>Feature sequence001 335 117 gene locus_tag LOCUS_00010 gene infA 335 117 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393913.1 protein_id gnl|my_center|LOCUS_00010 1176 400 gene locus_tag LOCUS_00020 gene map 1176 400 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545375.1 protein_id gnl|my_center|LOCUS_00020 2968 1202 gene locus_tag LOCUS_00030 2968 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3409 2969 gene locus_tag LOCUS_00040 gene rplO 3409 2969 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081797.1 protein_id gnl|my_center|LOCUS_00040 3759 3424 gene locus_tag LOCUS_00050 3759 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4578 4036 gene locus_tag LOCUS_00060 gene rplF 4578 4036 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869914.1 protein_id gnl|my_center|LOCUS_00060 4988 4590 gene locus_tag LOCUS_00070 gene rpsH 4988 4590 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036371522.1 protein_id gnl|my_center|LOCUS_00070 5790 5245 gene locus_tag LOCUS_00080 gene rplE 5790 5245 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_00080 6143 5811 gene locus_tag LOCUS_00090 gene rplX 6143 5811 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546700.1 protein_id gnl|my_center|LOCUS_00090 6534 6166 gene locus_tag LOCUS_00100 gene rplN 6534 6166 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603030.1 protein_id gnl|my_center|LOCUS_00100 6834 6577 gene locus_tag LOCUS_00110 gene rpsQ 6834 6577 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_00110 7048 6839 gene locus_tag LOCUS_00120 7048 6839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 7476 7048 gene locus_tag LOCUS_00130 gene rplP 7476 7048 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393930.1 protein_id gnl|my_center|LOCUS_00130 8148 7492 gene locus_tag LOCUS_00140 gene rpsC 8148 7492 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390432.1 protein_id gnl|my_center|LOCUS_00140 8490 8152 gene locus_tag LOCUS_00150 gene rplV 8490 8152 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156475.1 protein_id gnl|my_center|LOCUS_00150 8816 8520 gene locus_tag LOCUS_00160 gene rpsS 8816 8520 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173711.1 protein_id gnl|my_center|LOCUS_00160 9540 8836 gene locus_tag LOCUS_00170 gene rplB 9540 8836 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938601.1 protein_id gnl|my_center|LOCUS_00170 9842 9558 gene locus_tag LOCUS_00180 gene rplW 9842 9558 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258233.1 protein_id gnl|my_center|LOCUS_00180 10459 9839 gene locus_tag LOCUS_00190 gene rplD 10459 9839 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127258.1 protein_id gnl|my_center|LOCUS_00190 11111 10461 gene locus_tag LOCUS_00200 gene rplC 11111 10461 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_00200 11621 11310 gene locus_tag LOCUS_00210 gene rpsJ 11621 11310 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393938.1 protein_id gnl|my_center|LOCUS_00210 12848 11640 gene locus_tag LOCUS_00220 gene tuf 12848 11640 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393939.1 protein_id gnl|my_center|LOCUS_00220 15092 12906 gene locus_tag LOCUS_00230 gene fusA 15092 12906 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_00230 15636 15166 gene locus_tag LOCUS_00240 gene rpsG 15636 15166 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021606.1 protein_id gnl|my_center|LOCUS_00240 16132 15761 gene locus_tag LOCUS_00250 gene rpsL 16132 15761 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943491.1 protein_id gnl|my_center|LOCUS_00250 20337 16255 gene locus_tag LOCUS_00260 gene rpoC 20337 16255 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_00260 24133 20357 gene locus_tag LOCUS_00270 gene rpoB 24133 20357 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882731.1 protein_id gnl|my_center|LOCUS_00270 24951 26222 gene locus_tag LOCUS_00280 24951 26222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 26250 26474 gene locus_tag LOCUS_00290 26250 26474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 26935 27756 gene locus_tag LOCUS_00300 gene mazG 26935 27756 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545835.1 protein_id gnl|my_center|LOCUS_00300 27885 28955 gene locus_tag LOCUS_00310 gene ltaE 27885 28955 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_00310 29016 29726 gene locus_tag LOCUS_00320 29016 29726 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660467.1 protein_id gnl|my_center|LOCUS_00320 29758 30003 gene locus_tag LOCUS_00330 29758 30003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 30214 30945 gene locus_tag LOCUS_00340 30214 30945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 30966 31193 gene locus_tag LOCUS_00350 30966 31193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 >Feature sequence002 1004 264 gene locus_tag LOCUS_00360 1004 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 1677 1159 gene locus_tag LOCUS_00370 1677 1159 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082498.1 protein_id gnl|my_center|LOCUS_00370 4752 1984 gene locus_tag LOCUS_00380 gene uvrA 4752 1984 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403227.1 protein_id gnl|my_center|LOCUS_00380 6662 5145 gene locus_tag LOCUS_00390 6662 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 7107 6838 gene locus_tag LOCUS_00400 7107 6838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 8081 7089 gene locus_tag LOCUS_00410 8081 7089 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258336.1 protein_id gnl|my_center|LOCUS_00410 8848 8078 gene locus_tag LOCUS_00420 8848 8078 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028151.1 protein_id gnl|my_center|LOCUS_00420 9561 9022 gene locus_tag LOCUS_00430 9561 9022 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940892.1 protein_id gnl|my_center|LOCUS_00430 10495 9746 gene locus_tag LOCUS_00440 gene cobB1 10495 9746 CDS product NAD-dependent protein deacylase Cob1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879172.1 protein_id gnl|my_center|LOCUS_00440 11642 10506 gene locus_tag LOCUS_00450 gene acdA 11642 10506 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_00450 12968 11796 gene locus_tag LOCUS_00460 12968 11796 CDS product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879450.1 protein_id gnl|my_center|LOCUS_00460 14260 13034 gene locus_tag LOCUS_00470 14260 13034 CDS product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879450.1 protein_id gnl|my_center|LOCUS_00470 15392 14253 gene locus_tag LOCUS_00480 gene hadC 15392 14253 CDS product (R)-2-hydroxyisocaproyl-CoA dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 protein_id gnl|my_center|LOCUS_00480 17070 15421 gene locus_tag LOCUS_00490 17070 15421 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_00490 18566 17160 gene locus_tag LOCUS_00500 18566 17160 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256569.1 protein_id gnl|my_center|LOCUS_00500 20183 18579 gene locus_tag LOCUS_00510 20183 18579 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_00510 19338 19379 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20630 20496 gene locus_tag LOCUS_00520 20630 20496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 21440 20880 gene locus_tag LOCUS_00530 21440 20880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 20988 21029 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22166 21618 gene locus_tag LOCUS_00540 gene rsmD 22166 21618 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266978.1 protein_id gnl|my_center|LOCUS_00540 24199 22202 gene locus_tag LOCUS_00550 gene recG 24199 22202 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392440.1 protein_id gnl|my_center|LOCUS_00550 25178 24291 gene locus_tag LOCUS_00560 25178 24291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 26285 25323 gene locus_tag LOCUS_00570 26285 25323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 27390 26311 gene locus_tag LOCUS_00580 27390 26311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 28177 28422 gene locus_tag LOCUS_00590 28177 28422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 28452 29138 gene locus_tag LOCUS_00600 28452 29138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 29161 29946 gene locus_tag LOCUS_00610 29161 29946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 29505 29536 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence003 1238 321 gene locus_tag LOCUS_00620 1238 321 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391812.1 protein_id gnl|my_center|LOCUS_00620 1742 2341 gene locus_tag LOCUS_00630 1742 2341 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_00630 3671 2643 gene locus_tag LOCUS_00640 3671 2643 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00640 3603 3642 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3661 3903 gene locus_tag LOCUS_00650 3661 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 4702 4034 gene locus_tag LOCUS_00660 4702 4034 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_00660 5949 4711 gene locus_tag LOCUS_00670 5949 4711 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941163.1 protein_id gnl|my_center|LOCUS_00670 6405 7553 gene locus_tag LOCUS_00680 6405 7553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 7560 8246 gene locus_tag LOCUS_00690 7560 8246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 8243 9085 gene locus_tag LOCUS_00700 gene ccsB 8243 9085 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_00700 9108 10259 gene locus_tag LOCUS_00710 gene hemA 9108 10259 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_00710 10695 11663 gene locus_tag LOCUS_00720 gene hemC 10695 11663 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842596.1 protein_id gnl|my_center|LOCUS_00720 11642 13171 gene locus_tag LOCUS_00730 gene cobA 11642 13171 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460180.1 protein_id gnl|my_center|LOCUS_00730 13437 14516 gene locus_tag LOCUS_00740 13437 14516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 15145 14543 gene locus_tag LOCUS_00750 15145 14543 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020390.1 protein_id gnl|my_center|LOCUS_00750 16350 15322 gene locus_tag LOCUS_00760 16350 15322 CDS product phosphotriesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972726.1 protein_id gnl|my_center|LOCUS_00760 17257 16385 gene locus_tag LOCUS_00770 17257 16385 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942084.1 protein_id gnl|my_center|LOCUS_00770 18650 17547 gene locus_tag LOCUS_00780 18650 17547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 19269 18796 gene locus_tag LOCUS_00790 19269 18796 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223560.1 protein_id gnl|my_center|LOCUS_00790 19536 20201 gene locus_tag LOCUS_00800 gene coxH3 19536 20201 CDS product Dot/Icm type IV secretion system effector CoxH3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770384.1 protein_id gnl|my_center|LOCUS_00800 20509 21294 gene locus_tag LOCUS_00810 20509 21294 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846972.1 protein_id gnl|my_center|LOCUS_00810 21625 22440 gene locus_tag LOCUS_00820 21625 22440 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229218.1 protein_id gnl|my_center|LOCUS_00820 23706 22699 gene locus_tag LOCUS_00830 23706 22699 CDS product NrpR regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546211.1 protein_id gnl|my_center|LOCUS_00830 24520 25953 gene locus_tag LOCUS_00840 24520 25953 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080443.1 protein_id gnl|my_center|LOCUS_00840 26397 26113 gene locus_tag LOCUS_00850 26397 26113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 >Feature sequence004 2034 3515 gene locus_tag LOCUS_00860 2034 3515 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867476.1 protein_id gnl|my_center|LOCUS_00860 3566 4795 gene locus_tag LOCUS_00870 3566 4795 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480016.1 protein_id gnl|my_center|LOCUS_00870 4914 6146 gene locus_tag LOCUS_00880 4914 6146 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087102.1 protein_id gnl|my_center|LOCUS_00880 6287 7189 gene locus_tag LOCUS_00890 6287 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 7362 9461 gene locus_tag LOCUS_00900 7362 9461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 10059 9580 gene locus_tag LOCUS_00910 10059 9580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 10713 11993 gene locus_tag LOCUS_00920 10713 11993 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404713.1 protein_id gnl|my_center|LOCUS_00920 11990 13051 gene locus_tag LOCUS_00930 11990 13051 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941060.1 protein_id gnl|my_center|LOCUS_00930 13300 16341 gene locus_tag LOCUS_00940 13300 16341 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479332.1 protein_id gnl|my_center|LOCUS_00940 16103 16109 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17223 17005 gene locus_tag LOCUS_00950 17223 17005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 17125 17679 gene locus_tag LOCUS_00960 17125 17679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 17676 18287 gene locus_tag LOCUS_00970 17676 18287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 18424 19458 gene locus_tag LOCUS_00980 18424 19458 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881422.1 protein_id gnl|my_center|LOCUS_00980 19571 20416 gene locus_tag LOCUS_00990 19571 20416 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881421.1 protein_id gnl|my_center|LOCUS_00990 21365 20397 gene locus_tag LOCUS_01000 21365 20397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 22158 21358 gene locus_tag LOCUS_01010 22158 21358 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110556.1 protein_id gnl|my_center|LOCUS_01010 23403 22537 gene locus_tag LOCUS_01020 23403 22537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 <24298 23456 gene locus_tag LOCUS_01030 <24298 23456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015944627.1:acetyl-CoA carboxylase biotin carboxylase subunit >Feature sequence005 908 96 gene locus_tag LOCUS_01040 908 96 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393605.1 protein_id gnl|my_center|LOCUS_01040 1149 934 gene locus_tag LOCUS_01050 1149 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 2910 1252 gene locus_tag LOCUS_01060 2910 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 2923 2971 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3629 3240 gene locus_tag LOCUS_01070 3629 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 4642 3698 gene locus_tag LOCUS_01080 4642 3698 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015848914.1 protein_id gnl|my_center|LOCUS_01080 7227 5020 gene locus_tag LOCUS_01090 7227 5020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 7988 7263 gene locus_tag LOCUS_01100 7988 7263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 9115 8027 gene locus_tag LOCUS_01110 9115 8027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01110 9738 9112 gene locus_tag LOCUS_01120 9738 9112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01120 10467 9745 gene locus_tag LOCUS_01130 10467 9745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 11217 10501 gene locus_tag LOCUS_01140 11217 10501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 11773 12363 gene locus_tag LOCUS_01150 11773 12363 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231827.1 protein_id gnl|my_center|LOCUS_01150 13525 12449 gene locus_tag LOCUS_01160 gene mnmA 13525 12449 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393152.1 protein_id gnl|my_center|LOCUS_01160 14168 13719 gene locus_tag LOCUS_01170 14168 13719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 15408 14446 gene locus_tag LOCUS_01180 15408 14446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 16102 15692 gene locus_tag LOCUS_01190 16102 15692 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773532.1 protein_id gnl|my_center|LOCUS_01190 17567 16149 gene locus_tag LOCUS_01200 gene atpD 17567 16149 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_01200 16267 16325 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18491 17622 gene locus_tag LOCUS_01210 gene atpG 18491 17622 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272788.1 protein_id gnl|my_center|LOCUS_01210 20014 18491 gene locus_tag LOCUS_01220 gene atpA 20014 18491 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_01220 20587 20051 gene locus_tag LOCUS_01230 20587 20051 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097135.1 protein_id gnl|my_center|LOCUS_01230 21236 20577 gene locus_tag LOCUS_01240 21236 20577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 21505 21278 gene locus_tag LOCUS_01250 21505 21278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 22284 21547 gene locus_tag LOCUS_01260 22284 21547 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532843.1 protein_id gnl|my_center|LOCUS_01260 22661 22290 gene locus_tag LOCUS_01270 22661 22290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 23039 22758 gene locus_tag LOCUS_01280 23039 22758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 <23816 23204 gene locus_tag LOCUS_01290 <23816 23204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941019.1:NADH-quinone oxidoreductase subunit N >Feature sequence006 543 992 gene locus_tag LOCUS_01300 543 992 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942284.1 protein_id gnl|my_center|LOCUS_01300 2863 1172 gene locus_tag LOCUS_01310 gene mnmG 2863 1172 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546402.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01310 1204 1229 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4388 3120 gene locus_tag LOCUS_01320 gene mnmE 4388 3120 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244507.1 protein_id gnl|my_center|LOCUS_01320 5308 4556 gene locus_tag LOCUS_01330 5308 4556 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295258.1 protein_id gnl|my_center|LOCUS_01330 7203 5338 gene locus_tag LOCUS_01340 7203 5338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 7733 7524 gene locus_tag LOCUS_01350 gene yidD 7733 7524 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016065.1 protein_id gnl|my_center|LOCUS_01350 7942 7733 gene locus_tag LOCUS_01360 7942 7733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 10317 8737 gene locus_tag LOCUS_01370 10317 8737 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057809.1 protein_id gnl|my_center|LOCUS_01370 11829 10558 gene locus_tag LOCUS_01380 11829 10558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 14029 11843 gene locus_tag LOCUS_01390 14029 11843 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545008.1 protein_id gnl|my_center|LOCUS_01390 14376 14651 gene locus_tag LOCUS_01400 14376 14651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 14954 17311 gene locus_tag LOCUS_01410 14954 17311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 17289 17924 gene locus_tag LOCUS_01420 17289 17924 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528392.1 protein_id gnl|my_center|LOCUS_01420 18207 20120 gene locus_tag LOCUS_01430 18207 20120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 <21008 20125 gene locus_tag LOCUS_01440 <21008 20125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546471.1:acyl-CoA dehydrogenase family protein >Feature sequence007 855 346 gene locus_tag LOCUS_01450 855 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 1357 773 gene locus_tag LOCUS_01460 1357 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 2305 1598 gene locus_tag LOCUS_01470 2305 1598 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941442.1 protein_id gnl|my_center|LOCUS_01470 2599 2664 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3819 3043 gene locus_tag LOCUS_01480 3819 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 4545 3886 gene locus_tag LOCUS_01490 4545 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 5379 7895 gene locus_tag LOCUS_01500 5379 7895 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048172.1 protein_id gnl|my_center|LOCUS_01500 8102 9112 gene locus_tag LOCUS_01510 8102 9112 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015848914.1 protein_id gnl|my_center|LOCUS_01510 9241 10086 gene locus_tag LOCUS_01520 9241 10086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 10115 11182 gene locus_tag LOCUS_01530 10115 11182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062194302.1 protein_id gnl|my_center|LOCUS_01530 11187 12014 gene locus_tag LOCUS_01540 11187 12014 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869148.1 protein_id gnl|my_center|LOCUS_01540 12004 13434 gene locus_tag LOCUS_01550 12004 13434 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391352.1 protein_id gnl|my_center|LOCUS_01550 13690 14244 gene locus_tag LOCUS_01560 13690 14244 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944374.1 protein_id gnl|my_center|LOCUS_01560 14498 15628 gene locus_tag LOCUS_01570 14498 15628 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546390.1 protein_id gnl|my_center|LOCUS_01570 15934 15695 gene locus_tag LOCUS_01580 15934 15695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 16659 16246 gene locus_tag LOCUS_01590 16659 16246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 17060 18655 gene locus_tag LOCUS_01600 17060 18655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 >Feature sequence008 <1 947 gene locus_tag LOCUS_01610 <1 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061842.1:PAS domain S-box protein 1002 1658 gene locus_tag LOCUS_01620 1002 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01620 1989 3119 gene locus_tag LOCUS_01630 1989 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 3548 3291 gene locus_tag LOCUS_01640 3548 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 3974 3588 gene locus_tag LOCUS_01650 3974 3588 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214914.1 protein_id gnl|my_center|LOCUS_01650 5126 4116 gene locus_tag LOCUS_01660 5126 4116 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963507.1 protein_id gnl|my_center|LOCUS_01660 5718 7805 gene locus_tag LOCUS_01670 5718 7805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 9235 8114 gene locus_tag LOCUS_01680 9235 8114 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878191.1 protein_id gnl|my_center|LOCUS_01680 10234 10497 gene locus_tag LOCUS_01690 10234 10497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 12283 11129 gene locus_tag LOCUS_01700 12283 11129 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965886.1 protein_id gnl|my_center|LOCUS_01700 13119 12406 gene locus_tag LOCUS_01710 13119 12406 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966804.1 protein_id gnl|my_center|LOCUS_01710 14221 13241 gene locus_tag LOCUS_01720 14221 13241 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731552.1 protein_id gnl|my_center|LOCUS_01720 15934 14645 gene locus_tag LOCUS_01730 15934 14645 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020575.1 protein_id gnl|my_center|LOCUS_01730 16506 16063 gene locus_tag LOCUS_01740 16506 16063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 17489 16554 gene locus_tag LOCUS_01750 17489 16554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 <18639 17687 gene locus_tag LOCUS_01760 <18639 17687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000411056.1:Xaa-Pro dipeptidase >Feature sequence009 <1 741 gene locus_tag LOCUS_01770 <1 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933475.1:purine-nucleoside phosphorylase 783 1211 gene locus_tag LOCUS_01780 783 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 1138 1764 gene locus_tag LOCUS_01790 1138 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 1804 2307 gene locus_tag LOCUS_01800 1804 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01800 2434 2910 gene locus_tag LOCUS_01810 gene ispF 2434 2910 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929316.1 protein_id gnl|my_center|LOCUS_01810 3072 4547 gene locus_tag LOCUS_01820 gene gltX 3072 4547 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392646.1 protein_id gnl|my_center|LOCUS_01820 4676 4948 gene locus_tag LOCUS_01830 4676 4948 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043034.1 protein_id gnl|my_center|LOCUS_01830 5024 5374 gene locus_tag LOCUS_01840 5024 5374 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958148.1 protein_id gnl|my_center|LOCUS_01840 5674 5748 gene locus_tag LOCUS_t00010 5674 5748 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6645 5869 gene locus_tag LOCUS_01850 6645 5869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 7487 6678 gene locus_tag LOCUS_01860 7487 6678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 6695 6733 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7912 7511 gene locus_tag LOCUS_01870 7912 7511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 8534 8010 gene locus_tag LOCUS_01880 8534 8010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 9580 8537 gene locus_tag LOCUS_01890 9580 8537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 10428 9583 gene locus_tag LOCUS_01900 10428 9583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 12298 10415 gene locus_tag LOCUS_01910 12298 10415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 13057 12641 gene locus_tag LOCUS_01920 13057 12641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 14591 13350 gene locus_tag LOCUS_01930 14591 13350 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_01930 14761 14588 gene locus_tag LOCUS_01940 14761 14588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 >Feature sequence010 1281 2039 gene locus_tag LOCUS_01950 gene truA 1281 2039 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943506.1 protein_id gnl|my_center|LOCUS_01950 2368 3108 gene locus_tag LOCUS_01960 2368 3108 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393651.1 protein_id gnl|my_center|LOCUS_01960 3325 5835 gene locus_tag LOCUS_01970 3325 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 6052 6870 gene locus_tag LOCUS_01980 6052 6870 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990759.1 protein_id gnl|my_center|LOCUS_01980 7331 7699 gene locus_tag LOCUS_01990 7331 7699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 7710 10163 gene locus_tag LOCUS_02000 7710 10163 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942301.1 protein_id gnl|my_center|LOCUS_02000 10712 11599 gene locus_tag LOCUS_02010 gene sppA 10712 11599 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545082.1 protein_id gnl|my_center|LOCUS_02010 11612 12508 gene locus_tag LOCUS_02020 11612 12508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 12630 13148 gene locus_tag LOCUS_02030 12630 13148 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944687.1 protein_id gnl|my_center|LOCUS_02030 13432 13508 gene locus_tag LOCUS_t00020 13432 13508 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13718 13733 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14700 13804 gene locus_tag LOCUS_02040 14700 13804 CDS product DUF4846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765761.1 protein_id gnl|my_center|LOCUS_02040 15590 14949 gene locus_tag LOCUS_02050 15590 14949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 16792 16148 gene locus_tag LOCUS_02060 16792 16148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 >Feature sequence011 694 248 gene locus_tag LOCUS_02070 694 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02070 1872 619 gene locus_tag LOCUS_02080 1872 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02080 709 715 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3178 2102 gene locus_tag LOCUS_02090 3178 2102 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258942.1 protein_id gnl|my_center|LOCUS_02090 