCUS_20010 67861 67487 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088312.1 protein_id gnl|my_center|LOCUS_20010 68514 68017 gene locus_tag LOCUS_20020 68514 68017 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530144.1 protein_id gnl|my_center|LOCUS_20020 69106 68675 gene locus_tag LOCUS_20030 69106 68675 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704236.1 protein_id gnl|my_center|LOCUS_20030 69714 69505 gene locus_tag LOCUS_20040 69714 69505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 69871 70065 gene locus_tag LOCUS_20050 69871 70065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 70065 70451 gene locus_tag LOCUS_20060 70065 70451 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932025.1 protein_id gnl|my_center|LOCUS_20060 70866 70522 gene locus_tag LOCUS_20070 70866 70522 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 protein_id gnl|my_center|LOCUS_20070 71108 70851 gene locus_tag LOCUS_20080 71108 70851 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680104.1 protein_id gnl|my_center|LOCUS_20080 72758 71817 gene locus_tag LOCUS_20090 72758 71817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 72838 73077 gene locus_tag LOCUS_20100 72838 73077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 73268 73468 gene locus_tag LOCUS_20110 73268 73468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20110 >Feature sequence019 481 1632 gene locus_tag LOCUS_20120 481 1632 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793101.1 protein_id gnl|my_center|LOCUS_20120 3234 1720 gene locus_tag LOCUS_20130 gene nagZ 3234 1720 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963506.1 protein_id gnl|my_center|LOCUS_20130 4394 3249 gene locus_tag LOCUS_20140 4394 3249 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890808.1 protein_id gnl|my_center|LOCUS_20140 5563 4391 gene locus_tag LOCUS_20150 5563 4391 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_20150 5625 6488 gene locus_tag LOCUS_20160 gene murQ 5625 6488 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144000.1 protein_id gnl|my_center|LOCUS_20160 6698 7018 gene locus_tag LOCUS_20170 6698 7018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 7076 9133 gene locus_tag LOCUS_20180 7076 9133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 9346 9543 gene locus_tag LOCUS_20190 9346 9543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 9608 10405 gene locus_tag LOCUS_20200 9608 10405 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104791.1 protein_id gnl|my_center|LOCUS_20200 10552 11745 gene locus_tag LOCUS_20210 10552 11745 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225678.1 protein_id gnl|my_center|LOCUS_20210 11817 12611 gene locus_tag LOCUS_20220 11817 12611 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227837.1 protein_id gnl|my_center|LOCUS_20220 13526 12981 gene locus_tag LOCUS_20230 13526 12981 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419208.1 protein_id gnl|my_center|LOCUS_20230 13578 14603 gene locus_tag LOCUS_20240 13578 14603 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408181.1 protein_id gnl|my_center|LOCUS_20240 14605 15327 gene locus_tag LOCUS_20250 14605 15327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 15324 16535 gene locus_tag LOCUS_20260 15324 16535 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932902.1 protein_id gnl|my_center|LOCUS_20260 18040 16607 gene locus_tag LOCUS_20270 18040 16607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 18133 18573 gene locus_tag LOCUS_20280 18133 18573 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255194.1 protein_id gnl|my_center|LOCUS_20280 18699 20564 gene locus_tag LOCUS_20290 gene nuoL 18699 20564 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546379.1 protein_id gnl|my_center|LOCUS_20290 20579 22087 gene locus_tag LOCUS_20300 20579 22087 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_20300 22084 23544 gene locus_tag LOCUS_20310 22084 23544 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_20310 23791 24576 gene locus_tag LOCUS_20320 23791 24576 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258662.1 protein_id gnl|my_center|LOCUS_20320 24573 26198 gene locus_tag LOCUS_20330 24573 26198 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218596.1 protein_id gnl|my_center|LOCUS_20330 26359 27687 gene locus_tag LOCUS_20340 gene ugpB 26359 27687 CDS product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083853.1 protein_id gnl|my_center|LOCUS_20340 27692 28573 gene locus_tag LOCUS_20350 gene ugpA 27692 28573 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975291.1 protein_id gnl|my_center|LOCUS_20350 28570 29466 gene locus_tag LOCUS_20360 gene ugpE 28570 29466 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811259.1 protein_id gnl|my_center|LOCUS_20360 29463 30293 gene locus_tag LOCUS_20370 29463 30293 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067067.1 protein_id gnl|my_center|LOCUS_20370 30355 31872 gene locus_tag LOCUS_20380 gene glpK 30355 31872 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_20380 31869 32996 gene locus_tag LOCUS_20390 31869 32996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 32998 34080 gene locus_tag LOCUS_20400 32998 34080 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_20400 34073 35743 gene locus_tag LOCUS_20410 34073 35743 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819869.1 protein_id gnl|my_center|LOCUS_20410 35878 36111 gene locus_tag LOCUS_20420 35878 36111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 36101 36466 gene locus_tag LOCUS_20430 36101 36466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 36475 37227 gene locus_tag LOCUS_20440 36475 37227 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941002.1 protein_id gnl|my_center|LOCUS_20440 37260 37595 gene locus_tag LOCUS_20450 37260 37595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 37675 38325 gene locus_tag LOCUS_20460 37675 38325 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936275.1 protein_id gnl|my_center|LOCUS_20460 38350 41601 gene locus_tag LOCUS_20470 38350 41601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 41598 42707 gene locus_tag LOCUS_20480 41598 42707 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940693.1 protein_id gnl|my_center|LOCUS_20480 42921 44174 gene locus_tag LOCUS_20490 gene rho 42921 44174 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_20490 44370 44585 gene locus_tag LOCUS_20500 gene rpmE 44370 44585 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896340.1 protein_id gnl|my_center|LOCUS_20500 44704 45774 gene locus_tag LOCUS_20510 gene prfA 44704 45774 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_20510 45771 46646 gene locus_tag LOCUS_20520 gene prmC 45771 46646 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404795.1 protein_id gnl|my_center|LOCUS_20520 46646 47902 gene locus_tag LOCUS_20530 gene murA 46646 47902 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527889.1 protein_id gnl|my_center|LOCUS_20530 48055 48768 gene locus_tag LOCUS_20540 gene hisG 48055 48768 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943722.1 protein_id gnl|my_center|LOCUS_20540 48807 50075 gene locus_tag LOCUS_20550 gene hisD 48807 50075 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461463.1 protein_id gnl|my_center|LOCUS_20550 50072 50665 gene locus_tag LOCUS_20560 gene hisB 50072 50665 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_20560 50756 51379 gene locus_tag LOCUS_20570 gene hisH 50756 51379 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_20570 51376 52110 gene locus_tag LOCUS_20580 gene hisA 51376 52110 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207860.1 protein_id gnl|my_center|LOCUS_20580 52115 52894 gene locus_tag LOCUS_20590 gene hisF 52115 52894 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393527.1 protein_id gnl|my_center|LOCUS_20590 52891 53568 gene locus_tag LOCUS_20600 gene hisIE 52891 53568 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817209.1 protein_id gnl|my_center|LOCUS_20600 53565 54065 gene locus_tag LOCUS_20610 53565 54065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 54062 54841 gene locus_tag LOCUS_20620 54062 54841 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941592.1 protein_id gnl|my_center|LOCUS_20620 54846 55598 gene locus_tag LOCUS_20630 54846 55598 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_20630 55603 56868 gene locus_tag LOCUS_20640 55603 56868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 56868 58232 gene locus_tag LOCUS_20650 gene radA 56868 58232 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940957.1 protein_id gnl|my_center|LOCUS_20650 58241 59233 gene locus_tag LOCUS_20660 58241 59233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 59242 60009 gene locus_tag LOCUS_20670 gene ispD 59242 60009 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393964.1 protein_id gnl|my_center|LOCUS_20670 60015 60488 gene locus_tag LOCUS_20680 gene ispF 60015 60488 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459082.1 protein_id gnl|my_center|LOCUS_20680 60505 61935 gene locus_tag LOCUS_20690 gene cysS 60505 61935 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943976.1 protein_id gnl|my_center|LOCUS_20690 61932 62699 gene locus_tag LOCUS_20700 gene rlmB 61932 62699 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393958.1 protein_id gnl|my_center|LOCUS_20700 62739 62813 gene locus_tag LOCUS_t00190 62739 62813 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 62848 62933 gene locus_tag LOCUS_t00200 62848 62933 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 62973 63047 gene locus_tag LOCUS_t00210 62973 63047 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 63092 63167 gene locus_tag LOCUS_t00220 63092 63167 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 63356 64387 gene locus_tag LOCUS_20710 gene tuf 63356 64387 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_20710 64391 64540 gene locus_tag LOCUS_20720 gene rpmG 64391 64540 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881260.1 protein_id gnl|my_center|LOCUS_20720 64547 64623 gene locus_tag LOCUS_t00230 64547 64623 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 64656 64847 gene locus_tag LOCUS_20730 64656 64847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 64844 65398 gene locus_tag LOCUS_20740 gene nusG 64844 65398 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943498.1 protein_id gnl|my_center|LOCUS_20740 65402 65827 gene locus_tag LOCUS_20750 gene rplK 65402 65827 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943497.1 protein_id gnl|my_center|LOCUS_20750 66032 66739 gene locus_tag LOCUS_20760 gene rplA 66032 66739 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943496.1 protein_id gnl|my_center|LOCUS_20760 66757 67275 gene locus_tag LOCUS_20770 gene rplJ 66757 67275 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810195.1 protein_id gnl|my_center|LOCUS_20770 67328 67708 gene locus_tag LOCUS_20780 gene rplL 67328 67708 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536194.1 protein_id gnl|my_center|LOCUS_20780 67866 71336 gene locus_tag LOCUS_20790 67866 71336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 71254 71820 gene locus_tag LOCUS_20800 71254 71820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20800 >Feature sequence020 3319 2504 gene locus_tag LOCUS_20810 3319 2504 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226742.1 protein_id gnl|my_center|LOCUS_20810 4263 3484 gene locus_tag LOCUS_20820 4263 3484 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393001.1 protein_id gnl|my_center|LOCUS_20820 5442 4441 gene locus_tag LOCUS_20830 5442 4441 CDS product TIGR03842 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228421.1 protein_id gnl|my_center|LOCUS_20830 6255 5584 gene locus_tag LOCUS_20840 6255 5584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 7348 6341 gene locus_tag LOCUS_20850 7348 6341 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_20850 8226 7351 gene locus_tag LOCUS_20860 8226 7351 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529276.1 protein_id gnl|my_center|LOCUS_20860 9232 8234 gene locus_tag LOCUS_20870 9232 8234 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921208.1 protein_id gnl|my_center|LOCUS_20870 9432 10823 gene locus_tag LOCUS_20880 9432 10823 CDS product CUAEP/CCAEP-tail radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257877.1 protein_id gnl|my_center|LOCUS_20880 10907 11185 gene locus_tag LOCUS_20890 10907 11185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 11624 11337 gene locus_tag LOCUS_20900 11624 11337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 11593 11739 gene locus_tag LOCUS_20910 11593 11739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 13256 11805 gene locus_tag LOCUS_20920 13256 11805 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546123.1 protein_id gnl|my_center|LOCUS_20920 13766 13422 gene locus_tag LOCUS_20930 13766 13422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 14468 13803 gene locus_tag LOCUS_20940 14468 13803 CDS product sulfoxide reductase heme-binding subunit YedZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388352.1 protein_id gnl|my_center|LOCUS_20940 15423 14473 gene locus_tag LOCUS_20950 gene msrP 15423 14473 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527906.1 protein_id gnl|my_center|LOCUS_20950 15585 16265 gene locus_tag LOCUS_20960 15585 16265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 16706 16167 gene locus_tag LOCUS_20970 16706 16167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 18804 16699 gene locus_tag LOCUS_20980 18804 16699 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942130.1 protein_id gnl|my_center|LOCUS_20980 19536 18937 gene locus_tag LOCUS_20990 19536 18937 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064451.1 protein_id gnl|my_center|LOCUS_20990 22269 19549 gene locus_tag LOCUS_21000 gene glnD 22269 19549 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_21000 22330 23424 gene locus_tag LOCUS_21010 gene hisC 22330 23424 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_21010 24007 23645 gene locus_tag LOCUS_21020 24007 23645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 24154 25305 gene locus_tag LOCUS_21030 24154 25305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 25307 26245 gene locus_tag LOCUS_21040 25307 26245 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384240.1 protein_id gnl|my_center|LOCUS_21040 27377 26358 gene locus_tag LOCUS_21050 27377 26358 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222574.1 protein_id gnl|my_center|LOCUS_21050 28684 27377 gene locus_tag LOCUS_21060 28684 27377 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480624.1 protein_id gnl|my_center|LOCUS_21060 30444 28756 gene locus_tag LOCUS_21070 30444 28756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 31808 30441 gene locus_tag LOCUS_21080 gene fslC 31808 30441 CDS product rhizoferrin biosystnesis N-citrylornithine decarboxylase FslC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022882.1 protein_id gnl|my_center|LOCUS_21080 33984 31849 gene locus_tag LOCUS_21090 33984 31849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 34261 33977 gene locus_tag LOCUS_21100 34261 33977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 35586 34261 gene locus_tag LOCUS_21110 35586 34261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 35993 37432 gene locus_tag LOCUS_21120 35993 37432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 38020 37427 gene locus_tag LOCUS_21130 38020 37427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21130 38224 38033 gene locus_tag LOCUS_21140 38224 38033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 38585 39298 gene locus_tag LOCUS_21150 38585 39298 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583891.1 protein_id gnl|my_center|LOCUS_21150 39465 40337 gene locus_tag LOCUS_21160 39465 40337 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665727.1 protein_id gnl|my_center|LOCUS_21160 40709 40356 gene locus_tag LOCUS_21170 40709 40356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 41755 40742 gene locus_tag LOCUS_21180 41755 40742 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727690.1 protein_id gnl|my_center|LOCUS_21180 42783 41752 gene locus_tag LOCUS_21190 42783 41752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 43966 42815 gene locus_tag LOCUS_21200 43966 42815 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225693.1 protein_id gnl|my_center|LOCUS_21200 44955 43963 gene locus_tag LOCUS_21210 44955 43963 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222574.1 protein_id gnl|my_center|LOCUS_21210 46789 45104 gene locus_tag LOCUS_21220 46789 45104 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867965.1 protein_id gnl|my_center|LOCUS_21220 47577 46801 gene locus_tag LOCUS_21230 47577 46801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 49006 47618 gene locus_tag LOCUS_21240 49006 47618 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545384.1 protein_id gnl|my_center|LOCUS_21240 50370 49003 gene locus_tag LOCUS_21250 gene purB 50370 49003 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004345327.1 protein_id gnl|my_center|LOCUS_21250 52001 50373 gene locus_tag LOCUS_21260 gene fadK 52001 50373 CDS product medium-chain fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553704.1 protein_id gnl|my_center|LOCUS_21260 54045 52021 gene locus_tag LOCUS_21270 54045 52021 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957058.1 protein_id gnl|my_center|LOCUS_21270 55038 54049 gene locus_tag LOCUS_21280 55038 54049 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869565.1 protein_id gnl|my_center|LOCUS_21280 55280 55035 gene locus_tag LOCUS_21290 55280 55035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 55707 55264 gene locus_tag LOCUS_21300 55707 55264 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 protein_id gnl|my_center|LOCUS_21300 56861 55713 gene locus_tag LOCUS_21310 56861 55713 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097850.1 protein_id gnl|my_center|LOCUS_21310 57346 58239 gene locus_tag LOCUS_21320 57346 58239 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729046.1 protein_id gnl|my_center|LOCUS_21320 58410 59006 gene locus_tag LOCUS_21330 58410 59006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 58976 59329 gene locus_tag LOCUS_21340 58976 59329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 59366 59833 gene locus_tag LOCUS_21350 59366 59833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 60406 59876 gene locus_tag LOCUS_21360 60406 59876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 63780 60403 gene locus_tag LOCUS_21370 63780 60403 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090601.1 protein_id gnl|my_center|LOCUS_21370 64008 64445 gene locus_tag LOCUS_21380 64008 64445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 64792 64463 gene locus_tag LOCUS_21390 64792 64463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 65044 64823 gene locus_tag LOCUS_21400 65044 64823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 65063 65287 gene locus_tag LOCUS_21410 65063 65287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 65271 65591 gene locus_tag LOCUS_21420 65271 65591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 66053 65640 gene locus_tag LOCUS_21430 gene mce 66053 65640 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249285.1 protein_id gnl|my_center|LOCUS_21430 67251 66070 gene locus_tag LOCUS_21440 67251 66070 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397283.1 protein_id gnl|my_center|LOCUS_21440 68588 67248 gene locus_tag LOCUS_21450 68588 67248 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545534.1 protein_id gnl|my_center|LOCUS_21450 69628 68585 gene locus_tag LOCUS_21460 69628 68585 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921208.1 protein_id gnl|my_center|LOCUS_21460 71088 69625 gene locus_tag LOCUS_21470 71088 69625 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918850.1 protein_id gnl|my_center|LOCUS_21470 >Feature sequence021 2359 641 gene locus_tag LOCUS_21480 2359 641 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233929.1 protein_id gnl|my_center|LOCUS_21480 3547 2456 gene locus_tag LOCUS_21490 3547 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 3939 3544 gene locus_tag LOCUS_21500 3939 3544 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626534.1 protein_id gnl|my_center|LOCUS_21500 6832 3929 gene locus_tag LOCUS_21510 6832 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 6975 7442 gene locus_tag LOCUS_21520 6975 7442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 7452 7595 gene locus_tag LOCUS_21530 7452 7595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 8150 7620 gene locus_tag LOCUS_21540 8150 7620 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065398.1 protein_id gnl|my_center|LOCUS_21540 11644 8168 gene locus_tag LOCUS_21550 11644 8168 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227656.1 protein_id gnl|my_center|LOCUS_21550 12394 11753 gene locus_tag LOCUS_21560 12394 11753 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391397.1 protein_id gnl|my_center|LOCUS_21560 12420 13106 gene locus_tag LOCUS_21570 12420 13106 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083291.1 protein_id gnl|my_center|LOCUS_21570 13103 15595 gene locus_tag LOCUS_21580 13103 15595 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970504.1 protein_id gnl|my_center|LOCUS_21580 15602 16447 gene locus_tag LOCUS_21590 15602 16447 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765521.1 protein_id gnl|my_center|LOCUS_21590 16782 17573 gene locus_tag LOCUS_21600 16782 17573 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731410.1 protein_id gnl|my_center|LOCUS_21600 18441 17677 gene locus_tag LOCUS_21610 18441 17677 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084110.1 protein_id gnl|my_center|LOCUS_21610 18972 18445 gene locus_tag LOCUS_21620 18972 18445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21620 19311 19006 gene locus_tag LOCUS_21630 19311 19006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 19785 19372 gene locus_tag LOCUS_21640 19785 19372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 20230 19778 gene locus_tag LOCUS_21650 20230 19778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 21583 20282 gene locus_tag LOCUS_21660 21583 20282 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257876.1 protein_id gnl|my_center|LOCUS_21660 21859 22800 gene locus_tag LOCUS_21670 21859 22800 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259143.1 protein_id gnl|my_center|LOCUS_21670 22829 23557 gene locus_tag LOCUS_21680 22829 23557 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941989.1 protein_id gnl|my_center|LOCUS_21680 24408 23620 gene locus_tag LOCUS_21690 24408 23620 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404626.1 protein_id gnl|my_center|LOCUS_21690 25211 24405 gene locus_tag LOCUS_21700 gene phnE 25211 24405 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104070585.1 protein_id gnl|my_center|LOCUS_21700 25999 25208 gene locus_tag LOCUS_21710 gene phnE 25999 25208 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808587.1 protein_id gnl|my_center|LOCUS_21710 26718 25996 gene locus_tag LOCUS_21720 gene phnC 26718 25996 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368503.1 protein_id gnl|my_center|LOCUS_21720 27760 26735 gene locus_tag LOCUS_21730 gene phnD 27760 26735 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808591.1 protein_id gnl|my_center|LOCUS_21730 27881 28477 gene locus_tag LOCUS_21740 27881 28477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 28711 28484 gene locus_tag LOCUS_21750 28711 28484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 29412 28702 gene locus_tag LOCUS_21760 29412 28702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21760 29485 31302 gene locus_tag LOCUS_21770 29485 31302 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924872.1 protein_id gnl|my_center|LOCUS_21770 31305 32276 gene locus_tag LOCUS_21780 31305 32276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 32749 32303 gene locus_tag LOCUS_21790 32749 32303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 32812 33258 gene locus_tag LOCUS_21800 32812 33258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 33275 33889 gene locus_tag LOCUS_21810 33275 33889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 35951 33876 gene locus_tag LOCUS_21820 35951 33876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 37018 36059 gene locus_tag LOCUS_21830 37018 36059 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220497.1 protein_id gnl|my_center|LOCUS_21830 37422 37018 gene locus_tag LOCUS_21840 37422 37018 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809935.1 protein_id gnl|my_center|LOCUS_21840 39558 37558 gene locus_tag LOCUS_21850 39558 37558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 40194 39604 gene locus_tag LOCUS_21860 40194 39604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 40218 41018 gene locus_tag LOCUS_21870 40218 41018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 41015 41611 gene locus_tag LOCUS_21880 41015 41611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 42570 41617 gene locus_tag LOCUS_21890 42570 41617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 44335 42722 gene locus_tag LOCUS_21900 44335 42722 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226410.1 protein_id gnl|my_center|LOCUS_21900 44559 44332 gene locus_tag LOCUS_21910 44559 44332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 44558 44806 gene locus_tag LOCUS_21920 44558 44806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 46082 44769 gene locus_tag LOCUS_21930 gene larA 46082 44769 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461442.1 protein_id gnl|my_center|LOCUS_21930 46244 47200 gene locus_tag LOCUS_21940 46244 47200 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729508.1 protein_id gnl|my_center|LOCUS_21940 47221 48036 gene locus_tag LOCUS_21950 47221 48036 CDS product L-iditol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540951.1 protein_id gnl|my_center|LOCUS_21950 48074 49456 gene locus_tag LOCUS_21960 gene hydA 48074 49456 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812110.1 protein_id gnl|my_center|LOCUS_21960 50180 49524 gene locus_tag LOCUS_21970 gene msrA 50180 49524 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096571812.1 protein_id gnl|my_center|LOCUS_21970 50280 52199 gene locus_tag LOCUS_21980 50280 52199 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095687.1 protein_id gnl|my_center|LOCUS_21980 52274 52765 gene locus_tag LOCUS_21990 gene yeaK 52274 52765 CDS product mischarged aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138043.1 protein_id gnl|my_center|LOCUS_21990 52946 53953 gene locus_tag LOCUS_22000 52946 53953 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975419.1 protein_id gnl|my_center|LOCUS_22000 54940 53942 gene locus_tag LOCUS_22010 54940 53942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 55831 55196 gene locus_tag LOCUS_22020 55831 55196 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510731.1 protein_id gnl|my_center|LOCUS_22020 56550 56131 gene locus_tag LOCUS_22030 56550 56131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 58345 56849 gene locus_tag LOCUS_22040 58345 56849 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328128.1 protein_id gnl|my_center|LOCUS_22040 59325 58342 gene locus_tag LOCUS_22050 59325 58342 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837553.1 protein_id gnl|my_center|LOCUS_22050 61844 59400 gene locus_tag LOCUS_22060 61844 59400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 61780 63924 gene locus_tag LOCUS_22070 61780 63924 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930644.1 protein_id gnl|my_center|LOCUS_22070 63936 64157 gene locus_tag LOCUS_22080 63936 64157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 64683 65801 gene locus_tag LOCUS_22090 64683 65801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 66378 65857 gene locus_tag LOCUS_22100 66378 65857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 >Feature sequence022 3266 1593 gene locus_tag LOCUS_22110 gene pruA 3266 1593 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404266.1 protein_id gnl|my_center|LOCUS_22110 3545 4834 gene locus_tag LOCUS_22120 3545 4834 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142321.1 protein_id gnl|my_center|LOCUS_22120 4906 6012 gene locus_tag LOCUS_22130 4906 6012 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142438.1 protein_id gnl|my_center|LOCUS_22130 6272 6772 gene locus_tag LOCUS_22140 6272 6772 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058664.1 protein_id gnl|my_center|LOCUS_22140 6803 7273 gene locus_tag LOCUS_22150 6803 7273 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071234.1 protein_id gnl|my_center|LOCUS_22150 7364 7693 gene locus_tag LOCUS_22160 7364 7693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 8833 7811 gene locus_tag LOCUS_22170 8833 7811 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242607.1 protein_id gnl|my_center|LOCUS_22170 9007 9519 gene locus_tag LOCUS_22180 9007 9519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 10405 9611 gene locus_tag LOCUS_22190 10405 9611 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082975.1 protein_id gnl|my_center|LOCUS_22190 10849 10562 gene locus_tag LOCUS_22200 10849 10562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 11646 11149 gene locus_tag LOCUS_22210 11646 11149 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880208.1 protein_id gnl|my_center|LOCUS_22210 11918 11676 gene locus_tag LOCUS_22220 11918 11676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 12020 13228 gene locus_tag LOCUS_22230 12020 13228 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_22230 13307 14938 gene locus_tag LOCUS_22240 13307 14938 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085749.1 protein_id gnl|my_center|LOCUS_22240 15003 16163 gene locus_tag LOCUS_22250 15003 16163 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440658.1 protein_id gnl|my_center|LOCUS_22250 16282 16854 gene locus_tag LOCUS_22260 16282 16854 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695952.1 protein_id gnl|my_center|LOCUS_22260 16882 17685 gene locus_tag LOCUS_22270 16882 17685 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085734.1 protein_id gnl|my_center|LOCUS_22270 18813 17710 gene locus_tag LOCUS_22280 18813 17710 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225828.1 protein_id gnl|my_center|LOCUS_22280 20865 18892 gene locus_tag LOCUS_22290 20865 18892 CDS product alpha/beta hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268668.1 protein_id gnl|my_center|LOCUS_22290 20999 21772 gene locus_tag LOCUS_22300 20999 21772 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082975.1 protein_id gnl|my_center|LOCUS_22300 21769 24243 gene locus_tag LOCUS_22310 21769 24243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 25887 24319 gene locus_tag LOCUS_22320 25887 24319 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080855420.1 protein_id gnl|my_center|LOCUS_22320 26758 25931 gene locus_tag LOCUS_22330 26758 25931 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811978.1 protein_id gnl|my_center|LOCUS_22330 27729 26788 gene locus_tag LOCUS_22340 27729 26788 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_22340 29046 27760 gene locus_tag LOCUS_22350 29046 27760 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533446.1 protein_id gnl|my_center|LOCUS_22350 31189 29060 gene locus_tag LOCUS_22360 31189 29060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 32913 31186 gene locus_tag LOCUS_22370 32913 31186 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086403.1 protein_id gnl|my_center|LOCUS_22370 33804 32920 gene locus_tag LOCUS_22380 gene ilvE 33804 32920 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_22380 34888 33842 gene locus_tag LOCUS_22390 34888 33842 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393776.1 protein_id gnl|my_center|LOCUS_22390 35739 34972 gene locus_tag LOCUS_22400 35739 34972 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_22400 36668 36012 gene locus_tag LOCUS_22410 36668 36012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 37070 36852 gene locus_tag LOCUS_22420 37070 36852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 37432 37073 gene locus_tag LOCUS_22430 37432 37073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 38919 37732 gene locus_tag LOCUS_22440 38919 37732 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027007.1 protein_id gnl|my_center|LOCUS_22440 39971 38916 gene locus_tag LOCUS_22450 39971 38916 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_22450 40063 40491 gene locus_tag LOCUS_22460 40063 40491 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815599.1 protein_id gnl|my_center|LOCUS_22460 40518 41489 gene locus_tag LOCUS_22470 40518 41489 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879275.1 protein_id gnl|my_center|LOCUS_22470 41995 41531 gene locus_tag LOCUS_22480 41995 41531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 42420 41992 gene locus_tag LOCUS_22490 42420 41992 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163926.1 protein_id gnl|my_center|LOCUS_22490 42547 43416 gene locus_tag LOCUS_22500 42547 43416 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224371.1 protein_id gnl|my_center|LOCUS_22500 43685 43527 gene locus_tag LOCUS_22510 43685 43527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 44057 43815 gene locus_tag LOCUS_22520 44057 43815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 45370 44045 gene locus_tag LOCUS_22530 45370 44045 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089286.1 protein_id gnl|my_center|LOCUS_22530 46141 45431 gene locus_tag LOCUS_22540 46141 45431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 47148 46150 gene locus_tag LOCUS_22550 47148 46150 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486313.1 protein_id gnl|my_center|LOCUS_22550 48292 47444 gene locus_tag LOCUS_22560 gene amrB 48292 47444 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388207.1 protein_id gnl|my_center|LOCUS_22560 48402 49460 gene locus_tag LOCUS_22570 gene amrS 48402 49460 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942373.1 protein_id gnl|my_center|LOCUS_22570 49447 49782 gene locus_tag LOCUS_22580 49447 49782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 49814 50485 gene locus_tag LOCUS_22590 49814 50485 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083659.1 protein_id gnl|my_center|LOCUS_22590 51136 50513 gene locus_tag LOCUS_22600 51136 50513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 51308 52456 gene locus_tag LOCUS_22610 51308 52456 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_22610 53282 52458 gene locus_tag LOCUS_22620 53282 52458 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965824.1 protein_id gnl|my_center|LOCUS_22620 53419 54690 gene locus_tag LOCUS_22630 53419 54690 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_22630 55419 54781 gene locus_tag LOCUS_22640 55419 54781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 57104 55920 gene locus_tag LOCUS_22650 57104 55920 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224755.1 protein_id gnl|my_center|LOCUS_22650 57490 57101 gene locus_tag LOCUS_22660 57490 57101 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815550.1 protein_id gnl|my_center|LOCUS_22660 57879 57490 gene locus_tag LOCUS_22670 57879 57490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 58173 57889 gene locus_tag LOCUS_22680 58173 57889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 58459 58238 gene locus_tag LOCUS_22690 58459 58238 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_22690 59128 58712 gene locus_tag LOCUS_22700 59128 58712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 59379 59137 gene locus_tag LOCUS_22710 59379 59137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 60036 59647 gene locus_tag LOCUS_22720 60036 59647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 61435 60143 gene locus_tag LOCUS_22730 61435 60143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 61530 61889 gene locus_tag LOCUS_22740 61530 61889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 61882 62214 gene locus_tag LOCUS_22750 61882 62214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 62813 62301 gene locus_tag LOCUS_22760 62813 62301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 63056 62832 gene locus_tag LOCUS_22770 63056 62832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 63269 63057 gene locus_tag LOCUS_22780 63269 63057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 63480 63295 gene locus_tag LOCUS_22790 63480 63295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 64287 63862 gene locus_tag LOCUS_22800 64287 63862 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815546.1 protein_id gnl|my_center|LOCUS_22800 65479 64310 gene locus_tag LOCUS_22810 65479 64310 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815544.1 protein_id gnl|my_center|LOCUS_22810 66630 65479 gene locus_tag LOCUS_22820 66630 65479 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815539.1 protein_id gnl|my_center|LOCUS_22820 >Feature sequence023 351 791 gene locus_tag LOCUS_22830 351 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 799 4812 gene locus_tag LOCUS_22840 799 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 4957 5178 gene locus_tag LOCUS_22850 4957 5178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 5218 5919 gene locus_tag LOCUS_22860 5218 5919 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348683.1 protein_id gnl|my_center|LOCUS_22860 6410 5997 gene locus_tag LOCUS_22870 6410 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 6526 9336 gene locus_tag LOCUS_22880 gene uvrA 6526 9336 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_22880 9333 9620 gene locus_tag LOCUS_22890 9333 9620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 9617 10879 gene locus_tag LOCUS_22900 9617 10879 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877874.1 protein_id gnl|my_center|LOCUS_22900 10945 12159 gene locus_tag LOCUS_22910 10945 12159 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730955.1 protein_id gnl|my_center|LOCUS_22910 12185 12688 gene locus_tag LOCUS_22920 12185 12688 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088090.1 protein_id gnl|my_center|LOCUS_22920 13467 12751 gene locus_tag LOCUS_22930 13467 12751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 14855 13446 gene locus_tag LOCUS_22940 14855 13446 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088880.1 protein_id gnl|my_center|LOCUS_22940 15598 15044 gene locus_tag LOCUS_22950 15598 15044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 16531 15617 gene locus_tag LOCUS_22960 16531 15617 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258665.1 protein_id gnl|my_center|LOCUS_22960 16596 17702 gene locus_tag LOCUS_22970 16596 17702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 17841 19160 gene locus_tag LOCUS_22980 17841 19160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 19317 20483 gene locus_tag LOCUS_22990 19317 20483 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066054433.1 protein_id gnl|my_center|LOCUS_22990 20689 21891 gene locus_tag LOCUS_23000 20689 21891 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501370.1 protein_id gnl|my_center|LOCUS_23000 22323 21928 gene locus_tag LOCUS_23010 22323 21928 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403014.1 protein_id gnl|my_center|LOCUS_23010 22565 22320 gene locus_tag LOCUS_23020 22565 22320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 23341 22763 gene locus_tag LOCUS_23030 23341 22763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 24921 23338 gene locus_tag LOCUS_23040 24921 23338 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256261.1 protein_id gnl|my_center|LOCUS_23040 25300 24932 gene locus_tag LOCUS_23050 25300 24932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 25425 25748 gene locus_tag LOCUS_23060 25425 25748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 25767 26690 gene locus_tag LOCUS_23070 25767 26690 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086091.1 protein_id gnl|my_center|LOCUS_23070 26766 31322 gene locus_tag LOCUS_23080 26766 31322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 31319 31993 gene locus_tag LOCUS_23090 31319 31993 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727243.1 protein_id gnl|my_center|LOCUS_23090 31990 32751 gene locus_tag LOCUS_23100 31990 32751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 33292 32900 gene locus_tag LOCUS_23110 33292 32900 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259070.1 protein_id gnl|my_center|LOCUS_23110 33654 34643 gene locus_tag LOCUS_23120 33654 34643 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222574.1 protein_id gnl|my_center|LOCUS_23120 34652 35086 gene locus_tag LOCUS_23130 34652 35086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 35083 36126 gene locus_tag LOCUS_23140 35083 36126 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389462.1 protein_id gnl|my_center|LOCUS_23140 36348 36560 gene locus_tag LOCUS_23150 36348 36560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 36557 36814 gene locus_tag LOCUS_23160 36557 36814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 36836 37828 gene locus_tag LOCUS_23170 36836 37828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 38045 39280 gene locus_tag LOCUS_23180 gene thrC 38045 39280 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870985.1 protein_id gnl|my_center|LOCUS_23180 39640 40236 gene locus_tag LOCUS_23190 39640 40236 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546348.1 protein_id gnl|my_center|LOCUS_23190 40915 40178 gene locus_tag LOCUS_23200 40915 40178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 41299 41207 gene locus_tag LOCUS_t00240 41299 41207 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 42371 41598 gene locus_tag LOCUS_23210 42371 41598 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259075.1 protein_id gnl|my_center|LOCUS_23210 43164 42379 gene locus_tag LOCUS_23220 gene lgt 43164 42379 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057991.1 protein_id gnl|my_center|LOCUS_23220 43369 44109 gene locus_tag LOCUS_23230 gene tolQ 43369 44109 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_23230 44099 44536 gene locus_tag LOCUS_23240 gene tolR 44099 44536 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_23240 44566 45414 gene locus_tag LOCUS_23250 44566 45414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 45417 46748 gene locus_tag LOCUS_23260 gene tolB 45417 46748 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_23260 46808 47419 gene locus_tag LOCUS_23270 46808 47419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 47437 48312 gene locus_tag LOCUS_23280 gene ybgF 47437 48312 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943188.1 protein_id gnl|my_center|LOCUS_23280 48835 48302 gene locus_tag LOCUS_23290 48835 48302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 49564 48953 gene locus_tag LOCUS_23300 49564 48953 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546603.1 protein_id gnl|my_center|LOCUS_23300 49574 50332 gene locus_tag LOCUS_23310 49574 50332 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122046.1 protein_id gnl|my_center|LOCUS_23310 51330 50662 gene locus_tag LOCUS_23320 51330 50662 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403266.1 protein_id gnl|my_center|LOCUS_23320 51795 51358 gene locus_tag LOCUS_23330 51795 51358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 53636 51861 gene locus_tag LOCUS_23340 53636 51861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 55260 53653 gene locus_tag LOCUS_23350 55260 53653 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_23350 56032 55265 gene locus_tag LOCUS_23360 56032 55265 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838670.1 protein_id gnl|my_center|LOCUS_23360 57021 56032 gene locus_tag LOCUS_23370 57021 56032 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_23370 57127 59268 gene locus_tag LOCUS_23380 57127 59268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 59390 59887 gene locus_tag LOCUS_23390 59390 59887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 60277 61530 gene locus_tag LOCUS_23400 60277 61530 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064432.1 protein_id gnl|my_center|LOCUS_23400 61576 62610 gene locus_tag LOCUS_23410 61576 62610 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966592.1 protein_id gnl|my_center|LOCUS_23410 62607 63041 gene locus_tag LOCUS_23420 62607 63041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 63065 64135 gene locus_tag LOCUS_23430 63065 64135 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965044.1 protein_id gnl|my_center|LOCUS_23430 64138 64935 gene locus_tag LOCUS_23440 64138 64935 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083244.1 protein_id gnl|my_center|LOCUS_23440 64932 65810 gene locus_tag LOCUS_23450 64932 65810 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083243.1 protein_id gnl|my_center|LOCUS_23450 65891 66559 gene locus_tag LOCUS_23460 65891 66559 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808119.