2171 2180 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4370 3441 gene locus_tag LOCUS_02100 4370 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 5110 5661 gene locus_tag LOCUS_02110 5110 5661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 6100 6582 gene locus_tag LOCUS_02120 6100 6582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 6967 7173 gene locus_tag LOCUS_02130 6967 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 7432 7151 gene locus_tag LOCUS_02140 7432 7151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 9881 7404 gene locus_tag LOCUS_02150 9881 7404 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259579.1 protein_id gnl|my_center|LOCUS_02150 10615 10253 gene locus_tag LOCUS_02160 10615 10253 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393883.1 protein_id gnl|my_center|LOCUS_02160 10999 11409 gene locus_tag LOCUS_02170 10999 11409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 12031 11420 gene locus_tag LOCUS_02180 12031 11420 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545142.1 protein_id gnl|my_center|LOCUS_02180 13582 12839 gene locus_tag LOCUS_02190 13582 12839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 14592 13774 gene locus_tag LOCUS_02200 14592 13774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 15595 15377 gene locus_tag LOCUS_02210 15595 15377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02210 16200 15532 gene locus_tag LOCUS_02220 16200 15532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02220 >Feature sequence012 378 61 gene locus_tag LOCUS_02230 378 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 2696 696 gene locus_tag LOCUS_02240 2696 696 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461059.1 protein_id gnl|my_center|LOCUS_02240 3570 3016 gene locus_tag LOCUS_02250 3570 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 5112 4066 gene locus_tag LOCUS_02260 5112 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 6191 5733 gene locus_tag LOCUS_02270 6191 5733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 9007 6188 gene locus_tag LOCUS_02280 9007 6188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 10646 9183 gene locus_tag LOCUS_02290 10646 9183 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_02290 10827 12428 gene locus_tag LOCUS_02300 gene pyrG 10827 12428 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877763.1 protein_id gnl|my_center|LOCUS_02300 13888 12578 gene locus_tag LOCUS_02310 13888 12578 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323826.1 protein_id gnl|my_center|LOCUS_02310 15837 14248 gene locus_tag LOCUS_02320 15837 14248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 16501 15830 gene locus_tag LOCUS_02330 16501 15830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 >Feature sequence013 1157 678 gene locus_tag LOCUS_02340 1157 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 2190 1171 gene locus_tag LOCUS_02350 gene aroF 2190 1171 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943764.1 protein_id gnl|my_center|LOCUS_02350 2583 3572 gene locus_tag LOCUS_02360 2583 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 3714 4217 gene locus_tag LOCUS_02370 3714 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 4260 5003 gene locus_tag LOCUS_02380 4260 5003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 5023 5868 gene locus_tag LOCUS_02390 5023 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 5921 6772 gene locus_tag LOCUS_02400 5921 6772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02400 6769 7233 gene locus_tag LOCUS_02410 6769 7233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02410 7251 8801 gene locus_tag LOCUS_02420 7251 8801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 8895 10091 gene locus_tag LOCUS_02430 8895 10091 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888498.1 protein_id gnl|my_center|LOCUS_02430 10898 10308 gene locus_tag LOCUS_02440 10898 10308 CDS product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943752.1 protein_id gnl|my_center|LOCUS_02440 14089 11027 gene locus_tag LOCUS_02450 14089 11027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 12628 12643 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence014 2320 1949 gene locus_tag LOCUS_02460 2320 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 3860 2703 gene locus_tag LOCUS_02470 3860 2703 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986574.1 protein_id gnl|my_center|LOCUS_02470 4690 3887 gene locus_tag LOCUS_02480 4690 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407616.1 protein_id gnl|my_center|LOCUS_02480 5518 4844 gene locus_tag LOCUS_02490 5518 4844 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407619.1 protein_id gnl|my_center|LOCUS_02490 6165 5515 gene locus_tag LOCUS_02500 6165 5515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 6857 6165 gene locus_tag LOCUS_02510 6857 6165 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073072.1 protein_id gnl|my_center|LOCUS_02510 7716 6874 gene locus_tag LOCUS_02520 7716 6874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 8872 7688 gene locus_tag LOCUS_02530 8872 7688 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289079.1 protein_id gnl|my_center|LOCUS_02530 9167 8994 gene locus_tag LOCUS_02540 9167 8994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 9545 9243 gene locus_tag LOCUS_02550 9545 9243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 10332 9535 gene locus_tag LOCUS_02560 10332 9535 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244130.1 protein_id gnl|my_center|LOCUS_02560 11191 10595 gene locus_tag LOCUS_02570 11191 10595 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941288.1 protein_id gnl|my_center|LOCUS_02570 11862 12959 gene locus_tag LOCUS_02580 11862 12959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 14925 13066 gene locus_tag LOCUS_02590 14925 13066 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_02590 15647 15246 gene locus_tag LOCUS_02600 15647 15246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 >Feature sequence015 1281 943 gene locus_tag LOCUS_02610 1281 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 1633 1271 gene locus_tag LOCUS_02620 1633 1271 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545631.1 protein_id gnl|my_center|LOCUS_02620 2565 2212 gene locus_tag LOCUS_02630 2565 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 2931 2635 gene locus_tag LOCUS_02640 2931 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 3478 3116 gene locus_tag LOCUS_02650 3478 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 4309 3674 gene locus_tag LOCUS_02660 4309 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 4535 4365 gene locus_tag LOCUS_02670 4535 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 5936 5355 gene locus_tag LOCUS_02680 5936 5355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 6743 7771 gene locus_tag LOCUS_02690 6743 7771 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259475.1 protein_id gnl|my_center|LOCUS_02690 8245 7766 gene locus_tag LOCUS_02700 8245 7766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 8469 8332 gene locus_tag LOCUS_02710 8469 8332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 9353 9156 gene locus_tag LOCUS_02720 9353 9156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 9801 9553 gene locus_tag LOCUS_02730 9801 9553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 10203 11099 gene locus_tag LOCUS_02740 10203 11099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 11017 11092 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11138 12355 gene locus_tag LOCUS_02750 11138 12355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 12663 12971 gene locus_tag LOCUS_02760 12663 12971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 13039 14355 gene locus_tag LOCUS_02770 13039 14355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 14475 14873 gene locus_tag LOCUS_02780 14475 14873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 >Feature sequence016 976 17 gene locus_tag LOCUS_02790 976 17 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921208.1 protein_id gnl|my_center|LOCUS_02790 1932 1126 gene locus_tag LOCUS_02800 gene ccsB 1932 1126 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393687.1 protein_id gnl|my_center|LOCUS_02800 3286 1937 gene locus_tag LOCUS_02810 gene resB 3286 1937 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230515.1 protein_id gnl|my_center|LOCUS_02810 5476 3398 gene locus_tag LOCUS_02820 5476 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 6219 5542 gene locus_tag LOCUS_02830 6219 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 7948 7250 gene locus_tag LOCUS_02840 7948 7250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02840 8500 7970 gene locus_tag LOCUS_02850 8500 7970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02850 8648 8430 gene locus_tag LOCUS_02860 8648 8430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 9591 8662 gene locus_tag LOCUS_02870 9591 8662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 10539 9655 gene locus_tag LOCUS_02880 10539 9655 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_02880 11196 10699 gene locus_tag LOCUS_02890 11196 10699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 12539 11997 gene locus_tag LOCUS_02900 12539 11997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 13029 14201 gene locus_tag LOCUS_02910 13029 14201 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393272.1 protein_id gnl|my_center|LOCUS_02910 14364 14828 gene locus_tag LOCUS_02920 14364 14828 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070911733.1 protein_id gnl|my_center|LOCUS_02920 15015 15416 gene locus_tag LOCUS_02930 15015 15416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 >Feature sequence017 1708 263 gene locus_tag LOCUS_02940 1708 263 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392787.1 protein_id gnl|my_center|LOCUS_02940 3165 1705 gene locus_tag LOCUS_02950 gene hydG 3165 1705 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939053.1 protein_id gnl|my_center|LOCUS_02950 1944 1948 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5143 3245 gene locus_tag LOCUS_02960 5143 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 5579 5175 gene locus_tag LOCUS_02970 5579 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 7460 5733 gene locus_tag LOCUS_02980 7460 5733 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_02980 10649 7551 gene locus_tag LOCUS_02990 10649 7551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 11186 10656 gene locus_tag LOCUS_03000 11186 10656 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868903.1 protein_id gnl|my_center|LOCUS_03000 11773 12738 gene locus_tag LOCUS_03010 11773 12738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 13011 14981 gene locus_tag LOCUS_03020 gene acs 13011 14981 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546141.1 protein_id gnl|my_center|LOCUS_03020 >Feature sequence018 3 575 gene locus_tag LOCUS_03030 3 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 863 1657 gene locus_tag LOCUS_03040 863 1657 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_03040 1814 2668 gene locus_tag LOCUS_03050 1814 2668 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462165.1 protein_id gnl|my_center|LOCUS_03050 3050 4012 gene locus_tag LOCUS_03060 gene pdhA 3050 4012 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943082.1 protein_id gnl|my_center|LOCUS_03060 4043 4048 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4119 5105 gene locus_tag LOCUS_03070 4119 5105 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943073.1 protein_id gnl|my_center|LOCUS_03070 5236 5667 gene locus_tag LOCUS_03080 5236 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 6010 7512 gene locus_tag LOCUS_03090 6010 7512 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389632.1 protein_id gnl|my_center|LOCUS_03090 7516 7854 gene locus_tag LOCUS_03100 7516 7854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 9422 8031 gene locus_tag LOCUS_03110 9422 8031 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986115.1 protein_id gnl|my_center|LOCUS_03110 9788 10057 gene locus_tag LOCUS_03120 gene fliQ 9788 10057 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816214.1 protein_id gnl|my_center|LOCUS_03120 10204 10773 gene locus_tag LOCUS_03130 10204 10773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 10782 11288 gene locus_tag LOCUS_03140 10782 11288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 11290 11775 gene locus_tag LOCUS_03150 11290 11775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 11806 13890 gene locus_tag LOCUS_03160 gene flhA 11806 13890 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965446.1 protein_id gnl|my_center|LOCUS_03160 >Feature sequence019 2407 431 gene locus_tag LOCUS_03170 2407 431 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880423.1 protein_id gnl|my_center|LOCUS_03170 2761 2414 gene locus_tag LOCUS_03180 2761 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 2982 2740 gene locus_tag LOCUS_03190 2982 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 4339 2987 gene locus_tag LOCUS_03200 4339 2987 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582601.1 protein_id gnl|my_center|LOCUS_03200 5789 4329 gene locus_tag LOCUS_03210 5789 4329 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582600.1 protein_id gnl|my_center|LOCUS_03210 5237 5245 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6771 5821 gene locus_tag LOCUS_03220 6771 5821 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_03220 7747 6806 gene locus_tag LOCUS_03230 7747 6806 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966497.1 protein_id gnl|my_center|LOCUS_03230 8942 7797 gene locus_tag LOCUS_03240 8942 7797 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228926.1 protein_id gnl|my_center|LOCUS_03240 9886 8948 gene locus_tag LOCUS_03250 9886 8948 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 protein_id gnl|my_center|LOCUS_03250 10595 9876 gene locus_tag LOCUS_03260 10595 9876 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_03260 10811 10951 gene locus_tag LOCUS_03270 10811 10951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 12131 11055 gene locus_tag LOCUS_03280 12131 11055 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383451.1 protein_id gnl|my_center|LOCUS_03280 12730 12332 gene locus_tag LOCUS_03290 12730 12332 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846721.1 protein_id gnl|my_center|LOCUS_03290 14016 12823 gene locus_tag LOCUS_03300 14016 12823 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119555905.1 protein_id gnl|my_center|LOCUS_03300 <14995 14122 gene locus_tag LOCUS_03310 <14995 14122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926974.1:MmgE/PrpD family protein >Feature sequence020 109 1407 gene locus_tag LOCUS_03320 109 1407 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582434.1 protein_id gnl|my_center|LOCUS_03320 1410 1610 gene locus_tag LOCUS_03330 1410 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 1731 1985 gene locus_tag LOCUS_03340 1731 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 2208 2651 gene locus_tag LOCUS_03350 2208 2651 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546164.1 protein_id gnl|my_center|LOCUS_03350 2657 5071 gene locus_tag LOCUS_03360 gene lon 2657 5071 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_03360 5454 6710 gene locus_tag LOCUS_03370 5454 6710 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878013.1 protein_id gnl|my_center|LOCUS_03370 6926 7933 gene locus_tag LOCUS_03380 6926 7933 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392245.1 protein_id gnl|my_center|LOCUS_03380 8047 8271 gene locus_tag LOCUS_03390 8047 8271 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023504.1 protein_id gnl|my_center|LOCUS_03390 8417 8584 gene locus_tag LOCUS_03400 8417 8584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 8683 9459 gene locus_tag LOCUS_03410 8683 9459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 9389 9694 gene locus_tag LOCUS_03420 9389 9694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 9931 12069 gene locus_tag LOCUS_03430 9931 12069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 12066 12713 gene locus_tag LOCUS_03440 12066 12713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 13108 12719 gene locus_tag LOCUS_03450 13108 12719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 13382 14143 gene locus_tag LOCUS_03460 13382 14143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 14590 14231 gene locus_tag LOCUS_03470 14590 14231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 >Feature sequence021 594 64 gene locus_tag LOCUS_03480 594 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 1262 594 gene locus_tag LOCUS_03490 1262 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 2587 1445 gene locus_tag LOCUS_03500 2587 1445 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020683.1 protein_id gnl|my_center|LOCUS_03500 3757 2834 gene locus_tag LOCUS_03510 3757 2834 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545051.1 protein_id gnl|my_center|LOCUS_03510 4288 5688 gene locus_tag LOCUS_03520 4288 5688 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867476.1 protein_id gnl|my_center|LOCUS_03520 6274 5672 gene locus_tag LOCUS_03530 6274 5672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 6771 7910 gene locus_tag LOCUS_03540 6771 7910 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072840.1 protein_id gnl|my_center|LOCUS_03540 9126 8158 gene locus_tag LOCUS_03550 9126 8158 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546038.1 protein_id gnl|my_center|LOCUS_03550 9335 9087 gene locus_tag LOCUS_03560 9335 9087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 9511 10683 gene locus_tag LOCUS_03570 9511 10683 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_03570 11214 12026 gene locus_tag LOCUS_03580 11214 12026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 12163 13455 gene locus_tag LOCUS_03590 12163 13455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 13565 14122 gene locus_tag LOCUS_03600 13565 14122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 14379 14753 gene locus_tag LOCUS_03610 14379 14753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 >Feature sequence022 4083 1189 gene locus_tag LOCUS_03620 4083 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03620 5494 4223 gene locus_tag LOCUS_03630 5494 4223 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392647.1 protein_id gnl|my_center|LOCUS_03630 6148 5600 gene locus_tag LOCUS_03640 6148 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03640 6436 6158 gene locus_tag LOCUS_03650 6436 6158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03650 7415 6513 gene locus_tag LOCUS_03660 7415 6513 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941353.1 protein_id gnl|my_center|LOCUS_03660 8189 7809 gene locus_tag LOCUS_03670 8189 7809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 8811 9557 gene locus_tag LOCUS_03680 8811 9557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 9647 10213 gene locus_tag LOCUS_03690 9647 10213 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931994.1 protein_id gnl|my_center|LOCUS_03690 10240 10572 gene locus_tag LOCUS_03700 10240 10572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 10674 11750 gene locus_tag LOCUS_03710 10674 11750 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978698.1 protein_id gnl|my_center|LOCUS_03710 >Feature sequence023 1096 155 gene locus_tag LOCUS_03720 1096 155 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229036.1 protein_id gnl|my_center|LOCUS_03720 2507 1209 gene locus_tag LOCUS_03730 2507 1209 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_03730 4085 2709 gene locus_tag LOCUS_03740 4085 2709 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_03740 5217 4057 gene locus_tag LOCUS_03750 5217 4057 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_03750 6242 5214 gene locus_tag LOCUS_03760 6242 5214 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_03760 7264 6242 gene locus_tag LOCUS_03770 gene rfbB 7264 6242 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_03770 7869 7261 gene locus_tag LOCUS_03780 7869 7261 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_03780 8926 7955 gene locus_tag LOCUS_03790 gene gmd 8926 7955 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_03790 10095 8923 gene locus_tag LOCUS_03800 10095 8923 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061734.1 protein_id gnl|my_center|LOCUS_03800 11077 10337 gene locus_tag LOCUS_03810 11077 10337 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_03810 14138 11067 gene locus_tag LOCUS_03820 gene glnE 14138 11067 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943989.1 protein_id gnl|my_center|LOCUS_03820 14383 14135 gene locus_tag LOCUS_03830 14383 14135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 >Feature sequence024 1195 3549 gene locus_tag LOCUS_03840 1195 3549 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022605.1 protein_id gnl|my_center|LOCUS_03840 3924 4376 gene locus_tag LOCUS_03850 3924 4376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03850 4463 5020 gene locus_tag LOCUS_03860 4463 5020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03860 5133 6713 gene locus_tag LOCUS_03870 gene serA 5133 6713 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020641.1 protein_id gnl|my_center|LOCUS_03870 6848 7837 gene locus_tag LOCUS_03880 gene galE 6848 7837 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876270.1 protein_id gnl|my_center|LOCUS_03880 7847 9430 gene locus_tag LOCUS_03890 7847 9430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 9924 10592 gene locus_tag LOCUS_03900 9924 10592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 11593 10832 gene locus_tag LOCUS_03910 11593 10832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 11878 11953 gene locus_tag LOCUS_t00030 11878 11953 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 12084 13997 gene locus_tag LOCUS_03920 gene thrS 12084 13997 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048136.1 protein_id gnl|my_center|LOCUS_03920 14056 14388 gene locus_tag LOCUS_03930 14056 14388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 >Feature sequence025 730 92 gene locus_tag LOCUS_03940 730 92 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943939.1 protein_id gnl|my_center|LOCUS_03940 3407 786 gene locus_tag LOCUS_03950 3407 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 3660 3400 gene locus_tag LOCUS_03960 3660 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 4810 3890 gene locus_tag LOCUS_03970 4810 3890 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868480.1 protein_id gnl|my_center|LOCUS_03970 5943 4789 gene locus_tag LOCUS_03980 gene porA 5943 4789 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877345.1 protein_id gnl|my_center|LOCUS_03980 7628 5940 gene locus_tag LOCUS_03990 7628 5940 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_03990 8420 7833 gene locus_tag LOCUS_04000 8420 7833 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868483.1 protein_id gnl|my_center|LOCUS_04000 9010 8417 gene locus_tag LOCUS_04010 9010 8417 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940756.1 protein_id gnl|my_center|LOCUS_04010 9193 9738 gene locus_tag LOCUS_04020 9193 9738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 9770 10162 gene locus_tag LOCUS_04030 9770 10162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 10128 10844 gene locus_tag LOCUS_04040 10128 10844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 10879 11508 gene locus_tag LOCUS_04050 10879 11508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 11765 12148 gene locus_tag LOCUS_04060 11765 12148 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930621.1 protein_id gnl|my_center|LOCUS_04060 12364 12621 gene locus_tag LOCUS_04070 12364 12621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 12883 12629 gene locus_tag LOCUS_04080 12883 12629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 >Feature sequence026 1460 690 gene locus_tag LOCUS_04090 1460 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 3259 1736 gene locus_tag LOCUS_04100 3259 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 3800 3252 gene locus_tag LOCUS_04110 3800 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 4776 3853 gene locus_tag LOCUS_04120 4776 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 5555 4809 gene locus_tag LOCUS_04130 5555 4809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 6678 5566 gene locus_tag LOCUS_04140 6678 5566 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875973.1 protein_id gnl|my_center|LOCUS_04140 8312 6675 gene locus_tag LOCUS_04150 8312 6675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 9694 8351 gene locus_tag LOCUS_04160 9694 8351 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393050.1 protein_id gnl|my_center|LOCUS_04160 10494 9691 gene locus_tag LOCUS_04170 gene trpA 10494 9691 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943006.1 protein_id gnl|my_center|LOCUS_04170 11800 10610 gene locus_tag LOCUS_04180 gene trpB 11800 10610 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546381.1 protein_id gnl|my_center|LOCUS_04180 12044 11790 gene locus_tag LOCUS_04190 12044 11790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 12111 12437 gene locus_tag LOCUS_04200 12111 12437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 13212 12409 gene locus_tag LOCUS_04210 gene trpC 13212 12409 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392852.1 protein_id gnl|my_center|LOCUS_04210 <14217 13182 gene locus_tag LOCUS_04220 <14217 13182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025774851.1:anthranilate phosphoribosyltransferase >Feature sequence027 1187 42 gene locus_tag LOCUS_04230 1187 42 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546088.1 protein_id gnl|my_center|LOCUS_04230 1616 2089 gene locus_tag LOCUS_04240 1616 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 2086 2472 gene locus_tag LOCUS_04250 2086 2472 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943337.1 protein_id gnl|my_center|LOCUS_04250 2656 3402 gene locus_tag LOCUS_04260 2656 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04260 3467 3805 gene locus_tag LOCUS_04270 3467 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 4081 4305 gene locus_tag LOCUS_04280 4081 4305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04280 4302 4940 gene locus_tag LOCUS_04290 4302 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04290 5429 6628 gene locus_tag LOCUS_04300 5429 6628 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_04300 6628 7317 gene locus_tag LOCUS_04310 6628 7317 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 protein_id gnl|my_center|LOCUS_04310 7617 8009 gene locus_tag LOCUS_04320 7617 8009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 11069 8262 gene locus_tag LOCUS_04330 11069 8262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 11836 11294 gene locus_tag LOCUS_04340 11836 11294 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940509.1 protein_id gnl|my_center|LOCUS_04340 12396 13670 gene locus_tag LOCUS_04350 gene glgC 12396 13670 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329623.1 protein_id gnl|my_center|LOCUS_04350 >Feature sequence028 926 360 gene locus_tag LOCUS_04360 926 360 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242591.1 protein_id gnl|my_center|LOCUS_04360 1632 2363 gene locus_tag LOCUS_04370 1632 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 2365 3156 gene locus_tag LOCUS_04380 2365 3156 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025568069.1 protein_id gnl|my_center|LOCUS_04380 3457 4269 gene locus_tag LOCUS_04390 3457 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 4366 6042 gene locus_tag LOCUS_04400 4366 6042 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878783.1 protein_id gnl|my_center|LOCUS_04400 6074 6481 gene locus_tag LOCUS_04410 6074 6481 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879708.1 protein_id gnl|my_center|LOCUS_04410 6548 7699 gene locus_tag LOCUS_04420 6548 7699 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114530.1 protein_id gnl|my_center|LOCUS_04420 7964 9514 gene locus_tag LOCUS_04430 7964 9514 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_04430 9767 11323 gene locus_tag LOCUS_04440 9767 11323 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926057.1 protein_id gnl|my_center|LOCUS_04440 11597 12463 gene locus_tag LOCUS_04450 11597 12463 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524880.1 protein_id gnl|my_center|LOCUS_04450 12747 13292 gene locus_tag LOCUS_04460 12747 13292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 13306 13554 gene locus_tag LOCUS_04470 13306 13554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 >Feature sequence029 2310 1381 gene locus_tag LOCUS_04480 2310 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 3225 2593 gene locus_tag LOCUS_04490 3225 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 4448 3297 gene locus_tag LOCUS_04500 4448 3297 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804113.1 protein_id gnl|my_center|LOCUS_04500 4638 4441 gene locus_tag LOCUS_04510 4638 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 4855 4667 gene locus_tag LOCUS_04520 4855 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 6755 4848 gene locus_tag LOCUS_04530 gene iorA 6755 4848 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068577330.1 protein_id gnl|my_center|LOCUS_04530 7329 6937 gene locus_tag LOCUS_04540 7329 6937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 8565 7360 gene locus_tag LOCUS_04550 8565 7360 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816570.1 protein_id gnl|my_center|LOCUS_04550 9045 9257 gene locus_tag LOCUS_04560 9045 9257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 9270 9923 gene locus_tag LOCUS_04570 9270 9923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 9920 11512 gene locus_tag LOCUS_04580 9920 11512 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258690.1 protein_id gnl|my_center|LOCUS_04580 12193 12651 gene locus_tag LOCUS_04590 12193 12651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 12648 13154 gene locus_tag LOCUS_04600 12648 13154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 13330 13797 gene locus_tag LOCUS_04610 13330 13797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 >Feature sequence030 70 513 gene locus_tag LOCUS_04620 70 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 745 515 gene locus_tag LOCUS_04630 745 515 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_04630 1125 826 gene locus_tag LOCUS_04640 1125 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 2537 1209 gene locus_tag LOCUS_04650 gene ffh 2537 1209 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_04650 2998 4218 gene locus_tag LOCUS_04660 gene amrB 2998 4218 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880857.1 protein_id gnl|my_center|LOCUS_04660 4807 5367 gene locus_tag LOCUS_04670 4807 5367 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789731.1 protein_id gnl|my_center|LOCUS_04670 5372 5629 gene locus_tag LOCUS_04680 5372 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 5641 6045 gene locus_tag LOCUS_04690 5641 6045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 6017 6226 gene locus_tag LOCUS_04700 6017 6226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 6598 7110 gene locus_tag LOCUS_04710 6598 7110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 7116 8618 gene locus_tag LOCUS_04720 7116 8618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 10861 8708 gene locus_tag LOCUS_04730 10861 8708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 12129 11002 gene locus_tag LOCUS_04740 12129 11002 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942069.1 protein_id gnl|my_center|LOCUS_04740 12237 12159 gene locus_tag LOCUS_t00040 12237 12159 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12965 12585 gene locus_tag LOCUS_04750 12965 12585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 13406 13654 gene locus_tag LOCUS_04760 13406 13654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 >Feature sequence031 2426 1905 gene locus_tag LOCUS_04770 2426 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 2328 2630 gene locus_tag LOCUS_04780 2328 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 3817 2807 gene locus_tag LOCUS_04790 3817 2807 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816053.1 protein_id gnl|my_center|LOCUS_04790 5099 3834 gene locus_tag LOCUS_04800 5099 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04800 5779 5108 gene locus_tag LOCUS_04810 5779 5108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04810 6666 5818 gene locus_tag LOCUS_04820 6666 5818 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970597.1 protein_id gnl|my_center|LOCUS_04820 8670 6688 gene locus_tag LOCUS_04830 8670 6688 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877962.1 protein_id gnl|my_center|LOCUS_04830 8986 8720 gene locus_tag LOCUS_04840 8986 8720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 10054 9047 gene locus_tag LOCUS_04850 10054 9047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 11756 10146 gene locus_tag LOCUS_04860 11756 10146 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980180.1 protein_id gnl|my_center|LOCUS_04860 12599 11784 gene locus_tag LOCUS_04870 12599 11784 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014529496.1 protein_id gnl|my_center|LOCUS_04870 13501 12749 gene locus_tag LOCUS_04880 13501 12749 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061125.1 protein_id gnl|my_center|LOCUS_04880 >Feature sequence032 2066 483 gene locus_tag LOCUS_04890 2066 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 3896 2364 gene locus_tag LOCUS_04900 3896 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 4900 3989 gene locus_tag LOCUS_04910 4900 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 5421 4897 gene locus_tag LOCUS_04920 5421 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 7807 5423 gene locus_tag LOCUS_04930 7807 5423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 9596 8082 gene locus_tag LOCUS_04940 9596 8082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 11725 10790 gene locus_tag LOCUS_04950 11725 10790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 13076 11952 gene locus_tag LOCUS_04960 13076 11952 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943138.1 protein_id gnl|my_center|LOCUS_04960 >Feature sequence033 338 1903 gene locus_tag LOCUS_04970 338 1903 CDS product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123257.1 protein_id gnl|my_center|LOCUS_04970 2361 3401 gene locus_tag LOCUS_04980 gene rtcA 2361 3401 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387129.1 protein_id gnl|my_center|LOCUS_04980 3470 4609 gene locus_tag LOCUS_04990 3470 4609 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913616.1 protein_id gnl|my_center|LOCUS_04990 4777 5340 gene locus_tag LOCUS_05000 4777 5340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 5399 7990 gene locus_tag LOCUS_05010 5399 7990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 10102 8081 gene locus_tag LOCUS_05020 gene brxL 10102 8081 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942749.1 protein_id gnl|my_center|LOCUS_05020 12738 10114 gene locus_tag LOCUS_05030 12738 10114 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942750.1 protein_id gnl|my_center|LOCUS_05030 >Feature sequence034 370 585 gene locus_tag LOCUS_05040 370 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05040 637 1569 gene locus_tag LOCUS_05050 637 1569 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879662.1 protein_id gnl|my_center|LOCUS_05050 1569 2360 gene locus_tag LOCUS_05060 1569 2360 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816058.1 protein_id gnl|my_center|LOCUS_05060 2667 3767 gene locus_tag LOCUS_05070 2667 3767 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878758.1 protein_id gnl|my_center|LOCUS_05070 3769 4380 gene locus_tag LOCUS_05080 3769 4380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 4467 5513 gene locus_tag LOCUS_05090 4467 5513 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107441.1 protein_id gnl|my_center|LOCUS_05090 6411 6884 gene locus_tag LOCUS_05100 6411 6884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 6835 7554 gene locus_tag LOCUS_05110 6835 7554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 7583 9355 gene locus_tag LOCUS_05120 7583 9355 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877847.1 protein_id gnl|my_center|LOCUS_05120 9482 9817 gene locus_tag LOCUS_05130 9482 9817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 10001 10876 gene locus_tag LOCUS_05140 10001 10876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 11051 11407 gene locus_tag LOCUS_05150 11051 11407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 11580 12737 gene locus_tag LOCUS_05160 11580 12737 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114530.1 protein_id gnl|my_center|LOCUS_05160 >Feature sequence035 2359 908 gene locus_tag LOCUS_05170 gene cdaA 2359 908 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941532.1 protein_id gnl|my_center|LOCUS_05170 4609 2393 gene locus_tag LOCUS_05180 gene glgB 4609 2393 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_05180 2399 2419 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5178 5426 gene locus_tag LOCUS_05190 5178 5426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 5499 5693 gene locus_tag LOCUS_05200 gene rpmI 5499 5693 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002811096.1 protein_id gnl|my_center|LOCUS_05200 5740 6120 gene locus_tag LOCUS_05210 gene rplT 5740 6120 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099086.1 protein_id gnl|my_center|LOCUS_05210 6098 6829 gene locus_tag LOCUS_05220 gene hisA 6098 6829 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393528.1 protein_id gnl|my_center|LOCUS_05220 7010 7882 gene locus_tag LOCUS_05230 7010 7882 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545810.1 protein_id gnl|my_center|LOCUS_05230 7875 8531 gene locus_tag LOCUS_05240 gene tmk 7875 8531 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391590.1 protein_id gnl|my_center|LOCUS_05240 8528 9625 gene locus_tag LOCUS_05250 gene holB 8528 9625 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_05250 9797 10396 gene locus_tag LOCUS_05260 9797 10396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 10377 11726 gene locus_tag LOCUS_05270 gene metG 10377 11726 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391596.1 protein_id gnl|my_center|LOCUS_05270 11723 13060 gene locus_tag LOCUS_05280 11723 13060 CDS product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943126.1 protein_id gnl|my_center|LOCUS_05280 >Feature sequence036 664 221 gene locus_tag LOCUS_05290 664 221 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048431.1 protein_id gnl|my_center|LOCUS_05290 799 948 gene locus_tag LOCUS_05300 799 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 966 1583 gene locus_tag LOCUS_05310 966 1583 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964931.1 protein_id gnl|my_center|LOCUS_05310 1748 2215 gene locus_tag LOCUS_05320 1748 2215 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763459.1 protein_id gnl|my_center|LOCUS_05320 3544 2321 gene locus_tag LOCUS_05330 gene glnA4 3544 2321 CDS product gamma-glutamylethanolamide synthetase GlnA4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027883.1 protein_id gnl|my_center|LOCUS_05330 5655 3781 gene locus_tag LOCUS_05340 5655 3781 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227894.1 protein_id gnl|my_center|LOCUS_05340 7091 5916 gene locus_tag LOCUS_05350 7091 5916 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972086.1 protein_id gnl|my_center|LOCUS_05350 7968 7114 gene locus_tag LOCUS_05360 7968 7114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 8298 8011 gene locus_tag LOCUS_05370 8298 8011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 10296 8305 gene locus_tag LOCUS_05380 10296 8305 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249027.1 protein_id gnl|my_center|LOCUS_05380 12581 10611 gene locus_tag LOCUS_05390 12581 10611 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228884.1 protein_id gnl|my_center|LOCUS_05390 >Feature sequence037 761 597 gene locus_tag LOCUS_05400 761 597 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869872.1 protein_id gnl|my_center|LOCUS_05400 1776 823 gene locus_tag LOCUS_05410 1776 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 2512 1982 gene locus_tag LOCUS_05420 2512 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 3932 2571 gene locus_tag LOCUS_05430 gene nrfD 3932 2571 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404833.1 protein_id gnl|my_center|LOCUS_05430 7181 4146 gene locus_tag LOCUS_05440 7181 4146 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372295.1 protein_id gnl|my_center|LOCUS_05440 9120 7723 gene locus_tag LOCUS_05450 gene atoC 9120 7723 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125298.1 protein_id gnl|my_center|LOCUS_05450 10822 9143 gene locus_tag LOCUS_05460 10822 9143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 10938 11357 gene locus_tag LOCUS_05470 10938 11357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 >Feature sequence038 207 1043 gene locus_tag LOCUS_05480 207 1043 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546252.1 protein_id gnl|my_center|LOCUS_05480 1188 2399 gene locus_tag LOCUS_05490 1188 2399 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545925.1 protein_id gnl|my_center|LOCUS_05490 3134 2421 gene locus_tag LOCUS_05500 3134 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 3505 3152 gene locus_tag LOCUS_05510 3505 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 3811 4719 gene locus_tag LOCUS_05520 3811 4719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 5008 5166 gene locus_tag LOCUS_05530 5008 5166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 5600 5178 gene locus_tag LOCUS_05540 5600 5178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 7012 5669 gene locus_tag LOCUS_05550 gene dinB 7012 5669 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087861794.1 protein_id gnl|my_center|LOCUS_05550 7449 9377 gene locus_tag LOCUS_05560 7449 9377 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922636.1 protein_id gnl|my_center|LOCUS_05560 10782 9685 gene locus_tag LOCUS_05570 10782 9685 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546683.1 protein_id gnl|my_center|LOCUS_05570 12212 11331 gene locus_tag LOCUS_05580 12212 11331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05580 12713 12231 gene locus_tag LOCUS_05590 12713 12231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 >Feature sequence039 946 1557 gene locus_tag LOCUS_05600 946 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 2816 2370 gene locus_tag LOCUS_05610 2816 2370 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140634.1 protein_id gnl|my_center|LOCUS_05610 3091 3891 gene locus_tag LOCUS_05620 3091 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 4195 4926 gene locus_tag LOCUS_05630 4195 4926 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124783.1 protein_id gnl|my_center|LOCUS_05630 5002 6492 gene locus_tag LOCUS_05640 5002 6492 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_05640 7952 6846 gene locus_tag LOCUS_05650 7952 6846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 8375 8656 gene locus_tag LOCUS_05660 8375 8656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 9199 10698 gene locus_tag LOCUS_05670 9199 10698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 10875 12560 gene locus_tag LOCUS_05680 10875 12560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 >Feature sequence040 <1 651 gene locus_tag LOCUS_05690 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000172583.1:glycerophosphodiester phosphodiesterase 653 1681 gene locus_tag LOCUS_05700 653 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 1759 3057 gene locus_tag LOCUS_05710 1759 3057 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129220445.1 protein_id gnl|my_center|LOCUS_05710 3059 3739 gene locus_tag LOCUS_05720 3059 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 4756 3755 gene locus_tag LOCUS_05730 4756 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 5895 5134 gene locus_tag LOCUS_05740 5895 5134 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081113.1 protein_id gnl|my_center|LOCUS_05740 6308 8596 gene locus_tag LOCUS_05750 6308 8596 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584148.1 protein_id gnl|my_center|LOCUS_05750 8830 9855 gene locus_tag LOCUS_05760 8830 9855 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583055.1 protein_id gnl|my_center|LOCUS_05760 9866 11047 gene locus_tag LOCUS_05770 gene iolM 9866 11047 CDS product scyllo-inosose 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083260.1 protein_id gnl|my_center|LOCUS_05770 11258 11665 gene locus_tag LOCUS_05780 11258 11665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 >Feature sequence041 <1 679 gene locus_tag LOCUS_05790 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003727573.1:chromosomal replication initiator protein DnaA 703 1107 gene locus_tag LOCUS_05800 703 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05800 1178 2221 gene locus_tag LOCUS_05810 1178 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 2202 3158 gene locus_tag LOCUS_05820 2202 3158 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_05820 3179 4816 gene locus_tag LOCUS_05830 3179 4816 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_05830 4820 5602 gene locus_tag LOCUS_05840 4820 5602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 5539 5994 gene locus_tag LOCUS_05850 5539 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 6032 7264 gene locus_tag LOCUS_05860 6032 7264 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_05860 7439 8215 gene locus_tag LOCUS_05870 7439 8215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 8281 8838 gene locus_tag LOCUS_05880 8281 8838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 8835 9587 gene locus_tag LOCUS_05890 8835 9587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 >Feature sequence042 1074 7 gene locus_tag LOCUS_05900 gene prfA 1074 7 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_05900 1770 1081 gene locus_tag LOCUS_05910 gene thyX 1770 1081 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943727.1 protein_id gnl|my_center|LOCUS_05910 1933 1730 gene locus_tag LOCUS_05920 gene rpmE 1933 1730 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_05920 2729 2082 gene locus_tag LOCUS_05930 2729 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 4136 3249 gene locus_tag LOCUS_05940 4136 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 5305 4289 gene locus_tag LOCUS_05950 5305 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 6132 6608 gene locus_tag LOCUS_05960 6132 6608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 6921 7976 gene locus_tag LOCUS_05970 6921 7976 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460939.1 protein_id gnl|my_center|LOCUS_05970 8018 8644 gene locus_tag LOCUS_05980 8018 8644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 8709 8945 gene locus_tag LOCUS_05990 8709 8945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 9167 10684 gene locus_tag LOCUS_06000 9167 10684 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933195.1 protein_id gnl|my_center|LOCUS_06000 >Feature sequence043 1197 610 gene locus_tag LOCUS_06010 gene rsxA 1197 610 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_06010 1823 1197 gene locus_tag LOCUS_06020 1823 1197 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419045.1 protein_id gnl|my_center|LOCUS_06020 2424 1816 gene locus_tag LOCUS_06030 gene rsxG 2424 1816 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816276.1 protein_id gnl|my_center|LOCUS_06030 3431 2421 gene locus_tag LOCUS_06040 3431 2421 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_06040 4123 3428 gene locus_tag LOCUS_06050 4123 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06050 4151 4198 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4870 5373 gene locus_tag LOCUS_06060 4870 5373 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476513.1 protein_id gnl|my_center|LOCUS_06060 5387 5812 gene locus_tag LOCUS_06070 5387 5812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 5861 7507 gene locus_tag LOCUS_06080 5861 7507 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727411.1 protein_id gnl|my_center|LOCUS_06080 7841 9040 gene locus_tag LOCUS_06090 7841 9040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 9201 10448 gene locus_tag LOCUS_06100 9201 10448 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815636.1 protein_id gnl|my_center|LOCUS_06100 10633 11706 gene locus_tag LOCUS_06110 10633 11706 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867209.1 protein_id gnl|my_center|LOCUS_06110 >Feature sequence044 727 1233 gene locus_tag LOCUS_06120 727 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 1257 2207 gene locus_tag LOCUS_06130 1257 2207 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462197.1 protein_id gnl|my_center|LOCUS_06130 2204 2875 gene locus_tag LOCUS_06140 gene ftsE 2204 2875 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942419.1 protein_id gnl|my_center|LOCUS_06140 2905 4938 gene locus_tag LOCUS_06150 2905 4938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 4919 6364 gene locus_tag LOCUS_06160 4919 6364 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_06160 6279 6479 gene locus_tag LOCUS_06170 6279 6479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 6476 7129 gene locus_tag LOCUS_06180 6476 7129 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545768.1 protein_id gnl|my_center|LOCUS_06180 7080 7769 gene locus_tag LOCUS_06190 7080 7769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 7747 8181 gene locus_tag LOCUS_06200 gene rpiB 7747 8181 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_06200 8212 9477 gene locus_tag LOCUS_06210 8212 9477 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_06210 9510 9965 gene locus_tag LOCUS_06220 9510 9965 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_06220 9962 11329 gene locus_tag LOCUS_06230 gene hslU 9962 11329 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_06230 >Feature sequence045 893 18 gene locus_tag LOCUS_06240 gene dapA 893 18 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940835.1 protein_id gnl|my_center|LOCUS_06240 2454 1033 gene locus_tag LOCUS_06250 gene dnaB 2454 1033 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583712.1 protein_id gnl|my_center|LOCUS_06250 2923 2477 gene locus_tag LOCUS_06260 gene rplI 2923 2477 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545246.1 protein_id gnl|my_center|LOCUS_06260 3360 3124 gene locus_tag LOCUS_06270 gene rpsR 3360 3124 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391678.1 protein_id gnl|my_center|LOCUS_06270 3956 3453 gene locus_tag LOCUS_06280 3956 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 4272 3865 gene locus_tag LOCUS_06290 4272 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 6707 4575 gene locus_tag LOCUS_06300 6707 4575 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_06300 7045 8607 gene locus_tag LOCUS_06310 7045 8607 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085732.1 protein_id gnl|my_center|LOCUS_06310 8745 9950 gene locus_tag LOCUS_06320 8745 9950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 10207 11730 gene locus_tag LOCUS_06330 10207 11730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 >Feature sequence046 624 3071 gene locus_tag LOCUS_06340 624 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 3229 3456 gene locus_tag LOCUS_06350 3229 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 3529 5157 gene locus_tag LOCUS_06360 gene muiA 3529 5157 CDS product mucoidy inhibitor MuiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114297.1 protein_id gnl|my_center|LOCUS_06360 5258 5578 gene locus_tag LOCUS_06370 5258 5578 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255937.1 protein_id gnl|my_center|LOCUS_06370 5822 6523 gene locus_tag LOCUS_06380 5822 6523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 6589 7083 gene locus_tag LOCUS_06390 6589 7083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 7095 8480 gene locus_tag LOCUS_06400 7095 8480 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083033.1 protein_id gnl|my_center|LOCUS_06400 9525 8572 gene locus_tag LOCUS_06410 9525 8572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 10356 9823 gene locus_tag LOCUS_06420 10356 9823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 11423 10455 gene locus_tag LOCUS_06430 gene ispE 11423 10455 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140106.1 protein_id gnl|my_center|LOCUS_06430 11742 11428 gene locus_tag LOCUS_06440 11742 11428 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022822.1 protein_id gnl|my_center|LOCUS_06440 >Feature sequence047 3147 2923 gene locus_tag LOCUS_06450 3147 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 4239 4310 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5297 4449 gene locus_tag LOCUS_06460 5297 4449 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389859.1 protein_id gnl|my_center|LOCUS_06460 7398 5380 gene locus_tag LOCUS_06470 7398 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 8674 7568 gene locus_tag LOCUS_06480 8674 7568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 8814 11441 gene locus_tag LOCUS_06490 8814 11441 CDS product non-lysosomal glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108530.1 protein_id gnl|my_center|LOCUS_06490 >Feature sequence048 340 1044 gene locus_tag LOCUS_06500 340 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546704.1 protein_id gnl|my_center|LOCUS_06500 1041 1874 gene locus_tag LOCUS_06510 1041 1874 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941442.1 protein_id gnl|my_center|LOCUS_06510 1981 3831 gene locus_tag LOCUS_06520 1981 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 3899 4270 gene locus_tag LOCUS_06530 3899 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 4345 6159 gene locus_tag LOCUS_06540 4345 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 6235 6786 gene locus_tag LOCUS_06550 6235 6786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 6846 7025 gene locus_tag LOCUS_06560 6846 7025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 7217 9073 gene locus_tag LOCUS_06570 7217 9073 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227162.1 protein_id gnl|my_center|LOCUS_06570 9155 10087 gene locus_tag LOCUS_06580 9155 10087 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392167.1 protein_id gnl|my_center|LOCUS_06580 >Feature sequence049 622 185 gene locus_tag LOCUS_06590 622 185 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943767.1 protein_id gnl|my_center|LOCUS_06590 1290 808 gene locus_tag LOCUS_06600 gene moaC 1290 808 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545678.1 protein_id gnl|my_center|LOCUS_06600 2319 1300 gene locus_tag LOCUS_06610 2319 1300 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060827.1 protein_id gnl|my_center|LOCUS_06610 3397 2705 gene locus_tag