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence024 498 268 gene locus_tag LOCUS_23470 498 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 705 1958 gene locus_tag LOCUS_23480 705 1958 CDS product EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121732.1 protein_id gnl|my_center|LOCUS_23480 1963 3603 gene locus_tag LOCUS_23490 1963 3603 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942126.1 protein_id gnl|my_center|LOCUS_23490 3603 5894 gene locus_tag LOCUS_23500 3603 5894 CDS product 1-deoxy-D-xylulose-5-phosphate synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258659.1 protein_id gnl|my_center|LOCUS_23500 5968 6936 gene locus_tag LOCUS_23510 5968 6936 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228360.1 protein_id gnl|my_center|LOCUS_23510 7581 6955 gene locus_tag LOCUS_23520 7581 6955 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776788.1 protein_id gnl|my_center|LOCUS_23520 7744 8694 gene locus_tag LOCUS_23530 7744 8694 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242543.1 protein_id gnl|my_center|LOCUS_23530 8714 10072 gene locus_tag LOCUS_23540 8714 10072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 10069 12045 gene locus_tag LOCUS_23550 10069 12045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 13443 12112 gene locus_tag LOCUS_23560 13443 12112 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385794.1 protein_id gnl|my_center|LOCUS_23560 14464 13628 gene locus_tag LOCUS_23570 14464 13628 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528258.1 protein_id gnl|my_center|LOCUS_23570 15220 14477 gene locus_tag LOCUS_23580 15220 14477 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942660.1 protein_id gnl|my_center|LOCUS_23580 16598 15237 gene locus_tag LOCUS_23590 16598 15237 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532304.1 protein_id gnl|my_center|LOCUS_23590 18364 16811 gene locus_tag LOCUS_23600 gene hutH 18364 16811 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143059.1 protein_id gnl|my_center|LOCUS_23600 19596 18352 gene locus_tag LOCUS_23610 gene hutI 19596 18352 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869661.1 protein_id gnl|my_center|LOCUS_23610 20120 19593 gene locus_tag LOCUS_23620 20120 19593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 21709 20135 gene locus_tag LOCUS_23630 gene hutU 21709 20135 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256864.1 protein_id gnl|my_center|LOCUS_23630 22347 21811 gene locus_tag LOCUS_23640 22347 21811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 22383 24257 gene locus_tag LOCUS_23650 22383 24257 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090647.1 protein_id gnl|my_center|LOCUS_23650 24265 25242 gene locus_tag LOCUS_23660 24265 25242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 25741 25304 gene locus_tag LOCUS_23670 25741 25304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 26677 25769 gene locus_tag LOCUS_23680 26677 25769 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202085.1 protein_id gnl|my_center|LOCUS_23680 27616 26810 gene locus_tag LOCUS_23690 27616 26810 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258270.1 protein_id gnl|my_center|LOCUS_23690 28064 27660 gene locus_tag LOCUS_23700 28064 27660 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529139.1 protein_id gnl|my_center|LOCUS_23700 28302 28075 gene locus_tag LOCUS_23710 28302 28075 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244189.1 protein_id gnl|my_center|LOCUS_23710 28667 29773 gene locus_tag LOCUS_23720 28667 29773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 29992 34047 gene locus_tag LOCUS_23730 29992 34047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 34268 39199 gene locus_tag LOCUS_23740 34268 39199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 39196 39882 gene locus_tag LOCUS_23750 39196 39882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 39902 43729 gene locus_tag LOCUS_23760 39902 43729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 43726 44043 gene locus_tag LOCUS_23770 43726 44043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 44146 46155 gene locus_tag LOCUS_23780 44146 46155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 46155 46712 gene locus_tag LOCUS_23790 46155 46712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 48198 46960 gene locus_tag LOCUS_23800 48198 46960 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921673.1 protein_id gnl|my_center|LOCUS_23800 48715 48548 gene locus_tag LOCUS_23810 48715 48548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 48795 49163 gene locus_tag LOCUS_23820 48795 49163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 49112 49744 gene locus_tag LOCUS_23830 49112 49744 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890562.1 protein_id gnl|my_center|LOCUS_23830 49880 50593 gene locus_tag LOCUS_23840 49880 50593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 50655 50852 gene locus_tag LOCUS_23850 50655 50852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 50828 51142 gene locus_tag LOCUS_23860 50828 51142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 51628 51203 gene locus_tag LOCUS_23870 51628 51203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 51814 54468 gene locus_tag LOCUS_23880 51814 54468 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056205.1 protein_id gnl|my_center|LOCUS_23880 54495 55007 gene locus_tag LOCUS_23890 54495 55007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 55200 55895 gene locus_tag LOCUS_23900 55200 55895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23900 55892 56950 gene locus_tag LOCUS_23910 55892 56950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23910 57026 57259 gene locus_tag LOCUS_23920 57026 57259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 57256 57492 gene locus_tag LOCUS_23930 57256 57492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 57789 58103 gene locus_tag LOCUS_23940 57789 58103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 58100 58807 gene locus_tag LOCUS_23950 58100 58807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 58804 59562 gene locus_tag LOCUS_23960 gene chbG 58804 59562 CDS product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097018.1 protein_id gnl|my_center|LOCUS_23960 59573 60520 gene locus_tag LOCUS_23970 59573 60520 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091306554.1 protein_id gnl|my_center|LOCUS_23970 60517 61566 gene locus_tag LOCUS_23980 60517 61566 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140737.1 protein_id gnl|my_center|LOCUS_23980 61667 63235 gene locus_tag LOCUS_23990 61667 63235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 >Feature sequence025 210 1517 gene locus_tag LOCUS_24000 gene nirJ2 210 1517 CDS product putative heme d1 biosynthesis radical SAM protein NirJ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392759.1 protein_id gnl|my_center|LOCUS_24000 1548 3356 gene locus_tag LOCUS_24010 1548 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 3356 4186 gene locus_tag LOCUS_24020 3356 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 4191 6446 gene locus_tag LOCUS_24030 4191 6446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 6446 7153 gene locus_tag LOCUS_24040 6446 7153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 7243 8139 gene locus_tag LOCUS_24050 7243 8139 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582908.1 protein_id gnl|my_center|LOCUS_24050 8136 8561 gene locus_tag LOCUS_24060 8136 8561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 8548 9756 gene locus_tag LOCUS_24070 8548 9756 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965994.1 protein_id gnl|my_center|LOCUS_24070 11331 9784 gene locus_tag LOCUS_24080 11331 9784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 13366 11582 gene locus_tag LOCUS_24090 13366 11582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 14438 13431 gene locus_tag LOCUS_24100 14438 13431 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941278.1 protein_id gnl|my_center|LOCUS_24100 15406 14435 gene locus_tag LOCUS_24110 15406 14435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 16468 15419 gene locus_tag LOCUS_24120 16468 15419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 17663 16473 gene locus_tag LOCUS_24130 17663 16473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 19172 17676 gene locus_tag LOCUS_24140 19172 17676 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943836.1 protein_id gnl|my_center|LOCUS_24140 20503 19169 gene locus_tag LOCUS_24150 20503 19169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 21942 20518 gene locus_tag LOCUS_24160 21942 20518 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943836.1 protein_id gnl|my_center|LOCUS_24160 22228 22821 gene locus_tag LOCUS_24170 22228 22821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 25230 22846 gene locus_tag LOCUS_24180 25230 22846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 25990 25268 gene locus_tag LOCUS_24190 25990 25268 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393713.1 protein_id gnl|my_center|LOCUS_24190 26736 28007 gene locus_tag LOCUS_24200 26736 28007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 28188 28922 gene locus_tag LOCUS_24210 28188 28922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 28919 30115 gene locus_tag LOCUS_24220 28919 30115 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_24220 30361 30612 gene locus_tag LOCUS_24230 30361 30612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 30614 31633 gene locus_tag LOCUS_24240 30614 31633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 32121 31624 gene locus_tag LOCUS_24250 32121 31624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 34284 32260 gene locus_tag LOCUS_24260 34284 32260 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943843.1 protein_id gnl|my_center|LOCUS_24260 35276 34281 gene locus_tag LOCUS_24270 35276 34281 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943842.1 protein_id gnl|my_center|LOCUS_24270 37081 35297 gene locus_tag LOCUS_24280 37081 35297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 38258 37446 gene locus_tag LOCUS_24290 38258 37446 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941282.1 protein_id gnl|my_center|LOCUS_24290 39334 38270 gene locus_tag LOCUS_24300 39334 38270 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942432.1 protein_id gnl|my_center|LOCUS_24300 40886 39495 gene locus_tag LOCUS_24310 40886 39495 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_24310 42126 40861 gene locus_tag LOCUS_24320 42126 40861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 42791 42123 gene locus_tag LOCUS_24330 42791 42123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 43415 44365 gene locus_tag LOCUS_24340 43415 44365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 44302 45000 gene locus_tag LOCUS_24350 44302 45000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 44997 45833 gene locus_tag LOCUS_24360 44997 45833 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085650.1 protein_id gnl|my_center|LOCUS_24360 46030 46515 gene locus_tag LOCUS_24370 46030 46515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 46512 47039 gene locus_tag LOCUS_24380 46512 47039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 47074 47589 gene locus_tag LOCUS_24390 47074 47589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 47624 48025 gene locus_tag LOCUS_24400 47624 48025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 48044 48565 gene locus_tag LOCUS_24410 48044 48565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 48864 48496 gene locus_tag LOCUS_24420 48864 48496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 50053 48875 gene locus_tag LOCUS_24430 50053 48875 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258129.1 protein_id gnl|my_center|LOCUS_24430 50624 50403 gene locus_tag LOCUS_24440 50624 50403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 50643 50828 gene locus_tag LOCUS_24450 50643 50828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 50828 51928 gene locus_tag LOCUS_24460 50828 51928 CDS product aliphatic nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877947.1 protein_id gnl|my_center|LOCUS_24460 51976 52485 gene locus_tag LOCUS_24470 51976 52485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 52565 53773 gene locus_tag LOCUS_24480 52565 53773 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_24480 54065 53977 gene locus_tag LOCUS_t00250 54065 53977 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 54558 57953 gene locus_tag LOCUS_24490 54558 57953 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087804.1 protein_id gnl|my_center|LOCUS_24490 58023 58098 gene locus_tag LOCUS_t00260 58023 58098 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 58271 58501 gene locus_tag LOCUS_24500 58271 58501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 58530 58946 gene locus_tag LOCUS_24510 58530 58946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 60912 58990 gene locus_tag LOCUS_24520 60912 58990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 61214 60984 gene locus_tag LOCUS_24530 61214 60984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 61295 61540 gene locus_tag LOCUS_24540 61295 61540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 63640 61709 gene locus_tag LOCUS_24550 63640 61709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 64467 63637 gene locus_tag LOCUS_24560 64467 63637 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943921.1 protein_id gnl|my_center|LOCUS_24560 <65320 64526 gene locus_tag LOCUS_24570 <65320 64526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024118841.1:ATP-binding protein >Feature sequence026 1686 1198 gene locus_tag LOCUS_24580 1686 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 2439 1825 gene locus_tag LOCUS_24590 2439 1825 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967149.1 protein_id gnl|my_center|LOCUS_24590 2578 3492 gene locus_tag LOCUS_24600 2578 3492 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229093.1 protein_id gnl|my_center|LOCUS_24600 3489 4220 gene locus_tag LOCUS_24610 gene kdsB 3489 4220 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_24610 4217 5407 gene locus_tag LOCUS_24620 4217 5407 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532846.1 protein_id gnl|my_center|LOCUS_24620 5404 6798 gene locus_tag LOCUS_24630 5404 6798 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969494.1 protein_id gnl|my_center|LOCUS_24630 6988 8355 gene locus_tag LOCUS_24640 6988 8355 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529762.1 protein_id gnl|my_center|LOCUS_24640 8382 9305 gene locus_tag LOCUS_24650 8382 9305 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170961.1 protein_id gnl|my_center|LOCUS_24650 9413 10264 gene locus_tag LOCUS_24660 9413 10264 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529760.1 protein_id gnl|my_center|LOCUS_24660 10376 10705 gene locus_tag LOCUS_24670 10376 10705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24670 10748 11503 gene locus_tag LOCUS_24680 10748 11503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24680 11599 12150 gene locus_tag LOCUS_24690 11599 12150 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243030.1 protein_id gnl|my_center|LOCUS_24690 12147 13466 gene locus_tag LOCUS_24700 12147 13466 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243031.1 protein_id gnl|my_center|LOCUS_24700 13557 14651 gene locus_tag LOCUS_24710 gene ugpC 13557 14651 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_24710 14656 15840 gene locus_tag LOCUS_24720 14656 15840 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088976.1 protein_id gnl|my_center|LOCUS_24720 16625 15846 gene locus_tag LOCUS_24730 16625 15846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 16925 17728 gene locus_tag LOCUS_24740 16925 17728 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_24740 17728 18675 gene locus_tag LOCUS_24750 17728 18675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 18662 19393 gene locus_tag LOCUS_24760 18662 19393 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086608.1 protein_id gnl|my_center|LOCUS_24760 19395 20126 gene locus_tag LOCUS_24770 19395 20126 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039588.1 protein_id gnl|my_center|LOCUS_24770 20141 20503 gene locus_tag LOCUS_24780 20141 20503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 20556 22163 gene locus_tag LOCUS_24790 20556 22163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 23057 22197 gene locus_tag LOCUS_24800 23057 22197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 24716 23166 gene locus_tag LOCUS_24810 24716 23166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 25048 24713 gene locus_tag LOCUS_24820 25048 24713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 26700 25048 gene locus_tag LOCUS_24830 26700 25048 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878476.1 protein_id gnl|my_center|LOCUS_24830 27243 26887 gene locus_tag LOCUS_24840 27243 26887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 28593 27277 gene locus_tag LOCUS_24850 28593 27277 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878474.1 protein_id gnl|my_center|LOCUS_24850 29930 28590 gene locus_tag LOCUS_24860 29930 28590 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878473.1 protein_id gnl|my_center|LOCUS_24860 30186 31400 gene locus_tag LOCUS_24870 30186 31400 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101996.1 protein_id gnl|my_center|LOCUS_24870 31481 32365 gene locus_tag LOCUS_24880 31481 32365 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941421.1 protein_id gnl|my_center|LOCUS_24880 32373 33287 gene locus_tag LOCUS_24890 32373 33287 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807584.1 protein_id gnl|my_center|LOCUS_24890 33274 34023 gene locus_tag LOCUS_24900 33274 34023 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618819.1 protein_id gnl|my_center|LOCUS_24900 34027 34746 gene locus_tag LOCUS_24910 34027 34746 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_24910 34754 35668 gene locus_tag LOCUS_24920 gene livH 34754 35668 CDS product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099131.1 protein_id gnl|my_center|LOCUS_24920 35593 36564 gene locus_tag LOCUS_24930 35593 36564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 36561 37250 gene locus_tag LOCUS_24940 36561 37250 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384686.1 protein_id gnl|my_center|LOCUS_24940 37247 37609 gene locus_tag LOCUS_24950 37247 37609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 37795 39024 gene locus_tag LOCUS_24960 37795 39024 CDS product 3-hydroxy-3-methylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814048.1 protein_id gnl|my_center|LOCUS_24960 39021 39950 gene locus_tag LOCUS_24970 39021 39950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 39964 41166 gene locus_tag LOCUS_24980 39964 41166 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227721.1 protein_id gnl|my_center|LOCUS_24980 41185 42012 gene locus_tag LOCUS_24990 41185 42012 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941846.1 protein_id gnl|my_center|LOCUS_24990 42091 43329 gene locus_tag LOCUS_25000 42091 43329 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810537.1 protein_id gnl|my_center|LOCUS_25000 43335 44708 gene locus_tag LOCUS_25010 43335 44708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 44711 44995 gene locus_tag LOCUS_25020 44711 44995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 45006 46352 gene locus_tag LOCUS_25030 gene mgtE 45006 46352 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088007.1 protein_id gnl|my_center|LOCUS_25030 46468 47097 gene locus_tag LOCUS_25040 46468 47097 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444207.1 protein_id gnl|my_center|LOCUS_25040 47123 48145 gene locus_tag LOCUS_25050 47123 48145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 49001 48120 gene locus_tag LOCUS_25060 49001 48120 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626171.1 protein_id gnl|my_center|LOCUS_25060 50452 48998 gene locus_tag LOCUS_25070 gene atoC 50452 48998 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389139.1 protein_id gnl|my_center|LOCUS_25070 51937 50465 gene locus_tag LOCUS_25080 51937 50465 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940757.1 protein_id gnl|my_center|LOCUS_25080 53387 51960 gene locus_tag LOCUS_25090 gene tilS 53387 51960 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391652.1 protein_id gnl|my_center|LOCUS_25090 54330 53629 gene locus_tag LOCUS_25100 54330 53629 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227680.1 protein_id gnl|my_center|LOCUS_25100 54677 54351 gene locus_tag LOCUS_25110 gene erpA 54677 54351 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814883.1 protein_id gnl|my_center|LOCUS_25110 55493 54777 gene locus_tag LOCUS_25120 55493 54777 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172835.1 protein_id gnl|my_center|LOCUS_25120 57096 55519 gene locus_tag LOCUS_25130 57096 55519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 57517 57101 gene locus_tag LOCUS_25140 57517 57101 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405497.1 protein_id gnl|my_center|LOCUS_25140 57927 57514 gene locus_tag LOCUS_25150 57927 57514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25150 58898 57924 gene locus_tag LOCUS_25160 58898 57924 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257672.1 protein_id gnl|my_center|LOCUS_25160 59795 59010 gene locus_tag LOCUS_25170 59795 59010 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085567.1 protein_id gnl|my_center|LOCUS_25170 60985 59792 gene locus_tag LOCUS_25180 60985 59792 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966992.1 protein_id gnl|my_center|LOCUS_25180 61128 61053 gene locus_tag LOCUS_t00270 61128 61053 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence027 1606 203 gene locus_tag LOCUS_25190 gene leuC 1606 203 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920779.1 protein_id gnl|my_center|LOCUS_25190 2159 1665 gene locus_tag LOCUS_25200 2159 1665 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090633.1 protein_id gnl|my_center|LOCUS_25200 2929 2210 gene locus_tag LOCUS_25210 2929 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 3458 2934 gene locus_tag LOCUS_25220 3458 2934 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_25220 4029 3481 gene locus_tag LOCUS_25230 gene folK 4029 3481 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173770.1 protein_id gnl|my_center|LOCUS_25230 4319 4032 gene locus_tag LOCUS_25240 gene folB 4319 4032 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809748.1 protein_id gnl|my_center|LOCUS_25240 5572 4391 gene locus_tag LOCUS_25250 5572 4391 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_25250 6342 5569 gene locus_tag LOCUS_25260 6342 5569 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393001.1 protein_id gnl|my_center|LOCUS_25260 7142 6339 gene locus_tag LOCUS_25270 gene dapB 7142 6339 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_25270 8043 7153 gene locus_tag LOCUS_25280 gene dapA 8043 7153 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939154.1 protein_id gnl|my_center|LOCUS_25280 8211 9473 gene locus_tag LOCUS_25290 8211 9473 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190627.1 protein_id gnl|my_center|LOCUS_25290 10604 9525 gene locus_tag LOCUS_25300 10604 9525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 12001 10601 gene locus_tag LOCUS_25310 gene argH 12001 10601 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546455.1 protein_id gnl|my_center|LOCUS_25310 12752 12039 gene locus_tag LOCUS_25320 12752 12039 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_25320 13892 12840 gene locus_tag LOCUS_25330 gene mltG 13892 12840 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393139.1 protein_id gnl|my_center|LOCUS_25330 14038 15039 gene locus_tag LOCUS_25340 14038 15039 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_25340 17503 14936 gene locus_tag LOCUS_25350 17503 14936 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942301.1 protein_id gnl|my_center|LOCUS_25350 17963 17505 gene locus_tag LOCUS_25360 17963 17505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 18235 18032 gene locus_tag LOCUS_25370 18235 18032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 19639 18503 gene locus_tag LOCUS_25380 19639 18503 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728652.1 protein_id gnl|my_center|LOCUS_25380 20964 19735 gene locus_tag LOCUS_25390 20964 19735 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545682.1 protein_id gnl|my_center|LOCUS_25390 21693 21031 gene locus_tag LOCUS_25400 21693 21031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 22048 21695 gene locus_tag LOCUS_25410 22048 21695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 22546 22049 gene locus_tag LOCUS_25420 22546 22049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 23130 22543 gene locus_tag LOCUS_25430 23130 22543 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_25430 23594 23217 gene locus_tag LOCUS_25440 23594 23217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 24729 23731 gene locus_tag LOCUS_25450 24729 23731 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256438.1 protein_id gnl|my_center|LOCUS_25450 25802 24738 gene locus_tag LOCUS_25460 gene thrC 25802 24738 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880238.1 protein_id gnl|my_center|LOCUS_25460 27225 25924 gene locus_tag LOCUS_25470 27225 25924 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_25470 28533 27334 gene locus_tag LOCUS_25480 gene alaC 28533 27334 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546347.1 protein_id gnl|my_center|LOCUS_25480 28786 29682 gene locus_tag LOCUS_25490 28786 29682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 30560 29748 gene locus_tag LOCUS_25500 30560 29748 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869263.1 protein_id gnl|my_center|LOCUS_25500 30541 30726 gene locus_tag LOCUS_25510 30541 30726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 31664 30723 gene locus_tag LOCUS_25520 31664 30723 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_25520 32670 31678 gene locus_tag LOCUS_25530 32670 31678 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084174.1 protein_id gnl|my_center|LOCUS_25530 33789 32752 gene locus_tag LOCUS_25540 gene ltaE 33789 32752 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258446.1 protein_id gnl|my_center|LOCUS_25540 34582 33794 gene locus_tag LOCUS_25550 34582 33794 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383206.1 protein_id gnl|my_center|LOCUS_25550 34663 35913 gene locus_tag LOCUS_25560 34663 35913 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_25560 35933 36913 gene locus_tag LOCUS_25570 35933 36913 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528641.1 protein_id gnl|my_center|LOCUS_25570 36923 38812 gene locus_tag LOCUS_25580 36923 38812 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957058.1 protein_id gnl|my_center|LOCUS_25580 38975 39553 gene locus_tag LOCUS_25590 38975 39553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25590 40087 39569 gene locus_tag LOCUS_25600 40087 39569 CDS product arsinothricin resistance N-acetyltransferase ArsN1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258843.1 protein_id gnl|my_center|LOCUS_25600 41067 40084 gene locus_tag LOCUS_25610 41067 40084 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086447.1 protein_id gnl|my_center|LOCUS_25610 41233 41970 gene locus_tag LOCUS_25620 41233 41970 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582685.1 protein_id gnl|my_center|LOCUS_25620 41992 42972 gene locus_tag LOCUS_25630 41992 42972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 43024 43812 gene locus_tag LOCUS_25640 43024 43812 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886407.1 protein_id gnl|my_center|LOCUS_25640 43817 44692 gene locus_tag LOCUS_25650 gene pxpB 43817 44692 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869461.1 protein_id gnl|my_center|LOCUS_25650 44653 45627 gene locus_tag LOCUS_25660 44653 45627 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896290.1 protein_id gnl|my_center|LOCUS_25660 45638 46963 gene locus_tag LOCUS_25670 45638 46963 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394859.1 protein_id gnl|my_center|LOCUS_25670 47001 47837 gene locus_tag LOCUS_25680 47001 47837 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_25680 48681 47908 gene locus_tag LOCUS_25690 48681 47908 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_25690 48857 49630 gene locus_tag LOCUS_25700 48857 49630 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868110.1 protein_id gnl|my_center|LOCUS_25700 49714 50148 gene locus_tag LOCUS_25710 49714 50148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 50296 51414 gene locus_tag LOCUS_25720 gene gcvT 50296 51414 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_25720 51440 51832 gene locus_tag LOCUS_25730 gene gcvH 51440 51832 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393442.1 protein_id gnl|my_center|LOCUS_25730 51855 53198 gene locus_tag LOCUS_25740 gene gcvPA 51855 53198 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393441.1 protein_id gnl|my_center|LOCUS_25740 53427 54611 gene locus_tag LOCUS_25750 53427 54611 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941060.1 protein_id gnl|my_center|LOCUS_25750 54656 57880 gene locus_tag LOCUS_25760 54656 57880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 58532 59494 gene locus_tag LOCUS_25770 58532 59494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 60511 59579 gene locus_tag LOCUS_25780 gene cysK 60511 59579 CDS product O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899275.1 protein_id gnl|my_center|LOCUS_25780 61738 60749 gene locus_tag LOCUS_25790 61738 60749 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869565.1 protein_id gnl|my_center|LOCUS_25790 61955 61770 gene locus_tag LOCUS_25800 61955 61770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 62168 63247 gene locus_tag LOCUS_25810 62168 63247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 >Feature sequence028 1605 871 gene locus_tag LOCUS_25820 1605 871 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259472.1 protein_id gnl|my_center|LOCUS_25820 2389 1598 gene locus_tag LOCUS_25830 2389 1598 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149338.1 protein_id gnl|my_center|LOCUS_25830 3285 2449 gene locus_tag LOCUS_25840 3285 2449 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787928.1 protein_id gnl|my_center|LOCUS_25840 4483 3299 gene locus_tag LOCUS_25850 4483 3299 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965179.1 protein_id gnl|my_center|LOCUS_25850 5690 4596 gene locus_tag LOCUS_25860 5690 4596 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259127.1 protein_id gnl|my_center|LOCUS_25860 6805 5702 gene locus_tag LOCUS_25870 6805 5702 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942246.1 protein_id gnl|my_center|LOCUS_25870 8093 6810 gene locus_tag LOCUS_25880 8093 6810 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246425.1 protein_id gnl|my_center|LOCUS_25880 8131 9270 gene locus_tag LOCUS_25890 8131 9270 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931784.1 protein_id gnl|my_center|LOCUS_25890 10220 9285 gene locus_tag LOCUS_25900 gene rbsK 10220 9285 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526901.1 protein_id gnl|my_center|LOCUS_25900 10638 10255 gene locus_tag LOCUS_25910 10638 10255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 10841 10635 gene locus_tag LOCUS_25920 10841 10635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 11940 10960 gene locus_tag LOCUS_25930 11940 10960 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337842.1 protein_id gnl|my_center|LOCUS_25930 12060 12230 gene locus_tag LOCUS_25940 12060 12230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 13488 12220 gene locus_tag LOCUS_25950 13488 12220 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 protein_id gnl|my_center|LOCUS_25950 13749 14162 gene locus_tag LOCUS_25960 13749 14162 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372681.1 protein_id gnl|my_center|LOCUS_25960 14179 15729 gene locus_tag LOCUS_25970 14179 15729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 15735 20132 gene locus_tag LOCUS_25980 15735 20132 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037460.1 protein_id gnl|my_center|LOCUS_25980 20367 20756 gene locus_tag LOCUS_25990 20367 20756 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031578.1 protein_id gnl|my_center|LOCUS_25990 21561 20824 gene locus_tag LOCUS_26000 21561 20824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26000 22038 21640 gene locus_tag LOCUS_26010 22038 21640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26010 22230 22352 gene locus_tag LOCUS_26020 22230 22352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 22404 22856 gene locus_tag LOCUS_26030 22404 22856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 22856 24283 gene locus_tag LOCUS_26040 22856 24283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 24280 25197 gene locus_tag LOCUS_26050 24280 25197 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223881.1 protein_id gnl|my_center|LOCUS_26050 25179 25892 gene locus_tag LOCUS_26060 25179 25892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 25892 26137 gene locus_tag LOCUS_26070 25892 26137 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973433.1 protein_id gnl|my_center|LOCUS_26070 26692 27885 gene locus_tag LOCUS_26080 26692 27885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 27998 28639 gene locus_tag LOCUS_26090 27998 28639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 28924 28673 gene locus_tag LOCUS_26100 28924 28673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 29547 30815 gene locus_tag LOCUS_26110 29547 30815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 30862 32241 gene locus_tag LOCUS_26120 30862 32241 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727913.1 protein_id gnl|my_center|LOCUS_26120 32313 33182 gene locus_tag LOCUS_26130 32313 33182 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389016.1 protein_id gnl|my_center|LOCUS_26130 33182 34018 gene locus_tag LOCUS_26140 33182 34018 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066677.1 protein_id gnl|my_center|LOCUS_26140 34173 34448 gene locus_tag LOCUS_26150 34173 34448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 35802 34519 gene locus_tag LOCUS_26160 35802 34519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 36000 36209 gene locus_tag LOCUS_26170 36000 36209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 36285 36644 gene locus_tag LOCUS_26180 36285 36644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 37364 36861 gene locus_tag LOCUS_26190 gene phnB 37364 36861 CDS product Dot/Icm type IV secretion system effector PhnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957793.1 protein_id gnl|my_center|LOCUS_26190 37279 37590 gene locus_tag LOCUS_26200 37279 37590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 37587 38570 gene locus_tag LOCUS_26210 37587 38570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 38629 39234 gene locus_tag LOCUS_26220 38629 39234 CDS product DUF2459 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404966.1 protein_id gnl|my_center|LOCUS_26220 39497 39733 gene locus_tag LOCUS_26230 39497 39733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 40229 40080 gene locus_tag LOCUS_26240 40229 40080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 40465 40587 gene locus_tag LOCUS_26250 40465 40587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 40584 41525 gene locus_tag LOCUS_26260 40584 41525 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258742.1 protein_id gnl|my_center|LOCUS_26260 42630 41557 gene locus_tag LOCUS_26270 42630 41557 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339249.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26270 44935 42917 gene locus_tag LOCUS_26280 44935 42917 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976072.1 protein_id gnl|my_center|LOCUS_26280 45606 44932 gene locus_tag LOCUS_26290 45606 44932 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529993.1 protein_id gnl|my_center|LOCUS_26290 46827 45673 gene locus_tag LOCUS_26300 46827 45673 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969663.1 protein_id gnl|my_center|LOCUS_26300 49925 48153 gene locus_tag LOCUS_26310 49925 48153 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698821.1 protein_id gnl|my_center|LOCUS_26310 50449 49922 gene locus_tag LOCUS_26320 50449 49922 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939219.1 protein_id gnl|my_center|LOCUS_26320 50630 50466 gene locus_tag LOCUS_26330 50630 50466 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013190.1 protein_id gnl|my_center|LOCUS_26330 51447 50740 gene locus_tag LOCUS_26340 51447 50740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 52589 51483 gene locus_tag LOCUS_26350 gene apbC 52589 51483 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257064.1 protein_id gnl|my_center|LOCUS_26350 52707 53216 gene locus_tag LOCUS_26360 52707 53216 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256436.1 protein_id gnl|my_center|LOCUS_26360 53216 54295 gene locus_tag LOCUS_26370 53216 54295 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942902.1 protein_id gnl|my_center|LOCUS_26370 54295 55410 gene locus_tag LOCUS_26380 54295 55410 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925739.1 protein_id gnl|my_center|LOCUS_26380 55407 57164 gene locus_tag LOCUS_26390 gene msbA 55407 57164 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_26390 57864 57334 gene locus_tag LOCUS_26400 57864 57334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 59420 58110 gene locus_tag LOCUS_26410 59420 58110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 >Feature sequence029 1069 677 gene locus_tag LOCUS_26420 1069 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 2232 1066 gene locus_tag LOCUS_26430 2232 1066 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061151682.1 protein_id gnl|my_center|LOCUS_26430 3790 2243 gene locus_tag LOCUS_26440 3790 2243 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729759.1 protein_id gnl|my_center|LOCUS_26440 4795 3848 gene locus_tag LOCUS_26450 4795 3848 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066663.1 protein_id gnl|my_center|LOCUS_26450 5673 4792 gene locus_tag LOCUS_26460 5673 4792 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902562.1 protein_id gnl|my_center|LOCUS_26460 5996 5670 gene locus_tag LOCUS_26470 5996 5670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389227.1 protein_id gnl|my_center|LOCUS_26470 7361 6003 gene locus_tag LOCUS_26480 7361 6003 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389228.1 protein_id gnl|my_center|LOCUS_26480 8701 7343 gene locus_tag LOCUS_26490 8701 7343 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665507.1 protein_id gnl|my_center|LOCUS_26490 9849 8695 gene locus_tag LOCUS_26500 9849 8695 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227992.1 protein_id gnl|my_center|LOCUS_26500 11390 9846 gene locus_tag LOCUS_26510 11390 9846 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978555.1 protein_id gnl|my_center|LOCUS_26510 12175 11369 gene locus_tag LOCUS_26520 12175 11369 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312277.1 protein_id gnl|my_center|LOCUS_26520 12407 13453 gene locus_tag LOCUS_26530 12407 13453 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 protein_id gnl|my_center|LOCUS_26530 13507 13986 gene locus_tag LOCUS_26540 13507 13986 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090564.1 protein_id gnl|my_center|LOCUS_26540 13993 15294 gene locus_tag LOCUS_26550 13993 15294 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 protein_id gnl|my_center|LOCUS_26550 16717 15494 gene locus_tag LOCUS_26560 16717 15494 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810358.1 protein_id gnl|my_center|LOCUS_26560 17161 16883 gene locus_tag LOCUS_26570 17161 16883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 18153 17185 gene locus_tag LOCUS_26580 18153 17185 CDS product kelch repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143161.1 protein_id gnl|my_center|LOCUS_26580 18321 20183 gene locus_tag LOCUS_26590 18321 20183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 20495 20193 gene locus_tag LOCUS_26600 20495 20193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 20806 20492 gene locus_tag LOCUS_26610 20806 20492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 21197 20829 gene locus_tag LOCUS_26620 21197 20829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 21695 21216 gene locus_tag LOCUS_26630 21695 21216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 22084 21692 gene locus_tag LOCUS_26640 22084 21692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 22442 22068 gene locus_tag LOCUS_26650 22442 22068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 22902 24194 gene locus_tag LOCUS_26660 22902 24194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 24191 24976 gene locus_tag LOCUS_26670 gene istB 24191 24976 CDS product IS21-like element ISMt2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418125.1 protein_id gnl|my_center|LOCUS_26670 27389 26049 gene locus_tag LOCUS_26680 27389 26049 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979128.1 protein_id gnl|my_center|LOCUS_26680 28078 27413 gene locus_tag LOCUS_26690 28078 27413 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919054.1 protein_id gnl|my_center|LOCUS_26690 29114 28068 gene locus_tag LOCUS_26700 29114 28068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 29950 29111 gene locus_tag LOCUS_26710 29950 29111 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975129.1 protein_id gnl|my_center|LOCUS_26710 31343 29973 gene locus_tag LOCUS_26720 31343 29973 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064334.1 protein_id gnl|my_center|LOCUS_26720 32605 31340 gene locus_tag LOCUS_26730 gene preA 32605 31340 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338051.1 protein_id gnl|my_center|LOCUS_26730 33321 32650 gene locus_tag LOCUS_26740 33321 32650 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727452.1 protein_id gnl|my_center|LOCUS_26740 34685 33318 gene locus_tag LOCUS_26750 34685 33318 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392478.1 protein_id gnl|my_center|LOCUS_26750 35655 34699 gene locus_tag LOCUS_26760 35655 34699 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989564.1 protein_id gnl|my_center|LOCUS_26760 36556 35669 gene locus_tag LOCUS_26770 36556 35669 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_26770 37838 36606 gene locus_tag LOCUS_26780 37838 36606 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733127.1 protein_id gnl|my_center|LOCUS_26780 38489 38151 gene locus_tag LOCUS_26790 38489 38151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 39363 38908 gene locus_tag LOCUS_26800 39363 38908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 42048 39502 gene locus_tag LOCUS_26810 42048 39502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 42482 42084 gene locus_tag LOCUS_26820 42482 42084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26820 42922 42644 gene locus_tag LOCUS_26830 42922 42644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 44316 42919 gene locus_tag LOCUS_26840 44316 42919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 45584 44328 gene locus_tag LOCUS_26850 45584 44328 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729636.1 protein_id gnl|my_center|LOCUS_26850 45802 45581 gene locus_tag LOCUS_26860 45802 45581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 45984 45799 gene locus_tag LOCUS_26870 45984 45799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 46195 45986 gene locus_tag LOCUS_26880 46195 45986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 46491 46210 gene locus_tag LOCUS_26890 46491 46210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 46951 46586 gene locus_tag LOCUS_26900 46951 46586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 47484 47714 gene locus_tag LOCUS_26910 47484 47714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 48028 48246 gene locus_tag LOCUS_26920 48028 48246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 48243 49403 gene locus_tag LOCUS_26930 48243 49403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 49691 50341 gene locus_tag LOCUS_26940 49691 50341 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010208432.1 protein_id gnl|my_center|LOCUS_26940 50406 50750 gene locus_tag LOCUS_26950 50406 50750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 50958 50882 gene locus_tag LOCUS_t00280 50958 50882 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 51666 51884 gene locus_tag LOCUS_26960 51666 51884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 51899 52246 gene locus_tag LOCUS_26970 51899 52246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 53180 53572 gene locus_tag LOCUS_26980 53180 53572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 53575 54138 gene locus_tag LOCUS_26990 53575 54138 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921523.1 protein_id gnl|my_center|LOCUS_26990 55626 54511 gene locus_tag LOCUS_27000 55626 54511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 56006 55623 gene locus_tag LOCUS_27010 56006 55623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 55998 56357 gene locus_tag LOCUS_27020 55998 56357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 >Feature sequence030 68 1360 gene locus_tag LOCUS_27030 68 1360 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879269.1 protein_id gnl|my_center|LOCUS_27030 1570 2739 gene locus_tag LOCUS_27040 1570 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 2752 3525 gene locus_tag LOCUS_27050 2752 3525 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877797.1 protein_id gnl|my_center|LOCUS_27050 3552 4523 gene locus_tag LOCUS_27060 3552 4523 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877798.1 protein_id gnl|my_center|LOCUS_27060 4520 6613 gene locus_tag LOCUS_27070 4520 6613 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289484.1 protein_id gnl|my_center|LOCUS_27070 6622 7071 gene locus_tag LOCUS_27080 6622 7071 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880218.1 protein_id gnl|my_center|LOCUS_27080 7136 8416 gene locus_tag LOCUS_27090 7136 8416 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_27090 8426 9076 gene locus_tag LOCUS_27100 8426 9076 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102831.1 protein_id gnl|my_center|LOCUS_27100 9106 9558 gene locus_tag LOCUS_27110 9106 9558 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881076.1 protein_id gnl|my_center|LOCUS_27110 9678 10169 gene locus_tag LOCUS_27120 9678 10169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 10166 11065 gene locus_tag LOCUS_27130 10166 11065 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880219.1 protein_id gnl|my_center|LOCUS_27130 11233 12366 gene locus_tag LOCUS_27140 11233 12366 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391983.1 protein_id gnl|my_center|LOCUS_27140 12363 13316 gene locus_tag LOCUS_27150 12363 13316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 13351 14130 gene locus_tag LOCUS_27160 13351 14130 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194827.1 protein_id gnl|my_center|LOCUS_27160 14271 15272 gene locus_tag LOCUS_27170 14271 15272 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393325.1 protein_id gnl|my_center|LOCUS_27170 15432 16964 gene locus_tag LOCUS_27180 15432 16964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 17037 18350 gene locus_tag LOCUS_27190 gene sat 17037 18350 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_27190 18378 18851 gene locus_tag LOCUS_27200 gene aprB 18378 18851 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879165.1 protein_id gnl|my_center|LOCUS_27200 20133 20666 gene locus_tag LOCUS_27210 20133 20666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27210 20745 22064 gene locus_tag LOCUS_27220 20745 22064 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932547.1 protein_id gnl|my_center|LOCUS_27220 22061 24208 gene locus_tag LOCUS_27230 22061 24208 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545086.1 protein_id gnl|my_center|LOCUS_27230 24459 25778 gene locus_tag LOCUS_27240 gene qmoC 24459 25778 CDS product quinone-interacting membrane-bound oxidoreductase complex subunit QmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545389.1 protein_id gnl|my_center|LOCUS_27240 25820 25939 gene locus_tag LOCUS_27250 25820 25939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 25944 26324 gene locus_tag LOCUS_27260 25944 26324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 26348 27454 gene locus_tag LOCUS_27270 26348 27454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 27659 27477 gene locus_tag LOCUS_27280 27659 27477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 27678 28187 gene locus_tag LOCUS_27290 gene soxY 27678 28187 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119460.1 protein_id gnl|my_center|LOCUS_27290 28203 28532 gene locus_tag LOCUS_27300 gene soxZ 28203 28532 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881177.1 protein_id gnl|my_center|LOCUS_27300 28568 29881 gene locus_tag LOCUS_27310 28568 29881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 29886 31574 gene locus_tag LOCUS_27320 gene soxB 29886 31574 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086299.1 protein_id gnl|my_center|LOCUS_27320 31696 31917 gene locus_tag LOCUS_27330 31696 31917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 31957 32268 gene locus_tag LOCUS_27340 31957 32268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 32353 34107 gene locus_tag LOCUS_27350 32353 34107 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339081.1 protein_id gnl|my_center|LOCUS_27350 34122 35111 gene locus_tag LOCUS_27360 34122 35111 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339083.1 protein_id gnl|my_center|LOCUS_27360 35122 35868 gene locus_tag LOCUS_27370 35122 35868 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723689.1 protein_id gnl|my_center|LOCUS_27370 35865 36671 gene locus_tag LOCUS_27380 35865 36671 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927255.1 protein_id gnl|my_center|LOCUS_27380 37331 36717 gene locus_tag LOCUS_27390 37331 36717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 37666 37328 gene locus_tag LOCUS_27400 37666 37328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 37777 38085 gene locus_tag LOCUS_27410 37777 38085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 38076 38768 gene locus_tag LOCUS_27420 38076 38768 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723682.1 protein_id gnl|my_center|LOCUS_27420 38961 41207 gene locus_tag LOCUS_27430 38961 41207 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_27430 41492 42751 gene locus_tag LOCUS_27440 gene icd 41492 42751 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229433.1 protein_id gnl|my_center|LOCUS_27440 42754 43686 gene locus_tag LOCUS_27450 gene mdh 42754 43686 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325654.1 protein_id gnl|my_center|LOCUS_27450 43706 44548 gene locus_tag LOCUS_27460 43706 44548 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816933.1 protein_id gnl|my_center|LOCUS_27460 44664 45236 gene locus_tag LOCUS_27470 44664 45236 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881093.1 protein_id gnl|my_center|LOCUS_27470 45255 46034 gene locus_tag LOCUS_27480 45255 46034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_27480 46065 47867 gene locus_tag LOCUS_27490 46065 47867 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 protein_id gnl|my_center|LOCUS_27490 47867 48619 gene locus_tag LOCUS_27500 47867 48619 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726931.1 protein_id gnl|my_center|LOCUS_27500 48684 49850 gene locus_tag LOCUS_27510 gene sucC 48684 49850 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020785.1 protein_id gnl|my_center|LOCUS_27510 49847 50725 gene locus_tag LOCUS_27520 gene sucD 49847 50725 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115178.1 protein_id gnl|my_center|LOCUS_27520 50736 51161 gene locus_tag LOCUS_27530 gene ndk 50736 51161 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810689.1 protein_id gnl|my_center|LOCUS_27530 51239 51676 gene locus_tag LOCUS_27540 51239 51676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 51754 53406 gene locus_tag LOCUS_27550 51754 53406 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257757.1 protein_id gnl|my_center|LOCUS_27550 53628 54284 gene locus_tag LOCUS_27560 53628 54284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 54329 54514 gene locus_tag LOCUS_27570 54329 54514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 54616 54804 gene locus_tag LOCUS_27580 54616 54804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 >Feature sequence031 2997 2041 gene locus_tag LOCUS_27590 2997 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 3881 2997 gene locus_tag LOCUS_27600 3881 2997 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064390.1 protein_id gnl|my_center|LOCUS_27600 5123 3891 gene locus_tag LOCUS_27610 5123 3891 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064393.1 protein_id gnl|my_center|LOCUS_27610 6399 5164 gene locus_tag LOCUS_27620 6399 5164 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582831.1 protein_id gnl|my_center|LOCUS_27620 7054 6416 gene locus_tag LOCUS_27630 7054 6416 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_27630 8200 7370 gene locus_tag LOCUS_27640 8200 7370 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892776.1 protein_id gnl|my_center|LOCUS_27640 8978 8241 gene locus_tag LOCUS_27650 8978 8241 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058012.1 protein_id gnl|my_center|LOCUS_27650 10463 9114 gene locus_tag LOCUS_27660 10463 9114 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524110.1 protein_id gnl|my_center|LOCUS_27660 11335 10451 gene locus_tag LOCUS_27670 11335 10451 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393491.1 protein_id gnl|my_center|LOCUS_27670 11661 11326 gene locus_tag LOCUS_27680 11661 11326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 12776 11673 gene locus_tag LOCUS_27690 12776 11673 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530155.1 protein_id gnl|my_center|LOCUS_27690 14929 12773 gene locus_tag LOCUS_27700 gene lptD 14929 12773 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943003.1 protein_id gnl|my_center|LOCUS_27700 16291 14984 gene locus_tag LOCUS_27710 16291 14984 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227872.1 protein_id gnl|my_center|LOCUS_27710 17148 16288 gene locus_tag LOCUS_27720 gene accD 17148 16288 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_27720 18090 17179 gene locus_tag LOCUS_27730 gene trpA 18090 17179 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943006.1 protein_id gnl|my_center|LOCUS_27730 19378 18152 gene locus_tag LOCUS_27740 gene trpB 19378 18152 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943010.1 protein_id gnl|my_center|LOCUS_27740 19992 19375 gene locus_tag LOCUS_27750 19992 19375 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_27750 20789 19998 gene locus_tag LOCUS_27760 gene trpC 20789 19998 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392852.1 protein_id gnl|my_center|LOCUS_27760 22023 20806 gene locus_tag LOCUS_27770 22023 20806 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250627.1 protein_id gnl|my_center|LOCUS_27770 23072 22194 gene locus_tag LOCUS_27780 gene galU 23072 22194 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583975.1 protein_id gnl|my_center|LOCUS_27780 23985 23107 gene locus_tag LOCUS_27790 23985 23107 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978023.1 protein_id gnl|my_center|LOCUS_27790 25406 24006 gene locus_tag LOCUS_27800 25406 24006 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939391.1 protein_id gnl|my_center|LOCUS_27800 26850 25414 gene locus_tag LOCUS_27810 26850 25414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 28154 26868 gene locus_tag