LOCUS_06620 3397 2705 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943339.1 protein_id gnl|my_center|LOCUS_06620 6164 4314 gene locus_tag LOCUS_06630 6164 4314 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658063.1 protein_id gnl|my_center|LOCUS_06630 7207 6440 gene locus_tag LOCUS_06640 7207 6440 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943067.1 protein_id gnl|my_center|LOCUS_06640 8174 7314 gene locus_tag LOCUS_06650 8174 7314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06650 8449 8159 gene locus_tag LOCUS_06660 8449 8159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06660 8755 9714 gene locus_tag LOCUS_06670 8755 9714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 9717 10214 gene locus_tag LOCUS_06680 9717 10214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 10238 11245 gene locus_tag LOCUS_06690 10238 11245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 11492 11229 gene locus_tag LOCUS_06700 gene rpsT 11492 11229 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545489.1 protein_id gnl|my_center|LOCUS_06700 >Feature sequence050 1563 424 gene locus_tag LOCUS_06710 1563 424 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_06710 2755 1580 gene locus_tag LOCUS_06720 2755 1580 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190136.1 protein_id gnl|my_center|LOCUS_06720 3152 4987 gene locus_tag LOCUS_06730 3152 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 5641 5081 gene locus_tag LOCUS_06740 5641 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 7274 5877 gene locus_tag LOCUS_06750 7274 5877 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_06750 8249 7362 gene locus_tag LOCUS_06760 8249 7362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 7563 7626 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8749 8369 gene locus_tag LOCUS_06770 8749 8369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 9688 8795 gene locus_tag LOCUS_06780 9688 8795 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678383.1 protein_id gnl|my_center|LOCUS_06780 11290 9935 gene locus_tag LOCUS_06790 gene rsmB 11290 9935 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392419.1 protein_id gnl|my_center|LOCUS_06790 >Feature sequence051 1050 1072 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2344 1619 gene locus_tag LOCUS_06800 2344 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 4266 2371 gene locus_tag LOCUS_06810 4266 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 4903 4268 gene locus_tag LOCUS_06820 4903 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 6052 5168 gene locus_tag LOCUS_06830 6052 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 6790 6365 gene locus_tag LOCUS_06840 6790 6365 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121968.1 protein_id gnl|my_center|LOCUS_06840 7362 8381 gene locus_tag LOCUS_06850 7362 8381 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_06850 8808 10574 gene locus_tag LOCUS_06860 8808 10574 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256840.1 protein_id gnl|my_center|LOCUS_06860 >Feature sequence052 1264 395 gene locus_tag LOCUS_06870 1264 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 1535 2182 gene locus_tag LOCUS_06880 1535 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 2713 2426 gene locus_tag LOCUS_06890 2713 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 5779 2816 gene locus_tag LOCUS_06900 5779 2816 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_06900 6763 5786 gene locus_tag LOCUS_06910 6763 5786 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275358.1 protein_id gnl|my_center|LOCUS_06910 7548 7108 gene locus_tag LOCUS_06920 7548 7108 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966842.1 protein_id gnl|my_center|LOCUS_06920 7906 8634 gene locus_tag LOCUS_06930 gene fabG 7906 8634 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911773.1 protein_id gnl|my_center|LOCUS_06930 9048 10763 gene locus_tag LOCUS_06940 9048 10763 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_06940 >Feature sequence053 <1 894 gene locus_tag LOCUS_06950 <1 894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259617.1:glycosyltransferase family 2 protein 881 2080 gene locus_tag LOCUS_06960 881 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 2023 3303 gene locus_tag LOCUS_06970 2023 3303 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024330.1 protein_id gnl|my_center|LOCUS_06970 3528 3337 gene locus_tag LOCUS_06980 3528 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 4038 5084 gene locus_tag LOCUS_06990 4038 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 5089 6570 gene locus_tag LOCUS_07000 5089 6570 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048103.1 protein_id gnl|my_center|LOCUS_07000 6602 7405 gene locus_tag LOCUS_07010 6602 7405 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893717.1 protein_id gnl|my_center|LOCUS_07010 7423 9258 gene locus_tag LOCUS_07020 7423 9258 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_07020 11210 9366 gene locus_tag LOCUS_07030 11210 9366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 >Feature sequence054 371 18 gene locus_tag LOCUS_07040 371 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 715 431 gene locus_tag LOCUS_07050 715 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 910 1680 gene locus_tag LOCUS_07060 910 1680 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250671.1 protein_id gnl|my_center|LOCUS_07060 2494 2661 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2937 3947 gene locus_tag LOCUS_07070 2937 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 4066 5046 gene locus_tag LOCUS_07080 4066 5046 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393353.1 protein_id gnl|my_center|LOCUS_07080 5043 7430 gene locus_tag LOCUS_07090 5043 7430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 7516 8097 gene locus_tag LOCUS_07100 7516 8097 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940274.1 protein_id gnl|my_center|LOCUS_07100 8145 9284 gene locus_tag LOCUS_07110 8145 9284 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763226.1 protein_id gnl|my_center|LOCUS_07110 9281 10027 gene locus_tag LOCUS_07120 9281 10027 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_07120 10198 11100 gene locus_tag LOCUS_07130 10198 11100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 >Feature sequence055 977 9 gene locus_tag LOCUS_07140 977 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545019.1 protein_id gnl|my_center|LOCUS_07140 1452 1108 gene locus_tag LOCUS_07150 1452 1108 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948455.1 protein_id gnl|my_center|LOCUS_07150 2850 1492 gene locus_tag LOCUS_07160 gene mtaB 2850 1492 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_07160 3593 2850 gene locus_tag LOCUS_07170 3593 2850 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430913.1 protein_id gnl|my_center|LOCUS_07170 4409 3624 gene locus_tag LOCUS_07180 4409 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07180 4620 4291 gene locus_tag LOCUS_07190 4620 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 6194 4641 gene locus_tag LOCUS_07200 gene dnaK 6194 4641 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_07200 7240 6506 gene locus_tag LOCUS_07210 gene grpE 7240 6506 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_07210 8298 7420 gene locus_tag LOCUS_07220 gene hrcA 8298 7420 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07220 9168 10613 gene locus_tag LOCUS_07230 9168 10613 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867476.1 protein_id gnl|my_center|LOCUS_07230 10799 10999 gene locus_tag LOCUS_07240 10799 10999 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_07240 >Feature sequence056 1356 862 gene locus_tag LOCUS_07250 1356 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 1582 1304 gene locus_tag LOCUS_07260 1582 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 1711 2163 gene locus_tag LOCUS_07270 1711 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 2165 2464 gene locus_tag LOCUS_07280 2165 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 3313 2942 gene locus_tag LOCUS_07290 3313 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 5068 3596 gene locus_tag LOCUS_07300 gene trpE 5068 3596 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_07300 5458 5072 gene locus_tag LOCUS_07310 gene hisI 5458 5072 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932151.1 protein_id gnl|my_center|LOCUS_07310 5712 5455 gene locus_tag LOCUS_07320 5712 5455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 6034 5594 gene locus_tag LOCUS_07330 6034 5594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 6362 6571 gene locus_tag LOCUS_07340 6362 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 7009 6464 gene locus_tag LOCUS_07350 7009 6464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 8211 7141 gene locus_tag LOCUS_07360 8211 7141 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286665.1 protein_id gnl|my_center|LOCUS_07360 8767 8342 gene locus_tag LOCUS_07370 gene aroQ 8767 8342 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_07370 10129 8843 gene locus_tag LOCUS_07380 10129 8843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 11074 10196 gene locus_tag LOCUS_07390 11074 10196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 >Feature sequence057 1385 1579 gene locus_tag LOCUS_07400 1385 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 1680 2939 gene locus_tag LOCUS_07410 1680 2939 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545411.1 protein_id gnl|my_center|LOCUS_07410 4004 4672 gene locus_tag LOCUS_07420 4004 4672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 4591 4655 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4663 4860 gene locus_tag LOCUS_07430 4663 4860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 5001 6329 gene locus_tag LOCUS_07440 5001 6329 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940912.1 protein_id gnl|my_center|LOCUS_07440 7430 6339 gene locus_tag LOCUS_07450 7430 6339 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890820.1 protein_id gnl|my_center|LOCUS_07450 8101 7616 gene locus_tag LOCUS_07460 8101 7616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 8530 8294 gene locus_tag LOCUS_07470 8530 8294 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755925.1 protein_id gnl|my_center|LOCUS_07470 8778 8527 gene locus_tag LOCUS_07480 8778 8527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 9091 8804 gene locus_tag LOCUS_07490 9091 8804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 9194 9856 gene locus_tag LOCUS_07500 9194 9856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 >Feature sequence058 2443 317 gene locus_tag LOCUS_07510 2443 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 3392 2562 gene locus_tag LOCUS_07520 3392 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 4772 3702 gene locus_tag LOCUS_07530 4772 3702 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658622.1 protein_id gnl|my_center|LOCUS_07530 5945 4782 gene locus_tag LOCUS_07540 5945 4782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 6295 6429 gene locus_tag LOCUS_07550 6295 6429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 6448 6759 gene locus_tag LOCUS_07560 6448 6759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 6760 7116 gene locus_tag LOCUS_07570 6760 7116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 7916 8332 gene locus_tag LOCUS_07580 7916 8332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 9381 8398 gene locus_tag LOCUS_07590 9381 8398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 10810 9518 gene locus_tag LOCUS_07600 10810 9518 CDS product phage/plasmid primase, P4 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903975.1 protein_id gnl|my_center|LOCUS_07600 >Feature sequence059 2330 570 gene locus_tag LOCUS_07610 2330 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 2578 3516 gene locus_tag LOCUS_07620 2578 3516 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530929.1 protein_id gnl|my_center|LOCUS_07620 4105 3836 gene locus_tag LOCUS_07630 4105 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 4441 4154 gene locus_tag LOCUS_07640 4441 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 5326 4679 gene locus_tag LOCUS_07650 5326 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 5919 5323 gene locus_tag LOCUS_07660 5919 5323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 6844 6257 gene locus_tag LOCUS_07670 6844 6257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07670 7548 6745 gene locus_tag LOCUS_07680 7548 6745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07680 6863 6913 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8104 10122 gene locus_tag LOCUS_07690 8104 10122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 8807 8908 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10119 10754 gene locus_tag LOCUS_07700 10119 10754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 >Feature sequence060 1041 487 gene locus_tag LOCUS_07710 1041 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 1735 1133 gene locus_tag LOCUS_07720 gene pyrE 1735 1133 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460653.1 protein_id gnl|my_center|LOCUS_07720 2028 1750 gene locus_tag LOCUS_07730 2028 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 2300 2061 gene locus_tag LOCUS_07740 2300 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 3222 2260 gene locus_tag LOCUS_07750 3222 2260 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_07750 4645 3215 gene locus_tag LOCUS_07760 4645 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 5751 4666 gene locus_tag LOCUS_07770 gene disA 5751 4666 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393302.1 protein_id gnl|my_center|LOCUS_07770 6852 5797 gene locus_tag LOCUS_07780 gene lysA 6852 5797 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_07780 8766 7174 gene locus_tag LOCUS_07790 8766 7174 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_07790 9194 9820 gene locus_tag LOCUS_07800 9194 9820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 9899 10615 gene locus_tag LOCUS_07810 9899 10615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 >Feature sequence061 164 2281 gene locus_tag LOCUS_07820 164 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 2649 2900 gene locus_tag LOCUS_07830 2649 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 2955 6248 gene locus_tag LOCUS_07840 gene carB 2955 6248 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941931.1 protein_id gnl|my_center|LOCUS_07840 6424 7386 gene locus_tag LOCUS_07850 6424 7386 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325468.1 protein_id gnl|my_center|LOCUS_07850 7383 8180 gene locus_tag LOCUS_07860 7383 8180 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942145.1 protein_id gnl|my_center|LOCUS_07860 8187 9272 gene locus_tag LOCUS_07870 8187 9272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 9418 10098 gene locus_tag LOCUS_07880 9418 10098 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_07880 >Feature sequence062 3157 353 gene locus_tag LOCUS_07890 3157 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 3738 4511 gene locus_tag LOCUS_07900 3738 4511 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902972.1 protein_id gnl|my_center|LOCUS_07900 5719 4709 gene locus_tag LOCUS_07910 5719 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 7067 5796 gene locus_tag LOCUS_07920 7067 5796 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545857.1 protein_id gnl|my_center|LOCUS_07920 8376 7057 gene locus_tag LOCUS_07930 gene proB 8376 7057 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392099.1 protein_id gnl|my_center|LOCUS_07930 7248 7302 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9625 8357 gene locus_tag LOCUS_07940 gene obgE 9625 8357 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392098.1 protein_id gnl|my_center|LOCUS_07940 9962 9702 gene locus_tag LOCUS_07950 gene rpmA 9962 9702 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545975.1 protein_id gnl|my_center|LOCUS_07950 10373 10062 gene locus_tag LOCUS_07960 gene rplU 10373 10062 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896002.1 protein_id gnl|my_center|LOCUS_07960 10711 10638 gene locus_tag LOCUS_t00050 10711 10638 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 10843 10767 gene locus_tag LOCUS_t00060 10843 10767 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence063 258 890 gene locus_tag LOCUS_07970 258 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 957 3134 gene locus_tag LOCUS_07980 gene acsB 957 3134 CDS product acetyl-CoA decarbonylase/synthase complex subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811727.1 protein_id gnl|my_center|LOCUS_07980 3225 4568 gene locus_tag LOCUS_07990 gene acsC 3225 4568 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811725.1 protein_id gnl|my_center|LOCUS_07990 4573 6477 gene locus_tag LOCUS_08000 4573 6477 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392714.1 protein_id gnl|my_center|LOCUS_08000 6637 7128 gene locus_tag LOCUS_08010 6637 7128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08010 7144 7590 gene locus_tag LOCUS_08020 7144 7590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08020 7709 8515 gene locus_tag LOCUS_08030 7709 8515 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392711.1 protein_id gnl|my_center|LOCUS_08030 8999 9418 gene locus_tag LOCUS_08040 gene ndk 8999 9418 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810689.1 protein_id gnl|my_center|LOCUS_08040 9720 10499 gene locus_tag LOCUS_08050 9720 10499 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393787.1 protein_id gnl|my_center|LOCUS_08050 >Feature sequence064 157 1512 gene locus_tag LOCUS_08060 157 1512 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064965.1 protein_id gnl|my_center|LOCUS_08060 1543 3102 gene locus_tag LOCUS_08070 1543 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 5031 4438 gene locus_tag LOCUS_08080 gene yqeK 5031 4438 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078244.1 protein_id gnl|my_center|LOCUS_08080 5805 5212 gene locus_tag LOCUS_08090 gene nadD 5805 5212 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392101.1 protein_id gnl|my_center|LOCUS_08090 7323 5911 gene locus_tag LOCUS_08100 7323 5911 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400120.1 protein_id gnl|my_center|LOCUS_08100 7444 7262 gene locus_tag LOCUS_08110 7444 7262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 7768 7526 gene locus_tag LOCUS_08120 7768 7526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 7688 7882 gene locus_tag LOCUS_08130 7688 7882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 7940 8530 gene locus_tag LOCUS_08140 7940 8530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08140 8681 9751 gene locus_tag LOCUS_08150 gene mqnE 8681 9751 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393346.1 protein_id gnl|my_center|LOCUS_08150 9867 10679 gene locus_tag LOCUS_08160 9867 10679 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922781.1 protein_id gnl|my_center|LOCUS_08160 >Feature sequence065 619 2733 gene locus_tag LOCUS_08170 619 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 4240 2828 gene locus_tag LOCUS_08180 gene glnA 4240 2828 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_08180 4604 4227 gene locus_tag LOCUS_08190 4604 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 5127 5477 gene locus_tag LOCUS_08200 5127 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 5648 6169 gene locus_tag LOCUS_08210 5648 6169 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391792.1 protein_id gnl|my_center|LOCUS_08210 6405 6815 gene locus_tag LOCUS_08220 6405 6815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 6841 8895 gene locus_tag LOCUS_08230 gene fusA 6841 8895 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583197.1 protein_id gnl|my_center|LOCUS_08230 9085 9738 gene locus_tag LOCUS_08240 9085 9738 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392339.1 protein_id gnl|my_center|LOCUS_08240 >Feature sequence066 3 326 gene locus_tag LOCUS_08250 3 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 323 622 gene locus_tag LOCUS_08260 gene porD 323 622 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082458.1 protein_id gnl|my_center|LOCUS_08260 840 2018 gene locus_tag LOCUS_08270 840 2018 CDS product 2-ketoisovalerate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545720.1 protein_id gnl|my_center|LOCUS_08270 2225 3154 gene locus_tag LOCUS_08280 2225 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 3910 3248 gene locus_tag LOCUS_08290 3910 3248 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880253.1 protein_id gnl|my_center|LOCUS_08290 4340 6583 gene locus_tag LOCUS_08300 4340 6583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 6577 7947 gene locus_tag LOCUS_08310 6577 7947 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940959.1 protein_id gnl|my_center|LOCUS_08310 8138 8614 gene locus_tag LOCUS_08320 8138 8614 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933541.1 protein_id gnl|my_center|LOCUS_08320 9106 8639 gene locus_tag LOCUS_08330 9106 8639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 9244 9122 gene locus_tag LOCUS_08340 9244 9122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 9602 10021 gene locus_tag LOCUS_08350 9602 10021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 10070 10345 gene locus_tag LOCUS_08360 10070 10345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 >Feature sequence067 170 1384 gene locus_tag LOCUS_08370 gene paaK 170 1384 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965787.1 protein_id gnl|my_center|LOCUS_08370 1617 2792 gene locus_tag LOCUS_08380 1617 2792 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939677.1 protein_id gnl|my_center|LOCUS_08380 2885 4288 gene locus_tag LOCUS_08390 gene gcvPA 2885 4288 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933289.1 protein_id gnl|my_center|LOCUS_08390 4303 5865 gene locus_tag LOCUS_08400 gene gcvPB 4303 5865 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868896.1 protein_id gnl|my_center|LOCUS_08400 5924 6937 gene locus_tag LOCUS_08410 5924 6937 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895577.1 protein_id gnl|my_center|LOCUS_08410 7209 8012 gene locus_tag LOCUS_08420 gene ucpA 7209 8012 CDS product SDR family oxidoreductase UcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517460.1 protein_id gnl|my_center|LOCUS_08420 8147 8977 gene locus_tag LOCUS_08430 8147 8977 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968672.1 protein_id gnl|my_center|LOCUS_08430 9163 9765 gene locus_tag LOCUS_08440 9163 9765 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545352.1 protein_id gnl|my_center|LOCUS_08440 >Feature sequence068 1149 2132 gene locus_tag LOCUS_08450 1149 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 2116 2862 gene locus_tag LOCUS_08460 2116 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 3205 4098 gene locus_tag LOCUS_08470 3205 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 4498 5325 gene locus_tag LOCUS_08480 4498 5325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 5253 5264 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5802 6272 gene locus_tag LOCUS_08490 5802 6272 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943628.1 protein_id gnl|my_center|LOCUS_08490 6440 7063 gene locus_tag LOCUS_08500 6440 7063 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_08500 9195 7906 gene locus_tag LOCUS_08510 gene serS 9195 7906 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391570.1 protein_id gnl|my_center|LOCUS_08510 10056 9208 gene locus_tag LOCUS_08520 10056 9208 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546849.1 protein_id gnl|my_center|LOCUS_08520 >Feature sequence069 26 196 gene locus_tag LOCUS_08530 26 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 209 1453 gene locus_tag LOCUS_08540 209 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08540 1609 2325 gene locus_tag LOCUS_08550 1609 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 2362 3900 gene locus_tag LOCUS_08560 2362 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 3903 4772 gene locus_tag LOCUS_08570 gene hpnK 3903 4772 CDS product hopanoid biosynthesis-associated protein HpnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941812.1 protein_id gnl|my_center|LOCUS_08570 5074 4850 gene locus_tag LOCUS_08580 5074 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 5825 5094 gene locus_tag LOCUS_08590 5825 5094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 6661 5852 gene locus_tag LOCUS_08600 6661 5852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08600 6761 6765 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7751 8173 gene locus_tag LOCUS_08610 7751 8173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 8328 8636 gene locus_tag LOCUS_08620 8328 8636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 9119 9571 gene locus_tag LOCUS_08630 9119 9571 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583624.1 protein_id gnl|my_center|LOCUS_08630 >Feature sequence070 713 1267 gene locus_tag LOCUS_08640 713 1267 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173934.1 protein_id gnl|my_center|LOCUS_08640 1386 2156 gene locus_tag LOCUS_08650 gene fabG 1386 2156 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225712.1 protein_id gnl|my_center|LOCUS_08650 2415 3872 gene locus_tag LOCUS_08660 2415 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 6056 4065 gene locus_tag LOCUS_08670 6056 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 6458 6291 gene locus_tag LOCUS_08680 6458 6291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 6569 8050 gene locus_tag LOCUS_08690 6569 8050 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082990.1 protein_id gnl|my_center|LOCUS_08690 >Feature sequence071 637 1941 gene locus_tag LOCUS_08700 637 1941 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114846.1 protein_id gnl|my_center|LOCUS_08700 2119 4581 gene locus_tag LOCUS_08710 2119 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 5010 5837 gene locus_tag LOCUS_08720 5010 5837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 5939 6808 gene locus_tag LOCUS_08730 5939 6808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 7116 6931 gene locus_tag LOCUS_08740 7116 6931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 8582 7176 gene locus_tag LOCUS_08750 8582 7176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 <10319 8785 gene locus_tag LOCUS_08760 <10319 8785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989822.1:primosomal protein N' >Feature sequence072 254 952 gene locus_tag LOCUS_08770 254 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08770 923 936 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 949 1596 gene locus_tag LOCUS_08780 949 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08780 2339 3118 gene locus_tag LOCUS_08790 2339 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 3057 3890 gene locus_tag LOCUS_08800 3057 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 5702 4005 gene locus_tag LOCUS_08810 gene groL 5702 4005 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545192.1 protein_id gnl|my_center|LOCUS_08810 6007 5861 gene locus_tag LOCUS_08820 6007 5861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08820 7269 6403 gene locus_tag LOCUS_08830 gene rsmA 7269 6403 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294004.1 protein_id gnl|my_center|LOCUS_08830 8249 7266 gene locus_tag LOCUS_08840 gene pdxA 8249 7266 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545509.1 protein_id gnl|my_center|LOCUS_08840 9004 8246 gene locus_tag