LOCUS_27820 28154 26868 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_27820 29889 28159 gene locus_tag LOCUS_27830 gene pilB 29889 28159 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_27830 30257 29886 gene locus_tag LOCUS_27840 30257 29886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 30361 30546 gene locus_tag LOCUS_27850 30361 30546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 32230 30524 gene locus_tag LOCUS_27860 32230 30524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 33943 32237 gene locus_tag LOCUS_27870 33943 32237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 34935 33952 gene locus_tag LOCUS_27880 34935 33952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 35579 34947 gene locus_tag LOCUS_27890 35579 34947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 36604 35576 gene locus_tag LOCUS_27900 gene pilM 36604 35576 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_27900 36942 37211 gene locus_tag LOCUS_27910 36942 37211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 37202 37855 gene locus_tag LOCUS_27920 37202 37855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 37852 38535 gene locus_tag LOCUS_27930 37852 38535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 38547 40439 gene locus_tag LOCUS_27940 38547 40439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 40822 40436 gene locus_tag LOCUS_27950 40822 40436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 40970 42805 gene locus_tag LOCUS_27960 gene cyaK 40970 42805 CDS product adenylate cyclase CyaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976264.1 protein_id gnl|my_center|LOCUS_27960 43239 42745 gene locus_tag LOCUS_27970 43239 42745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 43624 43247 gene locus_tag LOCUS_27980 43624 43247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 43718 45709 gene locus_tag LOCUS_27990 43718 45709 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_27990 45688 47277 gene locus_tag LOCUS_28000 45688 47277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 48306 47323 gene locus_tag LOCUS_28010 48306 47323 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194087.1 protein_id gnl|my_center|LOCUS_28010 49320 48313 gene locus_tag LOCUS_28020 49320 48313 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_28020 49671 49411 gene locus_tag LOCUS_28030 49671 49411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 51172 49697 gene locus_tag LOCUS_28040 gene hpnJ 51172 49697 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196953.1 protein_id gnl|my_center|LOCUS_28040 52097 51165 gene locus_tag LOCUS_28050 52097 51165 CDS product NAD-dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858299.1 protein_id gnl|my_center|LOCUS_28050 53331 52117 gene locus_tag LOCUS_28060 53331 52117 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965477.1 protein_id gnl|my_center|LOCUS_28060 >Feature sequence032 <1 630 gene locus_tag LOCUS_28070 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007328378.1:polysulfide reductase NrfD 627 878 gene locus_tag LOCUS_28080 627 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 875 2134 gene locus_tag LOCUS_28090 875 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 2149 2493 gene locus_tag LOCUS_28100 2149 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 2574 3101 gene locus_tag LOCUS_28110 2574 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 3114 3767 gene locus_tag LOCUS_28120 3114 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 4063 5373 gene locus_tag LOCUS_28130 4063 5373 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933494.1 protein_id gnl|my_center|LOCUS_28130 5370 6461 gene locus_tag LOCUS_28140 5370 6461 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902856.1 protein_id gnl|my_center|LOCUS_28140 6480 9578 gene locus_tag LOCUS_28150 6480 9578 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061075.1 protein_id gnl|my_center|LOCUS_28150 9606 9980 gene locus_tag LOCUS_28160 9606 9980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 10223 10528 gene locus_tag LOCUS_28170 10223 10528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 10549 10995 gene locus_tag LOCUS_28180 10549 10995 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941779.1 protein_id gnl|my_center|LOCUS_28180 11177 11539 gene locus_tag LOCUS_28190 11177 11539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 11536 11988 gene locus_tag LOCUS_28200 11536 11988 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941779.1 protein_id gnl|my_center|LOCUS_28200 11996 12424 gene locus_tag LOCUS_28210 11996 12424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 12615 13499 gene locus_tag LOCUS_28220 12615 13499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 13568 14137 gene locus_tag LOCUS_28230 13568 14137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28230 14372 16579 gene locus_tag LOCUS_28240 gene ccoN 14372 16579 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615370.1 protein_id gnl|my_center|LOCUS_28240 16576 16749 gene locus_tag LOCUS_28250 16576 16749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 16742 17350 gene locus_tag LOCUS_28260 16742 17350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 17350 18957 gene locus_tag LOCUS_28270 gene ccoG 17350 18957 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120871.1 protein_id gnl|my_center|LOCUS_28270 18954 19439 gene locus_tag LOCUS_28280 18954 19439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 19436 20182 gene locus_tag LOCUS_28290 19436 20182 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615371.1 protein_id gnl|my_center|LOCUS_28290 20154 22664 gene locus_tag LOCUS_28300 20154 22664 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120873.1 protein_id gnl|my_center|LOCUS_28300 22655 22807 gene locus_tag LOCUS_28310 22655 22807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 22888 23598 gene locus_tag LOCUS_28320 22888 23598 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889526.1 protein_id gnl|my_center|LOCUS_28320 23746 24036 gene locus_tag LOCUS_28330 23746 24036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 24135 25160 gene locus_tag LOCUS_28340 24135 25160 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583661.1 protein_id gnl|my_center|LOCUS_28340 25169 25579 gene locus_tag LOCUS_28350 25169 25579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 25569 28784 gene locus_tag LOCUS_28360 25569 28784 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461050.1 protein_id gnl|my_center|LOCUS_28360 28781 29257 gene locus_tag LOCUS_28370 28781 29257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 29254 30741 gene locus_tag LOCUS_28380 29254 30741 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228370.1 protein_id gnl|my_center|LOCUS_28380 30725 32116 gene locus_tag LOCUS_28390 30725 32116 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926801.1 protein_id gnl|my_center|LOCUS_28390 32149 32472 gene locus_tag LOCUS_28400 32149 32472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 32507 32794 gene locus_tag LOCUS_28410 32507 32794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 32996 33160 gene locus_tag LOCUS_28420 32996 33160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 33160 33456 gene locus_tag LOCUS_28430 33160 33456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 33558 33806 gene locus_tag LOCUS_28440 33558 33806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 34027 34302 gene locus_tag LOCUS_28450 34027 34302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 34299 36776 gene locus_tag LOCUS_28460 34299 36776 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958271.1 protein_id gnl|my_center|LOCUS_28460 36773 37150 gene locus_tag LOCUS_28470 36773 37150 CDS product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935065.1 protein_id gnl|my_center|LOCUS_28470 37158 38072 gene locus_tag LOCUS_28480 37158 38072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 38262 38552 gene locus_tag LOCUS_28490 38262 38552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 39024 40265 gene locus_tag LOCUS_28500 39024 40265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 40262 41623 gene locus_tag LOCUS_28510 gene atoC 40262 41623 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125282.1 protein_id gnl|my_center|LOCUS_28510 41911 43068 gene locus_tag LOCUS_28520 41911 43068 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943842.1 protein_id gnl|my_center|LOCUS_28520 43065 43820 gene locus_tag LOCUS_28530 43065 43820 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941282.1 protein_id gnl|my_center|LOCUS_28530 43943 44338 gene locus_tag LOCUS_28540 43943 44338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 44347 45444 gene locus_tag LOCUS_28550 44347 45444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 45441 45767 gene locus_tag LOCUS_28560 45441 45767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 45754 47790 gene locus_tag LOCUS_28570 45754 47790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 47790 48845 gene locus_tag LOCUS_28580 47790 48845 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943842.1 protein_id gnl|my_center|LOCUS_28580 48838 50532 gene locus_tag LOCUS_28590 48838 50532 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943843.1 protein_id gnl|my_center|LOCUS_28590 50866 51129 gene locus_tag LOCUS_28600 50866 51129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 51311 51910 gene locus_tag LOCUS_28610 51311 51910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 51907 52425 gene locus_tag LOCUS_28620 51907 52425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 >Feature sequence033 1 144 gene locus_tag LOCUS_28630 1 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 530 345 gene locus_tag LOCUS_28640 530 345 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227652.1 protein_id gnl|my_center|LOCUS_28640 1507 623 gene locus_tag LOCUS_28650 1507 623 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809513.1 protein_id gnl|my_center|LOCUS_28650 2312 1509 gene locus_tag LOCUS_28660 2312 1509 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898616.1 protein_id gnl|my_center|LOCUS_28660 2428 4977 gene locus_tag LOCUS_28670 2428 4977 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928589.1 protein_id gnl|my_center|LOCUS_28670 5047 6180 gene locus_tag LOCUS_28680 5047 6180 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_28680 7314 6214 gene locus_tag LOCUS_28690 7314 6214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 8659 7397 gene locus_tag LOCUS_28700 8659 7397 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089286.1 protein_id gnl|my_center|LOCUS_28700 8696 9703 gene locus_tag LOCUS_28710 8696 9703 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919898.1 protein_id gnl|my_center|LOCUS_28710 9717 10568 gene locus_tag LOCUS_28720 9717 10568 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256673.1 protein_id gnl|my_center|LOCUS_28720 11652 10888 gene locus_tag LOCUS_28730 11652 10888 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_28730 11808 12485 gene locus_tag LOCUS_28740 11808 12485 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_28740 12485 13408 gene locus_tag LOCUS_28750 12485 13408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 13485 14522 gene locus_tag LOCUS_28760 13485 14522 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227848.1 protein_id gnl|my_center|LOCUS_28760 14539 15060 gene locus_tag LOCUS_28770 14539 15060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 15062 16906 gene locus_tag LOCUS_28780 15062 16906 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_28780 16911 18257 gene locus_tag LOCUS_28790 16911 18257 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339249.1 protein_id gnl|my_center|LOCUS_28790 18250 18726 gene locus_tag LOCUS_28800 18250 18726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 18874 19254 gene locus_tag LOCUS_28810 18874 19254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 20017 19478 gene locus_tag LOCUS_28820 20017 19478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 21963 20119 gene locus_tag LOCUS_28830 21963 20119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 22322 23167 gene locus_tag LOCUS_28840 22322 23167 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063716.1 protein_id gnl|my_center|LOCUS_28840 23206 24243 gene locus_tag LOCUS_28850 23206 24243 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366951.1 protein_id gnl|my_center|LOCUS_28850 24294 25403 gene locus_tag LOCUS_28860 24294 25403 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_28860 25400 27133 gene locus_tag LOCUS_28870 25400 27133 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064852.1 protein_id gnl|my_center|LOCUS_28870 27184 28722 gene locus_tag LOCUS_28880 27184 28722 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065030.1 protein_id gnl|my_center|LOCUS_28880 28903 29193 gene locus_tag LOCUS_28890 28903 29193 CDS product virulence factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975919.1 protein_id gnl|my_center|LOCUS_28890 29492 31444 gene locus_tag LOCUS_28900 gene acs 29492 31444 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459120.1 protein_id gnl|my_center|LOCUS_28900 31631 32191 gene locus_tag LOCUS_28910 31631 32191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 32274 32585 gene locus_tag LOCUS_28920 32274 32585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 32813 34036 gene locus_tag LOCUS_28930 32813 34036 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810537.1 protein_id gnl|my_center|LOCUS_28930 34398 34808 gene locus_tag LOCUS_28940 34398 34808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 35674 34937 gene locus_tag LOCUS_28950 35674 34937 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_28950 35710 36342 gene locus_tag LOCUS_28960 35710 36342 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055897.1 protein_id gnl|my_center|LOCUS_28960 36529 37089 gene locus_tag LOCUS_28970 36529 37089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 37142 37831 gene locus_tag LOCUS_28980 37142 37831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 37953 39905 gene locus_tag LOCUS_28990 37953 39905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 39902 40897 gene locus_tag LOCUS_29000 39902 40897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 41112 43478 gene locus_tag LOCUS_29010 41112 43478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 43501 43914 gene locus_tag LOCUS_29020 43501 43914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 43928 44686 gene locus_tag LOCUS_29030 43928 44686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 44895 46487 gene locus_tag LOCUS_29040 44895 46487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29040 46480 47475 gene locus_tag LOCUS_29050 46480 47475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29050 47387 47851 gene locus_tag LOCUS_29060 47387 47851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 48452 47976 gene locus_tag LOCUS_29070 48452 47976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 49093 48449 gene locus_tag LOCUS_29080 49093 48449 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727134.1 protein_id gnl|my_center|LOCUS_29080 50078 49140 gene locus_tag LOCUS_29090 50078 49140 CDS product isoaspartyl peptidase/L-asparaginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939517.1 protein_id gnl|my_center|LOCUS_29090 50761 50198 gene locus_tag LOCUS_29100 50761 50198 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867261.1 protein_id gnl|my_center|LOCUS_29100 50924 51688 gene locus_tag LOCUS_29110 50924 51688 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067353.1 protein_id gnl|my_center|LOCUS_29110 51691 52602 gene locus_tag LOCUS_29120 51691 52602 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067356.1 protein_id gnl|my_center|LOCUS_29120 >Feature sequence034 <1 1907 gene locus_tag LOCUS_29130 <1 1907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037394620.1:M10 family metallopeptidase C-terminal domain-containing protein 1900 4059 gene locus_tag LOCUS_29140 1900 4059 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082901051.1 protein_id gnl|my_center|LOCUS_29140 4056 5384 gene locus_tag LOCUS_29150 4056 5384 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966765.1 protein_id gnl|my_center|LOCUS_29150 5812 5393 gene locus_tag LOCUS_29160 5812 5393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 6199 5828 gene locus_tag LOCUS_29170 6199 5828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 6874 6260 gene locus_tag LOCUS_29180 6874 6260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 8164 6920 gene locus_tag LOCUS_29190 gene pfp 8164 6920 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546508.1 protein_id gnl|my_center|LOCUS_29190 8378 9382 gene locus_tag LOCUS_29200 gene fbp 8378 9382 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932050.1 protein_id gnl|my_center|LOCUS_29200 9419 10345 gene locus_tag LOCUS_29210 9419 10345 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390262.1 protein_id gnl|my_center|LOCUS_29210 10351 10698 gene locus_tag LOCUS_29220 10351 10698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 10743 11735 gene locus_tag LOCUS_29230 10743 11735 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296290.1 protein_id gnl|my_center|LOCUS_29230 11785 12096 gene locus_tag LOCUS_29240 11785 12096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 12144 13823 gene locus_tag LOCUS_29250 gene ettA 12144 13823 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_29250 14829 13981 gene locus_tag LOCUS_29260 14829 13981 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083715.1 protein_id gnl|my_center|LOCUS_29260 14950 15456 gene locus_tag LOCUS_29270 14950 15456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 16157 15468 gene locus_tag LOCUS_29280 16157 15468 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_29280 16997 16230 gene locus_tag LOCUS_29290 16997 16230 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102518.1 protein_id gnl|my_center|LOCUS_29290 17099 18241 gene locus_tag LOCUS_29300 17099 18241 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941112.1 protein_id gnl|my_center|LOCUS_29300 18351 19301 gene locus_tag LOCUS_29310 18351 19301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 20568 19342 gene locus_tag LOCUS_29320 20568 19342 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222776.1 protein_id gnl|my_center|LOCUS_29320 20845 20546 gene locus_tag LOCUS_29330 20845 20546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 20926 21690 gene locus_tag LOCUS_29340 20926 21690 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087125.1 protein_id gnl|my_center|LOCUS_29340 21710 22492 gene locus_tag LOCUS_29350 21710 22492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 22499 23404 gene locus_tag LOCUS_29360 22499 23404 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940917.1 protein_id gnl|my_center|LOCUS_29360 23391 24578 gene locus_tag LOCUS_29370 gene fabF 23391 24578 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460499.1 protein_id gnl|my_center|LOCUS_29370 24575 25384 gene locus_tag LOCUS_29380 24575 25384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 25381 25656 gene locus_tag LOCUS_29390 25381 25656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 25673 26860 gene locus_tag LOCUS_29400 25673 26860 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941128.1 protein_id gnl|my_center|LOCUS_29400 26857 27999 gene locus_tag LOCUS_29410 26857 27999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 27996 29075 gene locus_tag LOCUS_29420 27996 29075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 29072 30346 gene locus_tag LOCUS_29430 29072 30346 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039084.1 protein_id gnl|my_center|LOCUS_29430 30343 31551 gene locus_tag LOCUS_29440 30343 31551 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020431.1 protein_id gnl|my_center|LOCUS_29440 31555 32235 gene locus_tag LOCUS_29450 31555 32235 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_29450 32246 32674 gene locus_tag LOCUS_29460 32246 32674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 32687 34477 gene locus_tag LOCUS_29470 32687 34477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 34508 36019 gene locus_tag LOCUS_29480 gene hpnJ 34508 36019 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196953.1 protein_id gnl|my_center|LOCUS_29480 36098 37684 gene locus_tag LOCUS_29490 gene serA 36098 37684 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941855.1 protein_id gnl|my_center|LOCUS_29490 37681 38130 gene locus_tag LOCUS_29500 37681 38130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 39283 38099 gene locus_tag LOCUS_29510 39283 38099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 39282 39692 gene locus_tag LOCUS_29520 39282 39692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 42449 39744 gene locus_tag LOCUS_29530 42449 39744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 42668 42883 gene locus_tag LOCUS_29540 42668 42883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 42951 45344 gene locus_tag LOCUS_29550 42951 45344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 46370 45459 gene locus_tag LOCUS_29560 46370 45459 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941237.1 protein_id gnl|my_center|LOCUS_29560 46400 47050 gene locus_tag LOCUS_29570 46400 47050 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258352.1 protein_id gnl|my_center|LOCUS_29570 47052 47960 gene locus_tag LOCUS_29580 gene mmsB 47052 47960 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103280.1 protein_id gnl|my_center|LOCUS_29580 48029 49090 gene locus_tag LOCUS_29590 48029 49090 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436788.1 protein_id gnl|my_center|LOCUS_29590 >Feature sequence035 2387 282 gene locus_tag LOCUS_29600 2387 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29600 3226 2393 gene locus_tag LOCUS_29610 3226 2393 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808131.1 protein_id gnl|my_center|LOCUS_29610 4135 3389 gene locus_tag LOCUS_29620 4135 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 4547 4152 gene locus_tag LOCUS_29630 4547 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 4895 5254 gene locus_tag LOCUS_29640 4895 5254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 5254 5826 gene locus_tag LOCUS_29650 5254 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 6540 5845 gene locus_tag LOCUS_29660 6540 5845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 6744 6962 gene locus_tag LOCUS_29670 6744 6962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 7083 8045 gene locus_tag LOCUS_29680 7083 8045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530069.1 protein_id gnl|my_center|LOCUS_29680 8036 8692 gene locus_tag LOCUS_29690 8036 8692 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 protein_id gnl|my_center|LOCUS_29690 8689 9270 gene locus_tag LOCUS_29700 8689 9270 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214742.1 protein_id gnl|my_center|LOCUS_29700 10400 9333 gene locus_tag LOCUS_29710 10400 9333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 11382 10480 gene locus_tag LOCUS_29720 11382 10480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 12617 11409 gene locus_tag LOCUS_29730 12617 11409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 14545 12728 gene locus_tag LOCUS_29740 14545 12728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 14805 15716 gene locus_tag LOCUS_29750 14805 15716 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965491.1 protein_id gnl|my_center|LOCUS_29750 15732 17105 gene locus_tag LOCUS_29760 15732 17105 CDS product acyclic terpene utilization AtuA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227202.1 protein_id gnl|my_center|LOCUS_29760 17118 17426 gene locus_tag LOCUS_29770 17118 17426 CDS product DUF4387 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813947.1 protein_id gnl|my_center|LOCUS_29770 17517 19634 gene locus_tag LOCUS_29780 17517 19634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29780 19631 21250 gene locus_tag LOCUS_29790 19631 21250 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226376432.1 protein_id gnl|my_center|LOCUS_29790 21317 22393 gene locus_tag LOCUS_29800 21317 22393 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966039.1 protein_id gnl|my_center|LOCUS_29800 22390 23310 gene locus_tag LOCUS_29810 22390 23310 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086028.1 protein_id gnl|my_center|LOCUS_29810 23307 24155 gene locus_tag LOCUS_29820 23307 24155 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089929.1 protein_id gnl|my_center|LOCUS_29820 24250 25122 gene locus_tag LOCUS_29830 24250 25122 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067118245.1 protein_id gnl|my_center|LOCUS_29830 25489 26148 gene locus_tag LOCUS_29840 25489 26148 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_29840 26153 27403 gene locus_tag LOCUS_29850 26153 27403 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436463.1 protein_id gnl|my_center|LOCUS_29850 27418 28410 gene locus_tag LOCUS_29860 27418 28410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 28442 30529 gene locus_tag LOCUS_29870 28442 30529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29870 30532 32187 gene locus_tag LOCUS_29880 30532 32187 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086403.1 protein_id gnl|my_center|LOCUS_29880 32184 33005 gene locus_tag LOCUS_29890 32184 33005 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808734.1 protein_id gnl|my_center|LOCUS_29890 33002 33853 gene locus_tag LOCUS_29900 33002 33853 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222208.1 protein_id gnl|my_center|LOCUS_29900 33872 35173 gene locus_tag LOCUS_29910 33872 35173 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031732.1 protein_id gnl|my_center|LOCUS_29910 35997 35545 gene locus_tag LOCUS_29920 35997 35545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 36767 35994 gene locus_tag LOCUS_29930 36767 35994 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728712.1 protein_id gnl|my_center|LOCUS_29930 37912 36809 gene locus_tag LOCUS_29940 37912 36809 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625955.1 protein_id gnl|my_center|LOCUS_29940 39582 37912 gene locus_tag LOCUS_29950 39582 37912 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930994.1 protein_id gnl|my_center|LOCUS_29950 40708 39617 gene locus_tag LOCUS_29960 40708 39617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 42130 40760 gene locus_tag LOCUS_29970 gene hydA 42130 40760 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086079.1 protein_id gnl|my_center|LOCUS_29970 42813 43013 gene locus_tag LOCUS_29980 42813 43013 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_29980 43528 43325 gene locus_tag LOCUS_29990 43528 43325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 45370 43601 gene locus_tag LOCUS_30000 45370 43601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 45738 45367 gene locus_tag LOCUS_30010 45738 45367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 46271 47257 gene locus_tag LOCUS_30020 46271 47257 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056629.1 protein_id gnl|my_center|LOCUS_30020 47282 49186 gene locus_tag LOCUS_30030 47282 49186 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_30030 50087 49275 gene locus_tag LOCUS_30040 50087 49275 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930745.1 protein_id gnl|my_center|LOCUS_30040 50400 51191 gene locus_tag LOCUS_30050 50400 51191 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_30050 >Feature sequence036 906 88 gene locus_tag LOCUS_30060 gene pstB 906 88 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020934.1 protein_id gnl|my_center|LOCUS_30060 2548 935 gene locus_tag LOCUS_30070 gene pstA 2548 935 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114377.1 protein_id gnl|my_center|LOCUS_30070 4839 2545 gene locus_tag LOCUS_30080 4839 2545 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418856.1 protein_id gnl|my_center|LOCUS_30080 5817 4840 gene locus_tag LOCUS_30090 gene pstS 5817 4840 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096673.1 protein_id gnl|my_center|LOCUS_30090 7920 6022 gene locus_tag LOCUS_30100 gene phoR 7920 6022 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_30100 8636 7929 gene locus_tag LOCUS_30110 8636 7929 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 protein_id gnl|my_center|LOCUS_30110 8847 10499 gene locus_tag LOCUS_30120 8847 10499 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766069.1 protein_id gnl|my_center|LOCUS_30120 10492 11070 gene locus_tag LOCUS_30130 10492 11070 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760706.1 protein_id gnl|my_center|LOCUS_30130 11561 12448 gene locus_tag LOCUS_30140 11561 12448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 12591 12445 gene locus_tag LOCUS_30150 12591 12445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 13513 12605 gene locus_tag LOCUS_30160 gene arcC 13513 12605 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904160.1 protein_id gnl|my_center|LOCUS_30160 14889 13510 gene locus_tag LOCUS_30170 14889 13510 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_30170 17233 14984 gene locus_tag LOCUS_30180 17233 14984 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028362.1 protein_id gnl|my_center|LOCUS_30180 17719 17306 gene locus_tag LOCUS_30190 17719 17306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 18386 17697 gene locus_tag LOCUS_30200 18386 17697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 19622 18474 gene locus_tag LOCUS_30210 19622 18474 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085196.1 protein_id gnl|my_center|LOCUS_30210 19728 20213 gene locus_tag LOCUS_30220 19728 20213 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 protein_id gnl|my_center|LOCUS_30220 21203 20262 gene locus_tag LOCUS_30230 21203 20262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 21799 21200 gene locus_tag LOCUS_30240 21799 21200 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002258733.1 protein_id gnl|my_center|LOCUS_30240 22257 22481 gene locus_tag LOCUS_30250 22257 22481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 22474 22689 gene locus_tag LOCUS_30260 22474 22689 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392021.1 protein_id gnl|my_center|LOCUS_30260 23188 22865 gene locus_tag LOCUS_30270 23188 22865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 24688 23831 gene locus_tag LOCUS_30280 24688 23831 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066662.1 protein_id gnl|my_center|LOCUS_30280 25625 24681 gene locus_tag LOCUS_30290 25625 24681 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836213.1 protein_id gnl|my_center|LOCUS_30290 27244 25667 gene locus_tag LOCUS_30300 27244 25667 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217481233.1 protein_id gnl|my_center|LOCUS_30300 27756 27241 gene locus_tag LOCUS_30310 27756 27241 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893865.1 protein_id gnl|my_center|LOCUS_30310 29025 27775 gene locus_tag LOCUS_30320 29025 27775 CDS product aconitase/3-isopropylmalate dehydratase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731589.1 protein_id gnl|my_center|LOCUS_30320 29945 29037 gene locus_tag LOCUS_30330 29945 29037 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665727.1 protein_id gnl|my_center|LOCUS_30330 30094 29945 gene locus_tag LOCUS_30340 30094 29945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 31359 30091 gene locus_tag LOCUS_30350 31359 30091 CDS product aconitase/3-isopropylmalate dehydratase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731589.1 protein_id gnl|my_center|LOCUS_30350 32118 31453 gene locus_tag LOCUS_30360 32118 31453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 34258 32372 gene locus_tag LOCUS_30370 34258 32372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 35469 34321 gene locus_tag LOCUS_30380 35469 34321 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900904.1 protein_id gnl|my_center|LOCUS_30380 36208 35483 gene locus_tag LOCUS_30390 36208 35483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 37482 36211 gene locus_tag LOCUS_30400 37482 36211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 38300 37479 gene locus_tag LOCUS_30410 38300 37479 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_30410 40612 38297 gene locus_tag LOCUS_30420 40612 38297 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480716.1 protein_id gnl|my_center|LOCUS_30420 40796 40635 gene locus_tag LOCUS_30430 40796 40635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 41201 40842 gene locus_tag LOCUS_30440 41201 40842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 42327 41365 gene locus_tag LOCUS_30450 42327 41365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 42487 43302 gene locus_tag LOCUS_30460 42487 43302 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225682.1 protein_id gnl|my_center|LOCUS_30460 43520 43789 gene locus_tag LOCUS_30470 43520 43789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 44246 44007 gene locus_tag LOCUS_30480 44246 44007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 45601 44243 gene locus_tag LOCUS_30490 45601 44243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 45777 46109 gene locus_tag LOCUS_30500 45777 46109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 46857 46159 gene locus_tag LOCUS_30510 46857 46159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 47765 46854 gene locus_tag LOCUS_30520 47765 46854 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038711.1 protein_id gnl|my_center|LOCUS_30520 48757 47762 gene locus_tag LOCUS_30530 48757 47762 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193771.1 protein_id gnl|my_center|LOCUS_30530 49385 48768 gene locus_tag LOCUS_30540 49385 48768 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_30540 49760 50410 gene locus_tag LOCUS_30550 49760 50410 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942478.1 protein_id gnl|my_center|LOCUS_30550 50585 50477 gene locus_tag LOCUS_r00010 50585 50477 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence037 1465 1250 gene locus_tag LOCUS_30560 1465 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 2200 1772 gene locus_tag LOCUS_30570 2200 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 2619 2308 gene locus_tag LOCUS_30580 2619 2308 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940733.1 protein_id gnl|my_center|LOCUS_30580 2965 2609 gene locus_tag LOCUS_30590 2965 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 3955 3050 gene locus_tag LOCUS_30600 3955 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 5454 4540 gene locus_tag LOCUS_30610 5454 4540 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085952.1 protein_id gnl|my_center|LOCUS_30610 6700 5462 gene locus_tag LOCUS_30620 6700 5462 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809839.1 protein_id gnl|my_center|LOCUS_30620 7446 6751 gene locus_tag LOCUS_30630 7446 6751 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083887.1 protein_id gnl|my_center|LOCUS_30630 8195 7446 gene locus_tag LOCUS_30640 8195 7446 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086167.1 protein_id gnl|my_center|LOCUS_30640 9187 8192 gene locus_tag LOCUS_30650 9187 8192 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809842.1 protein_id gnl|my_center|LOCUS_30650 10041 9187 gene locus_tag LOCUS_30660 10041 9187 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064203.1 protein_id gnl|my_center|LOCUS_30660 11035 10049 gene locus_tag LOCUS_30670 11035 10049 CDS product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817430.1 protein_id gnl|my_center|LOCUS_30670 12140 11166 gene locus_tag LOCUS_30680 12140 11166 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 protein_id gnl|my_center|LOCUS_30680 12358 12155 gene locus_tag LOCUS_30690 12358 12155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 13439 12570 gene locus_tag LOCUS_30700 13439 12570 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256256.1 protein_id gnl|my_center|LOCUS_30700 13450 13698 gene locus_tag LOCUS_30710 13450 13698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 15285 13714 gene locus_tag LOCUS_30720 15285 13714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 15862 15278 gene locus_tag LOCUS_30730 15862 15278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 17780 15855 gene locus_tag LOCUS_30740 17780 15855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 19429 17777 gene locus_tag LOCUS_30750 19429 17777 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583496.1 protein_id gnl|my_center|LOCUS_30750 19588 19451 gene locus_tag LOCUS_30760 19588 19451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 21330 19882 gene locus_tag LOCUS_30770 21330 19882 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_30770 22099 21338 gene locus_tag LOCUS_30780 22099 21338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 22620 22222 gene locus_tag LOCUS_30790 22620 22222 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023127.1 protein_id gnl|my_center|LOCUS_30790 26999 22671 gene locus_tag LOCUS_30800 26999 22671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 28331 27186 gene locus_tag LOCUS_30810 gene acdA 28331 27186 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_30810 29287 28328 gene locus_tag LOCUS_30820 29287 28328 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_30820 31233 29308 gene locus_tag LOCUS_30830 31233 29308 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271912.1 protein_id gnl|my_center|LOCUS_30830 32390 31230 gene locus_tag LOCUS_30840 gene acdA 32390 31230 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_30840 34572 32425 gene locus_tag LOCUS_30850 34572 32425 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_30850 35662 34565 gene locus_tag LOCUS_30860 35662 34565 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460999.1 protein_id gnl|my_center|LOCUS_30860 36461 35673 gene locus_tag LOCUS_30870 36461 35673 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036719.1 protein_id gnl|my_center|LOCUS_30870 37320 36451 gene locus_tag LOCUS_30880 37320 36451 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_30880 38489 37335 gene locus_tag LOCUS_30890 38489 37335 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027926.1 protein_id gnl|my_center|LOCUS_30890 39388 38636 gene locus_tag LOCUS_30900 39388 38636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 40035 39385 gene locus_tag LOCUS_30910 40035 39385 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096990.1 protein_id gnl|my_center|LOCUS_30910 40712 40032 gene locus_tag LOCUS_30920 40712 40032 CDS product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552494.1 protein_id gnl|my_center|LOCUS_30920 42870 40726 gene locus_tag LOCUS_30930 42870 40726 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170066.1 protein_id gnl|my_center|LOCUS_30930 45032 42897 gene locus_tag LOCUS_30940 45032 42897 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827278.1 protein_id gnl|my_center|LOCUS_30940 45574 45029 gene locus_tag LOCUS_30950 45574 45029 CDS product acetone carboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528124.1 protein_id gnl|my_center|LOCUS_30950 46416 45610 gene locus_tag LOCUS_30960 46416 45610 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 protein_id gnl|my_center|LOCUS_30960 47233 46427 gene locus_tag LOCUS_30970 47233 46427 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496487.1 protein_id gnl|my_center|LOCUS_30970 48526 47237 gene locus_tag LOCUS_30980 48526 47237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 <49441 48663 gene locus_tag LOCUS_30990 <49441 48663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003819989.1:carboxylase >Feature sequence038 1478 135 gene locus_tag LOCUS_31000 1478 135 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_31000 3609 1543 gene locus_tag LOCUS_31010 3609 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 5186 3738 gene locus_tag LOCUS_31020 gene fslC 5186 3738 CDS product rhizoferrin biosystnesis N-citrylornithine decarboxylase FslC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022882.1 protein_id gnl|my_center|LOCUS_31020 6225 5116 gene locus_tag LOCUS_31030 6225 5116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 7303 6230 gene locus_tag LOCUS_31040 7303 6230 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582961.1 protein_id gnl|my_center|LOCUS_31040 7499 7281 gene locus_tag LOCUS_31050 7499 7281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 10201 7499 gene locus_tag LOCUS_31060 10201 7499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 10735 11568 gene locus_tag LOCUS_31070 10735 11568 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966277.1 protein_id gnl|my_center|LOCUS_31070 11556 12362 gene locus_tag LOCUS_31080 11556 12362 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228665.1 protein_id gnl|my_center|LOCUS_31080 12397 13407 gene locus_tag LOCUS_31090 gene dctP 12397 13407 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965687.1 protein_id gnl|my_center|LOCUS_31090 13415 13903 gene locus_tag LOCUS_31100 13415 13903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 13900 15189 gene locus_tag LOCUS_31110 13900 15189 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 protein_id gnl|my_center|LOCUS_31110 15463 15323 gene locus_tag LOCUS_31120 15463 15323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 15476 15673 gene locus_tag LOCUS_31130 15476 15673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 15746 15919 gene locus_tag LOCUS_31140 15746 15919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 16517 16053 gene locus_tag LOCUS_31150 16517 16053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 16695 16621 gene locus_tag LOCUS_t00290 16695 16621 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 18292 16742 gene locus_tag LOCUS_31160 18292 16742 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328128.1 protein_id gnl|my_center|LOCUS_31160 19816 18341 gene locus_tag LOCUS_31170 19816 18341 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258188.1 protein_id gnl|my_center|LOCUS_31170 20667 19813 gene locus_tag LOCUS_31180 20667 19813 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002078886.1 protein_id gnl|my_center|LOCUS_31180 21563 20664 gene locus_tag LOCUS_31190 21563 20664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 22455 21574 gene locus_tag LOCUS_31200 22455 21574 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121957.1 protein_id gnl|my_center|LOCUS_31200 22567 24471 gene locus_tag LOCUS_31210 22567 24471 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_31210 25388 24759 gene locus_tag LOCUS_31220 gene lexA 25388 24759 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940718.1 protein_id gnl|my_center|LOCUS_31220 25955 25473 gene locus_tag LOCUS_31230 25955 25473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 26121 26303 gene locus_tag LOCUS_31240 26121 26303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 26296 27495 gene locus_tag LOCUS_31250 26296 27495 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041861981.1 protein_id gnl|my_center|LOCUS_31250 27603 28619 gene locus_tag LOCUS_31260 27603 28619 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256339.1 protein_id gnl|my_center|LOCUS_31260 28652 29890 gene locus_tag LOCUS_31270 gene ccrA 28652 29890 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078168.1 protein_id gnl|my_center|LOCUS_31270 30710 29913 gene locus_tag LOCUS_31280 30710 29913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069846.1 protein_id gnl|my_center|LOCUS_31280 30854 31216 gene locus_tag LOCUS_31290 30854 31216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 31272 31733 gene locus_tag LOCUS_31300 31272 31733 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855793.1 protein_id gnl|my_center|LOCUS_31300 32577 31759 gene locus_tag LOCUS_31310 32577 31759 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255957.1 protein_id gnl|my_center|LOCUS_31310 32759 32574 gene locus_tag LOCUS_31320 32759 32574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 32857 34593 gene locus_tag LOCUS_31330 gene polX 32857 34593 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228471.1 protein_id gnl|my_center|LOCUS_31330 34657 35265 gene locus_tag LOCUS_31340 34657 35265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 36234 35365 gene locus_tag LOCUS_31350 gene dapF 36234 35365 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583145.1 protein_id gnl|my_center|LOCUS_31350 37123 36326 gene locus_tag LOCUS_31360 37123 36326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31360 38248 37157 gene locus_tag LOCUS_31370 gene citZ 38248 37157 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903548.1 protein_id gnl|my_center|LOCUS_31370 38417 39361 gene locus_tag LOCUS_31380 38417 39361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 40560 39337 gene locus_tag LOCUS_31390 40560 39337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 42267 40654 gene locus_tag LOCUS_31400 42267 40654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 43751 42264 gene locus_tag LOCUS_31410 gene lcfB 43751 42264 CDS product long-chain-fatty-acid--CoA ligase LcfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244686.1 protein_id gnl|my_center|LOCUS_31410 44891 43923 gene locus_tag LOCUS_31420 44891 43923 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257832.1 protein_id gnl|my_center|LOCUS_31420 45514 44936 gene locus_tag LOCUS_31430 45514 44936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 45640 46176 gene locus_tag LOCUS_31440 45640 46176 CDS product Slp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942462.1 protein_id gnl|my_center|LOCUS_31440 47494 46190 gene locus_tag LOCUS_31450 47494 46190 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546417.1 protein_id gnl|my_center|LOCUS_31450 48335 47505 gene locus_tag LOCUS_31460 48335 47505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 >Feature sequence039 1240 98 gene locus_tag LOCUS_31470 1240 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 1997 1323 gene locus_tag LOCUS_31480 1997 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 1890 2162 gene locus_tag LOCUS_31490 1890 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 2730 2485 gene locus_tag LOCUS_31500 2730 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 3127 2792 gene locus_tag LOCUS_31510 3127 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 3872 3057 gene locus_tag LOCUS_31520 3872 3057 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_31520 4498 3884 gene locus_tag LOCUS_31530 4498 3884 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404669.1 protein_id gnl|my_center|LOCUS_31530 4938 4675 gene locus_tag LOCUS_31540 4938 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 5740 5057 gene locus_tag LOCUS_31550 5740 5057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 6767 5985 gene locus_tag LOCUS_31560 gene soxA 6767 5985 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174733.1 protein_id gnl|my_center|LOCUS_31560 7100 6780 gene locus_tag LOCUS_31570 gene soxZ 7100 6780 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085518.1 protein_id gnl|my_center|LOCUS_31570 7576 7103 gene locus_tag LOCUS_31580 7576 7103 CDS product SoxY-related AACIE arm protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085519.1 protein_id gnl|my_center|LOCUS_31580 8002 7577 gene locus_tag LOCUS_31590 gene soxX 8002 7577 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171929.1 protein_id gnl|my_center|LOCUS_31590 9267 7999 gene locus_tag LOCUS_31600 9267 7999 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921427.1 protein_id gnl|my_center|LOCUS_31600 9554 9264 gene locus_tag LOCUS_31610 9554 9264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 11735 9558 gene locus_tag LOCUS_31620 11735 9558 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085521.1 protein_id gnl|my_center|LOCUS_31620 12198 11749 gene locus_tag LOCUS_31630 12198 11749 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174739.1 protein_id gnl|my_center|LOCUS_31630 12375 12827 gene locus_tag LOCUS_31640 12375 12827 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704544.1 protein_id gnl|my_center|LOCUS_31640 13758 12856 gene locus_tag LOCUS_31650 13758 12856 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027460.1 protein_id gnl|my_center|LOCUS_31650 14513 13770 gene locus_tag LOCUS_31660 14513 13770 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228340.1 protein_id gnl|my_center|LOCUS_31660 14772 16451 gene locus_tag LOCUS_31670 14772 16451 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878783.1 protein_id gnl|my_center|LOCUS_31670 16466 16885 gene locus_tag LOCUS_31680 16466 16885 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 protein_id gnl|my_center|LOCUS_31680 18121 16922 gene locus_tag LOCUS_31690 18121 16922 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919308.1 protein_id gnl|my_center|LOCUS_31690 19633 18215 gene locus_tag LOCUS_31700 19633 18215 CDS product hydroxymethylglutaryl-CoA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919307.1 protein_id gnl|my_center|LOCUS_31700 19885 19691 gene locus_tag LOCUS_31710 19885 19691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 20335 21135 gene locus_tag LOCUS_31720 20335 21135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31720 21585 22745 gene locus_tag LOCUS_31730 21585 22745 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966164.1 protein_id gnl|my_center|LOCUS_31730 23308 22895 gene locus_tag LOCUS_31740 23308 22895 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762169.1 protein_id gnl|my_center|LOCUS_31740 23461 24234 gene locus_tag LOCUS_31750 23461 24234 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225713.1 protein_id gnl|my_center|LOCUS_31750 24236 25045 gene locus_tag LOCUS_31760 gene fabG 24236 25045 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888576.1 protein_id gnl|my_center|LOCUS_31760 25912 25037 gene locus_tag LOCUS_31770 25912 25037 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807962.1 protein_id gnl|my_center|LOCUS_31770 26705 25932 gene locus_tag LOCUS_31780 gene caiD 26705 25932 CDS product crotonobetainyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004377.1 protein_id gnl|my_center|LOCUS_31780 27701 26769 gene locus_tag LOCUS_31790 27701 26769 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229029.1 protein_id gnl|my_center|LOCUS_31790 28468 27728 gene locus_tag LOCUS_31800 28468 27728 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030941.1 protein_id gnl|my_center|LOCUS_31800 28614 28465 gene locus_tag LOCUS_31810 28614 28465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 28875 29867 gene locus_tag LOCUS_31820 28875 29867 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090292.1 protein_id gnl|my_center|LOCUS_31820 29905 30708 gene locus_tag LOCUS_31830 29905 30708 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729455.1 protein_id gnl|my_center|LOCUS_31830 30729 31208 gene locus_tag LOCUS_31840 30729 31208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 31209 32711 gene locus_tag LOCUS_31850 31209 32711 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083773.1 protein_id gnl|my_center|LOCUS_31850 32767 35079 gene locus_tag LOCUS_31860 32767 35079 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257971.1 protein_id gnl|my_center|LOCUS_31860 35076 35702 gene locus_tag LOCUS_31870 35076 35702 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014086.1 protein_id gnl|my_center|LOCUS_31870 35783 36226 gene locus_tag LOCUS_31880 35783 36226 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257527.1 protein_id gnl|my_center|LOCUS_31880 36232 36936 gene locus_tag LOCUS_31890 36232 36936 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257528.1 protein_id gnl|my_center|LOCUS_31890 36983 37633 gene locus_tag LOCUS_31900 36983 37633 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275419.1 protein_id gnl|my_center|LOCUS_31900 38084 37650 gene locus_tag LOCUS_31910 38084 37650 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410811.1 protein_id gnl|my_center|LOCUS_31910 38341 38081 gene locus_tag LOCUS_31920 38341 38081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 39336 38422 gene locus_tag LOCUS_31930 39336 38422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 42280 39461 gene locus_tag LOCUS_31940 42280 39461 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403859.1 protein_id gnl|my_center|LOCUS_31940 42182 42556 gene locus_tag LOCUS_31950 42182 42556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 42777 42508 gene locus_tag LOCUS_31960 42777 42508 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391906.1 protein_id gnl|my_center|LOCUS_31960 43041 42781 gene locus_tag LOCUS_31970 43041 42781 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 protein_id gnl|my_center|LOCUS_31970 44344 43034 gene locus_tag LOCUS_31980 44344 43034 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968693.1 protein_id gnl|my_center|LOCUS_31980 45968 44334 gene locus_tag LOCUS_31990 45968 44334 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403855.1 protein_id gnl|my_center|LOCUS_31990 46827 47051 gene locus_tag LOCUS_32000 46827 47051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 47048 47419 gene locus_tag LOCUS_32010 47048 47419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 47435 47785 gene locus_tag LOCUS_32020 47435 47785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 >Feature sequence040 361 161 gene locus_tag LOCUS_32030 361 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 686 486 gene locus_tag LOCUS_32040 686 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 1383 952 gene locus_tag LOCUS_32050 gene tadA 1383 952 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810985.1 protein_id gnl|my_center|LOCUS_32050 1568 1492 gene locus_tag LOCUS_t00300 1568 1492 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1663 1570 gene locus_tag LOCUS_t00310 1663 1570 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2748 1708 gene locus_tag LOCUS_32060 2748 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 2869 2780 gene locus_tag LOCUS_t00320 2869 2780 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4173 2881 gene locus_tag LOCUS_32070 gene serS 4173 2881 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937547.1 protein_id gnl|my_center|LOCUS_32070 6689 4257 gene locus_tag LOCUS_32080 gene gyrA 6689 4257 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021593.1 protein_id gnl|my_center|LOCUS_32080 9084 6703 gene locus_tag LOCUS_32090 gene gyrB 9084 6703 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940681.1 protein_id gnl|my_center|LOCUS_32090 10169 9081 gene locus_tag LOCUS_32100 gene recF 10169 9081 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259706.1 protein_id gnl|my_center|LOCUS_32100 11288 10194 gene locus_tag LOCUS_32110 gene dnaN 11288 10194 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_32110 12772 11453 gene locus_tag LOCUS_32120 gene dnaA 12772 11453 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963330.1 protein_id gnl|my_center|LOCUS_32120 13254 13625 gene locus_tag LOCUS_32130 13254 13625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 13622 13873 gene locus_tag LOCUS_32140 gene yidD 13622 13873 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918351.1 protein_id gnl|my_center|LOCUS_32140 13873 15549 gene locus_tag LOCUS_32150 13873 15549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 15629 16291 gene locus_tag LOCUS_32160 15629 16291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 16371 17132 gene locus_tag LOCUS_32170 16371 17132 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940782.1 protein_id gnl|my_center|LOCUS_32170 17350 17985 gene locus_tag LOCUS_32180 17350 17985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 17999 19114 gene locus_tag LOCUS_32190 gene mnmA 17999 19114 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_32190 19189 19755 gene locus_tag LOCUS_32200 gene atpF 19189 19755 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462233.1 protein_id gnl|my_center|LOCUS_32200 19769 20314 gene locus_tag LOCUS_32210 gene atpH 19769 20314 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940786.1 protein_id gnl|my_center|LOCUS_32210 20318 21844 gene locus_tag LOCUS_32220 gene atpA 20318 21844 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940787.1 protein_id gnl|my_center|LOCUS_32220 21860 22735 gene locus_tag LOCUS_32230 21860 22735 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933687.1 protein_id gnl|my_center|LOCUS_32230 22923 24344 gene locus_tag LOCUS_32240 gene atpD 22923 24344 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940789.1 protein_id gnl|my_center|LOCUS_32240 24344 24772 gene locus_tag LOCUS_32250 24344 24772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 24945 25331 gene locus_tag LOCUS_32260 24945 25331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 25316 26071 gene locus_tag LOCUS_32270 25316 26071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 26133 26876 gene locus_tag LOCUS_32280 26133 26876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 26873 28393 gene locus_tag LOCUS_32290 26873 28393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 28456 28734 gene locus_tag LOCUS_32300 28456 28734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 28731 29027 gene locus_tag LOCUS_32310 28731 29027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 29024 29629 gene locus_tag LOCUS_32320 29024 29629 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098133.1 protein_id gnl|my_center|LOCUS_32320 29658 30407 gene locus_tag LOCUS_32330 29658 30407 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939330.1 protein_id gnl|my_center|LOCUS_32330 30541 31515 gene locus_tag LOCUS_32340 30541 31515 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259623.1 protein_id gnl|my_center|LOCUS_32340 31537 32151 gene locus_tag LOCUS_32350 31537 32151 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140612.1 protein_id gnl|my_center|LOCUS_32350 33466 32195 gene locus_tag LOCUS_32360 33466 32195 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943128.1 protein_id gnl|my_center|LOCUS_32360 34286 33495 gene locus_tag LOCUS_32370 34286 33495 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878702.1 protein_id gnl|my_center|LOCUS_32370 35062 34289 gene locus_tag LOCUS_32380 35062 34289 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973420.1 protein_id gnl|my_center|LOCUS_32380 36098 35088 gene locus_tag LOCUS_32390 36098 35088 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541610.1 protein_id gnl|my_center|LOCUS_32390 36915 36091 gene locus_tag LOCUS_32400 36915 36091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 37041 38510 gene locus_tag LOCUS_32410 37041 38510 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810284.1 protein_id gnl|my_center|LOCUS_32410 40014 38677 gene locus_tag LOCUS_32420 40014 38677 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893543.1 protein_id gnl|my_center|LOCUS_32420 40328 41620 gene locus_tag LOCUS_32430 40328 41620 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393752.1 protein_id gnl|my_center|LOCUS_32430 41613 42536 gene locus_tag LOCUS_32440 41613 42536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811766.1 protein_id gnl|my_center|LOCUS_32440 42706 43983 gene locus_tag LOCUS_32450 42706 43983 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546283.1 protein_id gnl|my_center|LOCUS_32450 44053 44925 gene locus_tag LOCUS_32460 44053 44925 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_32460 44929 45873 gene locus_tag LOCUS_32470 44929 45873 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039247.1 protein_id gnl|my_center|LOCUS_32470 45873 46595 gene locus_tag LOCUS_32480 45873 46595 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878326.1 protein_id gnl|my_center|LOCUS_32480 46585 47316 gene locus_tag LOCUS_32490 46585 47316 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_32490 >Feature sequence041 <1 1038 gene locus_tag LOCUS_32500 <1 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250933.1:pyruvate synthase subunit PorA 1043 1951 gene locus_tag LOCUS_32510 1043 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 1959 2741 gene locus_tag LOCUS_32520 1959 2741 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216585.1 protein_id gnl|my_center|LOCUS_32520 2791 3918 gene locus_tag LOCUS_32530 2791 3918 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704492.1 protein_id gnl|my_center|LOCUS_32530 3902 4690 gene locus_tag LOCUS_32540 3902 4690 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729455.1 protein_id gnl|my_center|LOCUS_32540 4774 5853 gene locus_tag LOCUS_32550 4774 5853 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967354.1 protein_id gnl|my_center|LOCUS_32550 5907 6116 gene locus_tag LOCUS_32560 5907 6116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 6170 7210 gene locus_tag LOCUS_32570 6170 7210 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567469.1 protein_id gnl|my_center|LOCUS_32570 7221 8948 gene locus_tag LOCUS_32580 7221 8948 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930994.1 protein_id gnl|my_center|LOCUS_32580 8952 10031 gene locus_tag LOCUS_32590 8952 10031 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812767.1 protein_id gnl|my_center|LOCUS_32590 10917 10063 gene locus_tag LOCUS_32600 10917 10063 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626403.1 protein_id gnl|my_center|LOCUS_32600 11175 12236 gene locus_tag LOCUS_32610 11175 12236 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256339.1 protein_id gnl|my_center|LOCUS_32610 13785 12262 gene locus_tag LOCUS_32620 13785 12262 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921024.1 protein_id gnl|my_center|LOCUS_32620 14990 13782 gene locus_tag LOCUS_32630 14990 13782 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093005186.1 protein_id gnl|my_center|LOCUS_32630 15156 15443 gene locus_tag LOCUS_32640 15156 15443 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919993.1 protein_id gnl|my_center|LOCUS_32640 15512 15784 gene locus_tag LOCUS_32650 15512 15784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 15969 16283 gene locus_tag LOCUS_32660 15969 16283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 16378 18225 gene locus_tag LOCUS_32670 16378 18225 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542552.1 protein_id gnl|my_center|LOCUS_32670 18225 19103 gene locus_tag LOCUS_32680 18225 19103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 19105 20256 gene locus_tag LOCUS_32690 19105 20256 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869713.1 protein_id gnl|my_center|LOCUS_32690 20253 21728 gene locus_tag LOCUS_32700 20253 21728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 22841 21759 gene locus_tag LOCUS_32710 22841 21759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 24640 22838 gene locus_tag LOCUS_32720 24640 22838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 24861 25871 gene locus_tag LOCUS_32730 24861 25871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 27771 25882 gene locus_tag LOCUS_32740 27771 25882 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868972.1 protein_id gnl|my_center|LOCUS_32740 28259 27786 gene locus_tag LOCUS_32750 28259 27786 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225733.1 protein_id gnl|my_center|LOCUS_32750 29476 28277 gene locus_tag LOCUS_32760 29476 28277 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040749.1 protein_id gnl|my_center|LOCUS_32760 29974 29576 gene locus_tag LOCUS_32770 29974 29576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32770 30193 30023 gene locus_tag LOCUS_32780 30193 30023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32780 30362 30898 gene locus_tag LOCUS_32790 30362 30898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 30962 31447 gene locus_tag LOCUS_32800 30962 31447 CDS product putative molybdenum carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404314.1 protein_id gnl|my_center|LOCUS_32800 31596 32129 gene locus_tag LOCUS_32810 31596 32129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 32316 33995 gene locus_tag LOCUS_32820 32316 33995 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534776.1 protein_id gnl|my_center|LOCUS_32820 33995 35047 gene locus_tag LOCUS_32830 33995 35047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 35315 36382 gene locus_tag LOCUS_32840 35315 36382 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119007.1 protein_id gnl|my_center|LOCUS_32840 36379 37527 gene locus_tag LOCUS_32850 36379 37527 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228882.1 protein_id gnl|my_center|LOCUS_32850 37550 38512 gene locus_tag LOCUS_32860 gene pdhA 37550 38512 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_32860 38505 39479 gene locus_tag LOCUS_32870 38505 39479 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259507.1 protein_id gnl|my_center|LOCUS_32870 39479 39727 gene locus_tag LOCUS_32880 39479 39727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 40017 40781 gene locus_tag LOCUS_32890 40017 40781 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090610.1 protein_id gnl|my_center|LOCUS_32890 40778 42313 gene locus_tag LOCUS_32900 40778 42313 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228885.1 protein_id gnl|my_center|LOCUS_32900 42310 43107 gene locus_tag LOCUS_32910 42310 43107 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373316.1 protein_id gnl|my_center|LOCUS_32910 >Feature sequence042 292 368 gene locus_tag LOCUS_t00330 292 368 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1394 492 gene locus_tag LOCUS_32920 1394 492 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767686.1 protein_id gnl|my_center|LOCUS_32920 1466 3094 gene locus_tag LOCUS_32930 1466 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 3125 4183 gene locus_tag LOCUS_32940 3125 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 4255 5007 gene locus_tag LOCUS_32950 4255 5007 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973996.1 protein_id gnl|my_center|LOCUS_32950 5004 5828 gene locus_tag LOCUS_32960 5004 5828 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803987.1 protein_id gnl|my_center|LOCUS_32960 5825 7483 gene locus_tag LOCUS_32970 5825 7483 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086403.1 protein_id gnl|my_center|LOCUS_32970 7480 9561 gene locus_tag LOCUS_32980 7480 9561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 9558 11036 gene locus_tag LOCUS_32990 9558 11036 CDS product acyclic terpene utilization AtuA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040992.1 protein_id gnl|my_center|LOCUS_32990 11029 12039 gene locus_tag LOCUS_33000 11029 12039 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070810.1 protein_id gnl|my_center|LOCUS_33000 12053 13924 gene locus_tag LOCUS_33010 12053 13924 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271912.1 protein_id gnl|my_center|LOCUS_33010 13955 14440 gene locus_tag LOCUS_33020 gene glmS 13955 14440 CDS product methylaspartate mutase subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583702.1 protein_id gnl|my_center|LOCUS_33020 14499 15998 gene locus_tag LOCUS_33030 14499 15998 CDS product methylaspartate mutase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460941.1 protein_id gnl|my_center|LOCUS_33030 16006 16320 gene locus_tag LOCUS_33040 16006 16320 CDS product DUF4387 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583697.1 protein_id gnl|my_center|LOCUS_33040 16317 17714 gene locus_tag LOCUS_33050 gene glmL 16317 17714 CDS product methylaspartate mutase accessory protein GlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945203.1 protein_id gnl|my_center|LOCUS_33050 17818 19182 gene locus_tag LOCUS_33060 17818 19182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 19182 19526 gene locus_tag LOCUS_33070 19182 19526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 19998 19606 gene locus_tag LOCUS_33080 gene pcaC 19998 19606 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705266.1 protein_id gnl|my_center|LOCUS_33080 20133 21638 gene locus_tag LOCUS_33090 gene accC 20133 21638 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_33090 21655 22152 gene locus_tag LOCUS_33100 21655 22152 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107788.1 protein_id gnl|my_center|LOCUS_33100 22157 22894 gene locus_tag LOCUS_33110 22157 22894 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031213610.1 protein_id gnl|my_center|LOCUS_33110 22905 23762 gene locus_tag LOCUS_33120 22905 23762 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939615.1 protein_id gnl|my_center|LOCUS_33120 23885 24610 gene locus_tag LOCUS_33130 23885 24610 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389841.1 protein_id gnl|my_center|LOCUS_33130 24813 25490 gene locus_tag LOCUS_33140 24813 25490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 25560 26672 gene locus_tag LOCUS_33150 25560 26672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 26659 27774 gene locus_tag LOCUS_33160 26659 27774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 29171 27771 gene locus_tag LOCUS_33170 29171 27771 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257411.1 protein_id gnl|my_center|LOCUS_33170 29616 29182 gene locus_tag LOCUS_33180 29616 29182 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640541.1 protein_id gnl|my_center|LOCUS_33180 30017 29769 gene locus_tag LOCUS_33190 30017 29769 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349604.1 protein_id gnl|my_center|LOCUS_33190 31803 30172 gene locus_tag LOCUS_33200 31803 30172 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980180.1 protein_id gnl|my_center|LOCUS_33200 31955 34018 gene locus_tag LOCUS_33210 31955 34018 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244479.1 protein_id gnl|my_center|LOCUS_33210 34022 34942 gene locus_tag LOCUS_33220 34022 34942 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727690.1 protein_id gnl|my_center|LOCUS_33220 35030 35737 gene locus_tag LOCUS_33230 35030 35737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 35753 37405 gene locus_tag LOCUS_33240 35753 37405 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972394.1 protein_id gnl|my_center|LOCUS_33240 37402 38427 gene locus_tag LOCUS_33250 37402 38427 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807842.1 protein_id gnl|my_center|LOCUS_33250 38428 38874 gene locus_tag LOCUS_33260 38428 38874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 39022 39654 gene locus_tag LOCUS_33270 39022 39654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 39651 40982 gene locus_tag LOCUS_33280 39651 40982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 >Feature sequence043 2898 136 gene locus_tag LOCUS_33290 2898 136 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941349.1 protein_id gnl|my_center|LOCUS_33290 4056 2983 gene locus_tag LOCUS_33300 4056 2983 CDS product myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257445.1 protein_id gnl|my_center|LOCUS_33300 5147 4137 gene locus_tag LOCUS_33310 5147 4137 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539843.1 protein_id gnl|my_center|LOCUS_33310 6402 5212 gene locus_tag LOCUS_33320 6402 5212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 7144 6404 gene locus_tag LOCUS_33330 7144 6404 CDS product phosphocholine cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188389.1 protein_id gnl|my_center|LOCUS_33330 7320 7141 gene locus_tag LOCUS_33340 7320 7141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 8049 7399 gene locus_tag LOCUS_33350 8049 7399 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546348.1 protein_id gnl|my_center|LOCUS_33350 9500 8046 gene locus_tag LOCUS_33360 9500 8046 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544922.1 protein_id gnl|my_center|LOCUS_33360 9967 9527 gene locus_tag LOCUS_33370 gene mlaD 9967 9527 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941481.1 protein_id gnl|my_center|LOCUS_33370 10907 10161 gene locus_tag LOCUS_33380 10907 10161 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_33380 11710 10904 gene locus_tag LOCUS_33390 11710 10904 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545987.1 protein_id gnl|my_center|LOCUS_33390 13662 11707 gene locus_tag LOCUS_33400 gene shc 13662 11707 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941348.1 protein_id gnl|my_center|LOCUS_33400 13799 14599 gene locus_tag LOCUS_33410 13799 14599 CDS product carotenoid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942543.1 protein_id gnl|my_center|LOCUS_33410 14735 15751 gene locus_tag LOCUS_33420 gene hpnH 14735 15751 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056444.1 protein_id gnl|my_center|LOCUS_33420 15753 16085 gene locus_tag LOCUS_33430 15753 16085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 16090 16797 gene locus_tag LOCUS_33440 16090 16797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 16809 17822 gene locus_tag LOCUS_33450 16809 17822 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_33450 17819 18700 gene locus_tag LOCUS_33460 gene hpnD 17819 18700 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_33460 18872 19882 gene locus_tag LOCUS_33470 18872 19882 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920875.1 protein_id gnl|my_center|LOCUS_33470 19879 20910 gene locus_tag LOCUS_33480 19879 20910 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140373.1 protein_id gnl|my_center|LOCUS_33480 21792 21049 gene locus_tag LOCUS_33490 21792 21049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 23158 22238 gene locus_tag LOCUS_33500 23158 22238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 24422 23190 gene locus_tag LOCUS_33510 24422 23190 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044915.1 protein_id gnl|my_center|LOCUS_33510 25250 24522 gene locus_tag LOCUS_33520 gene purN 25250 24522 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938037.1 protein_id gnl|my_center|LOCUS_33520 26149 25247 gene locus_tag LOCUS_33530 26149 25247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 27498 26578 gene locus_tag LOCUS_33540 27498 26578 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147026359.1 protein_id gnl|my_center|LOCUS_33540 27961 27512 gene locus_tag LOCUS_33550 27961 27512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 28306 28545 gene locus_tag LOCUS_33560 28306 28545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 29571 28615 gene locus_tag LOCUS_33570 29571 28615 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088351.1 protein_id gnl|my_center|LOCUS_33570 30683 29892 gene locus_tag LOCUS_33580 30683 29892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 31139 31705 gene locus_tag LOCUS_33590 31139 31705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 33126 31873 gene locus_tag LOCUS_33600 33126 31873 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941161.1 protein_id gnl|my_center|LOCUS_33600 33817 33233 gene locus_tag LOCUS_33610 33817 33233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 34017 34292 gene locus_tag LOCUS_33620 34017 34292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 34311 35168 gene locus_tag LOCUS_33630 34311 35168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 35769 35263 gene locus_tag LOCUS_33640 35769 35263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 36073 36243 gene locus_tag LOCUS_33650 36073 36243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 36576 36385 gene locus_tag LOCUS_33660 36576 36385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 36711 37460 gene locus_tag LOCUS_33670 36711 37460 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530738.1 protein_id gnl|my_center|LOCUS_33670 37523 38083 gene locus_tag LOCUS_33680 37523 38083 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969365.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33680 39288 38092 gene locus_tag LOCUS_33690 39288 38092 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263449.1 protein_id gnl|my_center|LOCUS_33690 39510 40145 gene locus_tag LOCUS_33700 39510 40145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 >Feature sequence044 <1 709 gene locus_tag LOCUS_33710 <1 709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027423.1:FAD-dependent oxidoreductase 2574 802 gene locus_tag LOCUS_33720 2574 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 2637 2957 gene locus_tag LOCUS_33730 2637 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 3378 3869 gene locus_tag LOCUS_33740 3378 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 3866 4516 gene locus_tag LOCUS_33750 3866 4516 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546348.1 protein_id gnl|my_center|LOCUS_33750 5145 4570 gene locus_tag LOCUS_33760 5145 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33760 7455 5917 gene locus_tag LOCUS_33770 7455 5917 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392501.1 protein_id gnl|my_center|LOCUS_33770 9335 7452 gene locus_tag LOCUS_33780 gene nuoL 9335 7452 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392500.1 protein_id gnl|my_center|LOCUS_33780 9645 9346 gene locus_tag LOCUS_33790 gene nuoK 9645 9346 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257849.1 protein_id gnl|my_center|LOCUS_33790 10212 9718 gene locus_tag LOCUS_33800 10212 9718 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392498.1 protein_id gnl|my_center|LOCUS_33800 10772 10209 gene locus_tag LOCUS_33810 10772 10209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 11745 10765 gene locus_tag LOCUS_33820 gene nuoH 11745 10765 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392496.1 protein_id gnl|my_center|LOCUS_33820 12908 11748 gene locus_tag LOCUS_33830 12908 11748 CDS product NAD(P)H-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057128.1 protein_id gnl|my_center|LOCUS_33830 13593 12958 gene locus_tag LOCUS_33840 13593 12958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 14063 13611 gene locus_tag LOCUS_33850 14063 13611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 14706 14068 gene locus_tag LOCUS_33860 14706 14068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 15050 14697 gene locus_tag LOCUS_33870 gene ndhC 15050 14697 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932448.1 protein_id gnl|my_center|LOCUS_33870 15160 16104 gene locus_tag LOCUS_33880 15160 16104 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_33880 16138 16656 gene locus_tag LOCUS_33890 gene purE 16138 16656 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172593.1 protein_id gnl|my_center|LOCUS_33890 16968 16669 gene locus_tag LOCUS_33900 16968 16669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 18371 17076 gene locus_tag LOCUS_33910 18371 17076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 20333 18387 gene locus_tag LOCUS_33920 20333 18387 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877962.1 protein_id gnl|my_center|LOCUS_33920 20760 20341 gene locus_tag LOCUS_33930 20760 20341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 22547 20757 gene locus_tag LOCUS_33940 22547 20757 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393370.1 protein_id gnl|my_center|LOCUS_33940 23398 22553 gene locus_tag LOCUS_33950 23398 22553 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392933.1 protein_id gnl|my_center|LOCUS_33950 23712 24602 gene locus_tag LOCUS_33960 23712 24602 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258401.1 protein_id gnl|my_center|LOCUS_33960 25385 24636 gene locus_tag LOCUS_33970 25385 24636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33970 25975 25346 gene locus_tag LOCUS_33980 25975 25346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33980 26203 27924 gene locus_tag LOCUS_33990 26203 27924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 27971 28180 gene locus_tag LOCUS_34000 27971 28180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 28721 28329 gene locus_tag LOCUS_34010 28721 28329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 29186 28725 gene locus_tag LOCUS_34020 29186 28725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34020 30539 29277 gene locus_tag LOCUS_34030 30539 29277 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893543.1 protein_id gnl|my_center|LOCUS_34030 32083 30605 gene locus_tag LOCUS_34040 32083 30605 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243012.1 protein_id gnl|my_center|LOCUS_34040 32410 33288 gene locus_tag LOCUS_34050 32410 33288 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065249.1 protein_id gnl|my_center|LOCUS_34050 33302 34567 gene locus_tag LOCUS_34060 33302 34567 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093005186.1 protein_id gnl|my_center|LOCUS_34060 34666 35751 gene locus_tag LOCUS_34070 34666 35751 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228883.1 protein_id gnl|my_center|LOCUS_34070 35990 36985 gene locus_tag LOCUS_34080 gene pdhA 35990 36985 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_34080 36982 37986 gene locus_tag LOCUS_34090 36982 37986 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259507.1 protein_id gnl|my_center|LOCUS_34090 37983 38225 gene locus_tag LOCUS_34100 37983 38225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 38233 38418 gene locus_tag LOCUS_34110 38233 38418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 >Feature sequence045 1048 5 gene locus_tag LOCUS_34120 1048 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 1275 1051 gene locus_tag LOCUS_34130 1275 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34130 1795 2064 gene locus_tag LOCUS_34140 1795 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 2061 2393 gene locus_tag LOCUS_34150 2061 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 2745 3236 gene locus_tag LOCUS_34160 2745 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 3576 3214 gene locus_tag LOCUS_34170 3576 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 4688 3573 gene locus_tag LOCUS_34180 4688 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258442.1 protein_id gnl|my_center|LOCUS_34180 5254 4859 gene locus_tag LOCUS_34190 5254 4859 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228912.1 protein_id gnl|my_center|LOCUS_34190 5591 5923 gene locus_tag LOCUS_34200 5591 5923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 6101 5892 gene locus_tag LOCUS_34210 6101 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 6286 6107 gene locus_tag LOCUS_34220 6286 6107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 6735 7205 gene locus_tag LOCUS_34230 6735 7205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 8557 7271 gene locus_tag LOCUS_34240 8557 7271 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089286.1 protein_id gnl|my_center|LOCUS_34240 9577 8597 gene locus_tag LOCUS_34250 9577 8597 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731049.1 protein_id gnl|my_center|LOCUS_34250 9688 10899 gene locus_tag LOCUS_34260 9688 10899 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031151.1 protein_id gnl|my_center|LOCUS_34260 11949 11014 gene locus_tag LOCUS_34270 11949 11014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 16076 11940 gene locus_tag LOCUS_34280 16076 11940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 17827 16691 gene locus_tag LOCUS_34290 gene purM 17827 16691 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876828.1 protein_id gnl|my_center|LOCUS_34290 18679 18377 gene locus_tag LOCUS_34300 18679 18377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 19338 18679 gene locus_tag LOCUS_34310 19338 18679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 20369 19530 gene locus_tag LOCUS_34320 20369 19530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 21351 20974 gene locus_tag LOCUS_34330 21351 20974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 21576 21361 gene locus_tag LOCUS_34340 21576 21361 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_34340 22192 22117 gene locus_tag LOCUS_t00340 22192 22117 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 22331 22255 gene locus_tag LOCUS_t00350 22331 22255 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 22433 22357 gene locus_tag LOCUS_t00360 22433 22357 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 23399 22485 gene locus_tag LOCUS_34350 gene rfbD 23399 22485 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403367.1 protein_id gnl|my_center|LOCUS_34350 23605 24111 gene locus_tag LOCUS_34360 23605 24111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 24148 24630 gene locus_tag LOCUS_34370 24148 24630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 24627 25376 gene locus_tag LOCUS_34380 24627 25376 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144067654.1 protein_id gnl|my_center|LOCUS_34380 26342 25521 gene locus_tag LOCUS_34390 26342 25521 CDS product Rv2407 family type 3 sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412350.1 protein_id gnl|my_center|LOCUS_34390 28401 26353 gene locus_tag LOCUS_34400 28401 26353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 29537 28398 gene locus_tag LOCUS_34410 29537 28398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 30253 29606 gene locus_tag LOCUS_34420 30253 29606 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117124.1 protein_id gnl|my_center|LOCUS_34420 31635 30250 gene locus_tag LOCUS_34430 31635 30250 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258001.1 protein_id gnl|my_center|LOCUS_34430 32827 31640 gene locus_tag LOCUS_34440 32827 31640 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257999.1 protein_id gnl|my_center|LOCUS_34440 34469 32997 gene locus_tag LOCUS_34450 34469 32997 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143062.1 protein_id gnl|my_center|LOCUS_34450 36071 34485 gene locus_tag LOCUS_34460 36071 34485 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229603.1 protein_id gnl|my_center|LOCUS_34460 36221 36147 gene locus_tag LOCUS_t00370 36221 36147 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 36512 36297 gene locus_tag LOCUS_34470 36512 36297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 37129 36527 gene locus_tag LOCUS_34480 gene recR 37129 36527 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_34480 37443 37129 gene locus_tag LOCUS_34490 37443 37129 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546807.1 protein_id gnl|my_center|LOCUS_34490 39188 37440 gene locus_tag LOCUS_34500 39188 37440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 >Feature sequence046 329 2122 gene locus_tag LOCUS_34510 329 2122 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_34510 2296 4131 gene locus_tag LOCUS_34520 2296 4131 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_34520 4128 4898 gene locus_tag LOCUS_34530 4128 4898 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_34530 5079 5642 gene locus_tag LOCUS_34540 5079 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 5655 6140 gene locus_tag LOCUS_34550 5655 6140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 6146 6679 gene locus_tag LOCUS_34560 6146 6679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 6694 7917 gene locus_tag LOCUS_34570 6694 7917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 7914 8612 gene locus_tag LOCUS_34580 7914 8612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 8795 9856 gene locus_tag LOCUS_34590 gene pilM 8795 9856 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181416674.1 protein_id gnl|my_center|LOCUS_34590 9853 10395 gene locus_tag LOCUS_34600 9853 10395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 10399 11049 gene locus_tag LOCUS_34610 gene pilO 10399 11049 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765501.1 protein_id gnl|my_center|LOCUS_34610 11187 11516 gene locus_tag LOCUS_34620 11187 11516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 11532 13874 gene locus_tag LOCUS_34630 11532 13874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 13879 15051 gene locus_tag LOCUS_34640 gene aroC 13879 15051 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_34640 15106 16200 gene locus_tag LOCUS_34650 gene aroB 15106 16200 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942668.1 protein_id gnl|my_center|LOCUS_34650 16291 16953 gene locus_tag LOCUS_34660 16291 16953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 16958 17527 gene locus_tag LOCUS_34670 gene efp 16958 17527 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_34670 17532 18020 gene locus_tag LOCUS_34680 17532 18020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 18052 19386 gene locus_tag LOCUS_34690 gene accC 18052 19386 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142010.1 protein_id gnl|my_center|LOCUS_34690 19393 20037 gene locus_tag LOCUS_34700 gene thiE 19393 20037 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106006557.1 protein_id gnl|my_center|LOCUS_34700 20107 21315 gene locus_tag LOCUS_34710 20107 21315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 20800 20721 gene locus_tag LOCUS_t00380 20800 20721 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 21369 22358 gene locus_tag LOCUS_34720 21369 22358 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228603.1 protein_id gnl|my_center|LOCUS_34720 22358 23665 gene locus_tag LOCUS_34730 22358 23665 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256820.1 protein_id gnl|my_center|LOCUS_34730 23667 24464 gene locus_tag LOCUS_34740 23667 24464 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256821.1 protein_id gnl|my_center|LOCUS_34740 24472 25176 gene locus_tag LOCUS_34750 24472 25176 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173391.1 protein_id gnl|my_center|LOCUS_34750 25233 25523 gene locus_tag LOCUS_34760 25233 25523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 25523 25945 gene locus_tag LOCUS_34770 25523 25945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 26000 26458 gene locus_tag LOCUS_34780 26000 26458 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064568.1 protein_id gnl|my_center|LOCUS_34780 26458 27432 gene locus_tag LOCUS_34790 26458 27432 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258703.1 protein_id gnl|my_center|LOCUS_34790 27491 28669 gene locus_tag LOCUS_34800 27491 28669 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897686.1 protein_id gnl|my_center|LOCUS_34800 28669 30438 gene locus_tag LOCUS_34810 28669 30438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 30450 32498 gene locus_tag LOCUS_34820 30450 32498 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228476.1 protein_id gnl|my_center|LOCUS_34820 32815 32495 gene locus_tag LOCUS_34830 32815 32495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 32899 33864 gene locus_tag LOCUS_34840 32899 33864 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102239.1 protein_id gnl|my_center|LOCUS_34840 34232 35653 gene locus_tag LOCUS_34850 34232 35653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 36431 36051 gene locus_tag LOCUS_34860 36431 36051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 >Feature sequence047 1874 2416 gene locus_tag LOCUS_34870 1874 2416 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876951.1 protein_id gnl|my_center|LOCUS_34870 2419 4014 gene locus_tag LOCUS_34880 2419 4014 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_34880 4197 5024 gene locus_tag LOCUS_34890 4197 5024 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391615.1 protein_id gnl|my_center|LOCUS_34890 5251 6108 gene locus_tag LOCUS_34900 5251 6108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 6109 6651 gene locus_tag LOCUS_34910 6109 6651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 6700 7395 gene locus_tag LOCUS_34920 6700 7395 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391616.1 protein_id gnl|my_center|LOCUS_34920 7431 8207 gene locus_tag LOCUS_34930 gene modA 7431 8207 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258350.1 protein_id gnl|my_center|LOCUS_34930 8211 8867 gene locus_tag LOCUS_34940 gene modB 8211 8867 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937491.1 protein_id gnl|my_center|LOCUS_34940 9019 10137 gene locus_tag LOCUS_34950 9019 10137 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393322.1 protein_id gnl|my_center|LOCUS_34950 10134 11225 gene locus_tag LOCUS_34960 10134 11225 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391617.1 protein_id gnl|my_center|LOCUS_34960 11330 11560 gene locus_tag LOCUS_34970 11330 11560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 11586 12098 gene locus_tag LOCUS_34980 gene moaC 11586 12098 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306447.1 protein_id gnl|my_center|LOCUS_34980 12095 13222 gene locus_tag LOCUS_34990 12095 13222 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941879.1 protein_id gnl|my_center|LOCUS_34990 13329 13565 gene locus_tag LOCUS_35000 13329 13565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 13661 14299 gene locus_tag LOCUS_35010 gene tmk 13661 14299 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939417.1 protein_id gnl|my_center|LOCUS_35010 14307 15212 gene locus_tag LOCUS_35020 gene holB 14307 15212 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_35020 15220 16095 gene locus_tag LOCUS_35030 15220 16095 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_35030 16364 18265 gene locus_tag LOCUS_35040 gene metG 16364 18265 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939333.1 protein_id gnl|my_center|LOCUS_35040 18278 19264 gene locus_tag LOCUS_35050 18278 19264 CDS product DUF5924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266162.1 protein_id gnl|my_center|LOCUS_35050 19276 20055 gene locus_tag LOCUS_35060 19276 20055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 20067 20846 gene locus_tag LOCUS_35070 20067 20846 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729561.1 protein_id gnl|my_center|LOCUS_35070 23400 21025 gene locus_tag LOCUS_35080 23400 21025 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088977.1 protein_id gnl|my_center|LOCUS_35080 23882 23397 gene locus_tag LOCUS_35090 23882 23397 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088978.1 protein_id gnl|my_center|LOCUS_35090 24741 23884 gene locus_tag LOCUS_35100 24741 23884 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088979.1 protein_id gnl|my_center|LOCUS_35100 25173 24823 gene locus_tag LOCUS_35110 25173 24823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 25409 27190 gene locus_tag LOCUS_35120 25409 27190 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_35120 27194 29230 gene locus_tag LOCUS_35130 27194 29230 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162491196.1 protein_id gnl|my_center|LOCUS_35130 29482 29276 gene locus_tag LOCUS_35140 29482 29276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 29644 30441 gene locus_tag LOCUS_35150 29644 30441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 30446 30895 gene locus_tag LOCUS_35160 30446 30895 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040690.1 protein_id gnl|my_center|LOCUS_35160 30892 31290 gene locus_tag LOCUS_35170 30892 31290 CDS product Rid family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808978.1 protein_id gnl|my_center|LOCUS_35170 31296 31742 gene locus_tag LOCUS_35180 31296 31742 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978024.1 protein_id gnl|my_center|LOCUS_35180 31739 33910 gene locus_tag LOCUS_35190 31739 33910 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957058.1 protein_id gnl|my_center|LOCUS_35190 33941 34900 gene locus_tag LOCUS_35200 33941 34900 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070810.1 protein_id gnl|my_center|LOCUS_35200 >Feature sequence048 <1 889 gene locus_tag LOCUS_35210 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005902562.1:ABC transporter permease 886 1833 gene locus_tag LOCUS_35220 886 1833 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267881.1 protein_id gnl|my_center|LOCUS_35220 1919 3466 gene locus_tag LOCUS_35230 1919 3466 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729759.1 protein_id gnl|my_center|LOCUS_35230 3475 4641 gene locus_tag LOCUS_35240 3475 4641 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061151682.1 protein_id gnl|my_center|LOCUS_35240 4638 5030 gene locus_tag LOCUS_35250 4638 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 5058 6743 gene locus_tag LOCUS_35260 5058 6743 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250100.1 protein_id gnl|my_center|LOCUS_35260 6824 7759 gene locus_tag LOCUS_35270 6824 7759 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225690.1 protein_id gnl|my_center|LOCUS_35270 7815 8999 gene locus_tag LOCUS_35280 7815 8999 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938013.1 protein_id gnl|my_center|LOCUS_35280 9061 9936 gene locus_tag LOCUS_35290 9061 9936 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965993.1 protein_id gnl|my_center|LOCUS_35290 9938 10966 gene locus_tag LOCUS_35300 9938 10966 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253118.1 protein_id gnl|my_center|LOCUS_35300 10970 11746 gene locus_tag LOCUS_35310 10970 11746 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938016.1 protein_id gnl|my_center|LOCUS_35310 11748 12440 gene locus_tag LOCUS_35320 11748 12440 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680283.1 protein_id gnl|my_center|LOCUS_35320 12681 14717 gene locus_tag LOCUS_35330 12681 14717 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528563.1 protein_id gnl|my_center|LOCUS_35330 14714 16531 gene locus_tag LOCUS_35340 14714 16531 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528562.1 protein_id gnl|my_center|LOCUS_35340 16528 18501 gene locus_tag LOCUS_35350 16528 18501 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878757.1 protein_id gnl|my_center|LOCUS_35350 18640 19287 gene locus_tag LOCUS_35360 18640 19287 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969401.1 protein_id gnl|my_center|LOCUS_35360 19302 20321 gene locus_tag LOCUS_35370 19302 20321 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957832.1 protein_id gnl|my_center|LOCUS_35370 20321 21790 gene locus_tag LOCUS_35380 gene tcuA 20321 21790 CDS product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966591.1 protein_id gnl|my_center|LOCUS_35380 21774 22241 gene locus_tag LOCUS_35390 21774 22241 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 protein_id gnl|my_center|LOCUS_35390 22258 22983 gene locus_tag LOCUS_35400 22258 22983 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938016.1 protein_id gnl|my_center|LOCUS_35400 22964 23683 gene locus_tag LOCUS_35410 22964 23683 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173391.1 protein_id gnl|my_center|LOCUS_35410 23706 24950 gene locus_tag LOCUS_35420 23706 24950 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546283.1 protein_id gnl|my_center|LOCUS_35420 24966 25838 gene locus_tag LOCUS_35430 24966 25838 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_35430 25835 26800 gene locus_tag LOCUS_35440 25835 26800 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809683.1 protein_id gnl|my_center|LOCUS_35440 26790 28415 gene locus_tag LOCUS_35450 26790 28415 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869041.1 protein_id gnl|my_center|LOCUS_35450 29681 28518 gene locus_tag LOCUS_35460 29681 28518 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958401.1 protein_id gnl|my_center|LOCUS_35460 30788 29706 gene locus_tag LOCUS_35470 gene serC 30788 29706 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393775.1 protein_id gnl|my_center|LOCUS_35470 31663 30881 gene locus_tag LOCUS_35480 31663 30881 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533049.1 protein_id gnl|my_center|LOCUS_35480 33395 31797 gene locus_tag LOCUS_35490 33395 31797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 32280 32201 gene locus_tag LOCUS_t00390 32280 32201 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 34490 33429 gene locus_tag LOCUS_35500 34490 33429 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054879788.1 protein_id gnl|my_center|LOCUS_35500 34969 34730 gene locus_tag LOCUS_35510 34969 34730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 >Feature sequence049 647 30 gene locus_tag LOCUS_35520 647 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 1174 644 gene locus_tag LOCUS_35530 1174 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 1671 1171 gene locus_tag LOCUS_35540 1671 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 1820 2191 gene locus_tag LOCUS_35550 1820 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 2352 3359 gene locus_tag LOCUS_35560 2352 3359 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229093.1 protein_id gnl|my_center|LOCUS_35560 3363 4139 gene locus_tag LOCUS_35570 3363 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 4162 5145 gene locus_tag LOCUS_35580 4162 5145 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869565.1 protein_id gnl|my_center|LOCUS_35580 5146 7020 gene locus_tag LOCUS_35590 5146 7020 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957058.1 protein_id gnl|my_center|LOCUS_35590 7093 8415 gene locus_tag LOCUS_35600 7093 8415 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270475.1 protein_id gnl|my_center|LOCUS_35600 8809 8369 gene locus_tag LOCUS_35610 8809 8369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 10398 8806 gene locus_tag LOCUS_35620 10398 8806 CDS product indolepyruvate oxidoreductase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086194.1 protein_id gnl|my_center|LOCUS_35620 12497 10398 gene locus_tag LOCUS_35630 12497 10398 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527966.1 protein_id gnl|my_center|LOCUS_35630 12603 14339 gene locus_tag