LOCUS_08850 gene kdsB 9004 8246 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_08850 <10238 9226 gene locus_tag LOCUS_08860 <10238 9226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942900.1:lipid A export permease/ATP-binding protein MsbA >Feature sequence073 1353 2342 gene locus_tag LOCUS_08870 1353 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 2402 3178 gene locus_tag LOCUS_08880 2402 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 3849 4142 gene locus_tag LOCUS_08890 3849 4142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 4143 4874 gene locus_tag LOCUS_08900 4143 4874 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_08900 5095 7605 gene locus_tag LOCUS_08910 5095 7605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08910 7607 7990 gene locus_tag LOCUS_08920 7607 7990 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065974.1 protein_id gnl|my_center|LOCUS_08920 8000 9205 gene locus_tag LOCUS_08930 8000 9205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 9331 9813 gene locus_tag LOCUS_08940 9331 9813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 >Feature sequence074 <1 1047 gene locus_tag LOCUS_08950 <1 1047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000412652.1:beta-ketoacyl-ACP synthase II 1115 3025 gene locus_tag LOCUS_08960 1115 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 2931 3590 gene locus_tag LOCUS_08970 2931 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 3592 5421 gene locus_tag LOCUS_08980 3592 5421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 5396 5689 gene locus_tag LOCUS_08990 5396 5689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08990 5762 6991 gene locus_tag LOCUS_09000 5762 6991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 6998 9313 gene locus_tag LOCUS_09010 6998 9313 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480716.1 protein_id gnl|my_center|LOCUS_09010 9387 9566 gene locus_tag LOCUS_09020 9387 9566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 >Feature sequence075 279 1721 gene locus_tag LOCUS_09030 279 1721 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582827.1 protein_id gnl|my_center|LOCUS_09030 1848 2522 gene locus_tag LOCUS_09040 1848 2522 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358516.1 protein_id gnl|my_center|LOCUS_09040 3834 3067 gene locus_tag LOCUS_09050 3834 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 4277 3831 gene locus_tag LOCUS_09060 4277 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 4614 5804 gene locus_tag LOCUS_09070 4614 5804 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393062.1 protein_id gnl|my_center|LOCUS_09070 5822 6160 gene locus_tag LOCUS_09080 5822 6160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 6111 6743 gene locus_tag LOCUS_09090 6111 6743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 6892 8112 gene locus_tag LOCUS_09100 6892 8112 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973141.1 protein_id gnl|my_center|LOCUS_09100 9053 8349 gene locus_tag LOCUS_09110 9053 8349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 >Feature sequence076 2136 85 gene locus_tag LOCUS_09120 2136 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 3350 2154 gene locus_tag LOCUS_09130 3350 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 3639 3325 gene locus_tag LOCUS_09140 3639 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 6608 3741 gene locus_tag LOCUS_09150 gene uvrA 6608 3741 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943938.1 protein_id gnl|my_center|LOCUS_09150 7420 6851 gene locus_tag LOCUS_09160 7420 6851 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942171.1 protein_id gnl|my_center|LOCUS_09160 7722 7576 gene locus_tag LOCUS_09170 7722 7576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 8402 8019 gene locus_tag LOCUS_09180 8402 8019 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359271.1 protein_id gnl|my_center|LOCUS_09180 9347 8700 gene locus_tag LOCUS_09190 9347 8700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 >Feature sequence077 <1 660 gene locus_tag LOCUS_09200 <1 660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005115945.1:2-dehydropantoate 2-reductase 1075 746 gene locus_tag LOCUS_09210 1075 746 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719341.1 protein_id gnl|my_center|LOCUS_09210 1413 2537 gene locus_tag LOCUS_09220 1413 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 2585 3091 gene locus_tag LOCUS_09230 2585 3091 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390240.1 protein_id gnl|my_center|LOCUS_09230 4133 3141 gene locus_tag LOCUS_09240 4133 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 5621 4518 gene locus_tag LOCUS_09250 5621 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 5870 6655 gene locus_tag LOCUS_09260 gene rlmB 5870 6655 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393958.1 protein_id gnl|my_center|LOCUS_09260 8358 6604 gene locus_tag LOCUS_09270 8358 6604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 <9623 8401 gene locus_tag LOCUS_09280 <9623 8401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877894.1:S-layer glycoprotein N-glycosyltransferase AglJ >Feature sequence078 3443 261 gene locus_tag LOCUS_09290 3443 261 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968692.1 protein_id gnl|my_center|LOCUS_09290 4624 3968 gene locus_tag LOCUS_09300 4624 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 5501 4911 gene locus_tag LOCUS_09310 5501 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 4914 4969 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6636 5506 gene locus_tag LOCUS_09320 6636 5506 CDS product three-Cys-motif partner protein TcmP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142948.1 protein_id gnl|my_center|LOCUS_09320 7922 6633 gene locus_tag LOCUS_09330 7922 6633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 9466 7919 gene locus_tag LOCUS_09340 9466 7919 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968694.1 protein_id gnl|my_center|LOCUS_09340 >Feature sequence079 295 1296 gene locus_tag LOCUS_09350 295 1296 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519041.1 protein_id gnl|my_center|LOCUS_09350 1316 2608 gene locus_tag LOCUS_09360 gene eno 1316 2608 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942923.1 protein_id gnl|my_center|LOCUS_09360 2605 2892 gene locus_tag LOCUS_09370 2605 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 4256 3036 gene locus_tag LOCUS_09380 4256 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 4916 4272 gene locus_tag LOCUS_09390 4916 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 6168 4924 gene locus_tag LOCUS_09400 6168 4924 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815636.1 protein_id gnl|my_center|LOCUS_09400 7282 6287 gene locus_tag LOCUS_09410 7282 6287 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966749.1 protein_id gnl|my_center|LOCUS_09410 8608 7367 gene locus_tag LOCUS_09420 8608 7367 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064343.1 protein_id gnl|my_center|LOCUS_09420 8897 8697 gene locus_tag LOCUS_09430 8897 8697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 9353 8955 gene locus_tag LOCUS_09440 9353 8955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 >Feature sequence080 565 1332 gene locus_tag LOCUS_09450 565 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 1578 2195 gene locus_tag LOCUS_09460 1578 2195 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460642.1 protein_id gnl|my_center|LOCUS_09460 2831 4042 gene locus_tag LOCUS_09470 2831 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 4191 5444 gene locus_tag LOCUS_09480 4191 5444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 6879 5566 gene locus_tag LOCUS_09490 6879 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 7229 8302 gene locus_tag LOCUS_09500 7229 8302 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058160.1 protein_id gnl|my_center|LOCUS_09500 9336 8944 gene locus_tag LOCUS_09510 9336 8944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 >Feature sequence081 4948 83 gene locus_tag LOCUS_09520 4948 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 6093 5419 gene locus_tag LOCUS_09530 6093 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 6375 8084 gene locus_tag LOCUS_09540 6375 8084 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947007.1 protein_id gnl|my_center|LOCUS_09540 8394 8257 gene locus_tag LOCUS_09550 8394 8257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 8851 8510 gene locus_tag LOCUS_09560 8851 8510 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081748.1 protein_id gnl|my_center|LOCUS_09560 >Feature sequence082 <1 1313 gene locus_tag LOCUS_09570 <1 1313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141986.1:penicillin acylase family protein 1327 1548 gene locus_tag LOCUS_09580 1327 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 1629 2828 gene locus_tag LOCUS_09590 gene fldC 1629 2828 CDS product phenyllactyl-CoA dehydratase subunit FldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048236.1 protein_id gnl|my_center|LOCUS_09590 3439 2777 gene locus_tag LOCUS_09600 3439 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 4086 3886 gene locus_tag LOCUS_09610 4086 3886 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_09610 5622 4339 gene locus_tag LOCUS_09620 5622 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 6234 5755 gene locus_tag LOCUS_09630 6234 5755 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270458.1 protein_id gnl|my_center|LOCUS_09630 6486 6250 gene locus_tag LOCUS_09640 6486 6250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09640 7423 6455 gene locus_tag LOCUS_09650 7423 6455 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877713.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09650 8585 7446 gene locus_tag LOCUS_09660 8585 7446 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064172.1 protein_id gnl|my_center|LOCUS_09660 9105 8644 gene locus_tag LOCUS_09670 9105 8644 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270458.1 protein_id gnl|my_center|LOCUS_09670 >Feature sequence083 991 1977 gene locus_tag LOCUS_09680 991 1977 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227260.1 protein_id gnl|my_center|LOCUS_09680 3749 2190 gene locus_tag LOCUS_09690 3749 2190 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083171434.1 protein_id gnl|my_center|LOCUS_09690 4626 5573 gene locus_tag LOCUS_09700 4626 5573 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113106.1 protein_id gnl|my_center|LOCUS_09700 8104 5729 gene locus_tag LOCUS_09710 8104 5729 CDS product formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319769.1 protein_id gnl|my_center|LOCUS_09710 9316 8579 gene locus_tag LOCUS_09720 9316 8579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 >Feature sequence084 <1 722 gene locus_tag LOCUS_09730 <1 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545687.1:4-hydroxy-tetrahydrodipicolinate reductase 2259 874 gene locus_tag LOCUS_09740 2259 874 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_09740 3226 2486 gene locus_tag LOCUS_09750 gene surE 3226 2486 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942170.1 protein_id gnl|my_center|LOCUS_09750 4348 3707 gene locus_tag LOCUS_09760 4348 3707 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404330.1 protein_id gnl|my_center|LOCUS_09760 5939 4719 gene locus_tag LOCUS_09770 5939 4719 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918225.1 protein_id gnl|my_center|LOCUS_09770 6522 7676 gene locus_tag LOCUS_09780 6522 7676 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963323.1 protein_id gnl|my_center|LOCUS_09780 7816 9012 gene locus_tag LOCUS_09790 7816 9012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930997.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence085 2023 1349 gene locus_tag LOCUS_09800 2023 1349 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407700.1 protein_id gnl|my_center|LOCUS_09800 3262 2225 gene locus_tag LOCUS_09810 3262 2225 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942440.1 protein_id gnl|my_center|LOCUS_09810 3889 3272 gene locus_tag LOCUS_09820 3889 3272 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546460.1 protein_id gnl|my_center|LOCUS_09820 4212 3958 gene locus_tag LOCUS_09830 4212 3958 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903557.1 protein_id gnl|my_center|LOCUS_09830 4991 4209 gene locus_tag LOCUS_09840 4991 4209 CDS product GPMC system MBL fold metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943103.1 protein_id gnl|my_center|LOCUS_09840 5239 5637 gene locus_tag LOCUS_09850 5239 5637 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941778.1 protein_id gnl|my_center|LOCUS_09850 6303 5644 gene locus_tag LOCUS_09860 6303 5644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 7141 6296 gene locus_tag LOCUS_09870 7141 6296 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176621.1 protein_id gnl|my_center|LOCUS_09870 7321 8760 gene locus_tag LOCUS_09880 7321 8760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 >Feature sequence086 72 1145 gene locus_tag LOCUS_09890 72 1145 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393601.1 protein_id gnl|my_center|LOCUS_09890 1340 2926 gene locus_tag LOCUS_09900 1340 2926 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248486.1 protein_id gnl|my_center|LOCUS_09900 3091 4335 gene locus_tag LOCUS_09910 3091 4335 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256266.1 protein_id gnl|my_center|LOCUS_09910 4548 4988 gene locus_tag LOCUS_09920 4548 4988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 5238 5014 gene locus_tag LOCUS_09930 5238 5014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 6174 5638 gene locus_tag LOCUS_09940 6174 5638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 6784 6590 gene locus_tag LOCUS_09950 6784 6590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 6891 7313 gene locus_tag LOCUS_09960 6891 7313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 7411 8235 gene locus_tag LOCUS_09970 7411 8235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 8310 8903 gene locus_tag LOCUS_09980 8310 8903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 >Feature sequence087 165 3269 gene locus_tag LOCUS_09990 165 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 3531 4847 gene locus_tag LOCUS_10000 3531 4847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 4901 5584 gene locus_tag LOCUS_10010 4901 5584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10010 5517 5975 gene locus_tag LOCUS_10020 5517 5975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10020 5985 6707 gene locus_tag LOCUS_10030 5985 6707 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_10030 6713 7102 gene locus_tag LOCUS_10040 6713 7102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 7811 8212 gene locus_tag LOCUS_10050 7811 8212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 8965 8426 gene locus_tag LOCUS_10060 8965 8426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 >Feature sequence088 412 1974 gene locus_tag LOCUS_10070 412 1974 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225878.1 protein_id gnl|my_center|LOCUS_10070 1553 1584 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2475 3278 gene locus_tag LOCUS_10080 2475 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 3822 3508 gene locus_tag LOCUS_10090 3822 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 3842 4588 gene locus_tag LOCUS_10100 3842 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 4617 4928 gene locus_tag LOCUS_10110 4617 4928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 5512 4946 gene locus_tag LOCUS_10120 5512 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 5527 5754 gene locus_tag LOCUS_10130 5527 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 5847 6782 gene locus_tag LOCUS_10140 5847 6782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 6784 7635 gene locus_tag LOCUS_10150 6784 7635 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888715.1 protein_id gnl|my_center|LOCUS_10150 7723 8232 gene locus_tag LOCUS_10160 7723 8232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 8833 8327 gene locus_tag LOCUS_10170 gene rimI 8833 8327 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393645.1 protein_id gnl|my_center|LOCUS_10170 >Feature sequence089 <1 895 gene locus_tag LOCUS_10180 <1 895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963509.1:DUF1343 domain-containing protein 1157 2005 gene locus_tag LOCUS_10190 1157 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1986 2348 gene locus_tag LOCUS_10200 1986 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 2444 3577 gene locus_tag LOCUS_10210 gene anmK 2444 3577 CDS product anhydro-N-acetylmuramic acid kinase AnmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276045.1 protein_id gnl|my_center|LOCUS_10210 3825 5981 gene locus_tag LOCUS_10220 3825 5981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 7565 6051 gene locus_tag LOCUS_10230 7565 6051 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086603.1 protein_id gnl|my_center|LOCUS_10230 8018 7922 gene locus_tag LOCUS_t00070 8018 7922 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 8315 8779 gene locus_tag LOCUS_10240 8315 8779 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393390.1 protein_id gnl|my_center|LOCUS_10240 >Feature sequence090 <1 1550 gene locus_tag LOCUS_10250 <1 1550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460322.1:alanine--tRNA ligase 1715 2146 gene locus_tag LOCUS_10260 gene ruvX 1715 2146 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428279.1 protein_id gnl|my_center|LOCUS_10260 2309 3403 gene locus_tag LOCUS_10270 gene mltG 2309 3403 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545006.1 protein_id gnl|my_center|LOCUS_10270 3390 4622 gene locus_tag LOCUS_10280 3390 4622 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943192.1 protein_id gnl|my_center|LOCUS_10280 5952 4948 gene locus_tag LOCUS_10290 5952 4948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 7413 6100 gene locus_tag LOCUS_10300 gene mtgB 7413 6100 CDS product glycine betaine--corrinoid protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816521.1 protein_id gnl|my_center|LOCUS_10300 >Feature sequence091 2166 328 gene locus_tag LOCUS_10310 2166 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 2439 3359 gene locus_tag LOCUS_10320 2439 3359 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582519.1 protein_id gnl|my_center|LOCUS_10320 3927 3610 gene locus_tag LOCUS_10330 3927 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 5341 4142 gene locus_tag LOCUS_10340 5341 4142 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082509.1 protein_id gnl|my_center|LOCUS_10340 7332 5767 gene locus_tag LOCUS_10350 7332 5767 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045022.1 protein_id gnl|my_center|LOCUS_10350 8622 7933 gene locus_tag LOCUS_10360 8622 7933 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966771.1 protein_id gnl|my_center|LOCUS_10360 >Feature sequence092 2065 824 gene locus_tag LOCUS_10370 2065 824 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_10370 2702 2154 gene locus_tag LOCUS_10380 2702 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 3860 3168 gene locus_tag LOCUS_10390 3860 3168 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_10390 5150 4005 gene locus_tag LOCUS_10400 5150 4005 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941163.1 protein_id gnl|my_center|LOCUS_10400 5890 5219 gene locus_tag LOCUS_10410 gene thiE 5890 5219 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256280.1 protein_id gnl|my_center|LOCUS_10410 6238 5939 gene locus_tag LOCUS_10420 6238 5939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 7079 7399 gene locus_tag LOCUS_10430 7079 7399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 7706 8719 gene locus_tag LOCUS_10440 7706 8719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 >Feature sequence093 135 422 gene locus_tag LOCUS_10450 135 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 2224 893 gene locus_tag LOCUS_10460 2224 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 2638 3858 gene locus_tag LOCUS_10470 gene gspF 2638 3858 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940995.1 protein_id gnl|my_center|LOCUS_10470 3866 4951 gene locus_tag LOCUS_10480 3866 4951 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888498.1 protein_id gnl|my_center|LOCUS_10480 4961 6496 gene locus_tag LOCUS_10490 4961 6496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 6500 6904 gene locus_tag LOCUS_10500 6500 6904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 7008 6796 gene locus_tag LOCUS_10510 7008 6796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 7156 7431 gene locus_tag LOCUS_10520 7156 7431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 7619 8068 gene locus_tag LOCUS_10530 7619 8068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 8915 8115 gene locus_tag LOCUS_10540 8915 8115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 >Feature sequence094 594 1205 gene locus_tag LOCUS_10550 594 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 1363 1518 gene locus_tag LOCUS_10560 1363 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1588 1986 gene locus_tag LOCUS_10570 1588 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 2259 2903 gene locus_tag LOCUS_10580 2259 2903 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990695.1 protein_id gnl|my_center|LOCUS_10580 3077 3235 gene locus_tag LOCUS_10590 3077 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 4417 3263 gene locus_tag LOCUS_10600 4417 3263 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 protein_id gnl|my_center|LOCUS_10600 5353 4487 gene locus_tag LOCUS_10610 5353 4487 CDS product DUF6282 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877507.1 protein_id gnl|my_center|LOCUS_10610 5681 5469 gene locus_tag LOCUS_10620 5681 5469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 6959 5685 gene locus_tag LOCUS_10630 6959 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 7280 6996 gene locus_tag LOCUS_10640 7280 6996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 8112 7543 gene locus_tag LOCUS_10650 8112 7543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 8011 8289 gene locus_tag LOCUS_10660 8011 8289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 8819 8175 gene locus_tag LOCUS_10670 8819 8175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 >Feature sequence095 1000 2130 gene locus_tag LOCUS_10680 1000 2130 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869500.1 protein_id gnl|my_center|LOCUS_10680 2285 2866 gene locus_tag LOCUS_10690 2285 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 2996 3403 gene locus_tag LOCUS_10700 2996 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 3360 4094 gene locus_tag LOCUS_10710 3360 4094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 4363 4145 gene locus_tag LOCUS_10720 4363 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 5788 4601 gene locus_tag LOCUS_10730 5788 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 6693 6058 gene locus_tag LOCUS_10740 6693 6058 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920198.1 protein_id gnl|my_center|LOCUS_10740 7414 7145 gene locus_tag LOCUS_10750 7414 7145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 7593 8264 gene locus_tag LOCUS_10760 7593 8264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 8389 8847 gene locus_tag LOCUS_10770 8389 8847 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481688.1 protein_id gnl|my_center|LOCUS_10770 >Feature sequence096 206 739 gene locus_tag LOCUS_10780 206 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 3748 1022 gene locus_tag LOCUS_10790 3748 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 4200 3751 gene locus_tag LOCUS_10800 gene dtd 4200 3751 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583334.1 protein_id gnl|my_center|LOCUS_10800 6535 4331 gene locus_tag LOCUS_10810 6535 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 7121 6456 gene locus_tag LOCUS_10820 7121 6456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 7816 7313 gene locus_tag LOCUS_10830 7816 7313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 8749 8012 gene locus_tag LOCUS_10840 8749 8012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 >Feature sequence097 1433 600 gene locus_tag LOCUS_10850 1433 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 3796 1448 gene locus_tag LOCUS_10860 3796 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 3211 3289 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5376 3901 gene locus_tag LOCUS_10870 5376 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 5605 5360 gene locus_tag LOCUS_10880 5605 5360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 8027 5733 gene locus_tag LOCUS_10890 8027 5733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 <8851 8287 gene locus_tag LOCUS_10900 <8851 8287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392105.1:leucine--tRNA ligase >Feature sequence098 1068 658 gene locus_tag LOCUS_10910 1068 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 1535 1185 gene locus_tag LOCUS_10920 1535 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 3122 1761 gene locus_tag LOCUS_10930 3122 1761 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880700.1 protein_id gnl|my_center|LOCUS_10930 8736 3115 gene locus_tag LOCUS_10940 8736 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 >Feature sequence099 938 964 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1003 2658 gene locus_tag LOCUS_10950 1003 2658 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877513.1 protein_id gnl|my_center|LOCUS_10950 2858 3736 gene locus_tag LOCUS_10960 2858 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 3733 5001 gene locus_tag LOCUS_10970 3733 5001 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121756.1 protein_id gnl|my_center|LOCUS_10970 5104 5319 gene locus_tag LOCUS_10980 5104 5319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 6367 5387 gene locus_tag LOCUS_10990 6367 5387 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393452.1 protein_id gnl|my_center|LOCUS_10990 6753 7523 gene locus_tag LOCUS_11000 6753 7523 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392230.1 protein_id gnl|my_center|LOCUS_11000 >Feature sequence100 <1 671 gene locus_tag LOCUS_11010 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037396808.1:NADH-quinone oxidoreductase subunit NuoF 693 2303 gene locus_tag LOCUS_11020 693 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 2318 3352 gene locus_tag LOCUS_11030 gene nuoH 2318 3352 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941013.1 protein_id gnl|my_center|LOCUS_11030 3369 3896 gene locus_tag LOCUS_11040 3369 3896 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964313.1 protein_id gnl|my_center|LOCUS_11040 3887 4543 gene locus_tag LOCUS_11050 3887 4543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 4546 4848 gene locus_tag LOCUS_11060 gene nuoK 4546 4848 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480224.1 protein_id gnl|my_center|LOCUS_11060 4845 6350 gene locus_tag LOCUS_11070 4845 6350 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_11070 6376 7113 gene locus_tag LOCUS_11080 6376 7113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 7860 7150 gene locus_tag LOCUS_11090 7860 7150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 8364 7873 gene locus_tag LOCUS_11100 8364 7873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 >Feature sequence101 <1 764 gene locus_tag LOCUS_11110 <1 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392489.1:sensor histidine kinase 1284 1985 gene locus_tag LOCUS_11120 1284 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11120 2186 2443 gene locus_tag LOCUS_11130 2186 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 2524 3018 gene locus_tag LOCUS_11140 2524 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 3120 3305 gene locus_tag LOCUS_11150 3120 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 4732 3395 gene locus_tag LOCUS_11160 gene thrC 4732 3395 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257816.1 protein_id gnl|my_center|LOCUS_11160 5935 4859 gene locus_tag LOCUS_11170 5935 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 6201 7319 gene locus_tag LOCUS_11180 6201 7319 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403266.1 protein_id gnl|my_center|LOCUS_11180 7702 8505 gene locus_tag LOCUS_11190 7702 8505 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872130.1 protein_id gnl|my_center|LOCUS_11190 >Feature sequence102 795 520 gene locus_tag LOCUS_11200 795 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 1054 785 gene locus_tag LOCUS_11210 1054 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 1757 1278 gene locus_tag LOCUS_11220 1757 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 2940 1957 gene locus_tag LOCUS_11230 2940 1957 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228623.1 protein_id gnl|my_center|LOCUS_11230 3558 3214 gene locus_tag LOCUS_11240 3558 3214 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021317.1 protein_id gnl|my_center|LOCUS_11240 4018 3797 gene locus_tag LOCUS_11250 4018 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 4381 4163 gene locus_tag LOCUS_11260 4381 4163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11260 4530 4306 gene locus_tag LOCUS_11270 4530 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11270 4390 4408 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4761 4534 gene locus_tag LOCUS_11280 4761 4534 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932024.1 protein_id gnl|my_center|LOCUS_11280 5269 6423 gene locus_tag LOCUS_11290 5269 6423 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410070.1 protein_id gnl|my_center|LOCUS_11290 6677 6889 gene locus_tag LOCUS_11300 6677 6889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 7395 6949 gene locus_tag LOCUS_11310 7395 6949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 <8664 7456 gene locus_tag LOCUS_11320 <8664 7456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257221.