LOCUS_35640 12603 14339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 14336 15502 gene locus_tag LOCUS_35650 14336 15502 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535741.1 protein_id gnl|my_center|LOCUS_35650 16196 15576 gene locus_tag LOCUS_35660 16196 15576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 16685 16242 gene locus_tag LOCUS_35670 16685 16242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 17872 16682 gene locus_tag LOCUS_35680 17872 16682 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_35680 18367 17882 gene locus_tag LOCUS_35690 gene coaD 18367 17882 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941899.1 protein_id gnl|my_center|LOCUS_35690 18969 18415 gene locus_tag LOCUS_35700 gene rsmD 18969 18415 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392453.1 protein_id gnl|my_center|LOCUS_35700 21108 18982 gene locus_tag LOCUS_35710 gene recG 21108 18982 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941980.1 protein_id gnl|my_center|LOCUS_35710 21186 21377 gene locus_tag LOCUS_35720 gene rpmB 21186 21377 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012547624.1 protein_id gnl|my_center|LOCUS_35720 22728 21709 gene locus_tag LOCUS_35730 22728 21709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 23250 22879 gene locus_tag LOCUS_35740 23250 22879 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087492.1 protein_id gnl|my_center|LOCUS_35740 25470 23323 gene locus_tag LOCUS_35750 25470 23323 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_35750 26451 25513 gene locus_tag LOCUS_35760 gene secF 26451 25513 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085009790.1 protein_id gnl|my_center|LOCUS_35760 28077 26464 gene locus_tag LOCUS_35770 gene secD 28077 26464 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546364.1 protein_id gnl|my_center|LOCUS_35770 28412 28077 gene locus_tag LOCUS_35780 gene yajC 28412 28077 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931759.1 protein_id gnl|my_center|LOCUS_35780 29576 28419 gene locus_tag LOCUS_35790 gene tgt 29576 28419 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_35790 30617 29577 gene locus_tag LOCUS_35800 gene queA 30617 29577 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393197.1 protein_id gnl|my_center|LOCUS_35800 31020 30637 gene locus_tag LOCUS_35810 31020 30637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 31393 31022 gene locus_tag LOCUS_35820 31393 31022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 31503 32369 gene locus_tag LOCUS_35830 31503 32369 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917983.1 protein_id gnl|my_center|LOCUS_35830 32359 33309 gene locus_tag LOCUS_35840 gene pdhA 32359 33309 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_35840 33306 34361 gene locus_tag LOCUS_35850 33306 34361 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259507.1 protein_id gnl|my_center|LOCUS_35850 34718 34362 gene locus_tag LOCUS_35860 34718 34362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 >Feature sequence050 1608 127 gene locus_tag LOCUS_35870 1608 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 1889 1608 gene locus_tag LOCUS_35880 1889 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 2107 2808 gene locus_tag LOCUS_35890 2107 2808 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258474.1 protein_id gnl|my_center|LOCUS_35890 2821 4413 gene locus_tag LOCUS_35900 2821 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 4418 5344 gene locus_tag LOCUS_35910 4418 5344 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229489.1 protein_id gnl|my_center|LOCUS_35910 5924 5589 gene locus_tag LOCUS_35920 5924 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 6147 5911 gene locus_tag LOCUS_35930 6147 5911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 7163 6435 gene locus_tag LOCUS_35940 7163 6435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 7704 7153 gene locus_tag LOCUS_35950 7704 7153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 8469 7819 gene locus_tag LOCUS_35960 gene fsa 8469 7819 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870474.1 protein_id gnl|my_center|LOCUS_35960 8840 8502 gene locus_tag LOCUS_35970 8840 8502 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393092.1 protein_id gnl|my_center|LOCUS_35970 9777 8923 gene locus_tag LOCUS_35980 9777 8923 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256060.1 protein_id gnl|my_center|LOCUS_35980 10977 9829 gene locus_tag LOCUS_35990 10977 9829 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807953.1 protein_id gnl|my_center|LOCUS_35990 12259 10982 gene locus_tag LOCUS_36000 12259 10982 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256967.1 protein_id gnl|my_center|LOCUS_36000 13041 12247 gene locus_tag LOCUS_36010 13041 12247 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_36010 14352 13111 gene locus_tag LOCUS_36020 14352 13111 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104318.1 protein_id gnl|my_center|LOCUS_36020 15445 14378 gene locus_tag LOCUS_36030 15445 14378 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256970.1 protein_id gnl|my_center|LOCUS_36030 15368 15463 gene locus_tag LOCUS_t00400 15368 15463 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 16384 15491 gene locus_tag LOCUS_36040 16384 15491 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227944.1 protein_id gnl|my_center|LOCUS_36040 18296 16377 gene locus_tag LOCUS_36050 18296 16377 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256972.1 protein_id gnl|my_center|LOCUS_36050 19113 18289 gene locus_tag LOCUS_36060 19113 18289 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256973.1 protein_id gnl|my_center|LOCUS_36060 19454 19101 gene locus_tag LOCUS_36070 19454 19101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36070 21248 19926 gene locus_tag LOCUS_36080 21248 19926 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104318.1 protein_id gnl|my_center|LOCUS_36080 22341 21265 gene locus_tag LOCUS_36090 22341 21265 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719437.1 protein_id gnl|my_center|LOCUS_36090 23359 22421 gene locus_tag LOCUS_36100 23359 22421 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719438.1 protein_id gnl|my_center|LOCUS_36100 24157 23369 gene locus_tag LOCUS_36110 24157 23369 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566968.1 protein_id gnl|my_center|LOCUS_36110 26145 24154 gene locus_tag LOCUS_36120 26145 24154 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807270.1 protein_id gnl|my_center|LOCUS_36120 27881 26355 gene locus_tag LOCUS_36130 27881 26355 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459464.1 protein_id gnl|my_center|LOCUS_36130 28347 27892 gene locus_tag LOCUS_36140 28347 27892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 29349 28366 gene locus_tag LOCUS_36150 29349 28366 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813864.1 protein_id gnl|my_center|LOCUS_36150 30554 29364 gene locus_tag LOCUS_36160 30554 29364 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087142.1 protein_id gnl|my_center|LOCUS_36160 30757 30551 gene locus_tag LOCUS_36170 30757 30551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 31272 30754 gene locus_tag LOCUS_36180 31272 30754 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977514.1 protein_id gnl|my_center|LOCUS_36180 32506 31292 gene locus_tag LOCUS_36190 32506 31292 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087142.1 protein_id gnl|my_center|LOCUS_36190 32683 33474 gene locus_tag LOCUS_36200 32683 33474 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088777.1 protein_id gnl|my_center|LOCUS_36200 33626 34135 gene locus_tag LOCUS_36210 33626 34135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 34565 34221 gene locus_tag LOCUS_36220 34565 34221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 >Feature sequence051 400 1107 gene locus_tag LOCUS_36230 400 1107 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_36230 1260 1574 gene locus_tag LOCUS_36240 1260 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 1601 3064 gene locus_tag LOCUS_36250 1601 3064 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_36250 3084 4175 gene locus_tag LOCUS_36260 3084 4175 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141365.1 protein_id gnl|my_center|LOCUS_36260 4261 4839 gene locus_tag LOCUS_36270 4261 4839 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143070.1 protein_id gnl|my_center|LOCUS_36270 4836 5414 gene locus_tag LOCUS_36280 4836 5414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 6085 6852 gene locus_tag LOCUS_36290 6085 6852 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392440.1 protein_id gnl|my_center|LOCUS_36290 7355 11272 gene locus_tag LOCUS_36300 7355 11272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 11491 12789 gene locus_tag LOCUS_36310 11491 12789 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969447.1 protein_id gnl|my_center|LOCUS_36310 12830 13684 gene locus_tag LOCUS_36320 12830 13684 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244087.1 protein_id gnl|my_center|LOCUS_36320 13684 14514 gene locus_tag LOCUS_36330 13684 14514 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533026.1 protein_id gnl|my_center|LOCUS_36330 14533 15915 gene locus_tag LOCUS_36340 14533 15915 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_36340 16044 19532 gene locus_tag LOCUS_36350 16044 19532 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227656.1 protein_id gnl|my_center|LOCUS_36350 19662 20867 gene locus_tag LOCUS_36360 19662 20867 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036408.1 protein_id gnl|my_center|LOCUS_36360 21308 20889 gene locus_tag LOCUS_36370 21308 20889 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918826.1 protein_id gnl|my_center|LOCUS_36370 21705 22820 gene locus_tag LOCUS_36380 21705 22820 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024104.1 protein_id gnl|my_center|LOCUS_36380 22817 24736 gene locus_tag LOCUS_36390 gene iorA 22817 24736 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877454.1 protein_id gnl|my_center|LOCUS_36390 24753 25565 gene locus_tag LOCUS_36400 24753 25565 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459465.1 protein_id gnl|my_center|LOCUS_36400 25562 26236 gene locus_tag LOCUS_36410 25562 26236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814087.1 protein_id gnl|my_center|LOCUS_36410 26233 26856 gene locus_tag LOCUS_36420 26233 26856 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249090.1 protein_id gnl|my_center|LOCUS_36420 27085 28221 gene locus_tag LOCUS_36430 27085 28221 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_36430 28603 28274 gene locus_tag LOCUS_36440 28603 28274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36440 28768 28622 gene locus_tag LOCUS_36450 28768 28622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 29342 28854 gene locus_tag LOCUS_36460 29342 28854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 29654 29406 gene locus_tag LOCUS_36470 29654 29406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 30328 29672 gene locus_tag LOCUS_36480 30328 29672 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204015.1 protein_id gnl|my_center|LOCUS_36480 30963 30373 gene locus_tag LOCUS_36490 30963 30373 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388643.1 protein_id gnl|my_center|LOCUS_36490 31038 31748 gene locus_tag LOCUS_36500 31038 31748 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256873.1 protein_id gnl|my_center|LOCUS_36500 32500 31811 gene locus_tag LOCUS_36510 32500 31811 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460538.1 protein_id gnl|my_center|LOCUS_36510 33480 32650 gene locus_tag LOCUS_36520 33480 32650 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082427.1 protein_id gnl|my_center|LOCUS_36520 34390 33497 gene locus_tag LOCUS_36530 34390 33497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 >Feature sequence052 2246 840 gene locus_tag LOCUS_36540 2246 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 2548 2132 gene locus_tag LOCUS_36550 2548 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900634.1 protein_id gnl|my_center|LOCUS_36550 3871 2693 gene locus_tag LOCUS_36560 3871 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 4076 3885 gene locus_tag LOCUS_36570 4076 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 4344 4096 gene locus_tag LOCUS_36580 4344 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 5075 4695 gene locus_tag LOCUS_36590 5075 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 5690 5307 gene locus_tag LOCUS_36600 5690 5307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 6486 5695 gene locus_tag LOCUS_36610 6486 5695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 6717 6499 gene locus_tag LOCUS_36620 6717 6499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 8320 6779 gene locus_tag LOCUS_36630 8320 6779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 8706 8317 gene locus_tag LOCUS_36640 8706 8317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 9251 8703 gene locus_tag LOCUS_36650 9251 8703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 11424 9502 gene locus_tag LOCUS_36660 11424 9502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 11612 11421 gene locus_tag LOCUS_36670 11612 11421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 12048 11881 gene locus_tag LOCUS_36680 12048 11881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 12288 12067 gene locus_tag LOCUS_36690 12288 12067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 12811 13134 gene locus_tag LOCUS_36700 12811 13134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 13109 13330 gene locus_tag LOCUS_36710 13109 13330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 13718 13458 gene locus_tag LOCUS_36720 13718 13458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 13894 13817 gene locus_tag LOCUS_t00410 13894 13817 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 14706 14248 gene locus_tag LOCUS_36730 14706 14248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 15361 14840 gene locus_tag LOCUS_36740 15361 14840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 16372 15647 gene locus_tag LOCUS_36750 16372 15647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 17113 16661 gene locus_tag LOCUS_36760 17113 16661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 18918 17110 gene locus_tag LOCUS_36770 18918 17110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 20302 18920 gene locus_tag LOCUS_36780 20302 18920 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_36780 20356 21822 gene locus_tag LOCUS_36790 20356 21822 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017586463.1 protein_id gnl|my_center|LOCUS_36790 21923 22333 gene locus_tag LOCUS_36800 21923 22333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 22560 22267 gene locus_tag LOCUS_36810 22560 22267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 22490 22657 gene locus_tag LOCUS_36820 22490 22657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 23119 22676 gene locus_tag LOCUS_36830 23119 22676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36830 24371 23010 gene locus_tag LOCUS_36840 24371 23010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36840 24645 25658 gene locus_tag LOCUS_36850 24645 25658 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228360.1 protein_id gnl|my_center|LOCUS_36850 25700 28639 gene locus_tag LOCUS_36860 25700 28639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 28968 30065 gene locus_tag LOCUS_36870 28968 30065 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_36870 30356 31333 gene locus_tag LOCUS_36880 30356 31333 CDS product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035278.1 protein_id gnl|my_center|LOCUS_36880 31354 32625 gene locus_tag LOCUS_36890 31354 32625 CDS product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070644.1 protein_id gnl|my_center|LOCUS_36890 32662 34374 gene locus_tag LOCUS_36900 32662 34374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 >Feature sequence053 <1 578 gene locus_tag LOCUS_36910 <1 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227064.1:HNH endonuclease signature motif containing protein 697 1011 gene locus_tag LOCUS_36920 697 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 1011 1223 gene locus_tag LOCUS_36930 1011 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 1269 1538 gene locus_tag LOCUS_36940 1269 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 1677 2033 gene locus_tag LOCUS_36950 1677 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 2751 2080 gene locus_tag LOCUS_36960 2751 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 4009 2978 gene locus_tag LOCUS_36970 gene adhP 4009 2978 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649193.1 protein_id gnl|my_center|LOCUS_36970 5201 4017 gene locus_tag LOCUS_36980 5201 4017 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_36980 6544 5255 gene locus_tag LOCUS_36990 6544 5255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 7776 6541 gene locus_tag LOCUS_37000 7776 6541 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893543.1 protein_id gnl|my_center|LOCUS_37000 9829 7982 gene locus_tag LOCUS_37010 9829 7982 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727588.1 protein_id gnl|my_center|LOCUS_37010 10064 10684 gene locus_tag LOCUS_37020 10064 10684 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093220.1 protein_id gnl|my_center|LOCUS_37020 10700 11578 gene locus_tag LOCUS_37030 10700 11578 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064396.1 protein_id gnl|my_center|LOCUS_37030 12938 11610 gene locus_tag LOCUS_37040 12938 11610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 15320 13011 gene locus_tag LOCUS_37050 15320 13011 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257971.1 protein_id gnl|my_center|LOCUS_37050 15529 15317 gene locus_tag LOCUS_37060 15529 15317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 15733 16197 gene locus_tag LOCUS_37070 15733 16197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 16410 16586 gene locus_tag LOCUS_37080 16410 16586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 16886 18649 gene locus_tag LOCUS_37090 16886 18649 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110557.1 protein_id gnl|my_center|LOCUS_37090 18646 19407 gene locus_tag LOCUS_37100 gene xth 18646 19407 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_37100 20406 19417 gene locus_tag LOCUS_37110 20406 19417 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 protein_id gnl|my_center|LOCUS_37110 21395 20403 gene locus_tag LOCUS_37120 21395 20403 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870653.1 protein_id gnl|my_center|LOCUS_37120 21684 21406 gene locus_tag LOCUS_37130 21684 21406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 21991 21698 gene locus_tag LOCUS_37140 21991 21698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 23847 22054 gene locus_tag LOCUS_37150 23847 22054 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249942.1 protein_id gnl|my_center|LOCUS_37150 24247 23909 gene locus_tag LOCUS_37160 24247 23909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 24450 24731 gene locus_tag LOCUS_37170 24450 24731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 24789 25997 gene locus_tag LOCUS_37180 gene lhgO 24789 25997 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_37180 26628 26215 gene locus_tag LOCUS_37190 26628 26215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 26669 28108 gene locus_tag LOCUS_37200 26669 28108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 28133 28291 gene locus_tag LOCUS_37210 28133 28291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 29437 28682 gene locus_tag LOCUS_37220 29437 28682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 29634 29888 gene locus_tag LOCUS_37230 29634 29888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 30254 31240 gene locus_tag LOCUS_37240 30254 31240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 31465 31743 gene locus_tag LOCUS_37250 31465 31743 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_37250 31727 31975 gene locus_tag LOCUS_37260 31727 31975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 31972 32397 gene locus_tag LOCUS_37270 31972 32397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 33039 32500 gene locus_tag LOCUS_37280 33039 32500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 32941 33261 gene locus_tag LOCUS_37290 32941 33261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 33296 33751 gene locus_tag LOCUS_37300 33296 33751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 >Feature sequence054 801 514 gene locus_tag LOCUS_37310 gene groES 801 514 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970827.1 protein_id gnl|my_center|LOCUS_37310 964 1959 gene locus_tag LOCUS_37320 964 1959 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393452.1 protein_id gnl|my_center|LOCUS_37320 1962 3098 gene locus_tag LOCUS_37330 1962 3098 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256230.1 protein_id gnl|my_center|LOCUS_37330 4164 2983 gene locus_tag LOCUS_37340 4164 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 6625 4283 gene locus_tag LOCUS_37350 gene mrfA 6625 4283 CDS product ATP-dependent helicase MrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246149.1 protein_id gnl|my_center|LOCUS_37350 6692 7273 gene locus_tag LOCUS_37360 6692 7273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 7901 7308 gene locus_tag LOCUS_37370 7901 7308 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085955.1 protein_id gnl|my_center|LOCUS_37370 8413 7898 gene locus_tag LOCUS_37380 gene comD 8413 7898 CDS product sulfopyruvate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876830.1 protein_id gnl|my_center|LOCUS_37380 9387 8506 gene locus_tag LOCUS_37390 9387 8506 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064986.1 protein_id gnl|my_center|LOCUS_37390 11356 9413 gene locus_tag LOCUS_37400 11356 9413 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877962.1 protein_id gnl|my_center|LOCUS_37400 12369 11482 gene locus_tag LOCUS_37410 12369 11482 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986530.1 protein_id gnl|my_center|LOCUS_37410 12671 12859 gene locus_tag LOCUS_37420 12671 12859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 14503 12872 gene locus_tag LOCUS_37430 14503 12872 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328128.1 protein_id gnl|my_center|LOCUS_37430 15433 14522 gene locus_tag LOCUS_37440 15433 14522 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538206.1 protein_id gnl|my_center|LOCUS_37440 16559 15642 gene locus_tag LOCUS_37450 16559 15642 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031749.1 protein_id gnl|my_center|LOCUS_37450 17978 16578 gene locus_tag LOCUS_37460 gene rlmD 17978 16578 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105059.1 protein_id gnl|my_center|LOCUS_37460 18076 18591 gene locus_tag LOCUS_37470 18076 18591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 18588 20378 gene locus_tag LOCUS_37480 18588 20378 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924857.1 protein_id gnl|my_center|LOCUS_37480 20395 21132 gene locus_tag LOCUS_37490 20395 21132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 21200 22060 gene locus_tag LOCUS_37500 gene ispE 21200 22060 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140106.1 protein_id gnl|my_center|LOCUS_37500 22071 22145 gene locus_tag LOCUS_t00420 22071 22145 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 22167 23105 gene locus_tag LOCUS_37510 22167 23105 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546354.1 protein_id gnl|my_center|LOCUS_37510 23128 23793 gene locus_tag LOCUS_37520 23128 23793 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391626.1 protein_id gnl|my_center|LOCUS_37520 23794 24354 gene locus_tag LOCUS_37530 gene pth 23794 24354 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287401.1 protein_id gnl|my_center|LOCUS_37530 24492 24686 gene locus_tag LOCUS_37540 24492 24686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 24755 27070 gene locus_tag LOCUS_37550 24755 27070 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542519.1 protein_id gnl|my_center|LOCUS_37550 27072 28985 gene locus_tag LOCUS_37560 gene dnaG 27072 28985 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392160.1 protein_id gnl|my_center|LOCUS_37560 29011 30798 gene locus_tag LOCUS_37570 gene rpoD 29011 30798 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_37570 30812 30887 gene locus_tag LOCUS_t00430 30812 30887 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 31023 31730 gene locus_tag LOCUS_37580 31023 31730 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_37580 31619 32209 gene locus_tag LOCUS_37590 31619 32209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 32278 33675 gene locus_tag LOCUS_37600 32278 33675 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890488.1 protein_id gnl|my_center|LOCUS_37600 >Feature sequence055 157 408 gene locus_tag LOCUS_37610 157 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 762 1571 gene locus_tag LOCUS_37620 762 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 1874 1605 gene locus_tag LOCUS_37630 1874 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 1874 2044 gene locus_tag LOCUS_37640 1874 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 2295 2627 gene locus_tag LOCUS_37650 2295 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 3072 2851 gene locus_tag LOCUS_37660 3072 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 3379 6576 gene locus_tag LOCUS_37670 3379 6576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 6595 7497 gene locus_tag LOCUS_37680 gene garR 6595 7497 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098882.1 protein_id gnl|my_center|LOCUS_37680 9469 7544 gene locus_tag LOCUS_37690 9469 7544 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878757.1 protein_id gnl|my_center|LOCUS_37690 8751 8654 gene locus_tag LOCUS_t00440 8751 8654 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 10362 9652 gene locus_tag LOCUS_37700 10362 9652 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_37700 11356 10355 gene locus_tag LOCUS_37710 11356 10355 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965773.1 protein_id gnl|my_center|LOCUS_37710 12219 11353 gene locus_tag LOCUS_37720 12219 11353 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_37720 13947 12256 gene locus_tag LOCUS_37730 13947 12256 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 protein_id gnl|my_center|LOCUS_37730 15147 13978 gene locus_tag LOCUS_37740 15147 13978 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064155.1 protein_id gnl|my_center|LOCUS_37740 16616 15150 gene locus_tag LOCUS_37750 16616 15150 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296871.1 protein_id gnl|my_center|LOCUS_37750 17468 16680 gene locus_tag LOCUS_37760 17468 16680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 18514 17498 gene locus_tag LOCUS_37770 18514 17498 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404004.1 protein_id gnl|my_center|LOCUS_37770 20213 18531 gene locus_tag LOCUS_37780 20213 18531 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250100.1 protein_id gnl|my_center|LOCUS_37780 20625 20200 gene locus_tag LOCUS_37790 20625 20200 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 protein_id gnl|my_center|LOCUS_37790 22142 20643 gene locus_tag LOCUS_37800 gene lcfB 22142 20643 CDS product long-chain-fatty-acid--CoA ligase LcfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244686.1 protein_id gnl|my_center|LOCUS_37800 22885 22139 gene locus_tag LOCUS_37810 22885 22139 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869436.1 protein_id gnl|my_center|LOCUS_37810 24109 22901 gene locus_tag LOCUS_37820 24109 22901 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788709.1 protein_id gnl|my_center|LOCUS_37820 25309 24416 gene locus_tag LOCUS_37830 25309 24416 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089112.1 protein_id gnl|my_center|LOCUS_37830 25720 26736 gene locus_tag LOCUS_37840 25720 26736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 28100 26787 gene locus_tag LOCUS_37850 28100 26787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 29682 28111 gene locus_tag LOCUS_37860 29682 28111 CDS product DUF4331 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929156.1 protein_id gnl|my_center|LOCUS_37860 30512 29766 gene locus_tag LOCUS_37870 30512 29766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 32282 30999 gene locus_tag LOCUS_37880 32282 30999 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259422.1 protein_id gnl|my_center|LOCUS_37880 32343 32768 gene locus_tag LOCUS_37890 32343 32768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 >Feature sequence056 3882 1804 gene locus_tag LOCUS_37900 3882 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 4582 3893 gene locus_tag LOCUS_37910 gene queC 4582 3893 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389710.1 protein_id gnl|my_center|LOCUS_37910 5273 4593 gene locus_tag LOCUS_37920 5273 4593 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761795.1 protein_id gnl|my_center|LOCUS_37920 5710 5270 gene locus_tag LOCUS_37930 gene queD 5710 5270 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189793.1 protein_id gnl|my_center|LOCUS_37930 6514 5792 gene locus_tag LOCUS_37940 gene ubiE 6514 5792 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259480.1 protein_id gnl|my_center|LOCUS_37940 7368 6511 gene locus_tag LOCUS_37950 gene ubiA 7368 6511 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228063.1 protein_id gnl|my_center|LOCUS_37950 8944 7490 gene locus_tag LOCUS_37960 8944 7490 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391643.1 protein_id gnl|my_center|LOCUS_37960 9464 8955 gene locus_tag LOCUS_37970 9464 8955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151644554.1 protein_id gnl|my_center|LOCUS_37970 9526 13272 gene locus_tag LOCUS_37980 9526 13272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 13304 13576 gene locus_tag LOCUS_37990 13304 13576 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546355.1 protein_id gnl|my_center|LOCUS_37990 13689 13762 gene locus_tag LOCUS_t00450 13689 13762 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 13784 13859 gene locus_tag LOCUS_t00460 13784 13859 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 15362 14007 gene locus_tag LOCUS_38000 15362 14007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 16389 15463 gene locus_tag LOCUS_38010 16389 15463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 17761 18981 gene locus_tag LOCUS_38020 17761 18981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 19295 19011 gene locus_tag LOCUS_38030 19295 19011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 19736 19497 gene locus_tag LOCUS_38040 19736 19497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 23165 20049 gene locus_tag LOCUS_38050 23165 20049 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933392.1 protein_id gnl|my_center|LOCUS_38050 24814 23162 gene locus_tag LOCUS_38060 24814 23162 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257769.1 protein_id gnl|my_center|LOCUS_38060 27567 24811 gene locus_tag LOCUS_38070 27567 24811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 28219 27866 gene locus_tag LOCUS_38080 28219 27866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 29476 28349 gene locus_tag LOCUS_38090 29476 28349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 31203 30259 gene locus_tag LOCUS_38100 31203 30259 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918233.1 protein_id gnl|my_center|LOCUS_38100 31503 32009 gene locus_tag LOCUS_38110 31503 32009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 >Feature sequence057 382 696 gene locus_tag LOCUS_38120 382 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 693 1400 gene locus_tag LOCUS_38130 693 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 1397 2155 gene locus_tag LOCUS_38140 gene chbG 1397 2155 CDS product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815723.1 protein_id gnl|my_center|LOCUS_38140 2259 3191 gene locus_tag LOCUS_38150 2259 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 3188 4237 gene locus_tag LOCUS_38160 3188 4237 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140737.1 protein_id gnl|my_center|LOCUS_38160 4621 7809 gene locus_tag LOCUS_38170 4621 7809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 9514 7934 gene locus_tag LOCUS_38180 9514 7934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 10107 9595 gene locus_tag LOCUS_38190 10107 9595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 11249 10158 gene locus_tag LOCUS_38200 11249 10158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 11762 11259 gene locus_tag LOCUS_38210 11762 11259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 12301 11831 gene locus_tag LOCUS_38220 12301 11831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 12771 12412 gene locus_tag LOCUS_38230 12771 12412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 12816 13070 gene locus_tag LOCUS_38240 12816 13070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 13083 13301 gene locus_tag LOCUS_38250 13083 13301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 13668 16532 gene locus_tag LOCUS_38260 13668 16532 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_38260 16913 16602 gene locus_tag LOCUS_38270 16913 16602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 17242 17000 gene locus_tag LOCUS_38280 17242 17000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 18322 17360 gene locus_tag LOCUS_38290 18322 17360 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021352.1 protein_id gnl|my_center|LOCUS_38290 19545 18319 gene locus_tag LOCUS_38300 19545 18319 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061314.1 protein_id gnl|my_center|LOCUS_38300 19843 19562 gene locus_tag LOCUS_38310 19843 19562 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389676.1 protein_id gnl|my_center|LOCUS_38310 20196 19945 gene locus_tag LOCUS_38320 20196 19945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 20530 20198 gene locus_tag LOCUS_38330 20530 20198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 20999 20583 gene locus_tag LOCUS_38340 20999 20583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38340 21191 21024 gene locus_tag LOCUS_38350 21191 21024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 22138 21377 gene locus_tag LOCUS_38360 22138 21377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 22310 22867 gene locus_tag LOCUS_38370 22310 22867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 22855 23553 gene locus_tag LOCUS_38380 22855 23553 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421621.1 protein_id gnl|my_center|LOCUS_38380 23550 24824 gene locus_tag LOCUS_38390 23550 24824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 24821 25822 gene locus_tag LOCUS_38400 gene pqqE 24821 25822 CDS product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705481.1 protein_id gnl|my_center|LOCUS_38400 25854 26636 gene locus_tag LOCUS_38410 25854 26636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 26633 27721 gene locus_tag LOCUS_38420 26633 27721 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087591.1 protein_id gnl|my_center|LOCUS_38420 27718 27855 gene locus_tag LOCUS_38430 27718 27855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38430 28012 28188 gene locus_tag LOCUS_38440 28012 28188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 29510 28362 gene locus_tag LOCUS_38450 29510 28362 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503245.1 protein_id gnl|my_center|LOCUS_38450 29497 29715 gene locus_tag LOCUS_38460 29497 29715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 29721 30869 gene locus_tag LOCUS_38470 29721 30869 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958239.1 protein_id gnl|my_center|LOCUS_38470 >Feature sequence058 66 932 gene locus_tag LOCUS_38480 66 932 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_38480 1055 2059 gene locus_tag LOCUS_38490 gene gap 1055 2059 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_38490 2061 3248 gene locus_tag LOCUS_38500 2061 3248 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_38500 3262 4041 gene locus_tag LOCUS_38510 gene tpiA 3262 4041 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942272.1 protein_id gnl|my_center|LOCUS_38510 4049 4366 gene locus_tag LOCUS_38520 4049 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 4371 6026 gene locus_tag LOCUS_38530 4371 6026 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_38530 6027 7022 gene locus_tag LOCUS_38540 6027 7022 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_38540 7025 7912 gene locus_tag LOCUS_38550 7025 7912 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_38550 7976 8060 gene locus_tag LOCUS_t00470 7976 8060 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8401 9294 gene locus_tag LOCUS_38560 gene lipA 8401 9294 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258693.1 protein_id gnl|my_center|LOCUS_38560 9297 9647 gene locus_tag LOCUS_38570 9297 9647 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_38570 9638 10096 gene locus_tag LOCUS_38580 9638 10096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 10161 10658 gene locus_tag LOCUS_38590 10161 10658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 10857 12224 gene locus_tag LOCUS_38600 gene nuoD 10857 12224 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545955.1 protein_id gnl|my_center|LOCUS_38600 12227 12712 gene locus_tag LOCUS_38610 gene nuoE 12227 12712 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969256.1 protein_id gnl|my_center|LOCUS_38610 12957 12724 gene locus_tag LOCUS_38620 12957 12724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 13245 12958 gene locus_tag LOCUS_38630 13245 12958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 13555 14811 gene locus_tag LOCUS_38640 gene nuoF 13555 14811 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829484.1 protein_id gnl|my_center|LOCUS_38640 14804 16444 gene locus_tag LOCUS_38650 14804 16444 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403178.1 protein_id gnl|my_center|LOCUS_38650 16441 17550 gene locus_tag LOCUS_38660 gene nuoH 16441 17550 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944046.1 protein_id gnl|my_center|LOCUS_38660 17554 18177 gene locus_tag LOCUS_38670 17554 18177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 18179 18679 gene locus_tag LOCUS_38680 18179 18679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 18971 19273 gene locus_tag LOCUS_38690 gene nuoK 18971 19273 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258758.1 protein_id gnl|my_center|LOCUS_38690 19283 20281 gene locus_tag LOCUS_38700 gene pdhA 19283 20281 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943082.1 protein_id gnl|my_center|LOCUS_38700 20562 21542 gene locus_tag LOCUS_38710 20562 21542 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279894.1 protein_id gnl|my_center|LOCUS_38710 21539 22879 gene locus_tag LOCUS_38720 21539 22879 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404704.1 protein_id gnl|my_center|LOCUS_38720 22884 24284 gene locus_tag LOCUS_38730 gene lpdA 22884 24284 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670037.1 protein_id gnl|my_center|LOCUS_38730 24326 25483 gene locus_tag LOCUS_38740 24326 25483 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225693.1 protein_id gnl|my_center|LOCUS_38740 25825 25508 gene locus_tag LOCUS_38750 25825 25508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 26238 25858 gene locus_tag LOCUS_38760 26238 25858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 26389 27939 gene locus_tag LOCUS_38770 26389 27939 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_38770 27936 29621 gene locus_tag LOCUS_38780 27936 29621 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943914.1 protein_id gnl|my_center|LOCUS_38780 29786 30664 gene locus_tag LOCUS_38790 29786 30664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 30707 31423 gene locus_tag LOCUS_38800 30707 31423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 >Feature sequence059 199 492 gene locus_tag LOCUS_38810 199 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 498 1547 gene locus_tag LOCUS_38820 498 1547 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554743.1 protein_id gnl|my_center|LOCUS_38820 1544 2440 gene locus_tag LOCUS_38830 1544 2440 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421551.1 protein_id gnl|my_center|LOCUS_38830 3157 2444 gene locus_tag LOCUS_38840 3157 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 3403 3170 gene locus_tag LOCUS_38850 3403 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 4313 3411 gene locus_tag LOCUS_38860 4313 3411 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323835.1 protein_id gnl|my_center|LOCUS_38860 4458 4715 gene locus_tag LOCUS_38870 4458 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 4744 5439 gene locus_tag LOCUS_38880 4744 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 5555 7447 gene locus_tag LOCUS_38890 gene ftsH 5555 7447 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_38890 7464 8933 gene locus_tag LOCUS_38900 7464 8933 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_38900 8933 9367 gene locus_tag LOCUS_38910 8933 9367 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061570.1 protein_id gnl|my_center|LOCUS_38910 9602 9991 gene locus_tag LOCUS_38920 9602 9991 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525071.1 protein_id gnl|my_center|LOCUS_38920 10118 10354 gene locus_tag LOCUS_38930 10118 10354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 10351 10704 gene locus_tag LOCUS_38940 10351 10704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 10815 11027 gene locus_tag LOCUS_38950 10815 11027 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024015.1 protein_id gnl|my_center|LOCUS_38950 11292 11834 gene locus_tag LOCUS_38960 11292 11834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 12355 13374 gene locus_tag LOCUS_38970 12355 13374 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220518.1 protein_id gnl|my_center|LOCUS_38970 15208 15894 gene locus_tag LOCUS_38980 15208 15894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38980 15975 17267 gene locus_tag LOCUS_38990 15975 17267 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896596.1 protein_id gnl|my_center|LOCUS_38990 17542 18300 gene locus_tag LOCUS_39000 gene larB 17542 18300 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812203.1 protein_id gnl|my_center|LOCUS_39000 18338 19147 gene locus_tag LOCUS_39010 18338 19147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 21278 19179 gene locus_tag LOCUS_39020 21278 19179 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389968.1 protein_id gnl|my_center|LOCUS_39020 21610 22002 gene locus_tag LOCUS_39030 21610 22002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 22042 22323 gene locus_tag LOCUS_39040 22042 22323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 22392 22634 gene locus_tag LOCUS_39050 22392 22634 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242138.1 protein_id gnl|my_center|LOCUS_39050 22631 23017 gene locus_tag LOCUS_39060 22631 23017 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252024.1 protein_id gnl|my_center|LOCUS_39060 23504 23151 gene locus_tag LOCUS_39070 23504 23151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 24001 23501 gene locus_tag LOCUS_39080 24001 23501 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056674.1 protein_id gnl|my_center|LOCUS_39080 25776 24001 gene locus_tag LOCUS_39090 25776 24001 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039194.1 protein_id gnl|my_center|LOCUS_39090 25792 26508 gene locus_tag LOCUS_39100 25792 26508 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393651.1 protein_id gnl|my_center|LOCUS_39100 27356 26505 gene locus_tag LOCUS_39110 27356 26505 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_39110 28059 27370 gene locus_tag LOCUS_39120 28059 27370 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809848.1 protein_id gnl|my_center|LOCUS_39120 28817 28065 gene locus_tag LOCUS_39130 28817 28065 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809845.1 protein_id gnl|my_center|LOCUS_39130 29740 28817 gene locus_tag LOCUS_39140 29740 28817 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809842.1 protein_id gnl|my_center|LOCUS_39140 30609 29737 gene locus_tag LOCUS_39150 30609 29737 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064203.1 protein_id gnl|my_center|LOCUS_39150 <31665 30664 gene locus_tag LOCUS_39160 <31665 30664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003809839.1:ABC transporter substrate-binding protein >Feature sequence060 1572 19 gene locus_tag LOCUS_39170 1572 19 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_39170 3039 1621 gene locus_tag LOCUS_39180 gene boxB 3039 1621 CDS product benzoyl-CoA 2,3-epoxidase subunit BoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083901.1 protein_id gnl|my_center|LOCUS_39180 4715 3039 gene locus_tag LOCUS_39190 gene boxC 4715 3039 CDS product 2,3-epoxybenzoyl-CoA dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921378.1 protein_id gnl|my_center|LOCUS_39190 5418 4873 gene locus_tag LOCUS_39200 5418 4873 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454415.1 protein_id gnl|my_center|LOCUS_39200 6455 5418 gene locus_tag LOCUS_39210 6455 5418 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530701.1 protein_id gnl|my_center|LOCUS_39210 8860 6452 gene locus_tag LOCUS_39220 8860 6452 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969633.1 protein_id gnl|my_center|LOCUS_39220 9384 8857 gene locus_tag LOCUS_39230 9384 8857 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_39230 10670 9516 gene locus_tag LOCUS_39240 10670 9516 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958239.1 protein_id gnl|my_center|LOCUS_39240 10905 12023 gene locus_tag LOCUS_39250 10905 12023 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089439.1 protein_id gnl|my_center|LOCUS_39250 12061 12219 gene locus_tag LOCUS_39260 12061 12219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 12396 13274 gene locus_tag LOCUS_39270 12396 13274 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943730.1 protein_id gnl|my_center|LOCUS_39270 13255 14877 gene locus_tag LOCUS_39280 13255 14877 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726932.1 protein_id gnl|my_center|LOCUS_39280 14924 16213 gene locus_tag LOCUS_39290 14924 16213 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061490.1 protein_id gnl|my_center|LOCUS_39290 16216 17145 gene locus_tag LOCUS_39300 16216 17145 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721883.1 protein_id gnl|my_center|LOCUS_39300 17156 18007 gene locus_tag LOCUS_39310 17156 18007 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533026.1 protein_id gnl|my_center|LOCUS_39310 18011 19234 gene locus_tag LOCUS_39320 18011 19234 CDS product aconitase X catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250200.1 protein_id gnl|my_center|LOCUS_39320 19238 19666 gene locus_tag LOCUS_39330 19238 19666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 19672 20529 gene locus_tag LOCUS_39340 gene panB 19672 20529 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545863.1 protein_id gnl|my_center|LOCUS_39340 21033 21644 gene locus_tag LOCUS_39350 21033 21644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 21689 22060 gene locus_tag LOCUS_39360 21689 22060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 22331 23989 gene locus_tag LOCUS_39370 22331 23989 CDS product (2,3-dihydroxybenzoyl)adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243083.1 protein_id gnl|my_center|LOCUS_39370 24222 26702 gene locus_tag LOCUS_39380 24222 26702 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921440.1 protein_id gnl|my_center|LOCUS_39380 26699 27565 gene locus_tag LOCUS_39390 26699 27565 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807629.1 protein_id gnl|my_center|LOCUS_39390 27558 28055 gene locus_tag LOCUS_39400 gene cutC 27558 28055 CDS product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846892.1 protein_id gnl|my_center|LOCUS_39400 28052 30445 gene locus_tag LOCUS_39410 28052 30445 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242997.1 protein_id gnl|my_center|LOCUS_39410 >Feature sequence061 <1 2669 gene locus_tag LOCUS_39420 <1 2669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391799.1:excinuclease ABC subunit UvrA 2752 4170 gene locus_tag LOCUS_39430 gene pyk 2752 4170 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584142.1 protein_id gnl|my_center|LOCUS_39430 4182 4970 gene locus_tag LOCUS_39440 4182 4970 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729714.1 protein_id gnl|my_center|LOCUS_39440 4970 6325 gene locus_tag LOCUS_39450 4970 6325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 6447 7097 gene locus_tag LOCUS_39460 6447 7097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 7652 7128 gene locus_tag LOCUS_39470 7652 7128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 7537 8031 gene locus_tag LOCUS_39480 7537 8031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 8156 9538 gene locus_tag LOCUS_39490 8156 9538 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257378.1 protein_id gnl|my_center|LOCUS_39490 9553 10308 gene locus_tag LOCUS_39500 gene rfbF 9553 10308 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088721.1 protein_id gnl|my_center|LOCUS_39500 10374 11321 gene locus_tag LOCUS_39510 10374 11321 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546520.1 protein_id gnl|my_center|LOCUS_39510 11318 12547 gene locus_tag LOCUS_39520 11318 12547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 12860 13882 gene locus_tag LOCUS_39530 12860 13882 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458384.1 protein_id gnl|my_center|LOCUS_39530 13887 15434 gene locus_tag LOCUS_39540 13887 15434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 15406 16044 gene locus_tag LOCUS_39550 15406 16044 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467944.1 protein_id gnl|my_center|LOCUS_39550 16086 17072 gene locus_tag LOCUS_39560 16086 17072 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188546.1 protein_id gnl|my_center|LOCUS_39560 17081 18157 gene locus_tag LOCUS_39570 17081 18157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 18154 18957 gene locus_tag LOCUS_39580 18154 18957 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250977.1 protein_id gnl|my_center|LOCUS_39580 18935 20569 gene locus_tag LOCUS_39590 18935 20569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 20508 22826 gene locus_tag LOCUS_39600 20508 22826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 22840 24033 gene locus_tag LOCUS_39610 22840 24033 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249842.1 protein_id gnl|my_center|LOCUS_39610 24039 25196 gene locus_tag LOCUS_39620 24039 25196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 25193 26140 gene locus_tag LOCUS_39630 gene galE 25193 26140 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532494.1 protein_id gnl|my_center|LOCUS_39630 26137 27108 gene locus_tag LOCUS_39640 26137 27108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 27149 28138 gene locus_tag LOCUS_39650 27149 28138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 28135 29289 gene locus_tag LOCUS_39660 28135 29289 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_39660 29370 30374 gene locus_tag LOCUS_39670 29370 30374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 >Feature sequence062 284 1441 gene locus_tag LOCUS_39680 284 1441 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225722.1 protein_id gnl|my_center|LOCUS_39680 1644 3197 gene locus_tag LOCUS_39690 1644 3197 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259624.1 protein_id gnl|my_center|LOCUS_39690 3248 4102 gene locus_tag LOCUS_39700 3248 4102 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421145.1 protein_id gnl|my_center|LOCUS_39700 4113 5690 gene locus_tag LOCUS_39710 4113 5690 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978555.1 protein_id gnl|my_center|LOCUS_39710 5687 6514 gene locus_tag LOCUS_39720 5687 6514 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089114.1 protein_id gnl|my_center|LOCUS_39720 6571 7626 gene locus_tag LOCUS_39730 6571 7626 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942697.1 protein_id gnl|my_center|LOCUS_39730 7702 8229 gene locus_tag LOCUS_39740 7702 8229 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089532.1 protein_id gnl|my_center|LOCUS_39740 8226 9602 gene locus_tag LOCUS_39750 8226 9602 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063709.1 protein_id gnl|my_center|LOCUS_39750 9605 10765 gene locus_tag LOCUS_39760 9605 10765 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804113.1 protein_id gnl|my_center|LOCUS_39760 10762 11469 gene locus_tag LOCUS_39770 10762 11469 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941604.1 protein_id gnl|my_center|LOCUS_39770 11544 12731 gene locus_tag LOCUS_39780 11544 12731 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937886.1 protein_id gnl|my_center|LOCUS_39780 12738 13784 gene locus_tag LOCUS_39790 12738 13784 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002067912.1 protein_id gnl|my_center|LOCUS_39790 13781 15301 gene locus_tag LOCUS_39800 gene fadD13 13781 15301 CDS product long-chain-fatty-acid--CoA ligase FadD13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416081.1 protein_id gnl|my_center|LOCUS_39800 15303 16442 gene locus_tag LOCUS_39810 gene acdA 15303 16442 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_39810 16453 17169 gene locus_tag LOCUS_39820 16453 17169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 18636 17527 gene locus_tag LOCUS_39830 18636 17527 CDS product tellurite resistance/C4-dicarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063658.1 protein_id gnl|my_center|LOCUS_39830 20156 18633 gene locus_tag LOCUS_39840 20156 18633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 20976 20302 gene locus_tag LOCUS_39850 gene narI 20976 20302 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438321.1 protein_id gnl|my_center|LOCUS_39850 21707 20997 gene locus_tag LOCUS_39860 21707 20997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 23209 21701 gene locus_tag LOCUS_39870 gene narH 23209 21701 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092958.1 protein_id gnl|my_center|LOCUS_39870 26906 23262 gene locus_tag LOCUS_39880 26906 23262 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459023.1 protein_id gnl|my_center|LOCUS_39880 27948 26947 gene locus_tag LOCUS_39890 27948 26947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 29201 28458 gene locus_tag LOCUS_39900 29201 28458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 29604 29299 gene locus_tag LOCUS_39910 29604 29299 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141375.1 protein_id gnl|my_center|LOCUS_39910 >Feature sequence063 1838 1425 gene locus_tag LOCUS_39920 1838 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 2160 1831 gene locus_tag LOCUS_39930 2160 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 4242 2284 gene locus_tag LOCUS_39940 4242 2284 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226763.1 protein_id gnl|my_center|LOCUS_39940 5662 4259 gene locus_tag LOCUS_39950 5662 4259 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935682.1 protein_id gnl|my_center|LOCUS_39950 6010 6786 gene locus_tag LOCUS_39960 6010 6786 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_39960 6788 8041 gene locus_tag LOCUS_39970 6788 8041 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 protein_id gnl|my_center|LOCUS_39970 8047 9273 gene locus_tag LOCUS_39980 8047 9273 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482600.1 protein_id gnl|my_center|LOCUS_39980 9273 10022 gene locus_tag LOCUS_39990 9273 10022 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523242.1 protein_id gnl|my_center|LOCUS_39990 9985 11208 gene locus_tag LOCUS_40000 9985 11208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 11311 12489 gene locus_tag LOCUS_40010 11311 12489 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389759.1 protein_id gnl|my_center|LOCUS_40010 13313 12543 gene locus_tag LOCUS_40020 13313 12543 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925816.1 protein_id gnl|my_center|LOCUS_40020 13462 15156 gene locus_tag LOCUS_40030 13462 15156 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_40030 15162 16127 gene locus_tag LOCUS_40040 15162 16127 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083933.1 protein_id gnl|my_center|LOCUS_40040 17660 16146 gene locus_tag LOCUS_40050 17660 16146 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526169.1 protein_id gnl|my_center|LOCUS_40050 17659 18648 gene locus_tag LOCUS_40060 17659 18648 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176672.1 protein_id gnl|my_center|LOCUS_40060 18743 19177 gene locus_tag LOCUS_40070 18743 19177 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201060.1 protein_id gnl|my_center|LOCUS_40070 19253 20707 gene locus_tag LOCUS_40080 19253 20707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 20711 22114 gene locus_tag LOCUS_40090 20711 22114 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_40090 22284 22369 gene locus_tag LOCUS_t00480 22284 22369 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 22581 23849 gene locus_tag LOCUS_40100 gene tig 22581 23849 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392064.1 protein_id gnl|my_center|LOCUS_40100 23882 24511 gene locus_tag LOCUS_40110 gene clpP 23882 24511 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392065.1 protein_id gnl|my_center|LOCUS_40110 24522 25739 gene locus_tag LOCUS_40120 gene clpX 24522 25739 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_40120 25927 26253 gene locus_tag LOCUS_40130 25927 26253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 26371 27072 gene locus_tag LOCUS_40140 gene rsmI 26371 27072 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941314.1 protein_id gnl|my_center|LOCUS_40140 27051 27842 gene locus_tag LOCUS_40150 gene thiD 27051 27842 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256279.1 protein_id gnl|my_center|LOCUS_40150 27839 28612 gene locus_tag LOCUS_40160 gene tatC 27839 28612 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545000.1 protein_id gnl|my_center|LOCUS_40160 28609 29958 gene locus_tag LOCUS_40170 28609 29958 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941190.1 protein_id gnl|my_center|LOCUS_40170 >Feature sequence064 619 122 gene locus_tag LOCUS_40180 gene accB 619 122 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921156.1 protein_id gnl|my_center|LOCUS_40180 1431 631 gene locus_tag LOCUS_40190 1431 631 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 protein_id gnl|my_center|LOCUS_40190 2209 1457 gene locus_tag LOCUS_40200 gene tauC 2209 1457 CDS product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105423.1 protein_id gnl|my_center|LOCUS_40200 2985 2209 gene locus_tag LOCUS_40210 2985 2209 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808828.1 protein_id gnl|my_center|LOCUS_40210 4265 2988 gene locus_tag LOCUS_40220 4265 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 5136 4366 gene locus_tag LOCUS_40230 5136 4366 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337278.1 protein_id gnl|my_center|LOCUS_40230 5930 5133 gene locus_tag LOCUS_40240 5930 5133 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312277.1 protein_id gnl|my_center|LOCUS_40240 6170 6847 gene locus_tag LOCUS_40250 6170 6847 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393101.1 protein_id gnl|my_center|LOCUS_40250 6828 7097 gene locus_tag LOCUS_40260 6828 7097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 7097 8335 gene locus_tag LOCUS_40270 7097 8335 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393482.1 protein_id gnl|my_center|LOCUS_40270 8818 9156 gene locus_tag LOCUS_40280 8818 9156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40280 9156 9713 gene locus_tag LOCUS_40290 9156 9713 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393484.1 protein_id gnl|my_center|LOCUS_40290 9715 11319 gene locus_tag LOCUS_40300 9715 11319 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228677.1 protein_id gnl|my_center|LOCUS_40300 11316 11750 gene locus_tag LOCUS_40310 11316 11750 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065868.1 protein_id gnl|my_center|LOCUS_40310 11750 13762 gene locus_tag LOCUS_40320 11750 13762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 13773 15059 gene locus_tag LOCUS_40330 13773 15059 CDS product methanogenesis marker 16 metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023232.1 protein_id gnl|my_center|LOCUS_40330 15061 16815 gene locus_tag LOCUS_40340 15061 16815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 16812 17393 gene locus_tag LOCUS_40350 16812 17393 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545501.1 protein_id gnl|my_center|LOCUS_40350 17390 18400 gene locus_tag LOCUS_40360 gene mtaA 17390 18400 CDS product methylcobamide:CoM methyltransferase MtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589539.1 protein_id gnl|my_center|LOCUS_40360 18397 19134 gene locus_tag LOCUS_40370 18397 19134 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583102.1 protein_id gnl|my_center|LOCUS_40370 19144 20478 gene locus_tag LOCUS_40380 19144 20478 CDS product methanogenesis marker 16 metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023232.1 protein_id gnl|my_center|LOCUS_40380 20519 21508 gene locus_tag LOCUS_40390 20519 21508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 21585 22433 gene locus_tag LOCUS_40400 21585 22433 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496487.1 protein_id gnl|my_center|LOCUS_40400 22430 23164 gene locus_tag LOCUS_40410 22430 23164 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970045.1 protein_id gnl|my_center|LOCUS_40410 23172 23990 gene locus_tag LOCUS_40420 23172 23990 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809019.1 protein_id gnl|my_center|LOCUS_40420 23987 24766 gene locus_tag LOCUS_40430 23987 24766 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038928.1 protein_id gnl|my_center|LOCUS_40430 24795 25901 gene locus_tag LOCUS_40440 24795 25901 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809021.1 protein_id gnl|my_center|LOCUS_40440 25984 26967 gene locus_tag LOCUS_40450 25984 26967 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589798.1 protein_id gnl|my_center|LOCUS_40450 26969 27475 gene locus_tag LOCUS_40460 26969 27475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 27489 28997 gene locus_tag LOCUS_40470 27489 28997 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813871.1 protein_id gnl|my_center|LOCUS_40470 >Feature sequence065 1725 1294 gene locus_tag LOCUS_40480 1725 1294 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880109.1 protein_id gnl|my_center|LOCUS_40480 2123 1767 gene locus_tag LOCUS_40490 gene rsfS 2123 1767 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392104.1 protein_id gnl|my_center|LOCUS_40490 2767 2123 gene locus_tag LOCUS_40500 gene nadD 2767 2123 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228912.1 protein_id gnl|my_center|LOCUS_40500 4031 2775 gene locus_tag LOCUS_40510 4031 2775 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_40510 5179 4055 gene locus_tag LOCUS_40520 gene proB 5179 4055 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546492.1 protein_id gnl|my_center|LOCUS_40520 6120 5158 gene locus_tag LOCUS_40530 6120 5158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 6576 6265 gene locus_tag LOCUS_40540 gene rplU 6576 6265 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957542.1 protein_id gnl|my_center|LOCUS_40540 7277 7065 gene locus_tag LOCUS_40550 7277 7065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 7928 7380 gene locus_tag LOCUS_40560 7928 7380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 8107 7916 gene locus_tag LOCUS_40570 8107 7916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 8747 8118 gene locus_tag LOCUS_40580 gene sigE 8747 8118 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314132.1 protein_id gnl|my_center|LOCUS_40580 9552 8749 gene locus_tag LOCUS_40590 9552 8749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 10951 9941 gene locus_tag LOCUS_40600 10951 9941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 11689 11111 gene locus_tag LOCUS_40610 gene rsxA 11689 11111 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_40610 12414 11689 gene locus_tag LOCUS_40620 12414 11689 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904084.1 protein_id gnl|my_center|LOCUS_40620 13094 12411 gene locus_tag LOCUS_40630 13094 12411 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583455.1 protein_id gnl|my_center|LOCUS_40630 14098 13091 gene locus_tag LOCUS_40640 14098 13091 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_40640 15420 14095 gene locus_tag LOCUS_40650 gene rsxC 15420 14095 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583453.1 protein_id gnl|my_center|LOCUS_40650 20537 15537 gene locus_tag LOCUS_40660 20537 15537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 21412 20534 gene locus_tag LOCUS_40670 21412 20534 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583458.1 protein_id gnl|my_center|LOCUS_40670 22447 21416 gene locus_tag LOCUS_40680 22447 21416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 23390 22437 gene locus_tag LOCUS_40690 23390 22437 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444695.1 protein_id gnl|my_center|LOCUS_40690 25306 23387 gene locus_tag LOCUS_40700 25306 23387 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324152.1 protein_id gnl|my_center|LOCUS_40700 25622 26149 gene locus_tag LOCUS_40710 25622 26149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 26257 26577 gene locus_tag LOCUS_40720 26257 26577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 26612 26986 gene locus_tag LOCUS_40730 26612 26986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 27147 27644 gene locus_tag LOCUS_40740 27147 27644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 27654 28820 gene locus_tag LOCUS_40750 27654 28820 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027422.1 protein_id gnl|my_center|LOCUS_40750 >Feature sequence066 401 171 gene locus_tag LOCUS_40760 401 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 666 385 gene locus_tag LOCUS_40770 666 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 839 1129 gene locus_tag LOCUS_40780 839 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 1126 1788 gene locus_tag LOCUS_40790 1126 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40790 1871 2956 gene locus_tag LOCUS_40800 1871 2956 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941141.1 protein_id gnl|my_center|LOCUS_40800 2990 6073 gene locus_tag LOCUS_40810 2990 6073 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839231.1 protein_id gnl|my_center|LOCUS_40810 6096 9314 gene locus_tag LOCUS_40820 6096 9314 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839229.1 protein_id gnl|my_center|LOCUS_40820 9768 9418 gene locus_tag LOCUS_40830 9768 9418 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200901620.1 protein_id gnl|my_center|LOCUS_40830 9884 10111 gene locus_tag LOCUS_40840 9884 10111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 12077 10155 gene locus_tag LOCUS_40850 12077 10155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 12805 12347 gene locus_tag LOCUS_40860 12805 12347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 13158 13352 gene locus_tag LOCUS_40870 13158 13352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 13485 14171 gene locus_tag LOCUS_40880 13485 14171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 14149 14703 gene locus_tag LOCUS_40890 14149 14703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 15016 15435 gene locus_tag LOCUS_40900 15016 15435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 15432 16097 gene locus_tag LOCUS_40910 15432 16097 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140061.1 protein_id gnl|my_center|LOCUS_40910 16182 18737 gene locus_tag LOCUS_40920 16182 18737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 19019 18804 gene locus_tag LOCUS_40930 19019 18804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 19849 19016 gene locus_tag LOCUS_40940 19849 19016 CDS product extradiol dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814501.1 protein_id gnl|my_center|LOCUS_40940 20571 19972 gene locus_tag LOCUS_40950 20571 19972 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228105.1 protein_id gnl|my_center|LOCUS_40950 21504 20773 gene locus_tag LOCUS_40960 21504 20773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 22364 21519 gene locus_tag LOCUS_40970 22364 21519 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_40970 22427 22765 gene locus_tag LOCUS_40980 22427 22765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 22762 23724 gene locus_tag LOCUS_40990 22762 23724 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479639.1 protein_id gnl|my_center|LOCUS_40990 23900 24805 gene locus_tag LOCUS_41000 23900 24805 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041466227.1 protein_id gnl|my_center|LOCUS_41000 25120 24881 gene locus_tag LOCUS_41010 25120 24881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 25621 25406 gene locus_tag LOCUS_41020 25621 25406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 25910 25680 gene locus_tag LOCUS_41030 25910 25680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 26133 25855 gene locus_tag LOCUS_41040 26133 25855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 26415 26134 gene locus_tag LOCUS_41050 26415 26134 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_41050 26641 26459 gene locus_tag LOCUS_41060 26641 26459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 27045 26719 gene locus_tag LOCUS_41070 27045 26719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 27766 27254 gene locus_tag LOCUS_41080 27766 27254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 28051 27788 gene locus_tag LOCUS_41090 28051 27788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41090 28383 28129 gene locus_tag LOCUS_41100 28383 28129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 <29253 28633 gene locus_tag LOCUS_41110 <29253 28633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_093151333.1:serine hydrolase >Feature sequence067 <1 685 gene locus_tag LOCUS_41120 <1 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459063.1:glycyl-radical enzyme activating protein 892 2535 gene locus_tag LOCUS_41130 892 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 2684 3442 gene locus_tag LOCUS_41140 2684 3442 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227372.1 protein_id gnl|my_center|LOCUS_41140 3469 4830 gene locus_tag LOCUS_41150 3469 4830 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931675.1 protein_id gnl|my_center|LOCUS_41150 4830 5075 gene locus_tag LOCUS_41160 4830 5075 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776432.1 protein_id gnl|my_center|LOCUS_41160 5068 6177 gene locus_tag LOCUS_41170 5068 6177 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082297.1 protein_id gnl|my_center|LOCUS_41170 6155 6907 gene locus_tag LOCUS_41180 6155 6907 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420710.1 protein_id gnl|my_center|LOCUS_41180 6909 7475 gene locus_tag LOCUS_41190 6909 7475 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940603.1 protein_id gnl|my_center|LOCUS_41190 7552 8859 gene locus_tag LOCUS_41200 7552 8859 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244067.1 protein_id gnl|my_center|LOCUS_41200 8910 10448 gene locus_tag LOCUS_41210 8910 10448 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973928.1 protein_id gnl|my_center|LOCUS_41210 10461 11831 gene locus_tag LOCUS_41220 10461 11831 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244067.1 protein_id gnl|my_center|LOCUS_41220 11828 12994 gene locus_tag LOCUS_41230 11828 12994 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245114.1 protein_id gnl|my_center|LOCUS_41230 12991 14178 gene locus_tag LOCUS_41240 12991 14178 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640337.1 protein_id gnl|my_center|LOCUS_41240 14201 14989 gene locus_tag LOCUS_41250 14201 14989 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331316.1 protein_id gnl|my_center|LOCUS_41250 14999 16576 gene locus_tag LOCUS_41260 14999 16576 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665480.1 protein_id gnl|my_center|LOCUS_41260 16573 18081 gene locus_tag LOCUS_41270 16573 18081 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973928.1 protein_id gnl|my_center|LOCUS_41270 18121 19044 gene locus_tag LOCUS_41280 18121 19044 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368429.1 protein_id gnl|my_center|LOCUS_41280 19122 19919 gene locus_tag LOCUS_41290 19122 19919 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538206.1 protein_id gnl|my_center|LOCUS_41290 20044 21699 gene locus_tag LOCUS_41300 20044 21699 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941764.1 protein_id gnl|my_center|LOCUS_41300 21699 23285 gene locus_tag LOCUS_41310 21699 23285 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973928.1 protein_id gnl|my_center|LOCUS_41310 23415 24974 gene locus_tag LOCUS_41320 23415 24974 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973461.1 protein_id gnl|my_center|LOCUS_41320 25030 26241 gene locus_tag LOCUS_41330 gene acdA 25030 26241 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_41330 26350 26667 gene locus_tag LOCUS_41340 26350 26667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 26696 27772 gene locus_tag LOCUS_41350 26696 27772 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040453.1 protein_id gnl|my_center|LOCUS_41350 27794 28678 gene locus_tag LOCUS_41360 27794 28678 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808680.1 protein_id gnl|my_center|LOCUS_41360 >Feature sequence068 507 1541 gene locus_tag LOCUS_41370 507 1541 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250397.1 protein_id gnl|my_center|LOCUS_41370 1567 2850 gene locus_tag LOCUS_41380 1567 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 3028 3915 gene locus_tag LOCUS_41390 3028 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41390 3912 4868 gene locus_tag LOCUS_41400 3912 4868 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085969.1 protein_id gnl|my_center|LOCUS_41400 4865 5632 gene locus_tag LOCUS_41410 4865 5632 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088973.1 protein_id gnl|my_center|LOCUS_41410 5629 6348 gene locus_tag LOCUS_41420 5629 6348 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039306.1 protein_id gnl|my_center|LOCUS_41420 7721 6375 gene locus_tag LOCUS_41430 7721 6375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 7764 8795 gene locus_tag LOCUS_41440 7764 8795 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978349.1 protein_id gnl|my_center|LOCUS_41440 8884 9147 gene locus_tag LOCUS_41450 8884 9147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 9154 9447 gene locus_tag LOCUS_41460 9154 9447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 9602 10666 gene locus_tag LOCUS_41470 9602 10666 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186177.1 protein_id gnl|my_center|LOCUS_41470 10708 12798 gene locus_tag LOCUS_41480 10708 12798 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640693.1 protein_id gnl|my_center|LOCUS_41480 13251 12820 gene locus_tag LOCUS_41490 13251 12820 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096578551.1 protein_id gnl|my_center|LOCUS_41490 13475 13248 gene locus_tag LOCUS_41500 13475 13248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 13731 14933 gene locus_tag LOCUS_41510 13731 14933 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093005186.1 protein_id gnl|my_center|LOCUS_41510 14917 15711 gene locus_tag LOCUS_41520 14917 15711 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921513.1 protein_id gnl|my_center|LOCUS_41520 15777 16943 gene locus_tag LOCUS_41530 15777 16943 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089980.1 protein_id gnl|my_center|LOCUS_41530 16956 17912 gene locus_tag LOCUS_41540 16956 17912 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256277.1 protein_id gnl|my_center|LOCUS_41540 17959 18462 gene locus_tag LOCUS_41550 17959 18462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 18923 18465 gene locus_tag LOCUS_41560 18923 18465 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037987.1 protein_id gnl|my_center|LOCUS_41560 19253 19074 gene locus_tag LOCUS_41570 19253 19074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 19558 20082 gene locus_tag LOCUS_41580 19558 20082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 20061 21083 gene locus_tag LOCUS_41590 gene dusB 20061 21083 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941670.1 protein_id gnl|my_center|LOCUS_41590 21121 22647 gene locus_tag LOCUS_41600 21121 22647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 22644 24011 gene locus_tag LOCUS_41610 gene atoC 22644 24011 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389139.1 protein_id gnl|my_center|LOCUS_41610 24008 24739 gene locus_tag LOCUS_41620 24008 24739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 25049 24795 gene locus_tag LOCUS_41630 25049 24795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 26384 25284 gene locus_tag LOCUS_41640 26384 25284 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444040.1 protein_id gnl|my_center|LOCUS_41640 26646 27653 gene locus_tag LOCUS_41650 26646 27653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 27835 28635 gene locus_tag LOCUS_41660 27835 28635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 28632 29057 gene locus_tag LOCUS_41670 28632 29057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 >Feature sequence069 494 1498 gene locus_tag LOCUS_41680 494 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 1507 3825 gene locus_tag LOCUS_41690 1507 3825 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807632.1 protein_id gnl|my_center|LOCUS_41690 3827 4318 gene locus_tag LOCUS_41700 gene cutC 3827 4318 CDS product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846892.1 protein_id gnl|my_center|LOCUS_41700 4315 5190 gene locus_tag LOCUS_41710 4315 5190 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243136.1 protein_id gnl|my_center|LOCUS_41710 6141 5233 gene locus_tag LOCUS_41720 6141 5233 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_41720 6387 7466 gene locus_tag LOCUS_41730 6387 7466 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567469.1 protein_id gnl|my_center|LOCUS_41730 7832 9199 gene locus_tag LOCUS_41740 7832 9199 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930994.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41740 9196 10266 gene locus_tag LOCUS_41750 9196 10266 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016302.1 protein_id gnl|my_center|LOCUS_41750 10676 10311 gene locus_tag LOCUS_41760 10676 10311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 10881 10630 gene locus_tag LOCUS_41770 10881 10630 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143788.1 protein_id gnl|my_center|LOCUS_41770 11162 11332 gene locus_tag LOCUS_41780 11162 11332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 11329 12465 gene locus_tag LOCUS_41790 11329 12465 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089142.1 protein_id gnl|my_center|LOCUS_41790 12542 13669 gene locus_tag LOCUS_41800 12542 13669 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939810.1 protein_id gnl|my_center|LOCUS_41800 13683 15014 gene locus_tag LOCUS_41810 13683 15014 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460239.1 protein_id gnl|my_center|LOCUS_41810 15014 16750 gene locus_tag LOCUS_41820 15014 16750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 16771 18480 gene locus_tag LOCUS_41830 16771 18480 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086217.1 protein_id gnl|my_center|LOCUS_41830 18936 18619 gene locus_tag LOCUS_41840 18936 18619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 19218 18961 gene locus_tag LOCUS_41850 19218 18961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 19437 21002 gene locus_tag LOCUS_41860 19437 21002 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231527.1 protein_id gnl|my_center|LOCUS_41860 21095 21877 gene locus_tag LOCUS_41870 21095 21877 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231526.1 protein_id gnl|my_center|LOCUS_41870 21895 23067 gene locus_tag LOCUS_41880 21895 23067 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815544.1 protein_id gnl|my_center|LOCUS_41880 23064 23489 gene locus_tag LOCUS_41890 23064 23489 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965765.1 protein_id gnl|my_center|LOCUS_41890 23912 23610 gene locus_tag LOCUS_41900 23912 23610 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479928.1 protein_id gnl|my_center|LOCUS_41900 24989 23916 gene locus_tag LOCUS_41910 24989 23916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257446.1 protein_id gnl|my_center|LOCUS_41910 25460 26584 gene locus_tag LOCUS_41920 25460 26584 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942664.1 protein_id gnl|my_center|LOCUS_41920 27164 28021 gene locus_tag LOCUS_41930 27164 28021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 <29048 28463 gene locus_tag LOCUS_41940 <29048 28463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228417.1:Xaa-Pro peptidase family protein >Feature sequence070 2112 592 gene locus_tag LOCUS_41950 2112 592 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_41950 2299 3006 gene locus_tag LOCUS_41960 2299 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 3425 3003 gene locus_tag LOCUS_41970 3425 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 4337 3954 gene locus_tag LOCUS_41980 4337 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 6179 4413 gene locus_tag LOCUS_41990 6179 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 7539 6250 gene locus_tag LOCUS_42000 7539 6250 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403001.1 protein_id gnl|my_center|LOCUS_42000 7775 8680 gene locus_tag LOCUS_42010 7775 8680 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881059.1 protein_id gnl|my_center|LOCUS_42010 9447 9058 gene locus_tag LOCUS_42020 9447 9058 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255952.1 protein_id gnl|my_center|LOCUS_42020 11063 9459 gene locus_tag LOCUS_42030 11063 9459 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878783.1 protein_id gnl|my_center|LOCUS_42030 11854 11060 gene locus_tag LOCUS_42040 gene fabG 11854 11060 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392464.1 protein_id gnl|my_center|LOCUS_42040 12745 11948 gene locus_tag LOCUS_42050 12745 11948 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064266.1 protein_id gnl|my_center|LOCUS_42050 13598 12792 gene locus_tag LOCUS_42060 gene yqeB 13598 12792 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393498.1 protein_id gnl|my_center|LOCUS_42060 14752 13613 gene locus_tag LOCUS_42070 14752 13613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 17151 14749 gene locus_tag LOCUS_42080 17151 14749 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_42080 17657 17148 gene locus_tag LOCUS_42090 17657 17148 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975049.1 protein_id gnl|my_center|LOCUS_42090 18658 17654 gene locus_tag LOCUS_42100 18658 17654 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087966.1 protein_id gnl|my_center|LOCUS_42100 19293 18667 gene locus_tag LOCUS_42110 19293 18667 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206944.1 protein_id gnl|my_center|LOCUS_42110 20235 19429 gene locus_tag LOCUS_42120 20235 19429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 21571 20243 gene locus_tag LOCUS_42130 21571 20243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 22721 21582 gene locus_tag LOCUS_42140 22721 21582 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225683.1 protein_id gnl|my_center|LOCUS_42140 23922 22726 gene locus_tag LOCUS_42150 23922 22726 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090524.1 protein_id gnl|my_center|LOCUS_42150 24087 25316 gene locus_tag LOCUS_42160 24087 25316 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922632.1 protein_id gnl|my_center|LOCUS_42160 25475 25768 gene locus_tag LOCUS_42170 25475 25768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 25765 26790 gene locus_tag LOCUS_42180 gene coxB 25765 26790 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227850.1 protein_id gnl|my_center|LOCUS_42180 >Feature sequence071 120 1481 gene locus_tag LOCUS_42190 120 1481 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667541.1 protein_id gnl|my_center|LOCUS_42190 1523 2014 gene locus_tag LOCUS_42200 1523 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 2722 2108 gene locus_tag LOCUS_42210 2722 2108 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869771.1 protein_id gnl|my_center|LOCUS_42210 2767 3345 gene locus_tag LOCUS_42220 2767 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 3363 3569 gene locus_tag LOCUS_42230 3363 3569 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584018.1 protein_id gnl|my_center|LOCUS_42230 3665 4474 gene locus_tag LOCUS_42240 3665 4474 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227962.1 protein_id gnl|my_center|LOCUS_42240 4524 5669 gene locus_tag LOCUS_42250 4524 5669 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225706.1 protein_id gnl|my_center|LOCUS_42250 7988 5682 gene locus_tag LOCUS_42260 7988 5682 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257267.1 protein_id gnl|my_center|LOCUS_42260 10006 7985 gene locus_tag LOCUS_42270 10006 7985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 12366 10021 gene locus_tag LOCUS_42280 12366 10021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 14373 12544 gene locus_tag LOCUS_42290 14373 12544 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257922.1 protein_id gnl|my_center|LOCUS_42290 14761 14982 gene locus_tag LOCUS_42300 14761 14982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 16311 15064 gene locus_tag LOCUS_42310 gene fabF 16311 15064 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_42310 16419 17231 gene locus_tag LOCUS_42320 16419 17231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 17242 18207 gene locus_tag LOCUS_42330 gene kdgK1 17242 18207 CDS product bifunctional 2-dehydro-3-deoxygluconokinase/2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902071.1 protein_id gnl|my_center|LOCUS_42330 18219 19091 gene locus_tag LOCUS_42340 18219 19091 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258345.1 protein_id gnl|my_center|LOCUS_42340 19120 20034 gene locus_tag LOCUS_42350 19120 20034 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257319.1 protein_id gnl|my_center|LOCUS_42350 20052 24059 gene locus_tag LOCUS_42360 20052 24059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 24203 24385 gene locus_tag LOCUS_42370 24203 24385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 24382 25785 gene locus_tag LOCUS_42380 24382 25785 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090641.1 protein_id gnl|my_center|LOCUS_42380 26498 25812 gene locus_tag LOCUS_42390 26498 25812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973993.1 protein_id gnl|my_center|LOCUS_42390 >Feature sequence072 1036 479 gene locus_tag LOCUS_42400 1036 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 2067 1033 gene locus_tag LOCUS_42410 gene dctP 2067 1033 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063711.1 protein_id gnl|my_center|LOCUS_42410 2280 2672 gene locus_tag LOCUS_42420 2280 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 2818 3570 gene locus_tag LOCUS_42430 2818 3570 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095221.1 protein_id gnl|my_center|LOCUS_42430 3801 5237 gene locus_tag LOCUS_42440 3801 5237 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 protein_id gnl|my_center|LOCUS_42440 5258 5698 gene locus_tag LOCUS_42450 5258 5698 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879708.1 protein_id gnl|my_center|LOCUS_42450 5716 6501 gene locus_tag LOCUS_42460 5716 6501 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816058.1 protein_id gnl|my_center|LOCUS_42460 6501 8759 gene locus_tag LOCUS_42470 6501 8759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 8816 9811 gene locus_tag LOCUS_42480 8816 9811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42480 9863 11803 gene locus_tag LOCUS_42490 9863 11803 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_42490 11817 12509 gene locus_tag LOCUS_42500 11817 12509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 12524 12853 gene locus_tag LOCUS_42510 12524 12853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 12954 14012 gene locus_tag LOCUS_42520 12954 14012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 14029 14979 gene locus_tag LOCUS_42530 14029 14979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 16438 15053 gene locus_tag LOCUS_42540 16438 15053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 18237 16435 gene locus_tag LOCUS_42550 18237 16435 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141069.1 protein_id gnl|my_center|LOCUS_42550 19345 18299 gene locus_tag LOCUS_42560 19345 18299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 20595 19342 gene locus_tag LOCUS_42570 20595 19342 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803855.1 protein_id gnl|my_center|LOCUS_42570 21806 20592 gene locus_tag LOCUS_42580 21806 20592 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803854.1 protein_id gnl|my_center|LOCUS_42580 23042 21810 gene locus_tag LOCUS_42590 23042 21810 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_42590 23815 23039 gene locus_tag LOCUS_42600 23815 23039 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387053.1 protein_id gnl|my_center|LOCUS_42600 25161 23812 gene locus_tag LOCUS_42610 25161 23812 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088058.1 protein_id gnl|my_center|LOCUS_42610 26414 25221 gene locus_tag LOCUS_42620 26414 25221 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391470.1 protein_id gnl|my_center|LOCUS_42620 26413 26757 gene locus_tag LOCUS_42630 26413 26757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 >Feature sequence073 328 1194 gene locus_tag LOCUS_42640 328 1194 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172393.1 protein_id gnl|my_center|LOCUS_42640 1194 2156 gene locus_tag LOCUS_42650 1194 2156 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965773.1 protein_id gnl|my_center|LOCUS_42650 2351 3001 gene locus_tag LOCUS_42660 2351 3001 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728923.1 protein_id gnl|my_center|LOCUS_42660 2998 3717 gene locus_tag LOCUS_42670 2998 3717 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942652.1 protein_id gnl|my_center|LOCUS_42670 3785 4468 gene locus_tag LOCUS_42680 3785 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 4497 4823 gene locus_tag LOCUS_42690 gene trxA 4497 4823 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545412.1 protein_id gnl|my_center|LOCUS_42690 4835 6373 gene locus_tag LOCUS_42700 gene trpE 4835 6373 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_42700 6370 6951 gene locus_tag LOCUS_42710 6370 6951 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174596.1 protein_id gnl|my_center|LOCUS_42710 7034 8059 gene locus_tag LOCUS_42720 gene thiL 7034 8059 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392671.1 protein_id gnl|my_center|LOCUS_42720 8052 9329 gene locus_tag LOCUS_42730 8052 9329 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228155.1 protein_id gnl|my_center|LOCUS_42730 9326 10567 gene locus_tag LOCUS_42740 9326 10567 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228155.1 protein_id gnl|my_center|LOCUS_42740 10759 11433 gene locus_tag LOCUS_42750 10759 11433 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085274.1 protein_id gnl|my_center|LOCUS_42750 12135 11653 gene locus_tag LOCUS_42760 gene rplQ 12135 11653 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943458.1 protein_id gnl|my_center|LOCUS_42760 13118 12132 gene locus_tag LOCUS_42770 13118 12132 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 protein_id gnl|my_center|LOCUS_42770 13748 13125 gene locus_tag LOCUS_42780 gene rpsD 13748 13125 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545818.1 protein_id gnl|my_center|LOCUS_42780 14176 13763 gene locus_tag LOCUS_42790 gene rpsK 14176 13763 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393910.1 protein_id gnl|my_center|LOCUS_42790 14595 14188 gene locus_tag LOCUS_42800 gene rpsM 14595 14188 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869905.1 protein_id gnl|my_center|LOCUS_42800 15127 14909 gene locus_tag LOCUS_42810 gene infA 15127 14909 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156508.1 protein_id gnl|my_center|LOCUS_42810 15903 15142 gene locus_tag LOCUS_42820 gene map 15903 15142 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545375.1 protein_id gnl|my_center|LOCUS_42820 16562 15900 gene locus_tag LOCUS_42830 16562 15900 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_42830 17872 16559 gene locus_tag LOCUS_42840 gene secY 17872 16559 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_42840 18324 17869 gene locus_tag LOCUS_42850 gene rplO 18324 17869 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810128.1 protein_id gnl|my_center|LOCUS_42850 18503 18321 gene locus_tag LOCUS_42860 gene rpmD 18503 18321 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357637.1 protein_id gnl|my_center|LOCUS_42860 19017 18487 gene locus_tag LOCUS_42870 gene rpsE 19017 18487 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_42870 19393 19028 gene locus_tag LOCUS_42880 gene rplR 19393 19028 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583361.1 protein_id gnl|my_center|LOCUS_42880 19935 19393 gene locus_tag LOCUS_42890 gene rplF 19935 19393 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546082.1 protein_id gnl|my_center|LOCUS_42890 20339 19944 gene locus_tag LOCUS_42900 gene rpsH 20339 19944 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036371522.1 protein_id gnl|my_center|LOCUS_42900 20538 20353 gene locus_tag LOCUS_42910 20538 20353 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583358.1 protein_id gnl|my_center|LOCUS_42910 21248 20541 gene locus_tag LOCUS_42920 gene rplE 21248 20541 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966400.1 protein_id gnl|my_center|LOCUS_42920 21580 21254 gene locus_tag LOCUS_42930 gene rplX 21580 21254 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_42930 21969 21601 gene locus_tag LOCUS_42940 gene rplN 21969 21601 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545550.1 protein_id gnl|my_center|LOCUS_42940 22249 22001 gene locus_tag LOCUS_42950 gene rpsQ 22249 22001 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943477.1 protein_id gnl|my_center|LOCUS_42950 22620 22396 gene locus_tag LOCUS_42960 gene rpmC 22620 22396 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156482.1 protein_id gnl|my_center|LOCUS_42960 23044 22628 gene locus_tag LOCUS_42970 gene rplP 23044 22628 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933835.1 protein_id gnl|my_center|LOCUS_42970 23697 23050 gene locus_tag LOCUS_42980 gene rpsC 23697 23050 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_42980 24071 23700 gene locus_tag LOCUS_42990 gene rplV 24071 23700 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156475.1 protein_id gnl|my_center|LOCUS_42990 24372 24079 gene locus_tag LOCUS_43000 gene rpsS 24372 24079 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_43000 25209 24385 gene locus_tag LOCUS_43010 gene rplB 25209 24385 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081830.1 protein_id gnl|my_center|LOCUS_43010 25504 25214 gene locus_tag LOCUS_43020 gene rplW 25504 25214 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_43020 26130 25501 gene locus_tag LOCUS_43030 gene rplD 26130 25501 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393936.1 protein_id gnl|my_center|LOCUS_43030 26810 26133 gene locus_tag LOCUS_43040 gene rplC 26810 26133 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140089.1 protein_id gnl|my_center|LOCUS_43040 27144 26824 gene locus_tag LOCUS_43050 gene rpsJ 27144 26824 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943487.1 protein_id gnl|my_center|LOCUS_43050 >Feature sequence074 1043 672 gene locus_tag LOCUS_43060 1043 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 1517 1170 gene locus_tag LOCUS_43070 1517 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 1820 1602 gene locus_tag LOCUS_43080 1820 1602 CDS product gas vesicle structural protein GvpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724507.1 protein_id gnl|my_center|LOCUS_43080 2522 2124 gene locus_tag LOCUS_43090 2522 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 4009 2519 gene locus_tag LOCUS_43100 4009 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_43100 4739 4002 gene locus_tag LOCUS_43110 4739 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 5536 4736 gene locus_tag LOCUS_43120 5536 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 5949 5536 gene locus_tag LOCUS_43130 5949 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 6411 5953 gene locus_tag LOCUS_43140 6411 5953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 8560 6416 gene locus_tag LOCUS_43150 8560 6416 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_43150 9116 8565 gene locus_tag LOCUS_43160 9116 8565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 10497 9073 gene locus_tag LOCUS_43170 10497 9073 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941040.1 protein_id gnl|my_center|LOCUS_43170 11132 10494 gene locus_tag LOCUS_43180 11132 10494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 11804 11361 gene locus_tag LOCUS_43190 11804 11361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 14069 12120 gene locus_tag LOCUS_43200 14069 12120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 14361 16577 gene locus_tag LOCUS_43210 gene glgB 14361 16577 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_43210 16574 18760 gene locus_tag LOCUS_43220 gene glgX 16574 18760 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898930.1 protein_id gnl|my_center|LOCUS_43220 18778 20040 gene locus_tag LOCUS_43230 18778 20040 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014332063.1 protein_id gnl|my_center|LOCUS_43230 21506 20214 gene locus_tag LOCUS_43240 21506 20214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 21804 21589 gene locus_tag LOCUS_43250 21804 21589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 23319 21826 gene locus_tag LOCUS_43260 23319 21826 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529892.1 protein_id gnl|my_center|LOCUS_43260 23890 23321 gene locus_tag LOCUS_43270 23890 23321 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012132914.1 protein_id gnl|my_center|LOCUS_43270 24470 23901 gene locus_tag LOCUS_43280 24470 23901 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012132914.1 protein_id gnl|my_center|LOCUS_43280 26092 24491 gene locus_tag LOCUS_43290 26092 24491 CDS product FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626455.1 protein_id gnl|my_center|LOCUS_43290 >Feature sequence075 753 1427 gene locus_tag LOCUS_43300 753 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 1524 2831 gene locus_tag LOCUS_43310 1524 2831 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966049.1 protein_id gnl|my_center|LOCUS_43310 4014 3067 gene locus_tag LOCUS_43320 4014 3067 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223508.1 protein_id gnl|my_center|LOCUS_43320 4819 4052 gene locus_tag LOCUS_43330 4819 4052 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975597.1 protein_id gnl|my_center|LOCUS_43330 6509 4836 gene locus_tag LOCUS_43340 6509 4836 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090330.1 protein_id gnl|my_center|LOCUS_43340 6571 7608 gene locus_tag LOCUS_43350 6571 7608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 7769 8698 gene locus_tag LOCUS_43360 7769 8698 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728851.1 protein_id gnl|my_center|LOCUS_43360 8709 10130 gene locus_tag LOCUS_43370 gene hemY 8709 10130 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245394.1 protein_id gnl|my_center|LOCUS_43370 10696 10127 gene locus_tag LOCUS_43380 10696 10127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 11096 11368 gene locus_tag LOCUS_43390 11096 11368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 11590 12531 gene locus_tag LOCUS_43400 11590 12531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43400 12860 13267 gene locus_tag LOCUS_43410 12860 13267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 14090 13305 gene locus_tag LOCUS_43420 14090 13305 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399111.1 protein_id gnl|my_center|LOCUS_43420 14500 14087 gene locus_tag LOCUS_43430 gene msrB 14500 14087 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967753.1 protein_id gnl|my_center|LOCUS_43430 15631 14825 gene locus_tag LOCUS_43440 15631 14825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 17315 15609 gene locus_tag LOCUS_43450 17315 15609 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018210246.1 protein_id gnl|my_center|LOCUS_43450 17832 17422 gene locus_tag LOCUS_43460 17832 