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence103 <1 1286 gene locus_tag LOCUS_11330 <1 1286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_080510933.1:formate dehydrogenase subunit alpha 2486 1599 gene locus_tag LOCUS_11340 2486 1599 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890781.1 protein_id gnl|my_center|LOCUS_11340 2761 3516 gene locus_tag LOCUS_11350 2761 3516 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002145819.1 protein_id gnl|my_center|LOCUS_11350 3757 4185 gene locus_tag LOCUS_11360 3757 4185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 4712 4503 gene locus_tag LOCUS_11370 4712 4503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 4593 4871 gene locus_tag LOCUS_11380 4593 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 5620 4973 gene locus_tag LOCUS_11390 5620 4973 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542407.1 protein_id gnl|my_center|LOCUS_11390 6520 5681 gene locus_tag LOCUS_11400 6520 5681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 7911 6529 gene locus_tag LOCUS_11410 7911 6529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 >Feature sequence104 1030 809 gene locus_tag LOCUS_11420 1030 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1472 3547 gene locus_tag LOCUS_11430 1472 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 4017 4346 gene locus_tag LOCUS_11440 4017 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 4373 5764 gene locus_tag LOCUS_11450 4373 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 6033 7538 gene locus_tag LOCUS_11460 6033 7538 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640376.1 protein_id gnl|my_center|LOCUS_11460 >Feature sequence105 960 313 gene locus_tag LOCUS_11470 960 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 1738 1812 gene locus_tag LOCUS_t00080 1738 1812 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1887 1963 gene locus_tag LOCUS_t00090 1887 1963 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 3340 2078 gene locus_tag LOCUS_11480 3340 2078 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810537.1 protein_id gnl|my_center|LOCUS_11480 5030 3984 gene locus_tag LOCUS_11490 gene add 5030 3984 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228060.1 protein_id gnl|my_center|LOCUS_11490 5286 6431 gene locus_tag LOCUS_11500 gene wecB 5286 6431 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966158.1 protein_id gnl|my_center|LOCUS_11500 6683 7312 gene locus_tag LOCUS_11510 6683 7312 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272276.1 protein_id gnl|my_center|LOCUS_11510 7909 7505 gene locus_tag LOCUS_11520 gene fosX 7909 7505 CDS product FosX/FosE/FosI family fosfomycin resistance hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529521.1 protein_id gnl|my_center|LOCUS_11520 >Feature sequence106 987 133 gene locus_tag LOCUS_11530 987 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 1710 1267 gene locus_tag LOCUS_11540 1710 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 2598 2050 gene locus_tag LOCUS_11550 2598 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 4435 2990 gene locus_tag LOCUS_11560 4435 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 5576 7507 gene locus_tag LOCUS_11570 5576 7507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence107 1107 238 gene locus_tag LOCUS_11580 1107 238 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_11580 1827 1195 gene locus_tag LOCUS_11590 1827 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 2920 1943 gene locus_tag LOCUS_11600 2920 1943 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989909.1 protein_id gnl|my_center|LOCUS_11600 3675 3022 gene locus_tag LOCUS_11610 3675 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11610 4184 3597 gene locus_tag LOCUS_11620 4184 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11620 3703 3709 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4928 4197 gene locus_tag LOCUS_11630 gene nagB 4928 4197 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868991.1 protein_id gnl|my_center|LOCUS_11630 5877 5137 gene locus_tag LOCUS_11640 5877 5137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 6496 6080 gene locus_tag LOCUS_11650 6496 6080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11650 7243 6557 gene locus_tag LOCUS_11660 7243 6557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11660 >Feature sequence108 509 886 gene locus_tag LOCUS_11670 509 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 1005 1328 gene locus_tag LOCUS_11680 1005 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 1563 2060 gene locus_tag LOCUS_11690 1563 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 2636 2430 gene locus_tag LOCUS_11700 2636 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 2819 3049 gene locus_tag LOCUS_11710 2819 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 4592 3432 gene locus_tag LOCUS_11720 4592 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 4769 5662 gene locus_tag LOCUS_11730 4769 5662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 <8551 5722 gene locus_tag LOCUS_11740 <8551 5722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_084830245.1:glycoside hydrolase family 2 TIM barrel-domain containing protein >Feature sequence109 4279 1127 gene locus_tag LOCUS_11750 gene dnaE 4279 1127 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_11750 5086 4607 gene locus_tag LOCUS_11760 5086 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 5771 5295 gene locus_tag LOCUS_11770 5771 5295 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870384.1 protein_id gnl|my_center|LOCUS_11770 6481 5858 gene locus_tag LOCUS_11780 gene pgsA 6481 5858 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965120.1 protein_id gnl|my_center|LOCUS_11780 7797 6478 gene locus_tag LOCUS_11790 gene rimO 7797 6478 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_11790 <8544 8042 gene locus_tag LOCUS_11800 <8544 8042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001118781.1:DNA translocase FtsK >Feature sequence110 1498 1043 gene locus_tag LOCUS_11810 1498 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 2025 1495 gene locus_tag LOCUS_11820 2025 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 2893 2336 gene locus_tag LOCUS_11830 2893 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 4295 2883 gene locus_tag LOCUS_11840 4295 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 6388 4292 gene locus_tag LOCUS_11850 6388 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11850 7585 6410 gene locus_tag LOCUS_11860 7585 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11860 >Feature sequence111 477 1046 gene locus_tag LOCUS_11870 477 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 1083 3239 gene locus_tag LOCUS_11880 1083 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 4081 3266 gene locus_tag LOCUS_11890 4081 3266 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036621.1 protein_id gnl|my_center|LOCUS_11890 6205 4595 gene locus_tag LOCUS_11900 6205 4595 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838626.1 protein_id gnl|my_center|LOCUS_11900 8066 6336 gene locus_tag LOCUS_11910 8066 6336 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879525.1 protein_id gnl|my_center|LOCUS_11910 >Feature sequence112 214 561 gene locus_tag LOCUS_11920 214 561 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_11920 1799 666 gene locus_tag LOCUS_11930 1799 666 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122967.1 protein_id gnl|my_center|LOCUS_11930 2655 1780 gene locus_tag LOCUS_11940 2655 1780 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940917.1 protein_id gnl|my_center|LOCUS_11940 2992 2648 gene locus_tag LOCUS_11950 2992 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 3455 3042 gene locus_tag LOCUS_11960 3455 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11960 4810 3713 gene locus_tag LOCUS_11970 4810 3713 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582516.1 protein_id gnl|my_center|LOCUS_11970 5444 4983 gene locus_tag LOCUS_11980 5444 4983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 6113 5490 gene locus_tag LOCUS_11990 6113 5490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 7881 6136 gene locus_tag LOCUS_12000 7881 6136 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123836.1 protein_id gnl|my_center|LOCUS_12000 <8511 7995 gene locus_tag LOCUS_12010 <8511 7995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584072.1:radical SAM protein >Feature sequence113 239 490 gene locus_tag LOCUS_12020 239 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12020 554 2371 gene locus_tag LOCUS_12030 554 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 3058 4740 gene locus_tag LOCUS_12040 3058 4740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 4765 5766 gene locus_tag LOCUS_12050 4765 5766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 6074 6129 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6179 6373 gene locus_tag LOCUS_12060 6179 6373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 >Feature sequence114 3172 824 gene locus_tag LOCUS_12070 3172 824 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015337756.1 protein_id gnl|my_center|LOCUS_12070 4665 3169 gene locus_tag LOCUS_12080 4665 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 5315 4689 gene locus_tag LOCUS_12090 5315 4689 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256744.1 protein_id gnl|my_center|LOCUS_12090 6828 5296 gene locus_tag LOCUS_12100 6828 5296 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660540.1 protein_id gnl|my_center|LOCUS_12100 7301 6825 gene locus_tag LOCUS_12110 7301 6825 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392262.1 protein_id gnl|my_center|LOCUS_12110 7759 8184 gene locus_tag LOCUS_12120 7759 8184 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048129.1 protein_id gnl|my_center|LOCUS_12120 >Feature sequence115 620 2683 gene locus_tag LOCUS_12130 620 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 2732 2941 gene locus_tag LOCUS_12140 2732 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 2942 3877 gene locus_tag LOCUS_12150 2942 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 3874 4338 gene locus_tag LOCUS_12160 3874 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 4586 4416 gene locus_tag LOCUS_12170 4586 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 5438 4641 gene locus_tag LOCUS_12180 gene fabG 5438 4641 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807992.1 protein_id gnl|my_center|LOCUS_12180 6061 5690 gene locus_tag LOCUS_12190 6061 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 6638 6471 gene locus_tag LOCUS_12200 6638 6471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 7337 6729 gene locus_tag LOCUS_12210 7337 6729 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530512.1 protein_id gnl|my_center|LOCUS_12210 7744 7914 gene locus_tag LOCUS_12220 7744 7914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 8263 7985 gene locus_tag LOCUS_12230 8263 7985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 >Feature sequence116 664 86 gene locus_tag LOCUS_12240 664 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 1383 1619 gene locus_tag LOCUS_12250 1383 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 2128 2180 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2204 3031 gene locus_tag LOCUS_12260 2204 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12260 3232 3924 gene locus_tag LOCUS_12270 3232 3924 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398978.1 protein_id gnl|my_center|LOCUS_12270 4190 5032 gene locus_tag LOCUS_12280 gene dapF 4190 5032 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_12280 5210 6313 gene locus_tag LOCUS_12290 5210 6313 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062349.1 protein_id gnl|my_center|LOCUS_12290 6315 6863 gene locus_tag LOCUS_12300 6315 6863 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632567.1 protein_id gnl|my_center|LOCUS_12300 7101 7814 gene locus_tag LOCUS_12310 7101 7814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 >Feature sequence117 <1 759 gene locus_tag LOCUS_12320 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052270463.1:glycosyltransferase 811 1662 gene locus_tag LOCUS_12330 811 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 1656 1898 gene locus_tag LOCUS_12340 1656 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 2260 2913 gene locus_tag LOCUS_12350 2260 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 3351 6269 gene locus_tag LOCUS_12360 3351 6269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 6428 6276 gene locus_tag LOCUS_12370 6428 6276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 6456 6565 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence118 2117 834 gene locus_tag LOCUS_12380 2117 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 3597 2572 gene locus_tag LOCUS_12390 gene amrS 3597 2572 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867880.1 protein_id gnl|my_center|LOCUS_12390 4904 3927 gene locus_tag LOCUS_12400 4904 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 5314 5691 gene locus_tag LOCUS_12410 gene nifU 5314 5691 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_12410 5954 6757 gene locus_tag LOCUS_12420 5954 6757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 6759 7349 gene locus_tag LOCUS_12430 6759 7349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 7403 7870 gene locus_tag LOCUS_12440 7403 7870 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546571.1 protein_id gnl|my_center|LOCUS_12440 >Feature sequence119 <1 1623 gene locus_tag LOCUS_12450 <1 1623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393980.1:selenocysteine-specific translation elongation factor 1834 2298 gene locus_tag LOCUS_12460 1834 2298 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940875.1 protein_id gnl|my_center|LOCUS_12460 2295 4463 gene locus_tag LOCUS_12470 2295 4463 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940876.1 protein_id gnl|my_center|LOCUS_12470 4568 5341 gene locus_tag LOCUS_12480 4568 5341 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940877.1 protein_id gnl|my_center|LOCUS_12480 5498 5854 gene locus_tag LOCUS_12490 5498 5854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 7318 6014 gene locus_tag LOCUS_12500 7318 6014 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192988.1 protein_id gnl|my_center|LOCUS_12500 8305 7487 gene locus_tag LOCUS_12510 8305 7487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 >Feature sequence120 1582 383 gene locus_tag LOCUS_12520 1582 383 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921453.1 protein_id gnl|my_center|LOCUS_12520 1970 2179 gene locus_tag LOCUS_12530 1970 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 2552 3301 gene locus_tag LOCUS_12540 2552 3301 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804112.1 protein_id gnl|my_center|LOCUS_12540 3434 4312 gene locus_tag LOCUS_12550 3434 4312 CDS product 4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090280.1 protein_id gnl|my_center|LOCUS_12550 4578 6182 gene locus_tag LOCUS_12560 4578 6182 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259624.1 protein_id gnl|my_center|LOCUS_12560 6244 7488 gene locus_tag LOCUS_12570 6244 7488 CDS product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879450.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence121 1965 1069 gene locus_tag LOCUS_12580 1965 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 3652 2225 gene locus_tag LOCUS_12590 3652 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12590 4131 3667 gene locus_tag LOCUS_12600 4131 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12600 5329 4385 gene locus_tag LOCUS_12610 5329 4385 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_12610 5540 5253 gene locus_tag LOCUS_12620 5540 5253 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093283.1 protein_id gnl|my_center|LOCUS_12620 6906 5521 gene locus_tag LOCUS_12630 gene xseA 6906 5521 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_12630 7632 7120 gene locus_tag LOCUS_12640 7632 7120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 <8329 7719 gene locus_tag LOCUS_12650 <8329 7719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024311533.1:ankyrin repeat domain-containing protein >Feature sequence122 1090 2130 gene locus_tag LOCUS_12660 1090 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 2455 2231 gene locus_tag LOCUS_12670 2455 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 3159 2341 gene locus_tag LOCUS_12680 3159 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 3953 3591 gene locus_tag LOCUS_12690 3953 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 5363 4029 gene locus_tag LOCUS_12700 5363 4029 CDS product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930692.1 protein_id gnl|my_center|LOCUS_12700 5754 6422 gene locus_tag LOCUS_12710 5754 6422 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545889.1 protein_id gnl|my_center|LOCUS_12710 6634 7302 gene locus_tag LOCUS_12720 6634 7302 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256060.1 protein_id gnl|my_center|LOCUS_12720 7875 7414 gene locus_tag LOCUS_12730 7875 7414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 >Feature sequence123 194 637 gene locus_tag LOCUS_12740 194 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 1996 1235 gene locus_tag LOCUS_12750 1996 1235 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878702.1 protein_id gnl|my_center|LOCUS_12750 2658 2119 gene locus_tag LOCUS_12760 2658 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 3088 2567 gene locus_tag LOCUS_12770 3088 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 4494 3490 gene locus_tag LOCUS_12780 4494 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 4802 4500 gene locus_tag LOCUS_12790 4802 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 6314 5571 gene locus_tag LOCUS_12800 6314 5571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 7026 6505 gene locus_tag LOCUS_12810 7026 6505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 7841 7077 gene locus_tag LOCUS_12820 7841 7077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 >Feature sequence124 1822 3867 gene locus_tag LOCUS_12830 1822 3867 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083732.1 protein_id gnl|my_center|LOCUS_12830 4006 4848 gene locus_tag LOCUS_12840 4006 4848 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967075.1 protein_id gnl|my_center|LOCUS_12840 5174 6853 gene locus_tag LOCUS_12850 5174 6853 CDS product fumarate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061070.1 protein_id gnl|my_center|LOCUS_12850 6850 7536 gene locus_tag LOCUS_12860 6850 7536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 8121 7591 gene locus_tag LOCUS_12870 8121 7591 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941409.1 protein_id gnl|my_center|LOCUS_12870 >Feature sequence125 1660 1223 gene locus_tag LOCUS_12880 gene ybeY 1660 1223 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942921.1 protein_id gnl|my_center|LOCUS_12880 2066 1590 gene locus_tag LOCUS_12890 2066 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 2752 2063 gene locus_tag LOCUS_12900 2752 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12900 3717 2812 gene locus_tag LOCUS_12910 3717 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 4730 3726 gene locus_tag LOCUS_12920 4730 3726 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392130.1 protein_id gnl|my_center|LOCUS_12920 5019 4732 gene locus_tag LOCUS_12930 5019 4732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 5243 5686 gene locus_tag LOCUS_12940 5243 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 5744 6685 gene locus_tag LOCUS_12950 5744 6685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 6803 7753 gene locus_tag LOCUS_12960 6803 7753 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434938.1 protein_id gnl|my_center|LOCUS_12960 >Feature sequence126 3 1388 gene locus_tag LOCUS_12970 3 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 1385 1852 gene locus_tag LOCUS_12980 1385 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 1907 3463 gene locus_tag LOCUS_12990 1907 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 4139 5659 gene locus_tag LOCUS_13000 4139 5659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 >Feature sequence127 779 2743 gene locus_tag LOCUS_13010 779 2743 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730383.1 protein_id gnl|my_center|LOCUS_13010 2846 3688 gene locus_tag LOCUS_13020 2846 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 3681 5192 gene locus_tag LOCUS_13030 3681 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 5287 6444 gene locus_tag LOCUS_13040 gene waaF 5287 6444 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_13040 6441 7397 gene locus_tag LOCUS_13050 6441 7397 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 protein_id gnl|my_center|LOCUS_13050 >Feature sequence128 2651 2268 gene locus_tag LOCUS_13060 2651 2268 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227979.1 protein_id gnl|my_center|LOCUS_13060 2976 2656 gene locus_tag LOCUS_13070 2976 2656 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403362.1 protein_id gnl|my_center|LOCUS_13070 3912 3565 gene locus_tag LOCUS_13080 3912 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 4208 3960 gene locus_tag LOCUS_13090 4208 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 4455 4195 gene locus_tag LOCUS_13100 4455 4195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 5160 4627 gene locus_tag LOCUS_13110 5160 4627 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978004.1 protein_id gnl|my_center|LOCUS_13110 5766 5350 gene locus_tag LOCUS_13120 5766 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 7124 5787 gene locus_tag LOCUS_13130 gene orpR 7124 5787 CDS product sigma 54-interacting transcriptional regulator OrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939383.1 protein_id gnl|my_center|LOCUS_13130 >Feature sequence129 3263 1812 gene locus_tag LOCUS_13140 3263 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 4779 3460 gene locus_tag LOCUS_13150 4779 3460 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942374.1 protein_id gnl|my_center|LOCUS_13150 5642 4908 gene locus_tag LOCUS_13160 5642 4908 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942375.1 protein_id gnl|my_center|LOCUS_13160 6204 5620 gene locus_tag LOCUS_13170 6204 5620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 7281 6265 gene locus_tag LOCUS_13180 7281 6265 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942377.1 protein_id gnl|my_center|LOCUS_13180 6450 6527 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <8191 7552 gene locus_tag LOCUS_13190 <8191 7552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942378.1:branched-chain amino acid ABC transporter permease >Feature sequence130 1482 832 gene locus_tag LOCUS_13200 1482 832 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_13200 1555 1621 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2268 1741 gene locus_tag LOCUS_13210 2268 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 3039 2296 gene locus_tag LOCUS_13220 3039 2296 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259513.1 protein_id gnl|my_center|LOCUS_13220 3196 4179 gene locus_tag LOCUS_13230 gene eutC 3196 4179 CDS product ectoine utilization protein EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974132.1 protein_id gnl|my_center|LOCUS_13230 4226 4654 gene locus_tag LOCUS_13240 4226 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 6069 4783 gene locus_tag LOCUS_13250 6069 4783 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259422.1 protein_id gnl|my_center|LOCUS_13250 6771 6166 gene locus_tag LOCUS_13260 6771 6166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 7149 6826 gene locus_tag LOCUS_13270 7149 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 7775 7389 gene locus_tag LOCUS_13280 7775 7389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 >Feature sequence131 277 582 gene locus_tag LOCUS_13290 277 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 620 3673 gene locus_tag LOCUS_13300 620 3673 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081461260.1 protein_id gnl|my_center|LOCUS_13300 3660 5666 gene locus_tag LOCUS_13310 3660 5666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 >Feature sequence132 1184 3085 gene locus_tag LOCUS_13320 1184 3085 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085656.1 protein_id gnl|my_center|LOCUS_13320 3195 3440 gene locus_tag LOCUS_13330 3195 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 4421 3426 gene locus_tag LOCUS_13340 4421 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 4443 4634 gene locus_tag LOCUS_13350 4443 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 4807 5211 gene locus_tag LOCUS_13360 4807 5211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 5677 5468 gene locus_tag LOCUS_13370 5677 5468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 6065 7321 gene locus_tag LOCUS_13380 6065 7321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 >Feature sequence133 650 1252 gene locus_tag LOCUS_13390 650 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 1476 1640 gene locus_tag LOCUS_13400 1476 