17422 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974171.1 protein_id gnl|my_center|LOCUS_43460 21024 17923 gene locus_tag LOCUS_43470 21024 17923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 22215 21397 gene locus_tag LOCUS_43480 22215 21397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 22277 22645 gene locus_tag LOCUS_43490 22277 22645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 22656 22877 gene locus_tag LOCUS_43500 22656 22877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 23103 23381 gene locus_tag LOCUS_43510 23103 23381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 24231 23455 gene locus_tag LOCUS_43520 24231 23455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43520 24398 25885 gene locus_tag LOCUS_43530 24398 25885 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933713.1 protein_id gnl|my_center|LOCUS_43530 >Feature sequence076 424 945 gene locus_tag LOCUS_43540 424 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 949 1368 gene locus_tag LOCUS_43550 949 1368 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_43550 1432 2802 gene locus_tag LOCUS_43560 1432 2802 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_43560 2799 3380 gene locus_tag LOCUS_43570 2799 3380 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980453.1 protein_id gnl|my_center|LOCUS_43570 3839 3417 gene locus_tag LOCUS_43580 3839 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 4257 3850 gene locus_tag LOCUS_43590 4257 3850 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 protein_id gnl|my_center|LOCUS_43590 5930 4254 gene locus_tag LOCUS_43600 5930 4254 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257715.1 protein_id gnl|my_center|LOCUS_43600 6356 5979 gene locus_tag LOCUS_43610 6356 5979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 6675 7202 gene locus_tag LOCUS_43620 6675 7202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 7282 7881 gene locus_tag LOCUS_43630 7282 7881 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889002.1 protein_id gnl|my_center|LOCUS_43630 7911 8327 gene locus_tag LOCUS_43640 7911 8327 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846721.1 protein_id gnl|my_center|LOCUS_43640 8320 10002 gene locus_tag LOCUS_43650 8320 10002 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 protein_id gnl|my_center|LOCUS_43650 10401 10018 gene locus_tag LOCUS_43660 10401 10018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 11135 10506 gene locus_tag LOCUS_43670 11135 10506 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087542.1 protein_id gnl|my_center|LOCUS_43670 12394 11132 gene locus_tag LOCUS_43680 12394 11132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 12768 13154 gene locus_tag LOCUS_43690 12768 13154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967064.1 protein_id gnl|my_center|LOCUS_43690 13310 13693 gene locus_tag LOCUS_43700 13310 13693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 13732 14001 gene locus_tag LOCUS_43710 13732 14001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43710 14031 22853 gene locus_tag LOCUS_43720 14031 22853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 24285 23017 gene locus_tag LOCUS_43730 24285 23017 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494235.1 protein_id gnl|my_center|LOCUS_43730 <25598 24382 gene locus_tag LOCUS_43740 <25598 24382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919308.1:acetyl-CoA acetyltransferase >Feature sequence077 1291 980 gene locus_tag LOCUS_43750 gene groES 1291 980 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970827.1 protein_id gnl|my_center|LOCUS_43750 1430 2674 gene locus_tag LOCUS_43760 1430 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 2695 3147 gene locus_tag LOCUS_43770 2695 3147 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466682.1 protein_id gnl|my_center|LOCUS_43770 3239 5683 gene locus_tag LOCUS_43780 3239 5683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 6788 5700 gene locus_tag LOCUS_43790 6788 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 6997 8217 gene locus_tag LOCUS_43800 6997 8217 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524520.1 protein_id gnl|my_center|LOCUS_43800 8300 9163 gene locus_tag LOCUS_43810 8300 9163 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966751.1 protein_id gnl|my_center|LOCUS_43810 9412 10368 gene locus_tag LOCUS_43820 9412 10368 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313874.1 protein_id gnl|my_center|LOCUS_43820 10355 11107 gene locus_tag LOCUS_43830 10355 11107 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259471.1 protein_id gnl|my_center|LOCUS_43830 11104 11802 gene locus_tag LOCUS_43840 11104 11802 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039306.1 protein_id gnl|my_center|LOCUS_43840 12744 11824 gene locus_tag LOCUS_43850 12744 11824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 12710 12925 gene locus_tag LOCUS_43860 12710 12925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 13001 13618 gene locus_tag LOCUS_43870 13001 13618 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086438.1 protein_id gnl|my_center|LOCUS_43870 14730 13687 gene locus_tag LOCUS_43880 14730 13687 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259330.1 protein_id gnl|my_center|LOCUS_43880 15836 14832 gene locus_tag LOCUS_43890 15836 14832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 16681 15767 gene locus_tag LOCUS_43900 16681 15767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 16946 16773 gene locus_tag LOCUS_43910 16946 16773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 17433 17062 gene locus_tag LOCUS_43920 17433 17062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 18019 17801 gene locus_tag LOCUS_43930 18019 17801 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_43930 17976 18353 gene locus_tag LOCUS_43940 17976 18353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 18423 18650 gene locus_tag LOCUS_43950 18423 18650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 18631 18951 gene locus_tag LOCUS_43960 18631 18951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 19510 19031 gene locus_tag LOCUS_43970 19510 19031 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033059696.1 protein_id gnl|my_center|LOCUS_43970 21295 20159 gene locus_tag LOCUS_43980 21295 20159 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407690.1 protein_id gnl|my_center|LOCUS_43980 22104 21298 gene locus_tag LOCUS_43990 22104 21298 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104791.1 protein_id gnl|my_center|LOCUS_43990 22477 22091 gene locus_tag LOCUS_44000 22477 22091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 24022 22559 gene locus_tag LOCUS_44010 24022 22559 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762891.1 protein_id gnl|my_center|LOCUS_44010 <25051 24056 gene locus_tag LOCUS_44020 <25051 24056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933392.1:DEAD/DEAH box helicase family protein >Feature sequence078 <1 1105 gene locus_tag LOCUS_44030 <1 1105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538194.1:M28 family peptidase 2772 1351 gene locus_tag LOCUS_44040 2772 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 3479 2769 gene locus_tag LOCUS_44050 3479 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 4981 3896 gene locus_tag LOCUS_44060 4981 3896 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_44060 6315 4978 gene locus_tag LOCUS_44070 gene nhaA 6315 4978 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119453.1 protein_id gnl|my_center|LOCUS_44070 7202 6336 gene locus_tag LOCUS_44080 7202 6336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089645.1 protein_id gnl|my_center|LOCUS_44080 7514 7293 gene locus_tag LOCUS_44090 7514 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 8301 11321 gene locus_tag LOCUS_44100 8301 11321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 11327 11701 gene locus_tag LOCUS_44110 11327 11701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 11739 12098 gene locus_tag LOCUS_44120 11739 12098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 12155 13798 gene locus_tag LOCUS_44130 12155 13798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 13795 15201 gene locus_tag LOCUS_44140 13795 15201 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808174.1 protein_id gnl|my_center|LOCUS_44140 15407 15898 gene locus_tag LOCUS_44150 15407 15898 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200939.1 protein_id gnl|my_center|LOCUS_44150 15891 16367 gene locus_tag LOCUS_44160 15891 16367 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258548.1 protein_id gnl|my_center|LOCUS_44160 16364 17170 gene locus_tag LOCUS_44170 16364 17170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 17196 17642 gene locus_tag LOCUS_44180 17196 17642 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941779.1 protein_id gnl|my_center|LOCUS_44180 17726 18850 gene locus_tag LOCUS_44190 17726 18850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 18867 20012 gene locus_tag LOCUS_44200 18867 20012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 20003 20431 gene locus_tag LOCUS_44210 20003 20431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44210 20459 20830 gene locus_tag LOCUS_44220 20459 20830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44220 20858 21493 gene locus_tag LOCUS_44230 20858 21493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 21866 22486 gene locus_tag LOCUS_44240 21866 22486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 22483 23637 gene locus_tag LOCUS_44250 gene hadC 22483 23637 CDS product (R)-2-hydroxyisocaproyl-CoA dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 protein_id gnl|my_center|LOCUS_44250 >Feature sequence079 639 1220 gene locus_tag LOCUS_44260 639 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 1346 1543 gene locus_tag LOCUS_44270 1346 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 1540 1818 gene locus_tag LOCUS_44280 1540 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 1815 3110 gene locus_tag LOCUS_44290 1815 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 3388 3666 gene locus_tag LOCUS_44300 3388 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 3747 4085 gene locus_tag LOCUS_44310 3747 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 4088 4654 gene locus_tag LOCUS_44320 4088 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 4651 4878 gene locus_tag LOCUS_44330 4651 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 4856 5119 gene locus_tag LOCUS_44340 4856 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 5116 5385 gene locus_tag LOCUS_44350 5116 5385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 5408 6040 gene locus_tag LOCUS_44360 5408 6040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 6037 6213 gene locus_tag LOCUS_44370 6037 6213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 6216 7190 gene locus_tag LOCUS_44380 6216 7190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 7203 7373 gene locus_tag LOCUS_44390 7203 7373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 7408 10443 gene locus_tag LOCUS_44400 7408 10443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 10440 11054 gene locus_tag LOCUS_44410 10440 11054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 11080 11268 gene locus_tag LOCUS_44420 11080 11268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44420 11444 11722 gene locus_tag LOCUS_44430 11444 11722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 11790 12083 gene locus_tag LOCUS_44440 11790 12083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 12217 12432 gene locus_tag LOCUS_44450 12217 12432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 12509 13084 gene locus_tag LOCUS_44460 12509 13084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 13084 13377 gene locus_tag LOCUS_44470 13084 13377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 13377 13694 gene locus_tag LOCUS_44480 13377 13694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 13812 14219 gene locus_tag LOCUS_44490 13812 14219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 14219 15328 gene locus_tag LOCUS_44500 14219 15328 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545721.1 protein_id gnl|my_center|LOCUS_44500 15412 15338 gene locus_tag LOCUS_t00490 15412 15338 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 16392 15469 gene locus_tag LOCUS_44510 16392 15469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 16355 16717 gene locus_tag LOCUS_44520 16355 16717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 16792 17661 gene locus_tag LOCUS_44530 16792 17661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 18054 17893 gene locus_tag LOCUS_44540 18054 17893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 19011 18220 gene locus_tag LOCUS_44550 19011 18220 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400404.1 protein_id gnl|my_center|LOCUS_44550 19563 19048 gene locus_tag LOCUS_44560 19563 19048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 20702 19677 gene locus_tag LOCUS_44570 20702 19677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44570 22924 20702 gene locus_tag LOCUS_44580 22924 20702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 >Feature sequence080 962 1285 gene locus_tag LOCUS_44590 962 1285 CDS product GYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546546.1 protein_id gnl|my_center|LOCUS_44590 1292 1765 gene locus_tag LOCUS_44600 1292 1765 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869225.1 protein_id gnl|my_center|LOCUS_44600 1765 3114 gene locus_tag LOCUS_44610 1765 3114 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083225.1 protein_id gnl|my_center|LOCUS_44610 3135 5039 gene locus_tag LOCUS_44620 3135 5039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 5167 5433 gene locus_tag LOCUS_44630 5167 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 5511 6338 gene locus_tag LOCUS_44640 5511 6338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 6776 7429 gene locus_tag LOCUS_44650 6776 7429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 10266 7477 gene locus_tag LOCUS_44660 10266 7477 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950392.1 protein_id gnl|my_center|LOCUS_44660 10727 10275 gene locus_tag LOCUS_44670 10727 10275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 10949 11839 gene locus_tag LOCUS_44680 gene garR 10949 11839 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566608.1 protein_id gnl|my_center|LOCUS_44680 11848 12864 gene locus_tag LOCUS_44690 11848 12864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 12869 13276 gene locus_tag LOCUS_44700 12869 13276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 13281 14918 gene locus_tag LOCUS_44710 13281 14918 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089646.1 protein_id gnl|my_center|LOCUS_44710 14920 16029 gene locus_tag LOCUS_44720 14920 16029 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880158.1 protein_id gnl|my_center|LOCUS_44720 16205 16978 gene locus_tag LOCUS_44730 16205 16978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 17011 18264 gene locus_tag LOCUS_44740 17011 18264 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728099.1 protein_id gnl|my_center|LOCUS_44740 18272 18679 gene locus_tag LOCUS_44750 18272 18679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 19966 18698 gene locus_tag LOCUS_44760 19966 18698 CDS product folate/biopterin family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055871.1 protein_id gnl|my_center|LOCUS_44760 20023 20808 gene locus_tag LOCUS_44770 20023 20808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525542.1 protein_id gnl|my_center|LOCUS_44770 20827 22551 gene locus_tag LOCUS_44780 gene aceB 20827 22551 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483026.1 protein_id gnl|my_center|LOCUS_44780 >Feature sequence081 1472 591 gene locus_tag LOCUS_44790 1472 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44790 1948 3990 gene locus_tag LOCUS_44800 1948 3990 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942207.1 protein_id gnl|my_center|LOCUS_44800 5492 3996 gene locus_tag LOCUS_44810 5492 3996 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228379.1 protein_id gnl|my_center|LOCUS_44810 6268 5498 gene locus_tag LOCUS_44820 gene recO 6268 5498 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941240.1 protein_id gnl|my_center|LOCUS_44820 7179 6271 gene locus_tag LOCUS_44830 gene era 7179 6271 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360270.1 protein_id gnl|my_center|LOCUS_44830 7643 7179 gene locus_tag LOCUS_44840 7643 7179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44840 8677 7643 gene locus_tag LOCUS_44850 8677 7643 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110199.1 protein_id gnl|my_center|LOCUS_44850 10510 8708 gene locus_tag LOCUS_44860 gene aspS 10510 8708 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_44860 11841 10570 gene locus_tag LOCUS_44870 gene hisS 11841 10570 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393179.1 protein_id gnl|my_center|LOCUS_44870 12337 12020 gene locus_tag LOCUS_44880 12337 12020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 12659 12417 gene locus_tag LOCUS_44890 12659 12417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44890 12846 12664 gene locus_tag LOCUS_44900 12846 12664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 13354 12953 gene locus_tag LOCUS_44910 13354 12953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 13875 13357 gene locus_tag LOCUS_44920 13875 13357 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881079.1 protein_id gnl|my_center|LOCUS_44920 14468 13896 gene locus_tag LOCUS_44930 14468 13896 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392680.1 protein_id gnl|my_center|LOCUS_44930 16359 14491 gene locus_tag LOCUS_44940 16359 14491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 17102 16365 gene locus_tag LOCUS_44950 17102 16365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 18845 17235 gene locus_tag LOCUS_44960 18845 17235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 19371 19117 gene locus_tag LOCUS_44970 19371 19117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 19743 19441 gene locus_tag LOCUS_44980 19743 19441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44980 19972 19724 gene locus_tag LOCUS_44990 19972 19724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 20651 20013 gene locus_tag LOCUS_45000 20651 20013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 20718 21086 gene locus_tag LOCUS_45010 20718 21086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45010 21868 21083 gene locus_tag LOCUS_45020 21868 21083 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933215.1 protein_id gnl|my_center|LOCUS_45020 <22525 21884 gene locus_tag LOCUS_45030 <22525 21884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941971.1:polyprenyl synthetase family protein >Feature sequence082 <1 513 gene locus_tag LOCUS_45040 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392083.1:chaperonin GroEL 1753 593 gene locus_tag LOCUS_45050 1753 593 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_45050 2492 2043 gene locus_tag LOCUS_45060 2492 2043 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036247.1 protein_id gnl|my_center|LOCUS_45060 4102 2735 gene locus_tag LOCUS_45070 4102 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 4820 4149 gene locus_tag LOCUS_45080 4820 4149 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216652.1 protein_id gnl|my_center|LOCUS_45080 6024 5299 gene locus_tag LOCUS_45090 gene pgl 6024 5299 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_45090 7561 6044 gene locus_tag LOCUS_45100 gene zwf 7561 6044 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141170.1 protein_id gnl|my_center|LOCUS_45100 7880 7647 gene locus_tag LOCUS_45110 7880 7647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45110 10520 7887 gene locus_tag LOCUS_45120 10520 7887 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_45120 11451 10645 gene locus_tag LOCUS_45130 11451 10645 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141114.1 protein_id gnl|my_center|LOCUS_45130 13287 11824 gene locus_tag LOCUS_45140 13287 11824 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_45140 14765 13359 gene locus_tag LOCUS_45150 14765 13359 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 protein_id gnl|my_center|LOCUS_45150 15439 14762 gene locus_tag LOCUS_45160 15439 14762 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_45160 15954 15487 gene locus_tag LOCUS_45170 15954 15487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 16157 15951 gene locus_tag LOCUS_45180 16157 15951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 16470 16288 gene locus_tag LOCUS_45190 16470 16288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 16547 16924 gene locus_tag LOCUS_45200 16547 16924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 18005 17022 gene locus_tag LOCUS_45210 gene gnd 18005 17022 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089498.1 protein_id gnl|my_center|LOCUS_45210 19909 18038 gene locus_tag LOCUS_45220 19909 18038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 <22025 20040 gene locus_tag LOCUS_45230 <22025 20040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404851.1:bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase >Feature sequence083 332 1639 gene locus_tag LOCUS_45240 gene egtB 332 1639 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027439.1 protein_id gnl|my_center|LOCUS_45240 1649 2626 gene locus_tag LOCUS_45250 gene egtD 1649 2626 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027441.1 protein_id gnl|my_center|LOCUS_45250 3161 2946 gene locus_tag LOCUS_45260 3161 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 5050 3326 gene locus_tag LOCUS_45270 5050 3326 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140892.1 protein_id gnl|my_center|LOCUS_45270 5798 5052 gene locus_tag LOCUS_45280 5798 5052 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035421.1 protein_id gnl|my_center|LOCUS_45280 6330 5851 gene locus_tag LOCUS_45290 6330 5851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45290 6495 7034 gene locus_tag LOCUS_45300 6495 7034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 8456 7110 gene locus_tag LOCUS_45310 8456 7110 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163428.1 protein_id gnl|my_center|LOCUS_45310 8720 8481 gene locus_tag LOCUS_45320 8720 8481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 9258 8725 gene locus_tag LOCUS_45330 9258 8725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45330 9686 9255 gene locus_tag LOCUS_45340 9686 9255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45340 10293 9691 gene locus_tag LOCUS_45350 10293 9691 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941819.1 protein_id gnl|my_center|LOCUS_45350 10687 10427 gene locus_tag LOCUS_45360 10687 10427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45360 11435 10995 gene locus_tag LOCUS_45370 11435 10995 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094294.1 protein_id gnl|my_center|LOCUS_45370 11708 11463 gene locus_tag LOCUS_45380 11708 11463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 12071 12493 gene locus_tag LOCUS_45390 12071 12493 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027424.1 protein_id gnl|my_center|LOCUS_45390 12525 12752 gene locus_tag LOCUS_45400 12525 12752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877189.1 protein_id gnl|my_center|LOCUS_45400 13186 13557 gene locus_tag LOCUS_45410 13186 13557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45410 13916 14284 gene locus_tag LOCUS_45420 13916 14284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 14285 14503 gene locus_tag LOCUS_45430 14285 14503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 14582 17890 gene locus_tag LOCUS_45440 gene fdh 14582 17890 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227547.1 transl_except (pos:15155..15157,aa:Sec) note codon on position 192 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_45440 17915 18724 gene locus_tag LOCUS_45450 17915 18724 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145933610.1 protein_id gnl|my_center|LOCUS_45450 18705 19607 gene locus_tag LOCUS_45460 18705 19607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 19604 19843 gene locus_tag LOCUS_45470 19604 19843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 19846 20727 gene locus_tag LOCUS_45480 19846 20727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 20718 21071 gene locus_tag LOCUS_45490 20718 21071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 21064 21588 gene locus_tag LOCUS_45500 21064 21588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 >Feature sequence084 <1 924 gene locus_tag LOCUS_45510 <1 924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189298.1:tRNA 2-thiocytidine(32) synthetase TtcA 946 2130 gene locus_tag LOCUS_45520 946 2130 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480052.1 protein_id gnl|my_center|LOCUS_45520 2172 3026 gene locus_tag LOCUS_45530 gene sseA 2172 3026 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919301.1 protein_id gnl|my_center|LOCUS_45530 4490 3039 gene locus_tag LOCUS_45540 4490 3039 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058098.1 protein_id gnl|my_center|LOCUS_45540 4627 5463 gene locus_tag LOCUS_45550 4627 5463 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665727.1 protein_id gnl|my_center|LOCUS_45550 5474 6889 gene locus_tag LOCUS_45560 gene leuC 5474 6889 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388944.1 protein_id gnl|my_center|LOCUS_45560 6891 7502 gene locus_tag LOCUS_45570 gene leuD 6891 7502 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802156.1 protein_id gnl|my_center|LOCUS_45570 7499 8362 gene locus_tag LOCUS_45580 gene nudC 7499 8362 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941705.1 protein_id gnl|my_center|LOCUS_45580 8394 9173 gene locus_tag LOCUS_45590 8394 9173 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809706.1 protein_id gnl|my_center|LOCUS_45590 9262 10650 gene locus_tag LOCUS_45600 9262 10650 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965744.1 protein_id gnl|my_center|LOCUS_45600 10703 11302 gene locus_tag LOCUS_45610 10703 11302 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188272.1 protein_id gnl|my_center|LOCUS_45610 12212 11409 gene locus_tag LOCUS_45620 12212 11409 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943778.1 protein_id gnl|my_center|LOCUS_45620 12423 13409 gene locus_tag LOCUS_45630 12423 13409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45630 13406 14446 gene locus_tag LOCUS_45640 13406 14446 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942298.1 protein_id gnl|my_center|LOCUS_45640 14521 14757 gene locus_tag LOCUS_45650 14521 14757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45650 14820 15890 gene locus_tag LOCUS_45660 14820 15890 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393062.1 protein_id gnl|my_center|LOCUS_45660 16067 17590 gene locus_tag LOCUS_45670 16067 17590 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45670 17601 18362 gene locus_tag LOCUS_45680 17601 18362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 18453 18845 gene locus_tag LOCUS_45690 18453 18845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 18842 19039 gene locus_tag LOCUS_45700 18842 19039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 19046 19873 gene locus_tag LOCUS_45710 19046 19873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 20086 20355 gene locus_tag LOCUS_45720 20086 20355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 >Feature sequence085 2561 1224 gene locus_tag LOCUS_45730 2561 1224 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944609.1 protein_id gnl|my_center|LOCUS_45730 2545 2730 gene locus_tag LOCUS_45740 2545 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 3750 2890 gene locus_tag LOCUS_45750 3750 2890 CDS product MtaA/CmuA family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938010.1 protein_id gnl|my_center|LOCUS_45750 4548 3868 gene locus_tag LOCUS_45760 4548 3868 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393606.1 protein_id gnl|my_center|LOCUS_45760 4808 4629 gene locus_tag LOCUS_45770 4808 4629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 5144 5659 gene locus_tag LOCUS_45780 5144 5659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45780 7170 5827 gene locus_tag LOCUS_45790 7170 5827 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929105.1 protein_id gnl|my_center|LOCUS_45790 10448 7326 gene locus_tag LOCUS_45800 10448 7326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45800 11671 10451 gene locus_tag LOCUS_45810 11671 10451 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943303.1 protein_id gnl|my_center|LOCUS_45810 11916 11668 gene locus_tag LOCUS_45820 11916 11668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45820 14251 12122 gene locus_tag LOCUS_45830 14251 12122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45830 14208 14693 gene locus_tag LOCUS_45840 14208 14693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45840 14783 15604 gene locus_tag LOCUS_45850 14783 15604 CDS product ceramidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771218.1 protein_id gnl|my_center|LOCUS_45850 16420 15749 gene locus_tag LOCUS_45860 16420 15749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 16733 17260 gene locus_tag LOCUS_45870 16733 17260 CDS product CHRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530918.1 protein_id gnl|my_center|LOCUS_45870 18279 17305 gene locus_tag LOCUS_45880 18279 17305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 18833 18414 gene locus_tag LOCUS_45890 18833 18414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45890 18931 19824 gene locus_tag LOCUS_45900 18931 19824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 20323 19895 gene locus_tag LOCUS_45910 20323 19895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 >Feature sequence086 313 23 gene locus_tag LOCUS_45920 313 23 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921003.1 protein_id gnl|my_center|LOCUS_45920 502 2160 gene locus_tag LOCUS_45930 502 2160 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142798.1 protein_id gnl|my_center|LOCUS_45930 2185 2610 gene locus_tag LOCUS_45940 2185 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45940 2629 2847 gene locus_tag LOCUS_45950 2629 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45950 2963 3424 gene locus_tag LOCUS_45960 2963 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 3414 4769 gene locus_tag LOCUS_45970 3414 4769 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258069.1 protein_id gnl|my_center|LOCUS_45970 4857 5216 gene locus_tag LOCUS_45980 4857 5216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 5218 5994 gene locus_tag LOCUS_45990 5218 5994 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405600.1 protein_id gnl|my_center|LOCUS_45990 7285 6134 gene locus_tag LOCUS_46000 7285 6134 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970459.1 protein_id gnl|my_center|LOCUS_46000 7403 7696 gene locus_tag LOCUS_46010 7403 7696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46010 8139 7693 gene locus_tag LOCUS_46020 8139 7693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 9172 8267 gene locus_tag LOCUS_46030 9172 8267 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941053.1 protein_id gnl|my_center|LOCUS_46030 9246 11582 gene locus_tag LOCUS_46040 9246 11582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46040 12562 11603 gene locus_tag LOCUS_46050 12562 11603 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225108.1 protein_id gnl|my_center|LOCUS_46050 14012 12576 gene locus_tag LOCUS_46060 14012 12576 CDS product putative glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009982187.1 protein_id gnl|my_center|LOCUS_46060 14122 14991 gene locus_tag LOCUS_46070 14122 14991 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_46070 15596 15105 gene locus_tag LOCUS_46080 15596 15105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 15793 15593 gene locus_tag LOCUS_46090 15793 15593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46090 17106 15892 gene locus_tag LOCUS_46100 17106 15892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 17924 17124 gene locus_tag LOCUS_46110 17924 17124 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110556.1 protein_id gnl|my_center|LOCUS_46110 <19491 17927 gene locus_tag LOCUS_46120 <19491 17927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061084.1:formate dehydrogenase subunit alpha >Feature sequence087 363 644 gene locus_tag LOCUS_46130 363 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 714 896 gene locus_tag LOCUS_46140 714 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46140 1018 1245 gene locus_tag LOCUS_46150 1018 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 1248 2711 gene locus_tag LOCUS_46160 1248 2711 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943221.1 protein_id gnl|my_center|LOCUS_46160 2708 5674 gene locus_tag LOCUS_46170 2708 5674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46170 5947 8529 gene locus_tag LOCUS_46180 5947 8529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46180 8547 10310 gene locus_tag LOCUS_46190 8547 10310 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141069.1 protein_id gnl|my_center|LOCUS_46190 10297 11460 gene locus_tag LOCUS_46200 10297 11460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46200 12504 11905 gene locus_tag LOCUS_46210 12504 11905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 13306 12518 gene locus_tag LOCUS_46220 13306 12518 CDS product DUF2182 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532424.1 protein_id gnl|my_center|LOCUS_46220 13582 16683 gene locus_tag LOCUS_46230 13582 16683 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969249.1 protein_id gnl|my_center|LOCUS_46230 16717 17382 gene locus_tag LOCUS_46240 16717 17382 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328034.1 protein_id gnl|my_center|LOCUS_46240 18173 17553 gene locus_tag LOCUS_46250 18173 17553 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899957.1 protein_id gnl|my_center|LOCUS_46250 18576 18202 gene locus_tag LOCUS_46260 18576 18202 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899956.1 protein_id gnl|my_center|LOCUS_46260 >Feature sequence088 2233 560 gene locus_tag LOCUS_46270 2233 560 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_46270 2621 2199 gene locus_tag LOCUS_46280 2621 2199 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938185.1 protein_id gnl|my_center|LOCUS_46280 3610 2642 gene locus_tag LOCUS_46290 3610 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 4146 3613 gene locus_tag LOCUS_46300 4146 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 5457 4213 gene locus_tag LOCUS_46310 5457 4213 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200944.1 protein_id gnl|my_center|LOCUS_46310 5538 6398 gene locus_tag LOCUS_46320 5538 6398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 6750 6412 gene locus_tag LOCUS_46330 6750 6412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46330 7819 6974 gene locus_tag LOCUS_46340 7819 6974 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_46340 9327 7828 gene locus_tag LOCUS_46350 9327 7828 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057582.1 protein_id gnl|my_center|LOCUS_46350 9878 9324 gene locus_tag LOCUS_46360 9878 9324 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392135.1 protein_id gnl|my_center|LOCUS_46360 10657 9809 gene locus_tag LOCUS_46370 10657 9809 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393437.1 protein_id gnl|my_center|LOCUS_46370 12150 10654 gene locus_tag LOCUS_46380 gene gcvPB 12150 10654 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230209.1 protein_id gnl|my_center|LOCUS_46380 12485 12147 gene locus_tag LOCUS_46390 12485 12147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 13061 13252 gene locus_tag LOCUS_46400 13061 13252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 13252 13680 gene locus_tag LOCUS_46410 13252 13680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46410 13680 14999 gene locus_tag LOCUS_46420 13680 14999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46420 15003 16148 gene locus_tag LOCUS_46430 15003 16148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 16118 16462 gene locus_tag LOCUS_46440 16118 16462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46440 17380 17165 gene locus_tag LOCUS_46450 17380 17165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 17508 18401 gene locus_tag LOCUS_46460 17508 18401 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974282.1 protein_id gnl|my_center|LOCUS_46460 >Feature sequence089 273 482 gene locus_tag LOCUS_46470 273 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 512 691 gene locus_tag LOCUS_46480 512 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 1218 1532 gene locus_tag LOCUS_46490 1218 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46490 1713 2345 gene locus_tag LOCUS_46500 1713 2345 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019249123.1 protein_id gnl|my_center|LOCUS_46500 2347 3336 gene locus_tag LOCUS_46510 2347 3336 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901996.1 protein_id gnl|my_center|LOCUS_46510 3357 4235 gene locus_tag LOCUS_46520 3357 4235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 4258 5214 gene locus_tag LOCUS_46530 4258 5214 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807825.1 protein_id gnl|my_center|LOCUS_46530 5211 5672 gene locus_tag LOCUS_46540 5211 5672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46540 5694 7202 gene locus_tag LOCUS_46550 5694 7202 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083773.1 protein_id gnl|my_center|LOCUS_46550 7240 8325 gene locus_tag LOCUS_46560 7240 8325 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810382.1 protein_id gnl|my_center|LOCUS_46560 8322 9356 gene locus_tag LOCUS_46570 8322 9356 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880876.1 protein_id gnl|my_center|LOCUS_46570 9356 10228 gene locus_tag LOCUS_46580 9356 10228 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807629.1 protein_id gnl|my_center|LOCUS_46580 10231 10722 gene locus_tag LOCUS_46590 gene cutC 10231 10722 CDS product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846651.1 protein_id gnl|my_center|LOCUS_46590 10719 13127 gene locus_tag LOCUS_46600 10719 13127 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921440.1 protein_id gnl|my_center|LOCUS_46600 13124 14698 gene locus_tag LOCUS_46610 13124 14698 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_46610 14809 15078 gene locus_tag LOCUS_46620 14809 15078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 15078 15587 gene locus_tag LOCUS_46630 15078 15587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 16079 15825 gene locus_tag LOCUS_46640 16079 15825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 16276 16650 gene locus_tag LOCUS_46650 16276 16650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 16631 16993 gene locus_tag LOCUS_46660 16631 16993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 17125 17535 gene locus_tag LOCUS_46670 17125 17535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46670 18273 17596 gene locus_tag LOCUS_46680 18273 17596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46680 >Feature sequence090 1312 1788 gene locus_tag LOCUS_46690 1312 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46690 2169 1828 gene locus_tag LOCUS_46700 2169 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46700 2616 3386 gene locus_tag LOCUS_46710 2616 3386 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391918.1 protein_id gnl|my_center|LOCUS_46710 3404 4591 gene locus_tag LOCUS_46720 3404 4591 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064221.1 protein_id gnl|my_center|LOCUS_46720 4602 5462 gene locus_tag LOCUS_46730 4602 5462 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064222.1 protein_id gnl|my_center|LOCUS_46730 5471 6442 gene locus_tag LOCUS_46740 5471 6442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 6447 7175 gene locus_tag LOCUS_46750 6447 7175 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085709.1 protein_id gnl|my_center|LOCUS_46750 7175 7879 gene locus_tag LOCUS_46760 7175 7879 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089217.1 protein_id gnl|my_center|LOCUS_46760 7894 9015 gene locus_tag LOCUS_46770 7894 9015 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133901583.1 protein_id gnl|my_center|LOCUS_46770 9012 9317 gene locus_tag LOCUS_46780 9012 9317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46780 9298 10413 gene locus_tag LOCUS_46790 9298 10413 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204969.1 protein_id gnl|my_center|LOCUS_46790 10410 11570 gene locus_tag LOCUS_46800 10410 11570 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975704.1 protein_id gnl|my_center|LOCUS_46800 11675 12859 gene locus_tag LOCUS_46810 11675 12859 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258129.1 protein_id gnl|my_center|LOCUS_46810 12856 14031 gene locus_tag LOCUS_46820 12856 14031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46820 14074 14361 gene locus_tag LOCUS_46830 14074 14361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46830 14464 15228 gene locus_tag LOCUS_46840 gene sbnG 14464 15228 CDS product staphyloferrin B biosynthesis citrate synthase SbnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186804.1 protein_id gnl|my_center|LOCUS_46840 15225 16391 gene locus_tag LOCUS_46850 15225 16391 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_46850 16439 16828 gene locus_tag LOCUS_46860 16439 16828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 17390 16944 gene locus_tag LOCUS_46870 gene mce 17390 16944 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_46870 17560 17387 gene locus_tag LOCUS_46880 17560 17387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46880 >Feature sequence091 644 417 gene locus_tag LOCUS_46890 644 417 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312329.1 protein_id gnl|my_center|LOCUS_46890 1360 749 gene locus_tag LOCUS_46900 1360 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46900 2757 1426 gene locus_tag LOCUS_46910 2757 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46910 3642 3103 gene locus_tag LOCUS_46920 3642 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46920 3960 3655 gene locus_tag LOCUS_46930 3960 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229096.1 protein_id gnl|my_center|LOCUS_46930 4523 4251 gene locus_tag LOCUS_46940 4523 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46940 5218 4565 gene locus_tag LOCUS_46950 5218 4565 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731458.1 protein_id gnl|my_center|LOCUS_46950 5801 5394 gene locus_tag LOCUS_46960 5801 5394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46960 6295 6885 gene locus_tag LOCUS_46970 6295 6885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46970 7386 8081 gene locus_tag LOCUS_46980 7386 8081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46980 8078 10381 gene locus_tag LOCUS_46990 8078 10381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46990 10655 10410 gene locus_tag LOCUS_47000 10655 10410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47000 10821 10630 gene locus_tag LOCUS_47010 10821 10630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47010 10873 11325 gene locus_tag LOCUS_47020 10873 11325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47020 11396 11623 gene locus_tag LOCUS_47030 11396 11623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47030 11620 13044 gene locus_tag LOCUS_47040 11620 13044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47040 13059 13271 gene locus_tag LOCUS_47050 13059 13271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47050 13268 14212 gene locus_tag LOCUS_47060 13268 14212 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930636.1 protein_id gnl|my_center|LOCUS_47060 14277 14963 gene locus_tag LOCUS_47070 14277 14963 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880118.1 protein_id gnl|my_center|LOCUS_47070 14960 15298 gene locus_tag LOCUS_47080 14960 15298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47080 15303 15956 gene locus_tag LOCUS_47090 15303 15956 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019249123.1 protein_id gnl|my_center|LOCUS_47090 >Feature sequence092 755 357 gene locus_tag LOCUS_47100 755 357 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393815.1 protein_id gnl|my_center|LOCUS_47100 1001 756 gene locus_tag LOCUS_47110 1001 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47110 1209 1033 gene locus_tag LOCUS_47120 1209 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47120 1880 1386 gene locus_tag LOCUS_47130 1880 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 3404 2130 gene locus_tag LOCUS_47140 3404 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47140 4327 3554 gene locus_tag LOCUS_47150 4327 3554 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944031.1 protein_id gnl|my_center|LOCUS_47150 7634 4365 gene locus_tag LOCUS_47160 7634 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47160 7991 8863 gene locus_tag LOCUS_47170 7991 8863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47170 9518 9051 gene locus_tag LOCUS_47180 9518 9051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47180 10917 9613 gene locus_tag LOCUS_47190 10917 9613 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941517.1 protein_id gnl|my_center|LOCUS_47190 11923 11024 gene locus_tag LOCUS_47200 11923 11024 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023900.1 protein_id gnl|my_center|LOCUS_47200 11907 12164 gene locus_tag LOCUS_47210 11907 12164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47210 12748 12461 gene locus_tag LOCUS_47220 12748 12461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47220 13158 13460 gene locus_tag LOCUS_47230 13158 13460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47230 13743 14024 gene locus_tag LOCUS_47240 13743 14024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 14178 14008 gene locus_tag LOCUS_47250 14178 14008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47250 15456 14287 gene locus_tag LOCUS_47260 15456 14287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 >Feature sequence093 432 151 gene locus_tag LOCUS_47270 432 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 1702 509 gene locus_tag LOCUS_47280 1702 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 1803 4760 gene locus_tag LOCUS_47290 1803 4760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 4947 5447 gene locus_tag LOCUS_47300 4947 5447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47300 5660 7648 gene locus_tag LOCUS_47310 5660 7648 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_47310 7651 9612 gene locus_tag LOCUS_47320 7651 9612 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_47320 13246 11363 gene locus_tag LOCUS_47330 13246 11363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 13609 13262 gene locus_tag LOCUS_47340 13609 13262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 15906 13603 gene locus_tag LOCUS_47350 15906 13603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 >Feature sequence094 1260 649 gene locus_tag LOCUS_47360 1260 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47360 1538 2551 gene locus_tag LOCUS_47370 1538 2551 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 protein_id gnl|my_center|LOCUS_47370 2581 3957 gene locus_tag LOCUS_47380 2581 3957 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810930.1 protein_id gnl|my_center|LOCUS_47380 4024 5004 gene locus_tag LOCUS_47390 4024 5004 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929813.1 protein_id gnl|my_center|LOCUS_47390 6110 5022 gene locus_tag LOCUS_47400 6110 5022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47400 6648 6971 gene locus_tag LOCUS_47410 6648 6971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47410 6990 7772 gene locus_tag LOCUS_47420 6990 7772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47420 7776 8399 gene locus_tag LOCUS_47430 7776 8399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47430 8815 9201 gene locus_tag LOCUS_47440 8815 9201 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941201.1 protein_id gnl|my_center|LOCUS_47440 9263 10486 gene locus_tag LOCUS_47450 9263 10486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_47450 11188 10502 gene locus_tag LOCUS_47460 11188 10502 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868218.1 protein_id gnl|my_center|LOCUS_47460 12035 11193 gene locus_tag LOCUS_47470 gene pcaD 12035 11193 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727990.1 protein_id gnl|my_center|LOCUS_47470 12189 12476 gene locus_tag LOCUS_47480 12189 12476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47480 12498 12719 gene locus_tag LOCUS_47490 12498 12719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 12747 13838 gene locus_tag LOCUS_47500 12747 13838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_47500 13864 14868 gene locus_tag LOCUS_47510 13864 14868 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930616.1 protein_id gnl|my_center|LOCUS_47510 14879 15415 gene locus_tag LOCUS_47520 14879 15415 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808807.1 protein_id gnl|my_center|LOCUS_47520 >Feature sequence095 501 355 gene locus_tag LOCUS_47530 501 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47530 1127 501 gene locus_tag LOCUS_47540 1127 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47540 1903 1118 gene locus_tag LOCUS_47550 1903 1118 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967028.1 protein_id gnl|my_center|LOCUS_47550 2792 1908 gene locus_tag LOCUS_47560 2792 1908 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256971.1 protein_id gnl|my_center|LOCUS_47560 4128 2842 gene locus_tag LOCUS_47570 4128 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47570 5703 4186 gene locus_tag LOCUS_47580 5703 4186 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259464.1 protein_id gnl|my_center|LOCUS_47580 5989 7224 gene locus_tag LOCUS_47590 5989 7224 CDS product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879450.1 protein_id gnl|my_center|LOCUS_47590 7221 8315 gene locus_tag LOCUS_47600 gene hadC 7221 8315 CDS product (R)-2-hydroxyisocaproyl-CoA dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 protein_id gnl|my_center|LOCUS_47600 8476 8823 gene locus_tag LOCUS_47610 8476 8823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 10371 8752 gene locus_tag LOCUS_47620 10371 8752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47620 10374 11393 gene locus_tag LOCUS_47630 10374 