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1627 2085 gene locus_tag LOCUS_13410 1627 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 2654 2484 gene locus_tag LOCUS_13420 2654 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 2769 3857 gene locus_tag LOCUS_13430 2769 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 3976 4986 gene locus_tag LOCUS_13440 3976 4986 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546515.1 protein_id gnl|my_center|LOCUS_13440 4999 6156 gene locus_tag LOCUS_13450 4999 6156 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403060.1 protein_id gnl|my_center|LOCUS_13450 6156 7262 gene locus_tag LOCUS_13460 6156 7262 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546515.1 protein_id gnl|my_center|LOCUS_13460 >Feature sequence134 294 632 gene locus_tag LOCUS_13470 294 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 867 3743 gene locus_tag LOCUS_13480 867 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 2036 2053 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4787 4002 gene locus_tag LOCUS_13490 4787 4002 CDS product L-iditol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240170.1 protein_id gnl|my_center|LOCUS_13490 >Feature sequence135 289 1398 gene locus_tag LOCUS_13500 gene dprA 289 1398 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259053.1 protein_id gnl|my_center|LOCUS_13500 1457 2506 gene locus_tag LOCUS_13510 gene lpxK 1457 2506 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626176.1 protein_id gnl|my_center|LOCUS_13510 3105 2518 gene locus_tag LOCUS_13520 3105 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 3197 3427 gene locus_tag LOCUS_13530 3197 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 4049 3783 gene locus_tag LOCUS_13540 4049 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 5776 4373 gene locus_tag LOCUS_13550 5776 4373 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546190.1 protein_id gnl|my_center|LOCUS_13550 >Feature sequence136 441 1280 gene locus_tag LOCUS_13560 441 1280 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811924.1 protein_id gnl|my_center|LOCUS_13560 1803 1303 gene locus_tag LOCUS_13570 1803 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 3444 2002 gene locus_tag LOCUS_13580 3444 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 3638 4216 gene locus_tag LOCUS_13590 3638 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 4262 6301 gene locus_tag LOCUS_13600 gene feoB 4262 6301 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045027.1 protein_id gnl|my_center|LOCUS_13600 6533 6733 gene locus_tag LOCUS_13610 6533 6733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 6739 7407 gene locus_tag LOCUS_13620 6739 7407 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274356.1 protein_id gnl|my_center|LOCUS_13620 >Feature sequence137 989 519 gene locus_tag LOCUS_13630 989 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13630 1805 1038 gene locus_tag LOCUS_13640 1805 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13640 3422 1845 gene locus_tag LOCUS_13650 gene purH 3422 1845 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941271.1 protein_id gnl|my_center|LOCUS_13650 4298 3483 gene locus_tag LOCUS_13660 4298 3483 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922163.1 protein_id gnl|my_center|LOCUS_13660 7380 4291 gene locus_tag LOCUS_13670 7380 4291 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942279.1 protein_id gnl|my_center|LOCUS_13670 <7909 7377 gene locus_tag LOCUS_13680 <7909 7377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010081095.1:phosphoribosylformylglycinamidine cyclo-ligase >Feature sequence138 224 1534 gene locus_tag LOCUS_13690 224 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 1671 2891 gene locus_tag LOCUS_13700 1671 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 3333 4157 gene locus_tag LOCUS_13710 3333 4157 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454499.1 protein_id gnl|my_center|LOCUS_13710 4313 4597 gene locus_tag LOCUS_13720 4313 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 5815 4724 gene locus_tag LOCUS_13730 5815 4724 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006523900.1 protein_id gnl|my_center|LOCUS_13730 6659 5895 gene locus_tag LOCUS_13740 6659 5895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 7551 6664 gene locus_tag LOCUS_13750 7551 6664 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_13750 >Feature sequence139 1320 1162 gene locus_tag LOCUS_13760 1320 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 2889 1345 gene locus_tag LOCUS_13770 2889 1345 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392962.1 protein_id gnl|my_center|LOCUS_13770 3796 3032 gene locus_tag LOCUS_13780 3796 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 4373 3810 gene locus_tag LOCUS_13790 4373 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 4977 4666 gene locus_tag LOCUS_13800 4977 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13800 6180 5398 gene locus_tag LOCUS_13810 6180 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 6619 7509 gene locus_tag LOCUS_13820 6619 7509 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869527.1 protein_id gnl|my_center|LOCUS_13820 >Feature sequence140 2219 846 gene locus_tag LOCUS_13830 2219 846 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_13830 3374 2289 gene locus_tag LOCUS_13840 3374 2289 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878758.1 protein_id gnl|my_center|LOCUS_13840 3428 3640 gene locus_tag LOCUS_13850 3428 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 3887 3642 gene locus_tag LOCUS_13860 3887 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 4005 5189 gene locus_tag LOCUS_13870 4005 5189 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257342.1 protein_id gnl|my_center|LOCUS_13870 5905 5276 gene locus_tag LOCUS_13880 5905 5276 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927022.1 protein_id gnl|my_center|LOCUS_13880 >Feature sequence141 764 1807 gene locus_tag LOCUS_13890 764 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 1696 2793 gene locus_tag LOCUS_13900 1696 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 2946 3410 gene locus_tag LOCUS_13910 2946 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 3407 4690 gene locus_tag LOCUS_13920 gene gnfL 3407 4690 CDS product nitrogen fixation sensor histidine kinase GnfL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941669.1 protein_id gnl|my_center|LOCUS_13920 4687 5919 gene locus_tag LOCUS_13930 gene atoC 4687 5919 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125281.1 protein_id gnl|my_center|LOCUS_13930 5936 6148 gene locus_tag LOCUS_13940 5936 6148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 6145 6606 gene locus_tag LOCUS_13950 gene flgB 6145 6606 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392289.1 protein_id gnl|my_center|LOCUS_13950 6623 7039 gene locus_tag LOCUS_13960 gene flgC 6623 7039 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941076.1 protein_id gnl|my_center|LOCUS_13960 7156 7470 gene locus_tag LOCUS_13970 7156 7470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 >Feature sequence142 22 1467 gene locus_tag LOCUS_13980 22 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 3846 1597 gene locus_tag LOCUS_13990 3846 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 6212 4155 gene locus_tag LOCUS_14000 6212 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 <7834 6269 gene locus_tag LOCUS_14010 <7834 6269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066113.1:PAS domain S-box protein >Feature sequence143 1298 432 gene locus_tag LOCUS_14020 1298 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 1338 1383 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3087 1669 gene locus_tag LOCUS_14030 3087 1669 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898728.1 protein_id gnl|my_center|LOCUS_14030 4277 3564 gene locus_tag LOCUS_14040 4277 3564 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546880.1 protein_id gnl|my_center|LOCUS_14040 6101 4374 gene locus_tag LOCUS_14050 6101 4374 CDS product succinate dehydrogenase/fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878184.1 protein_id gnl|my_center|LOCUS_14050 6613 6245 gene locus_tag LOCUS_14060 gene sdhC 6613 6245 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887599.1 protein_id gnl|my_center|LOCUS_14060 6877 6626 gene locus_tag LOCUS_14070 6877 6626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 7431 7640 gene locus_tag LOCUS_14080 7431 7640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 >Feature sequence144 531 2069 gene locus_tag LOCUS_14090 531 2069 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392040.1 protein_id gnl|my_center|LOCUS_14090 2205 2711 gene locus_tag LOCUS_14100 2205 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 2727 3017 gene locus_tag LOCUS_14110 2727 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14110 3014 3436 gene locus_tag LOCUS_14120 3014 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 3455 4210 gene locus_tag LOCUS_14130 3455 4210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 4865 5629 gene locus_tag LOCUS_14140 4865 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 6212 7231 gene locus_tag LOCUS_14150 6212 7231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 7266 7481 gene locus_tag LOCUS_14160 7266 7481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 >Feature sequence145 179 832 gene locus_tag LOCUS_14170 179 832 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941525.1 protein_id gnl|my_center|LOCUS_14170 989 1663 gene locus_tag LOCUS_14180 989 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 1663 3603 gene locus_tag LOCUS_14190 gene iorA 1663 3603 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068577330.1 protein_id gnl|my_center|LOCUS_14190 3617 4243 gene locus_tag LOCUS_14200 3617 4243 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879522.1 protein_id gnl|my_center|LOCUS_14200 4227 5885 gene locus_tag LOCUS_14210 4227 5885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 5809 6330 gene locus_tag LOCUS_14220 5809 6330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 >Feature sequence146 584 144 gene locus_tag LOCUS_14230 584 144 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003509013.1 protein_id gnl|my_center|LOCUS_14230 1052 822 gene locus_tag LOCUS_14240 1052 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 1384 2439 gene locus_tag LOCUS_14250 1384 2439 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878191.1 protein_id gnl|my_center|LOCUS_14250 2476 2946 gene locus_tag LOCUS_14260 2476 2946 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229426.1 protein_id gnl|my_center|LOCUS_14260 3285 3016 gene locus_tag LOCUS_14270 3285 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 4530 3538 gene locus_tag LOCUS_14280 4530 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 5749 4547 gene locus_tag LOCUS_14290 5749 4547 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064595.1 protein_id gnl|my_center|LOCUS_14290 7366 6098 gene locus_tag LOCUS_14300 gene mttB 7366 6098 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q8TS73 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14300 7710 7366 gene locus_tag LOCUS_14310 7710 7366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 >Feature sequence147 <1 1110 gene locus_tag LOCUS_14320 <1 1110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941439.1:cache domain-containing protein 1122 1532 gene locus_tag LOCUS_14330 1122 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 1699 3069 gene locus_tag LOCUS_14340 1699 3069 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_14340 6089 3159 gene locus_tag LOCUS_14350 gene fdhF 6089 3159 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_14350 <7705 6149 gene locus_tag LOCUS_14360 <7705 6149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_088555170.1:FAD-dependent oxidoreductase >Feature sequence148 292 573 gene locus_tag LOCUS_14370 292 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 1529 747 gene locus_tag LOCUS_14380 1529 747 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_14380 1660 1986 gene locus_tag LOCUS_14390 1660 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 3039 1993 gene locus_tag LOCUS_14400 gene hisC 3039 1993 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121508.1 protein_id gnl|my_center|LOCUS_14400 4358 3036 gene locus_tag LOCUS_14410 gene hisD 4358 3036 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461463.1 protein_id gnl|my_center|LOCUS_14410 5663 4407 gene locus_tag LOCUS_14420 gene murA 5663 4407 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411274.1 protein_id gnl|my_center|LOCUS_14420 6232 5759 gene locus_tag LOCUS_14430 6232 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 7033 6251 gene locus_tag LOCUS_14440 gene tpiA 7033 6251 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259656.1 protein_id gnl|my_center|LOCUS_14440 <7699 7085 gene locus_tag LOCUS_14450 <7699 7085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942133.1:bifunctional riboflavin kinase/FAD synthetase >Feature sequence149 <1 561 gene locus_tag LOCUS_14460 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583097.1:corrinoid protein 780 1070 gene locus_tag LOCUS_14470 gene gatC 780 1070 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_14470 1273 2769 gene locus_tag LOCUS_14480 gene gatA 1273 2769 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_14480 3120 2827 gene locus_tag LOCUS_14490 3120 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 4139 3738 gene locus_tag LOCUS_14500 4139 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 6173 4704 gene locus_tag LOCUS_14510 6173 4704 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249895.1 protein_id gnl|my_center|LOCUS_14510 6474 6896 gene locus_tag LOCUS_14520 6474 6896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 6840 6870 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence150 560 1618 gene locus_tag LOCUS_14530 560 1618 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546105.1 protein_id gnl|my_center|LOCUS_14530 1911 1615 gene locus_tag LOCUS_14540 1911 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 2137 1988 gene locus_tag LOCUS_14550 2137 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 3490 2663 gene locus_tag LOCUS_14560 3490 2663 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421145.1 protein_id gnl|my_center|LOCUS_14560 4085 5653 gene locus_tag LOCUS_14570 gene top6B 4085 5653 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878155.1 protein_id gnl|my_center|LOCUS_14570 5853 6935 gene locus_tag LOCUS_14580 5853 6935 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869868.1 protein_id gnl|my_center|LOCUS_14580 7454 6936 gene locus_tag LOCUS_14590 7454 6936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 >Feature sequence151 250 924 gene locus_tag LOCUS_14600 250 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 947 1714 gene locus_tag LOCUS_14610 947 1714 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974643.1 protein_id gnl|my_center|LOCUS_14610 1684 2859 gene locus_tag LOCUS_14620 1684 2859 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228423.1 protein_id gnl|my_center|LOCUS_14620 3079 4047 gene locus_tag LOCUS_14630 3079 4047 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878191.1 protein_id gnl|my_center|LOCUS_14630 4255 4425 gene locus_tag LOCUS_14640 4255 4425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 4678 5409 gene locus_tag LOCUS_14650 4678 5409 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_14650 5452 6573 gene locus_tag LOCUS_14660 5452 6573 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869500.1 protein_id gnl|my_center|LOCUS_14660 >Feature sequence152 2835 1750 gene locus_tag LOCUS_14670 2835 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 3370 4344 gene locus_tag LOCUS_14680 3370 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 4360 5013 gene locus_tag LOCUS_14690 4360 5013 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030700.1 protein_id gnl|my_center|LOCUS_14690 5550 5206 gene locus_tag LOCUS_14700 5550 5206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14700 5995 5786 gene locus_tag LOCUS_14710 5995 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14710 6755 7378 gene locus_tag LOCUS_14720 6755 7378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 >Feature sequence153 346 1170 gene locus_tag LOCUS_14730 346 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 1187 1798 gene locus_tag LOCUS_14740 1187 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 1801 2298 gene locus_tag LOCUS_14750 1801 2298 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942702.1 protein_id gnl|my_center|LOCUS_14750 2386 3030 gene locus_tag LOCUS_14760 2386 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 2990 4024 gene locus_tag LOCUS_14770 2990 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 4046 4816 gene locus_tag LOCUS_14780 4046 4816 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388610.1 protein_id gnl|my_center|LOCUS_14780 4823 5644 gene locus_tag LOCUS_14790 gene proC 4823 5644 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931771.1 protein_id gnl|my_center|LOCUS_14790 5641 6249 gene locus_tag LOCUS_14800 gene divIVA 5641 6249 CDS product cell division protein DivIVA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355904.1 protein_id gnl|my_center|LOCUS_14800 6254 6970 gene locus_tag LOCUS_14810 6254 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 >Feature sequence154 193 1194 gene locus_tag LOCUS_14820 193 1194 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878131.1 protein_id gnl|my_center|LOCUS_14820 2635 1550 gene locus_tag LOCUS_14830 2635 1550 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878191.1 protein_id gnl|my_center|LOCUS_14830 4990 2816 gene locus_tag LOCUS_14840 4990 2816 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003908489.1 protein_id gnl|my_center|LOCUS_14840 6092 5001 gene locus_tag LOCUS_14850 6092 5001 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878191.1 protein_id gnl|my_center|LOCUS_14850 7038 6175 gene locus_tag LOCUS_14860 7038 6175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 >Feature sequence155 139 663 gene locus_tag LOCUS_14870 gene paaY 139 663 CDS product phenylacetic acid degradation protein PaaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123464.1 protein_id gnl|my_center|LOCUS_14870 591 800 gene locus_tag LOCUS_14880 591 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 850 884 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1734 1444 gene locus_tag LOCUS_14890 1734 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 2495 3553 gene locus_tag LOCUS_14900 2495 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 3741 4154 gene locus_tag LOCUS_14910 3741 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 4145 4651 gene locus_tag LOCUS_14920 4145 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 5148 4738 gene locus_tag LOCUS_14930 5148 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 5940 5437 gene locus_tag LOCUS_14940 5940 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 7304 5961 gene locus_tag LOCUS_14950 7304 5961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 >Feature sequence156 81 950 gene locus_tag LOCUS_14960 81 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 1068 1967 gene locus_tag LOCUS_14970 1068 1967 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479748.1 protein_id gnl|my_center|LOCUS_14970 2023 4584 gene locus_tag LOCUS_14980 2023 4584 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941031.1 protein_id gnl|my_center|LOCUS_14980 6761 4854 gene locus_tag LOCUS_14990 6761 4854 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024232.1 protein_id gnl|my_center|LOCUS_14990 >Feature sequence157 <1 779 gene locus_tag LOCUS_15000 <1 779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208107.1:outer membrane lipoprotein-sorting protein 793 1173 gene locus_tag LOCUS_15010 793 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 1170 1952 gene locus_tag LOCUS_15020 1170 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15020 2214 1960 gene locus_tag LOCUS_15030 2214 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 5071 2417 gene locus_tag LOCUS_15040 5071 2417 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461688.1 protein_id gnl|my_center|LOCUS_15040 5355 6338 gene locus_tag LOCUS_15050 5355 6338 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258973.1 protein_id gnl|my_center|LOCUS_15050 6342 7322 gene locus_tag LOCUS_15060 6342 7322 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990106.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence158 1160 228 gene locus_tag LOCUS_15070 1160 228 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392705.1 protein_id gnl|my_center|LOCUS_15070 1825 1157 gene locus_tag LOCUS_15080 1825 1157 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392706.1 protein_id gnl|my_center|LOCUS_15080 2793 1903 gene locus_tag LOCUS_15090 gene folD 2793 1903 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941526.1 protein_id gnl|my_center|LOCUS_15090 2951 2790 gene locus_tag LOCUS_15100 2951 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15100 3266 3060 gene locus_tag LOCUS_15110 3266 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15110 4433 3300 gene locus_tag LOCUS_15120 4433 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15120 6315 4366 gene locus_tag LOCUS_15130 6315 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15130 4586 4600 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7282 6410 gene locus_tag LOCUS_15140 7282 6410 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence159 507 2324 gene locus_tag LOCUS_15150 507 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 2585 3340 gene locus_tag LOCUS_15160 2585 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 3896 4462 gene locus_tag LOCUS_15170 gene rpoE 3896 4462 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_15170 4597 5214 gene locus_tag LOCUS_15180 4597 5214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 5482 7131 gene locus_tag LOCUS_15190 5482 7131 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249802.1 protein_id gnl|my_center|LOCUS_15190 >Feature sequence160 581 2005 gene locus_tag LOCUS_15200 581 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 2002 2700 gene locus_tag LOCUS_15210 2002 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 2826 4031 gene locus_tag LOCUS_15220 2826 4031 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532810.1 protein_id gnl|my_center|LOCUS_15220 4250 6640 gene locus_tag LOCUS_15230 4250 6640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 >Feature sequence161 232 495 gene locus_tag LOCUS_15240 232 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 699 1148 gene locus_tag LOCUS_15250 699 1148 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868963.1 protein_id gnl|my_center|LOCUS_15250 1332 2081 gene locus_tag LOCUS_15260 1332 2081 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980652.1 protein_id gnl|my_center|LOCUS_15260 2365 2634 gene locus_tag LOCUS_15270 2365 2634 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393466.1 protein_id gnl|my_center|LOCUS_15270 2624 3616 gene locus_tag LOCUS_15280 2624 3616 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942004.1 protein_id gnl|my_center|LOCUS_15280 4735 3620 gene locus_tag LOCUS_15290 4735 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15290 4804 4836 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5256 4993 gene locus_tag LOCUS_15300 5256 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15300 7050 5746 gene locus_tag LOCUS_15310 7050 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence162 2764 1742 gene locus_tag LOCUS_15320 2764 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 3018 4835 gene locus_tag LOCUS_15330 gene pcrA 3018 4835 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457083.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15330 4782 4813 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4826 5251 gene locus_tag LOCUS_15340 4826 5251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15340 5248 6261 gene locus_tag LOCUS_15350 gene pheA 5248 6261 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_15350 6276 6728 gene locus_tag LOCUS_15360 6276 6728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence163 222 1286 gene locus_tag LOCUS_15370 gene cobT 222 1286 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393223.1 protein_id gnl|my_center|LOCUS_15370 1899 2153 gene locus_tag LOCUS_15380 1899 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 2761 4371 gene locus_tag LOCUS_15390 gene btuB 2761 4371 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_15390 4481 5101 gene locus_tag LOCUS_15400 4481 5101 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141387.1 protein_id gnl|my_center|LOCUS_15400 5085 5504 gene locus_tag LOCUS_15410 5085 5504 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760582.1 protein_id gnl|my_center|LOCUS_15410 5501 6304 gene locus_tag LOCUS_15420 5501 6304 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928766.1 protein_id gnl|my_center|LOCUS_15420 6341 6616 gene locus_tag LOCUS_15430 6341 6616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 6613 6828 gene locus_tag LOCUS_15440 6613 6828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 >Feature sequence164 155 2659 gene locus_tag LOCUS_15450 gene ligD 155 2659 CDS product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958551.1 protein_id gnl|my_center|LOCUS_15450 2855 3907 gene locus_tag LOCUS_15460 2855 3907 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931304.1 protein_id gnl|my_center|LOCUS_15460 3994 4314 gene locus_tag LOCUS_15470 3994 4314 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393074.1 protein_id gnl|my_center|LOCUS_15470 4311 4505 gene locus_tag LOCUS_15480 4311 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 4945 5247 gene locus_tag LOCUS_15490 4945 5247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 5360 5587 gene locus_tag LOCUS_15500 5360 5587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 5860 6579 gene locus_tag LOCUS_15510 gene mrr 5860 6579 CDS product adenine/cytosine-specific restriction endonuclease Mrr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217931.