11393 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944030.1 protein_id gnl|my_center|LOCUS_47630 12877 11432 gene locus_tag LOCUS_47640 12877 11432 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096456532.1 protein_id gnl|my_center|LOCUS_47640 13026 13973 gene locus_tag LOCUS_47650 13026 13973 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973218.1 protein_id gnl|my_center|LOCUS_47650 14158 14937 gene locus_tag LOCUS_47660 14158 14937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47660 15343 15062 gene locus_tag LOCUS_47670 15343 15062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47670 >Feature sequence096 1192 1794 gene locus_tag LOCUS_47680 1192 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47680 1804 2580 gene locus_tag LOCUS_47690 1804 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47690 3531 2731 gene locus_tag LOCUS_47700 gene mscS 3531 2731 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_47700 4752 3544 gene locus_tag LOCUS_47710 4752 3544 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104167.1 protein_id gnl|my_center|LOCUS_47710 5024 6667 gene locus_tag LOCUS_47720 5024 6667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47720 6740 7537 gene locus_tag LOCUS_47730 6740 7537 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804112.1 protein_id gnl|my_center|LOCUS_47730 7548 8333 gene locus_tag LOCUS_47740 7548 8333 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_47740 8349 9500 gene locus_tag LOCUS_47750 8349 9500 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804113.1 protein_id gnl|my_center|LOCUS_47750 9500 10075 gene locus_tag LOCUS_47760 9500 10075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47760 10597 10400 gene locus_tag LOCUS_47770 10597 10400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47770 10860 10651 gene locus_tag LOCUS_47780 10860 10651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530089.1 protein_id gnl|my_center|LOCUS_47780 11530 11066 gene locus_tag LOCUS_47790 11530 11066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47790 11934 11560 gene locus_tag LOCUS_47800 11934 11560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47800 12154 11918 gene locus_tag LOCUS_47810 12154 11918 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259539.1 protein_id gnl|my_center|LOCUS_47810 13336 12944 gene locus_tag LOCUS_47820 13336 12944 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879708.1 protein_id gnl|my_center|LOCUS_47820 15023 13359 gene locus_tag LOCUS_47830 15023 13359 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869041.1 protein_id gnl|my_center|LOCUS_47830 >Feature sequence097 <1 770 gene locus_tag LOCUS_47840 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071344.1:TRAP transporter substrate-binding protein DctP 1975 836 gene locus_tag LOCUS_47850 1975 836 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931674.1 protein_id gnl|my_center|LOCUS_47850 2850 1975 gene locus_tag LOCUS_47860 2850 1975 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921650.1 protein_id gnl|my_center|LOCUS_47860 3955 2870 gene locus_tag LOCUS_47870 3955 2870 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082970.1 protein_id gnl|my_center|LOCUS_47870 5118 3961 gene locus_tag LOCUS_47880 5118 3961 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033450234.1 protein_id gnl|my_center|LOCUS_47880 6278 5115 gene locus_tag LOCUS_47890 6278 5115 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230129.1 protein_id gnl|my_center|LOCUS_47890 7322 6291 gene locus_tag LOCUS_47900 7322 6291 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189188.1 protein_id gnl|my_center|LOCUS_47900 7640 8650 gene locus_tag LOCUS_47910 7640 8650 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 protein_id gnl|my_center|LOCUS_47910 9118 8678 gene locus_tag LOCUS_47920 9118 8678 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393694.1 protein_id gnl|my_center|LOCUS_47920 9384 9115 gene locus_tag LOCUS_47930 9384 9115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47930 10409 9573 gene locus_tag LOCUS_47940 10409 9573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 10739 10470 gene locus_tag LOCUS_47950 10739 10470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47950 11520 11086 gene locus_tag LOCUS_47960 11520 11086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47960 12245 11811 gene locus_tag LOCUS_47970 12245 11811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47970 13866 12259 gene locus_tag LOCUS_47980 13866 12259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47980 >Feature sequence098 902 693 gene locus_tag LOCUS_47990 902 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47990 1052 2620 gene locus_tag LOCUS_48000 1052 2620 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812304.1 protein_id gnl|my_center|LOCUS_48000 2657 3604 gene locus_tag LOCUS_48010 2657 3604 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257249.1 protein_id gnl|my_center|LOCUS_48010 3604 4431 gene locus_tag LOCUS_48020 3604 4431 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257247.1 protein_id gnl|my_center|LOCUS_48020 4431 6494 gene locus_tag LOCUS_48030 4431 6494 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532883.1 protein_id gnl|my_center|LOCUS_48030 6487 7884 gene locus_tag LOCUS_48040 6487 7884 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930446.1 protein_id gnl|my_center|LOCUS_48040 7881 9155 gene locus_tag LOCUS_48050 7881 9155 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812305.1 protein_id gnl|my_center|LOCUS_48050 9152 10393 gene locus_tag LOCUS_48060 9152 10393 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104091.1 protein_id gnl|my_center|LOCUS_48060 10390 11610 gene locus_tag LOCUS_48070 10390 11610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 12289 11984 gene locus_tag LOCUS_48080 12289 11984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48080 12350 12487 gene locus_tag LOCUS_48090 12350 12487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48090 13632 12649 gene locus_tag LOCUS_48100 13632 12649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48100 <15127 14387 gene locus_tag LOCUS_48110 <15127 14387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538206.1:ABC transporter permease >Feature sequence099 2594 2154 gene locus_tag LOCUS_48120 2594 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48120 4494 2716 gene locus_tag LOCUS_48130 4494 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48130 4738 5715 gene locus_tag LOCUS_48140 4738 5715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48140 5841 6683 gene locus_tag LOCUS_48150 5841 6683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48150 6741 7598 gene locus_tag LOCUS_48160 6741 7598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48160 8820 7609 gene locus_tag LOCUS_48170 8820 7609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48170 9908 8817 gene locus_tag LOCUS_48180 9908 8817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48180 10309 10833 gene locus_tag LOCUS_48190 10309 10833 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194548.1 protein_id gnl|my_center|LOCUS_48190 10875 11702 gene locus_tag LOCUS_48200 10875 11702 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_48200 11734 14508 gene locus_tag LOCUS_48210 11734 14508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48210 >Feature sequence100 898 158 gene locus_tag LOCUS_48220 898 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48220 2018 951 gene locus_tag LOCUS_48230 2018 951 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880213.1 protein_id gnl|my_center|LOCUS_48230 3509 2310 gene locus_tag LOCUS_48240 3509 2310 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846995.1 protein_id gnl|my_center|LOCUS_48240 4249 3527 gene locus_tag LOCUS_48250 4249 3527 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880210.1 protein_id gnl|my_center|LOCUS_48250 4626 4249 gene locus_tag LOCUS_48260 4626 4249 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318897.1 protein_id gnl|my_center|LOCUS_48260 5054 4710 gene locus_tag LOCUS_48270 5054 4710 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785422.1 protein_id gnl|my_center|LOCUS_48270 6298 5153 gene locus_tag LOCUS_48280 6298 5153 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142358.1 protein_id gnl|my_center|LOCUS_48280 8468 6390 gene locus_tag LOCUS_48290 gene fusA 8468 6390 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546422.1 protein_id gnl|my_center|LOCUS_48290 9660 8719 gene locus_tag LOCUS_48300 9660 8719 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245441.1 protein_id gnl|my_center|LOCUS_48300 10665 9664 gene locus_tag LOCUS_48310 gene ispH 10665 9664 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073362.1 protein_id gnl|my_center|LOCUS_48310 11688 10930 gene locus_tag LOCUS_48320 11688 10930 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388219.1 protein_id gnl|my_center|LOCUS_48320 <14837 11872 gene locus_tag LOCUS_48330 <14837 11872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931090.1:DUF748 domain-containing protein >Feature sequence101 <1 936 gene locus_tag LOCUS_48340 <1 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_166468466.1:TRAP transporter large permease 960 1883 gene locus_tag LOCUS_48350 960 1883 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460928.1 protein_id gnl|my_center|LOCUS_48350 1880 2986 gene locus_tag LOCUS_48360 1880 2986 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228924.1 protein_id gnl|my_center|LOCUS_48360 2983 4143 gene locus_tag LOCUS_48370 2983 4143 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229596.1 protein_id gnl|my_center|LOCUS_48370 4140 5393 gene locus_tag LOCUS_48380 4140 5393 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129610996.1 protein_id gnl|my_center|LOCUS_48380 5390 6556 gene locus_tag LOCUS_48390 5390 6556 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082450.1 protein_id gnl|my_center|LOCUS_48390 6553 7971 gene locus_tag LOCUS_48400 6553 7971 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927617.1 protein_id gnl|my_center|LOCUS_48400 8133 9911 gene locus_tag LOCUS_48410 8133 9911 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114537.1 protein_id gnl|my_center|LOCUS_48410 10026 10310 gene locus_tag LOCUS_48420 10026 10310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48420 10383 10592 gene locus_tag LOCUS_48430 10383 10592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48430 10594 11655 gene locus_tag LOCUS_48440 10594 11655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_48440 11684 12700 gene locus_tag LOCUS_48450 11684 12700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48450 12729 13208 gene locus_tag LOCUS_48460 12729 13208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48460 13215 14528 gene locus_tag LOCUS_48470 13215 14528 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166468466.1 protein_id gnl|my_center|LOCUS_48470 >Feature sequence102 4187 3018 gene locus_tag LOCUS_48480 4187 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48480 4449 5039 gene locus_tag LOCUS_48490 4449 5039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48490 5051 5356 gene locus_tag LOCUS_48500 5051 5356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48500 7056 5458 gene locus_tag LOCUS_48510 7056 5458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48510 7311 7063 gene locus_tag LOCUS_48520 7311 7063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 8024 7416 gene locus_tag LOCUS_48530 8024 7416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48530 9092 8136 gene locus_tag LOCUS_48540 9092 8136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48540 11102 9276 gene locus_tag LOCUS_48550 11102 9276 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256059.1 protein_id gnl|my_center|LOCUS_48550 11242 13149 gene locus_tag LOCUS_48560 11242 13149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48560 13142 13834 gene locus_tag LOCUS_48570 gene kdpE 13142 13834 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185947.1 protein_id gnl|my_center|LOCUS_48570 <14441 13895 gene locus_tag LOCUS_48580 <14441 13895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228569.1:AMP-binding protein >Feature sequence103 631 555 gene locus_tag LOCUS_t00500 631 555 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1235 672 gene locus_tag LOCUS_48590 1235 672 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_48590 2031 1282 gene locus_tag LOCUS_48600 gene rph 2031 1282 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096595.1 protein_id gnl|my_center|LOCUS_48600 3721 2186 gene locus_tag LOCUS_48610 3721 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48610 4297 3962 gene locus_tag LOCUS_48620 4297 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48620 5648 4302 gene locus_tag LOCUS_48630 5648 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48630 5972 5679 gene locus_tag LOCUS_48640 5972 5679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48640 6252 6476 gene locus_tag LOCUS_48650 6252 6476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48650 6460 6723 gene locus_tag LOCUS_48660 6460 6723 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171672.1 protein_id gnl|my_center|LOCUS_48660 6935 9442 gene locus_tag LOCUS_48670 6935 9442 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_48670 9898 9544 gene locus_tag LOCUS_tm00010 9898 9544 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 10506 10045 gene locus_tag LOCUS_48680 gene smpB 10506 10045 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583706.1 protein_id gnl|my_center|LOCUS_48680 10559 10645 gene locus_tag LOCUS_t00510 10559 10645 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10727 10852 gene locus_tag LOCUS_48690 10727 10852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48690 10927 11259 gene locus_tag LOCUS_48700 10927 11259 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391614.1 protein_id gnl|my_center|LOCUS_48700 11335 12465 gene locus_tag LOCUS_48710 11335 12465 CDS product putative sulfate/molybdate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925781.1 protein_id gnl|my_center|LOCUS_48710 12631 12497 gene locus_tag LOCUS_48720 12631 12497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48720 13355 12624 gene locus_tag LOCUS_48730 13355 12624 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_48730 14067 13345 gene locus_tag LOCUS_48740 14067 13345 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878326.1 protein_id gnl|my_center|LOCUS_48740 >Feature sequence104 <1 956 gene locus_tag LOCUS_48750 <1 956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063709.1:TRAP transporter large permease 963 1742 gene locus_tag LOCUS_48760 963 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48760 1772 2548 gene locus_tag LOCUS_48770 1772 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48770 2694 3776 gene locus_tag LOCUS_48780 gene asd 2694 3776 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876434.1 protein_id gnl|my_center|LOCUS_48780 3826 5931 gene locus_tag LOCUS_48790 3826 5931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48790 5928 6581 gene locus_tag LOCUS_48800 5928 6581 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461976.1 protein_id gnl|my_center|LOCUS_48800 7102 6620 gene locus_tag LOCUS_48810 7102 6620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48810 7980 7090 gene locus_tag LOCUS_48820 7980 7090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48820 8682 7996 gene locus_tag LOCUS_48830 8682 7996 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811924.1 protein_id gnl|my_center|LOCUS_48830 9773 8697 gene locus_tag LOCUS_48840 9773 8697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48840 10327 9914 gene locus_tag LOCUS_48850 10327 9914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48850 10596 11993 gene locus_tag LOCUS_48860 gene tcuA 10596 11993 CDS product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966591.1 protein_id gnl|my_center|LOCUS_48860 11980 13077 gene locus_tag LOCUS_48870 gene tcuB 11980 13077 CDS product tricarballylate utilization 4Fe-4S protein TcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085110.1 protein_id gnl|my_center|LOCUS_48870 >Feature sequence105 887 651 gene locus_tag LOCUS_48880 887 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48880 1155 871 gene locus_tag LOCUS_48890 1155 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48890 1922 1224 gene locus_tag LOCUS_48900 1922 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48900 2798 2445 gene locus_tag LOCUS_48910 2798 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48910 3382 3140 gene locus_tag LOCUS_48920 3382 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48920 3639 3382 gene locus_tag LOCUS_48930 3639 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48930 4467 4102 gene locus_tag LOCUS_48940 4467 4102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48940 5507 4995 gene locus_tag LOCUS_48950 5507 4995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48950 5863 6333 gene locus_tag LOCUS_48960 5863 6333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48960 7537 6374 gene locus_tag LOCUS_48970 7537 6374 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089530.1 protein_id gnl|my_center|LOCUS_48970 7639 8361 gene locus_tag LOCUS_48980 7639 8361 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257014.1 protein_id gnl|my_center|LOCUS_48980 8362 9117 gene locus_tag LOCUS_48990 8362 9117 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216585.1 protein_id gnl|my_center|LOCUS_48990 9538 9628 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9751 10941 gene locus_tag LOCUS_49000 9751 10941 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_49000 12627 10948 gene locus_tag LOCUS_49010 12627 10948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49010 13037 12624 gene locus_tag LOCUS_49020 13037 12624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49020 >Feature sequence106 261 2624 gene locus_tag LOCUS_49030 gene tkt 261 2624 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403054.1 protein_id gnl|my_center|LOCUS_49030 2841 4064 gene locus_tag LOCUS_49040 2841 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49040 4081 4470 gene locus_tag LOCUS_49050 4081 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49050 4973 4512 gene locus_tag LOCUS_49060 4973 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49060 5123 6073 gene locus_tag LOCUS_49070 5123 6073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49070 7098 6103 gene locus_tag LOCUS_49080 7098 6103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49080 7632 7429 gene locus_tag LOCUS_49090 7632 7429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49090 7848 7633 gene locus_tag LOCUS_49100 7848 7633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49100 8146 7862 gene locus_tag LOCUS_49110 8146 7862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49110 9478 8414 gene locus_tag LOCUS_49120 9478 8414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_49120 10052 9765 gene locus_tag LOCUS_49130 10052 9765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49130 10599 10087 gene locus_tag LOCUS_49140 10599 10087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49140 12835 10688 gene locus_tag LOCUS_49150 12835 10688 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_49150 >Feature sequence107 1328 261 gene locus_tag LOCUS_49160 1328 261 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810382.1 protein_id gnl|my_center|LOCUS_49160 2074 1325 gene locus_tag LOCUS_49170 2074 1325 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086077.1 protein_id gnl|my_center|LOCUS_49170 2823 2065 gene locus_tag LOCUS_49180 2823 2065 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808828.1 protein_id gnl|my_center|LOCUS_49180 3837 2839 gene locus_tag LOCUS_49190 3837 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49190 5260 3881 gene locus_tag LOCUS_49200 5260 3881 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 protein_id gnl|my_center|LOCUS_49200 6155 5532 gene locus_tag LOCUS_49210 6155 5532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49210 7208 6447 gene locus_tag LOCUS_49220 7208 6447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49220 7242 9260 gene locus_tag LOCUS_49230 7242 9260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49230 9273 9650 gene locus_tag LOCUS_49240 9273 9650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49240 9759 10376 gene locus_tag LOCUS_49250 9759 10376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49250 10403 11275 gene locus_tag LOCUS_49260 10403 11275 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943615.1 protein_id gnl|my_center|LOCUS_49260 11272 12015 gene locus_tag LOCUS_49270 11272 12015 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059661.1 protein_id gnl|my_center|LOCUS_49270 >Feature sequence108 48 1442 gene locus_tag LOCUS_49280 48 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49280 1971 1498 gene locus_tag LOCUS_49290 1971 1498 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249247.1 protein_id gnl|my_center|LOCUS_49290 2615 1971 gene locus_tag LOCUS_49300 2615 1971 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384710.1 protein_id gnl|my_center|LOCUS_49300 2711 4852 gene locus_tag LOCUS_49310 2711 4852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49310 5332 4880 gene locus_tag LOCUS_49320 5332 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49320 6977 5673 gene locus_tag LOCUS_49330 6977 5673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49330 7127 7771 gene locus_tag LOCUS_49340 7127 7771 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019249123.1 protein_id gnl|my_center|LOCUS_49340 7749 9371 gene locus_tag LOCUS_49350 7749 9371 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 protein_id gnl|my_center|LOCUS_49350 9374 9805 gene locus_tag LOCUS_49360 9374 9805 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 protein_id gnl|my_center|LOCUS_49360 9817 11175 gene locus_tag LOCUS_49370 gene fldB 9817 11175 CDS product phenyllactyl-CoA dehydratase subunit FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048237.1 protein_id gnl|my_center|LOCUS_49370 11221 11823 gene locus_tag LOCUS_49380 11221 11823 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440210.1 protein_id gnl|my_center|LOCUS_49380 12580 11873 gene locus_tag LOCUS_49390 12580 11873 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435816.1 protein_id gnl|my_center|LOCUS_49390 >Feature sequence109 1934 387 gene locus_tag LOCUS_49400 1934 387 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965939.1 protein_id gnl|my_center|LOCUS_49400 2959 1931 gene locus_tag LOCUS_49410 2959 1931 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_49410 4332 3007 gene locus_tag LOCUS_49420 4332 3007 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388548.1 protein_id gnl|my_center|LOCUS_49420 4518 4718 gene locus_tag LOCUS_49430 4518 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49430 4986 4663 gene locus_tag LOCUS_49440 4986 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49440 5419 4991 gene locus_tag LOCUS_49450 5419 4991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49450 5670 5416 gene locus_tag LOCUS_49460 5670 5416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49460 8826 5947 gene locus_tag LOCUS_49470 8826 5947 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939652.1 protein_id gnl|my_center|LOCUS_49470 10402 8882 gene locus_tag LOCUS_49480 10402 8882 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228677.1 protein_id gnl|my_center|LOCUS_49480 10577 10404 gene locus_tag LOCUS_49490 10577 10404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49490 11203 10610 gene locus_tag LOCUS_49500 11203 10610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49500 12008 11235 gene locus_tag LOCUS_49510 12008 11235 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089217.1 protein_id gnl|my_center|LOCUS_49510 >Feature sequence110 2790 4187 gene locus_tag LOCUS_49520 2790 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49520 4419 4279 gene locus_tag LOCUS_49530 4419 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49530 4420 4671 gene locus_tag LOCUS_49540 4420 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49540 6892 5291 gene locus_tag LOCUS_49550 6892 5291 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229601.1 protein_id gnl|my_center|LOCUS_49550 7701 6889 gene locus_tag LOCUS_49560 7701 6889 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030973.1 protein_id gnl|my_center|LOCUS_49560 9809 7701 gene locus_tag LOCUS_49570 9809 7701 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229602.1 protein_id gnl|my_center|LOCUS_49570 9954 10928 gene locus_tag LOCUS_49580 9954 10928 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228475.1 protein_id gnl|my_center|LOCUS_49580 10945 11445 gene locus_tag LOCUS_49590 10945 11445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 >Feature sequence111 1456 2337 gene locus_tag LOCUS_49600 1456 2337 CDS product TIGR03854 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877740.1 protein_id gnl|my_center|LOCUS_49600 3111 5231 gene locus_tag LOCUS_49610 3111 5231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49610 5315 6244 gene locus_tag LOCUS_49620 5315 6244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49620 6315 6797 gene locus_tag LOCUS_49630 6315 6797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49630 6962 8362 gene locus_tag LOCUS_49640 gene fumC 6962 8362 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857390.1 protein_id gnl|my_center|LOCUS_49640 8359 9264 gene locus_tag LOCUS_49650 8359 9264 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140767.1 protein_id gnl|my_center|LOCUS_49650 9363 11765 gene locus_tag LOCUS_49660 9363 11765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49660 >Feature sequence112 2721 607 gene locus_tag LOCUS_49670 2721 607 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368420.1 protein_id gnl|my_center|LOCUS_49670 3049 2825 gene locus_tag LOCUS_49680 3049 2825 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_49680 3246 3052 gene locus_tag LOCUS_49690 3246 3052 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532021.1 protein_id gnl|my_center|LOCUS_49690 3743 5428 gene locus_tag LOCUS_49700 3743 5428 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093598.1 protein_id gnl|my_center|LOCUS_49700 6021 5533 gene locus_tag LOCUS_49710 gene aroQ 6021 5533 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035767.1 protein_id gnl|my_center|LOCUS_49710 6884 6132 gene locus_tag LOCUS_49720 6884 6132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49720 7516 7001 gene locus_tag LOCUS_49730 7516 7001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49730 8424 7567 gene locus_tag LOCUS_49740 8424 7567 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976828.1 protein_id gnl|my_center|LOCUS_49740 9515 8421 gene locus_tag LOCUS_49750 9515 8421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_49750 9685 9512 gene locus_tag LOCUS_49760 9685 9512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49760 10042 9755 gene locus_tag LOCUS_49770 10042 9755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49770 11224 10220 gene locus_tag LOCUS_49780 11224 10220 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086224.1 protein_id gnl|my_center|LOCUS_49780 11894 11232 gene locus_tag LOCUS_49790 11894 11232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49790 >Feature sequence113 2317 545 gene locus_tag LOCUS_49800 2317 545 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815513.1 protein_id gnl|my_center|LOCUS_49800 3170 2319 gene locus_tag LOCUS_49810 3170 2319 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039248.1 protein_id gnl|my_center|LOCUS_49810 4401 3196 gene locus_tag LOCUS_49820 4401 3196 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096034.1 protein_id gnl|my_center|LOCUS_49820 4574 5482 gene locus_tag LOCUS_49830 4574 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49830 6280 5588 gene locus_tag LOCUS_49840 6280 5588 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085971.1 protein_id gnl|my_center|LOCUS_49840 7053 6274 gene locus_tag LOCUS_49850 7053 6274 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086167.1 protein_id gnl|my_center|LOCUS_49850 7997 7053 gene locus_tag LOCUS_49860 7997 7053 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809842.1 protein_id gnl|my_center|LOCUS_49860 8851 7997 gene locus_tag LOCUS_49870 8851 7997 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064203.1 protein_id gnl|my_center|LOCUS_49870 10184 8943 gene locus_tag LOCUS_49880 10184 8943 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088694.1 protein_id gnl|my_center|LOCUS_49880 11097 10195 gene locus_tag LOCUS_49890 11097 10195 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227264.1 protein_id gnl|my_center|LOCUS_49890 <11653 11117 gene locus_tag LOCUS_49900 <11653 11117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003893543.1:M24 family metallopeptidase >Feature sequence114 698 1408 gene locus_tag LOCUS_49910 698 1408 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110587.1 protein_id gnl|my_center|LOCUS_49910 2443 1427 gene locus_tag LOCUS_49920 2443 1427 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_49920 2591 3055 gene locus_tag LOCUS_49930 2591 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49930 3070 3285 gene locus_tag LOCUS_49940 3070 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49940 3834 3466 gene locus_tag LOCUS_49950 3834 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49950 5496 4681 gene locus_tag LOCUS_49960 5496 4681 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879896.1 protein_id gnl|my_center|LOCUS_49960 7368 5599 gene locus_tag LOCUS_49970 7368 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49970 8333 9193 gene locus_tag LOCUS_49980 8333 9193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49980 9329 9670 gene locus_tag LOCUS_49990 9329 9670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49990 9855 10322 gene locus_tag LOCUS_50000 9855 10322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50000 <11591 10455 gene locus_tag LOCUS_50010 <11591 10455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804113.1:acyl-CoA dehydrogenase family protein >Feature sequence115 1968 811 gene locus_tag LOCUS_50020 1968 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50020 3438 1984 gene locus_tag LOCUS_50030 3438 1984 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941261.1 protein_id gnl|my_center|LOCUS_50030 4729 3431 gene locus_tag LOCUS_50040 4729 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50040 6264 4768 gene locus_tag LOCUS_50050 6264 4768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50050 9855 6343 gene locus_tag LOCUS_50060 9855 6343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50060 10176 9871 gene locus_tag LOCUS_50070 10176 9871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50070 <11562 10368 gene locus_tag LOCUS_50080 <11562 10368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942207.1:PBP1A family penicillin-binding protein >Feature sequence116 243 1223 gene locus_tag LOCUS_50090 243 1223 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941141.1 protein_id gnl|my_center|LOCUS_50090 1642 1217 gene locus_tag LOCUS_50100 1642 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50100 1910 1650 gene locus_tag LOCUS_50110 1910 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50110 2406 5165 gene locus_tag LOCUS_50120 gene cas3u 2406 5165 CDS product type I-U CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930412.1 protein_id gnl|my_center|LOCUS_50120 5162 5950 gene locus_tag LOCUS_50130 gene cas8c 5162 5950 CDS product type I-U CRISPR-associated protein Cas8c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940730.1 protein_id gnl|my_center|LOCUS_50130 5947 7089 gene locus_tag LOCUS_50140 gene cas7u 5947 7089 CDS product type I-U CRISPR-associated RAMP protein Csb1/Cas7u inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940731.1 protein_id gnl|my_center|LOCUS_50140 7089 8549 gene locus_tag LOCUS_50150 gene csb2 7089 8549 CDS product type I-U CRISPR-associated protein Csb2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940732.1 protein_id gnl|my_center|LOCUS_50150 8734 10443 gene locus_tag LOCUS_50160 gene cas1 8734 10443 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 protein_id gnl|my_center|LOCUS_50160 10455 10745 gene locus_tag LOCUS_50170 gene cas2 10455 10745 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387937.1 protein_id gnl|my_center|LOCUS_50170 10967 11226 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggtttccgcggcgtcgacgccgcggctccattgaagc >Feature sequence117 1498 35 gene locus_tag LOCUS_50180 1498 35 CDS product carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819989.1 protein_id gnl|my_center|LOCUS_50180 1997 1491 gene locus_tag LOCUS_50190 gene accB 1997 1491 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892082.1 protein_id gnl|my_center|LOCUS_50190 2362 1997 gene locus_tag LOCUS_50200 2362 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50200 3297 2359 gene locus_tag LOCUS_50210 3297 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50210 4745 3294 gene locus_tag LOCUS_50220 4745 3294 CDS product carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819989.1 protein_id gnl|my_center|LOCUS_50220 5496 4765 gene locus_tag LOCUS_50230 5496 4765 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_50230 6332 5493 gene locus_tag LOCUS_50240 6332 5493 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971601.1 protein_id gnl|my_center|LOCUS_50240 7344 6346 gene locus_tag LOCUS_50250 7344 6346 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032909456.1 protein_id gnl|my_center|LOCUS_50250 8773 7373 gene locus_tag LOCUS_50260 8773 7373 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459733.1 protein_id gnl|my_center|LOCUS_50260 10156 8819 gene locus_tag LOCUS_50270 gene accC 10156 8819 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124229.1 protein_id gnl|my_center|LOCUS_50270 10665 10168 gene locus_tag LOCUS_50280 gene accB 10665 10168 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921156.1 protein_id gnl|my_center|LOCUS_50280 >Feature sequence118 <1 4200 gene locus_tag LOCUS_50290 <1 4200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_200903603.1:acyl-CoA dehydratase activase 5025 4222 gene locus_tag LOCUS_50300 5025 4222 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328129.1 protein_id gnl|my_center|LOCUS_50300 5989 5045 gene locus_tag LOCUS_50310 5989 5045 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583497.1 protein_id gnl|my_center|LOCUS_50310 7693 6122 gene locus_tag LOCUS_50320 7693 6122 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868765.1 protein_id gnl|my_center|LOCUS_50320 9264 7690 gene locus_tag LOCUS_50330 9264 7690 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583223.1 protein_id gnl|my_center|LOCUS_50330 >Feature sequence119 183 1103 gene locus_tag LOCUS_50340 183 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50340 1116 2144 gene locus_tag LOCUS_50350 1116 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50350 2173 3543 gene locus_tag LOCUS_50360 2173 3543 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142580.1 protein_id gnl|my_center|LOCUS_50360 3540 4880 gene locus_tag LOCUS_50370 3540 4880 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142579.1 protein_id gnl|my_center|LOCUS_50370 5861 5043 gene locus_tag LOCUS_50380 5861 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50380 6691 5987 gene locus_tag LOCUS_50390 6691 5987 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085267.1 protein_id gnl|my_center|LOCUS_50390 7629 6688 gene locus_tag LOCUS_50400 7629 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50400 7802 7993 gene locus_tag LOCUS_50410 7802 7993 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528835.1 protein_id gnl|my_center|LOCUS_50410 7990 8877 gene locus_tag LOCUS_50420 7990 8877 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173824.1 protein_id gnl|my_center|LOCUS_50420 >Feature sequence120 1109 105 gene locus_tag LOCUS_50430 1109 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50430 1339 1115 gene locus_tag LOCUS_50440 1339 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50440 1905 1336 gene locus_tag LOCUS_50450 1905 1336 CDS product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086605.1 protein_id gnl|my_center|LOCUS_50450 3094 1919 gene locus_tag LOCUS_50460 3094 1919 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086611.1 protein_id gnl|my_center|LOCUS_50460 3873 3097 gene locus_tag LOCUS_50470 3873 3097 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087742.1 protein_id gnl|my_center|LOCUS_50470 4506 4003 gene locus_tag LOCUS_50480 4506 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50480 5419 4715 gene locus_tag LOCUS_50490 5419 4715 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528446.1 protein_id gnl|my_center|LOCUS_50490 6162 5416 gene locus_tag LOCUS_50500 6162 5416 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528445.1 protein_id gnl|my_center|LOCUS_50500 6503 6243 gene locus_tag LOCUS_50510 6503 6243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50510 6703 6500 gene locus_tag LOCUS_50520 6703 6500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50520 7936 6980 gene locus_tag LOCUS_50530 7936 6980 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338848.1 protein_id gnl|my_center|LOCUS_50530 8799 7933 gene locus_tag LOCUS_50540 8799 7933 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528443.1 protein_id gnl|my_center|LOCUS_50540 >Feature sequence121 926 147 gene locus_tag LOCUS_50550 926 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50550 1246 923 gene locus_tag LOCUS_50560 1246 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50560 2444 1317 gene locus_tag LOCUS_50570 2444 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50570 2611 2471 gene locus_tag LOCUS_50580 2611 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50580 2914 4599 gene locus_tag LOCUS_50590 2914 4599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50590 4680 5033 gene locus_tag LOCUS_50600 4680 5033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50600 5092 5334 gene locus_tag LOCUS_50610 5092 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50610 5316 5654 gene locus_tag LOCUS_50620 5316 5654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50620 5863 7128 gene locus_tag LOCUS_50630 5863 7128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50630 7148 7609 gene locus_tag LOCUS_50640 7148 7609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50640 7752 7522 gene locus_tag LOCUS_50650 7752 7522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50650 8220 7852 gene locus_tag LOCUS_50660 8220 7852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50660 >Feature sequence122 329 1072 gene locus_tag LOCUS_50670 329 1072 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887993.1 protein_id gnl|my_center|LOCUS_50670 1080 2483 gene locus_tag LOCUS_50680 1080 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50680 2471 2941 gene locus_tag LOCUS_50690 2471 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50690 3001 3153 gene locus_tag LOCUS_50700 3001 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50700 3150 3599 gene locus_tag LOCUS_50710 3150 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50710 3719 3886 gene locus_tag LOCUS_50720 3719 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50720 3978 5240 gene locus_tag LOCUS_50730 3978 5240 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972026.1 protein_id gnl|my_center|LOCUS_50730 5203 7071 gene locus_tag LOCUS_50740 5203 7071 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403165.1 protein_id gnl|my_center|LOCUS_50740 7068 7547 gene locus_tag LOCUS_50750 7068 7547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403166.1 protein_id gnl|my_center|LOCUS_50750 <8504 7828 gene locus_tag LOCUS_50760 <8504 7828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004552106.1:BON domain-containing protein >Feature sequence123 969 739 gene locus_tag LOCUS_50770 969 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50770 1144 2319 gene locus_tag LOCUS_50780 1144 2319 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897686.1 protein_id gnl|my_center|LOCUS_50780 2565 3626 gene locus_tag LOCUS_50790 2565 3626 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965491.1 protein_id gnl|my_center|LOCUS_50790 3623 4471 gene locus_tag LOCUS_50800 3623 4471 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086028.1 protein_id gnl|my_center|LOCUS_50800 4474 5259 gene locus_tag LOCUS_50810 4474 5259 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966038.1 protein_id gnl|my_center|LOCUS_50810 5351 6424 gene locus_tag LOCUS_50820 5351 6424 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394854.1 protein_id gnl|my_center|LOCUS_50820 6506 8248 gene locus_tag LOCUS_50830 6506 8248 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039194.1 protein_id gnl|my_center|LOCUS_50830 >Feature sequence124 1389 1066 gene locus_tag LOCUS_50840 1389 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50840 1271 2254 gene locus_tag LOCUS_50850 1271 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50850 2262 3014 gene locus_tag LOCUS_50860 2262 3014 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545318.1 protein_id gnl|my_center|LOCUS_50860 3028 3540 gene locus_tag LOCUS_50870 gene ruvC 3028 3540 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120029.1 protein_id gnl|my_center|LOCUS_50870 3537 4199 gene locus_tag LOCUS_50880 3537 4199 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326966.1 protein_id gnl|my_center|LOCUS_50880 4217 5230 gene locus_tag LOCUS_50890 gene ruvB 4217 5230 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393202.1 protein_id gnl|my_center|LOCUS_50890 5327 5554 gene locus_tag LOCUS_50900 5327 5554 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545707.1 protein_id gnl|my_center|LOCUS_50900 5554 6696 gene locus_tag LOCUS_50910 5554 6696 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943259.1 protein_id gnl|my_center|LOCUS_50910 6710 7042 gene locus_tag LOCUS_50920 6710 7042 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242740.1 protein_id gnl|my_center|LOCUS_50920 7122 7709 gene locus_tag LOCUS_50930 7122 7709 CDS product DUF6338 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087038.1 protein_id gnl|my_center|LOCUS_50930 >Feature sequence125 1532 822 gene locus_tag LOCUS_50940 1532 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50940 2215 1619 gene locus_tag LOCUS_50950 2215 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50950 2678 2244 gene locus_tag LOCUS_50960 2678 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50960 3076 2588 gene locus_tag LOCUS_50970 3076 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50970 3419 4333 gene locus_tag LOCUS_50980 3419 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50980 4270 4893 gene locus_tag LOCUS_50990 4270 4893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50990 5167 5820 gene locus_tag LOCUS_51000 5167 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51000 5918 7144 gene locus_tag LOCUS_51010 5918 7144 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946820.1 protein_id gnl|my_center|LOCUS_51010 >Feature sequence126 1437 769 gene locus_tag LOCUS_51020 1437 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51020 2481 1663 gene locus_tag LOCUS_51030 2481 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51030 2649 3182 gene locus_tag LOCUS_51040 2649 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51040 3179 3715 gene locus_tag LOCUS_51050 3179 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51050 3750 4253 gene locus_tag LOCUS_51060 3750 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51060 5329 4289 gene locus_tag LOCUS_51070 5329 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51070 <6737 5340 gene locus_tag LOCUS_51080 <6737 5340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839249.1:AMP-binding protein >Feature sequence127 656 426 gene locus_tag LOCUS_51090 656 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51090 1234 653 gene locus_tag LOCUS_51100 1234 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51100 1397 1221 gene locus_tag LOCUS_51110 1397 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51110 3160 1520 gene locus_tag LOCUS_51120 3160 1520 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545924.1 protein_id gnl|my_center|LOCUS_51120 3393 3157 gene locus_tag LOCUS_51130 3393 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51130 4499 3414 gene locus_tag LOCUS_51140 4499 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51140 6442 4499 gene locus_tag LOCUS_51150 6442 4499 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144073.1 protein_id gnl|my_center|LOCUS_51150 >Feature sequence128 1454 84 gene locus_tag LOCUS_51160 1454 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51160 2434 1451 gene locus_tag LOCUS_51170 gene gspK 2434 1451 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940990.1 protein_id gnl|my_center|LOCUS_51170 3060 2431 gene locus_tag LOCUS_51180 3060 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51180 3488 3057 gene locus_tag LOCUS_51190 3488 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51190 3936 3481 gene locus_tag LOCUS_51200 3936 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51200 4331 3951 gene locus_tag LOCUS_51210 gene gspG 4331 3951 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088760.1 protein_id gnl|my_center|LOCUS_51210 5666 5055 gene locus_tag LOCUS_51220 5666 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51220 >Feature sequence129 1254 535 gene locus_tag LOCUS_51230 1254 535 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887677.1 protein_id gnl|my_center|LOCUS_51230 2029 1274 gene locus_tag LOCUS_51240 2029 1274 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965992.1 protein_id gnl|my_center|LOCUS_51240 2900 2031 gene locus_tag LOCUS_51250 2900 2031 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109472687.1 protein_id gnl|my_center|LOCUS_51250 3785 2907 gene locus_tag LOCUS_51260 3785 2907 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_51260 4945 3830 gene locus_tag LOCUS_51270 4945 3830 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944012.1 protein_id gnl|my_center|LOCUS_51270 <5980 5006 gene locus_tag LOCUS_51280 <5980 5006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965775.1:ABC transporter substrate-binding protein >Feature sequence130 2 241 gene locus_tag LOCUS_51290 2 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51290 710 1378 gene locus_tag LOCUS_51300 710 1378 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230121.1 protein_id gnl|my_center|LOCUS_51300 1375 3390 gene locus_tag LOCUS_51310 gene feoB 1375 3390 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024217.1 protein_id gnl|my_center|LOCUS_51310 3763 4713 gene locus_tag LOCUS_51320 gene mtrA 3763 4713 CDS product decaheme c-type cytochrome MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071900.1 protein_id gnl|my_center|LOCUS_51320 >Feature sequence131 <1 757 gene locus_tag LOCUS_51330 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023175504.1:amidohydrolase family protein 754 1749 gene locus_tag LOCUS_51340 754 1749 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902019.1 protein_id gnl|my_center|LOCUS_51340 1922 2689 gene locus_tag LOCUS_51350 1922 2689 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808090.1 protein_id gnl|my_center|LOCUS_51350 2755 3912 gene locus_tag LOCUS_51360 2755 3912 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879085.1 protein_id gnl|my_center|LOCUS_51360 3926 4879 gene locus_tag LOCUS_51370 3926 4879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51370 >Feature sequence132 1588 431 gene locus_tag LOCUS_51380 1588 431 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257896.1 protein_id gnl|my_center|LOCUS_51380 2827 1685 gene locus_tag LOCUS_51390 2827 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51390 3459 2899 gene locus_tag LOCUS_51400 3459 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51400 3683 3477 gene locus_tag LOCUS_51410 3683 3477 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_51410 4002 3778 gene locus_tag LOCUS_51420 4002 3778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51420 4909 4082 gene locus_tag LOCUS_51430 4909 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51430 >Feature sequence133 126 479 gene locus_tag LOCUS_51440 126 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51440 476 880 gene locus_tag LOCUS_51450 476 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51450 858 1634 gene locus_tag LOCUS_51460 gene fabG 858 1634 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_51460 1631 3703 gene locus_tag LOCUS_51470 1631 3703 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229602.1 protein_id gnl|my_center|LOCUS_51470 >Feature sequence134 1176 2915 gene locus_tag LOCUS_51480 1176 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51480 3026 4312 gene locus_tag LOCUS_51490 3026 4312 CDS product IS701-like element ISBj9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087945.1 protein_id gnl|my_center|LOCUS_51490 >Feature sequence135 46 224 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggtttccgcggcgtcgacgccgcggctccattg 789 376 gene locus_tag LOCUS_51500 789 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51500 2183 1011 gene locus_tag LOCUS_51510 2183 1011 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393453.1 protein_id gnl|my_center|LOCUS_51510 2193 2897 gene locus_tag LOCUS_51520 2193 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51520 3878 2952 gene locus_tag LOCUS_51530 3878 2952 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383463.1 protein_id gnl|my_center|LOCUS_51530 >Feature sequence136 2984 1065 gene locus_tag LOCUS_51540 2984 1065 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_51540 >Feature sequence137 1534 176 gene locus_tag LOCUS_51550 1534 176 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224018.1 protein_id gnl|my_center|LOCUS_51550 1965 1531 gene locus_tag LOCUS_51560 1965 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51560 2183 1965 gene locus_tag LOCUS_51570 2183 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51570 2584 2309 gene locus_tag LOCUS_51580 2584 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51580 3023 2658 gene locus_tag LOCUS_51590 3023 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51590 >Feature sequence138 957 1433 gene locus_tag LOCUS_51600 957 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51600 >Feature sequence139 >Feature sequence140