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence165 1642 422 gene locus_tag LOCUS_15520 1642 422 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162490120.1 protein_id gnl|my_center|LOCUS_15520 2420 2890 gene locus_tag LOCUS_15530 gene paaI 2420 2890 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391943.1 protein_id gnl|my_center|LOCUS_15530 3606 3043 gene locus_tag LOCUS_15540 3606 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 5500 4298 gene locus_tag LOCUS_15550 5500 4298 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523689.1 protein_id gnl|my_center|LOCUS_15550 5669 5487 gene locus_tag LOCUS_15560 5669 5487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 5692 5822 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence166 1524 991 gene locus_tag LOCUS_15570 1524 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 2996 1923 gene locus_tag LOCUS_15580 2996 1923 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977450.1 protein_id gnl|my_center|LOCUS_15580 4659 3253 gene locus_tag LOCUS_15590 4659 3253 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121615.1 protein_id gnl|my_center|LOCUS_15590 >Feature sequence167 <1 1045 gene locus_tag LOCUS_15600 <1 1045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393341.1:DNA polymerase I 1258 2508 gene locus_tag LOCUS_15610 gene rho 1258 2508 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_15610 2853 2551 gene locus_tag LOCUS_15620 2853 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 3581 2871 gene locus_tag LOCUS_15630 3581 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 4696 3578 gene locus_tag LOCUS_15640 gene lptF 4696 3578 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_15640 5958 4783 gene locus_tag LOCUS_15650 5958 4783 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943264.1 protein_id gnl|my_center|LOCUS_15650 6974 6090 gene locus_tag LOCUS_15660 6974 6090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 >Feature sequence168 1137 2099 gene locus_tag LOCUS_15670 1137 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 3236 2250 gene locus_tag LOCUS_15680 3236 2250 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403550.1 protein_id gnl|my_center|LOCUS_15680 4724 3417 gene locus_tag LOCUS_15690 4724 3417 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_15690 5462 4737 gene locus_tag LOCUS_15700 5462 4737 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_15700 6742 5459 gene locus_tag LOCUS_15710 gene leuC 6742 5459 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393737.1 protein_id gnl|my_center|LOCUS_15710 >Feature sequence169 1108 122 gene locus_tag LOCUS_15720 1108 122 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257479.1 protein_id gnl|my_center|LOCUS_15720 1297 2058 gene locus_tag LOCUS_15730 1297 2058 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267696.1 protein_id gnl|my_center|LOCUS_15730 2143 3318 gene locus_tag LOCUS_15740 2143 3318 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963537.1 protein_id gnl|my_center|LOCUS_15740 3417 3560 gene locus_tag LOCUS_15750 3417 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 3835 5526 gene locus_tag LOCUS_15760 gene ilvB 3835 5526 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146975.1 protein_id gnl|my_center|LOCUS_15760 5698 5516 gene locus_tag LOCUS_15770 5698 5516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 5971 5705 gene locus_tag LOCUS_15780 5971 5705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15780 6218 6556 gene locus_tag LOCUS_15790 6218 6556 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227980.1 protein_id gnl|my_center|LOCUS_15790 6546 6959 gene locus_tag LOCUS_15800 6546 6959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 >Feature sequence170 227 301 gene locus_tag LOCUS_t00100 227 301 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 759 406 gene locus_tag LOCUS_15810 759 406 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940899.1 protein_id gnl|my_center|LOCUS_15810 1389 1628 gene locus_tag LOCUS_15820 gene thiS 1389 1628 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_15820 1707 2483 gene locus_tag LOCUS_15830 1707 2483 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941251.1 protein_id gnl|my_center|LOCUS_15830 2631 3329 gene locus_tag LOCUS_15840 gene thiE 2631 3329 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941250.1 protein_id gnl|my_center|LOCUS_15840 3471 4811 gene locus_tag LOCUS_15850 gene thiC 3471 4811 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941266.1 protein_id gnl|my_center|LOCUS_15850 4808 6292 gene locus_tag LOCUS_15860 4808 6292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 6256 6759 gene locus_tag LOCUS_15870 6256 6759 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037855.1 protein_id gnl|my_center|LOCUS_15870 >Feature sequence171 2287 791 gene locus_tag LOCUS_15880 2287 791 CDS product MOP flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089043.1 protein_id gnl|my_center|LOCUS_15880 3468 2284 gene locus_tag LOCUS_15890 3468 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 4450 3473 gene locus_tag LOCUS_15900 4450 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 5238 4450 gene locus_tag LOCUS_15910 5238 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 6424 5225 gene locus_tag LOCUS_15920 6424 5225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 >Feature sequence172 54 1265 gene locus_tag LOCUS_15930 54 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 1339 1560 gene locus_tag LOCUS_15940 1339 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 1570 2412 gene locus_tag LOCUS_15950 1570 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15950 2361 2393 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2415 2798 gene locus_tag LOCUS_15960 2415 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15960 2816 4027 gene locus_tag LOCUS_15970 2816 4027 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113715.1 protein_id gnl|my_center|LOCUS_15970 4046 5416 gene locus_tag LOCUS_15980 4046 5416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 5581 6843 gene locus_tag LOCUS_15990 5581 6843 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813466.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence173 <1 1164 gene locus_tag LOCUS_16000 <1 1164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546552.1:flagellar basal-body MS-ring/collar protein FliF 1220 1930 gene locus_tag LOCUS_16010 1220 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 1947 2777 gene locus_tag LOCUS_16020 gene fliH 1947 2777 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556888.1 protein_id gnl|my_center|LOCUS_16020 2774 4135 gene locus_tag LOCUS_16030 2774 4135 CDS product FliI/YscN family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941081.1 protein_id gnl|my_center|LOCUS_16030 4199 4669 gene locus_tag LOCUS_16040 4199 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 4864 5496 gene locus_tag LOCUS_16050 4864 5496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 5539 6255 gene locus_tag LOCUS_16060 5539 6255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 6203 6688 gene locus_tag LOCUS_16070 6203 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 >Feature sequence174 453 2150 gene locus_tag LOCUS_16080 gene recJ 453 2150 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_16080 2442 4430 gene locus_tag LOCUS_16090 2442 4430 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_16090 6149 4434 gene locus_tag LOCUS_16100 6149 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 >Feature sequence175 1 1242 gene locus_tag LOCUS_16110 1 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 1699 1313 gene locus_tag LOCUS_16120 1699 1313 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875873.1 protein_id gnl|my_center|LOCUS_16120 2604 2302 gene locus_tag LOCUS_16130 2604 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 3222 2683 gene locus_tag LOCUS_16140 3222 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 3598 3356 gene locus_tag LOCUS_16150 3598 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 3926 3672 gene locus_tag LOCUS_16160 3926 3672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 5623 3911 gene locus_tag LOCUS_16170 5623 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 5844 5686 gene locus_tag LOCUS_16180 5844 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 6615 6361 gene locus_tag LOCUS_16190 6615 6361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence176 574 807 gene locus_tag LOCUS_16200 574 807 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023834.1 protein_id gnl|my_center|LOCUS_16200 818 1345 gene locus_tag LOCUS_16210 818 1345 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393700.1 protein_id gnl|my_center|LOCUS_16210 1378 1779 gene locus_tag LOCUS_16220 1378 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 1917 2456 gene locus_tag LOCUS_16230 1917 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 2520 3074 gene locus_tag LOCUS_16240 2520 3074 CDS product aromatic aminobenezylarsenical efflux permease ArsG family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107453.1 protein_id gnl|my_center|LOCUS_16240 3261 3407 gene locus_tag LOCUS_16250 3261 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 3478 3720 gene locus_tag LOCUS_16260 3478 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16260 3979 4347 gene locus_tag LOCUS_16270 3979 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 4420 5514 gene locus_tag LOCUS_16280 gene acr3 4420 5514 CDS product arsenite efflux transporter Acr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398718.1 protein_id gnl|my_center|LOCUS_16280 5678 6073 gene locus_tag LOCUS_16290 5678 6073 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 protein_id gnl|my_center|LOCUS_16290 6325 6663 gene locus_tag LOCUS_16300 6325 6663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 >Feature sequence177 52 555 gene locus_tag LOCUS_16310 52 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 584 910 gene locus_tag LOCUS_16320 584 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 943 2151 gene locus_tag LOCUS_16330 943 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 2865 3944 gene locus_tag LOCUS_16340 2865 3944 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583099.1 protein_id gnl|my_center|LOCUS_16340 4274 4609 gene locus_tag LOCUS_16350 4274 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16350 4537 6168 gene locus_tag LOCUS_16360 4537 6168 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337730.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16360 >Feature sequence178 531 839 gene locus_tag LOCUS_16370 531 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 3752 849 gene locus_tag LOCUS_16380 3752 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 5991 4207 gene locus_tag LOCUS_16390 5991 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 <6734 6188 gene locus_tag LOCUS_16400 <6734 6188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967150.1:tetratricopeptide repeat protein >Feature sequence179 4390 1763 gene locus_tag LOCUS_16410 4390 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 5396 4560 gene locus_tag LOCUS_16420 gene pstS 5396 4560 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096673.1 protein_id gnl|my_center|LOCUS_16420 >Feature sequence180 1547 1014 gene locus_tag LOCUS_16430 1547 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 4414 1589 gene locus_tag LOCUS_16440 4414 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 5285 4752 gene locus_tag LOCUS_16450 5285 4752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 5824 5477 gene locus_tag LOCUS_16460 5824 5477 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546371.1 protein_id gnl|my_center|LOCUS_16460 <6674 6015 gene locus_tag LOCUS_16470 <6674 6015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546530.1:RtcB family protein >Feature sequence181 23 682 gene locus_tag LOCUS_16480 23 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 1848 877 gene locus_tag LOCUS_16490 1848 877 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816051.1 protein_id gnl|my_center|LOCUS_16490 2495 2010 gene locus_tag LOCUS_16500 2495 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 2792 3067 gene locus_tag LOCUS_16510 2792 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 3082 4053 gene locus_tag LOCUS_16520 3082 4053 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941786.1 protein_id gnl|my_center|LOCUS_16520 4496 4954 gene locus_tag LOCUS_16530 4496 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 5572 4907 gene locus_tag LOCUS_16540 5572 4907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 6413 5754 gene locus_tag LOCUS_16550 6413 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 >Feature sequence182 424 1050 gene locus_tag LOCUS_16560 424 1050 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943961.1 protein_id gnl|my_center|LOCUS_16560 1497 3233 gene locus_tag LOCUS_16570 1497 3233 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966867.1 protein_id gnl|my_center|LOCUS_16570 3259 4452 gene locus_tag LOCUS_16580 gene mtnA 3259 4452 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392224.1 protein_id gnl|my_center|LOCUS_16580 4356 5444 gene locus_tag LOCUS_16590 4356 5444 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583824.1 protein_id gnl|my_center|LOCUS_16590 5450 6145 gene locus_tag LOCUS_16600 gene cmk 5450 6145 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230555.1 protein_id gnl|my_center|LOCUS_16600 >Feature sequence183 1023 1991 gene locus_tag LOCUS_16610 1023 1991 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963925.1 protein_id gnl|my_center|LOCUS_16610 2715 2236 gene locus_tag LOCUS_16620 2715 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 2863 2927 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3421 4512 gene locus_tag LOCUS_16630 3421 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 4910 4656 gene locus_tag LOCUS_16640 gene grxC 4910 4656 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721669.1 protein_id gnl|my_center|LOCUS_16640 5268 6512 gene locus_tag LOCUS_16650 5268 6512 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860380.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence184 <1 780 gene locus_tag LOCUS_16660 <1 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392521.1:2-hydroxyacyl-CoA dehydratase family protein 2899 1727 gene locus_tag LOCUS_16670 2899 1727 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546061.1 protein_id gnl|my_center|LOCUS_16670 3104 2868 gene locus_tag LOCUS_16680 3104 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 4534 3293 gene locus_tag LOCUS_16690 4534 3293 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095742.1 protein_id gnl|my_center|LOCUS_16690 5664 4555 gene locus_tag LOCUS_16700 5664 4555 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877291.1 protein_id gnl|my_center|LOCUS_16700 <6571 5753 gene locus_tag LOCUS_16710 <6571 5753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031142.1:MerR family transcriptional regulator >Feature sequence185 2951 4096 gene locus_tag LOCUS_16720 2951 4096 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546390.1 protein_id gnl|my_center|LOCUS_16720 4599 4303 gene locus_tag LOCUS_16730 4599 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 6279 4975 gene locus_tag LOCUS_16740 6279 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 >Feature sequence186 219 1205 gene locus_tag LOCUS_16750 219 1205 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098061990.1 protein_id gnl|my_center|LOCUS_16750 1202 1612 gene locus_tag LOCUS_16760 1202 1612 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929878.1 protein_id gnl|my_center|LOCUS_16760 1687 3501 gene locus_tag LOCUS_16770 1687 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 3458 5779 gene locus_tag LOCUS_16780 3458 5779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 6101 5967 gene locus_tag LOCUS_16790 6101 5967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 >Feature sequence187 556 1518 gene locus_tag LOCUS_16800 556 1518 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943320.1 protein_id gnl|my_center|LOCUS_16800 1833 3455 gene locus_tag LOCUS_16810 1833 3455 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943319.1 protein_id gnl|my_center|LOCUS_16810 5108 4161 gene locus_tag LOCUS_16820 5108 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16820 >Feature sequence188 2080 4677 gene locus_tag LOCUS_16830 gene adhE 2080 4677 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035380749.1 protein_id gnl|my_center|LOCUS_16830 4961 5290 gene locus_tag LOCUS_16840 4961 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 >Feature sequence189 3702 1285 gene locus_tag LOCUS_16850 3702 1285 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943139.1 protein_id gnl|my_center|LOCUS_16850 3919 3968 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence190 1058 759 gene locus_tag LOCUS_16860 1058 759 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771921.1 protein_id gnl|my_center|LOCUS_16860 1311 3989 gene locus_tag LOCUS_16870 1311 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 4091 5449 gene locus_tag LOCUS_16880 gene der 4091 5449 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258958.1 protein_id gnl|my_center|LOCUS_16880 5452 6312 gene locus_tag LOCUS_16890 5452 6312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 >Feature sequence191 55 849 gene locus_tag LOCUS_16900 55 849 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877828.1 protein_id gnl|my_center|LOCUS_16900 1119 1253 gene locus_tag LOCUS_16910 1119 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 1712 2803 gene locus_tag LOCUS_16920 1712 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16920 3508 3107 gene locus_tag LOCUS_16930 3508 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 4610 3822 gene locus_tag LOCUS_16940 4610 3822 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_16940 5084 5971 gene locus_tag LOCUS_16950 5084 5971 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704527.1 protein_id gnl|my_center|LOCUS_16950 >Feature sequence192 1642 1328 gene locus_tag LOCUS_16960 1642 1328 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404610.1 protein_id gnl|my_center|LOCUS_16960 2487 1639 gene locus_tag LOCUS_16970 gene rapZ 2487 1639 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_16970 3311 2502 gene locus_tag LOCUS_16980 gene hprK 3311 2502 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127250.1 protein_id gnl|my_center|LOCUS_16980 3720 3325 gene locus_tag LOCUS_16990 3720 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 4280 3723 gene locus_tag LOCUS_17000 4280 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 4822 4277 gene locus_tag LOCUS_17010 4822 4277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 5397 4819 gene locus_tag LOCUS_17020 5397 4819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 6195 5428 gene locus_tag LOCUS_17030 6195 5428 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886388.1 protein_id gnl|my_center|LOCUS_17030 >Feature sequence193 1737 1438 gene locus_tag LOCUS_17040 1737 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 1906 1727 gene locus_tag LOCUS_17050 1906 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 2244 2927 gene locus_tag LOCUS_17060 2244 2927 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_17060 2924 4285 gene locus_tag LOCUS_17070 2924 4285 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 protein_id gnl|my_center|LOCUS_17070 4986 4438 gene locus_tag LOCUS_17080 4986 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 5724 5089 gene locus_tag LOCUS_17090 5724 5089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 6210 6040 gene locus_tag LOCUS_17100 6210 6040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 >Feature sequence194 1026 2006 gene locus_tag LOCUS_17110 1026 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 2251 3393 gene locus_tag LOCUS_17120 2251 3393 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113995.1 protein_id gnl|my_center|LOCUS_17120 3811 4110 gene locus_tag LOCUS_17130 3811 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 4711 4250 gene locus_tag LOCUS_17140 4711 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 >Feature sequence195 635 659 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1875 1210 gene locus_tag LOCUS_17150 1875 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 2386 3309 gene locus_tag LOCUS_17160 2386 3309 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942933.1 protein_id gnl|my_center|LOCUS_17160 3525 4418 gene locus_tag LOCUS_17170 3525 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 <6223 4486 gene locus_tag LOCUS_17180 <6223 4486 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141226.1:hydantoinase B/oxoprolinase family protein >Feature sequence196 882 1520 gene locus_tag LOCUS_17190 882 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 1543 3489 gene locus_tag LOCUS_17200 1543 3489 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044893.1 protein_id gnl|my_center|LOCUS_17200 3573 4535 gene locus_tag LOCUS_17210 3573 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17210 4430 4480 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4535 4888 gene locus_tag LOCUS_17220 4535 4888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17220 >Feature sequence197 2551 1523 gene locus_tag LOCUS_17230 2551 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 3626 2922 gene locus_tag LOCUS_17240 3626 2922 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482754.1 protein_id gnl|my_center|LOCUS_17240 4785 3628 gene locus_tag LOCUS_17250 4785 3628 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389453.1 protein_id gnl|my_center|LOCUS_17250 6047 4854 gene locus_tag LOCUS_17260 6047 4854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 >Feature sequence198 37 2889 gene locus_tag LOCUS_17270 37 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 3216 3593 gene locus_tag LOCUS_17280 3216 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 3707 4387 gene locus_tag LOCUS_17290 3707 4387 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392706.1 protein_id gnl|my_center|LOCUS_17290 4371 5306 gene locus_tag LOCUS_17300 4371 5306 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392705.1 protein_id gnl|my_center|LOCUS_17300 >Feature sequence199 <1 1050 gene locus_tag LOCUS_17310 <1 1050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000898981.1:alpha/beta hydrolase 1083 2459 gene locus_tag LOCUS_17320 gene hemL 1083 2459 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496557.1 protein_id gnl|my_center|LOCUS_17320 2708 4051 gene locus_tag LOCUS_17330 2708 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 4107 4349 gene locus_tag LOCUS_17340 4107 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 4913 4356 gene locus_tag LOCUS_17350 gene frr 4913 4356 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723450.1 protein_id gnl|my_center|LOCUS_17350 5653 4919 gene locus_tag LOCUS_17360 gene pyrH 5653 4919 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_17360 <6196 5661 gene locus_tag LOCUS_17370 <6196 5661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392547.1:translation elongation factor Ts >Feature sequence200 150 608 gene locus_tag LOCUS_17380 150 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 605 838 gene locus_tag LOCUS_17390 605 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 1464 976 gene locus_tag LOCUS_17400 1464 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 1937 1587 gene locus_tag LOCUS_17410 1937 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 2263 1841 gene locus_tag LOCUS_17420 2263 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 2458 2276 gene locus_tag LOCUS_17430 2458 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 5665 2579 gene locus_tag LOCUS_17440 5665 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 6090 5662 gene locus_tag LOCUS_17450 6090 5662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 >Feature sequence201 <1 1033 gene locus_tag LOCUS_17460 <1 1033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257950.1:aspartate aminotransferase family protein 1059 1352 gene locus_tag LOCUS_17470 1059 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 1336 1506 gene locus_tag LOCUS_17480 1336 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 1563 2579 gene locus_tag LOCUS_17490 1563 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 2512 3003 gene locus_tag LOCUS_17500 2512 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 3016 4188 gene locus_tag LOCUS_17510 3016 4188 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393482.1 protein_id gnl|my_center|LOCUS_17510 4189 5037 gene locus_tag LOCUS_17520 4189 5037 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393483.1 protein_id gnl|my_center|LOCUS_17520 5021 5554 gene locus_tag LOCUS_17530 5021 5554 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393484.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence202 1562 399 gene locus_tag LOCUS_17540 1562 399 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036621.1 protein_id gnl|my_center|LOCUS_17540 3199 1727 gene locus_tag LOCUS_17550 3199 1727 CDS product DUF92 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926895.1 protein_id gnl|my_center|LOCUS_17550 4401 3325 gene locus_tag LOCUS_17560 4401 3325 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878758.1 protein_id gnl|my_center|LOCUS_17560 5186 4740 gene locus_tag LOCUS_17570 5186 4740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 5819 5391 gene locus_tag LOCUS_17580 5819 5391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 >Feature sequence203 1531 2037 gene locus_tag LOCUS_17590 1531 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 2034 2975 gene locus_tag LOCUS_17600 gene ugpC 2034 2975 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087328.1 protein_id gnl|my_center|LOCUS_17600 3423 3064 gene locus_tag LOCUS_17610 3423 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 3553 3383 gene locus_tag LOCUS_17620 3553 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 5134 3929 gene locus_tag LOCUS_17630 5134 3929 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_17630 5420 5124 gene locus_tag LOCUS_17640 5420 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 >Feature sequence204 371 1504 gene locus_tag LOCUS_17650 371 1504 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942127.1 protein_id gnl|my_center|LOCUS_17650 1584 2045 gene locus_tag LOCUS_17660 1584 2045 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119424.1 protein_id gnl|my_center|LOCUS_17660 2067 3620 gene locus_tag LOCUS_17670 2067 3620 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942126.1 protein_id gnl|my_center|LOCUS_17670 4899 5888 gene locus_tag LOCUS_17680 4899 5888 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_17680 >Feature sequence205 987 160 gene locus_tag LOCUS_17690 gene srlD 987 160 CDS product sorbitol-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582810.1 protein_id gnl|my_center|LOCUS_17690 1356 2639 gene locus_tag LOCUS_17700 1356 2639 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102335.1 protein_id gnl|my_center|LOCUS_17700 3643 2657 gene locus_tag LOCUS_17710 3643 2657 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_17710 4166 4768 gene locus_tag LOCUS_17720 4166 4768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 <6062 4918 gene locus_tag LOCUS_17730 <6062 4918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870970.1:GMC family oxidoreductase >Feature sequence206 <1 1507 gene locus_tag LOCUS_17740 <1 1507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937997.1:molybdopterin-dependent oxidoreductase 1514 2263 gene locus_tag LOCUS_17750 1514 2263 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937996.1 protein_id gnl|my_center|LOCUS_17750 2320 3558 gene locus_tag LOCUS_17760 gene nrfD 2320 3558 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937995.1 protein_id gnl|my_center|LOCUS_17760 3575 3844 gene locus_tag LOCUS_17770 3575 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 3881 5197 gene locus_tag LOCUS_17780 3881 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545304.1 protein_id gnl|my_center|LOCUS_17780 5319 5966 gene locus_tag LOCUS_17790 5319 5966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546704.1 protein_id gnl|my_center|LOCUS_17790 >Feature sequence207 2911 1559 gene locus_tag LOCUS_17800 2911 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 5094 3052 gene locus_tag LOCUS_17810 5094 3052 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545601.1 protein_id gnl|my_center|LOCUS_17810 5754 5104 gene locus_tag LOCUS_17820 gene hisH 5754 5104 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943718.1 protein_id gnl|my_center|LOCUS_17820 >Feature sequence208 294 1265 gene locus_tag LOCUS_17830 gene iolN 294 1265 CDS product 3-dehydro-scyllo-inosose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083262.1 protein_id gnl|my_center|LOCUS_17830 2759 1266 gene locus_tag LOCUS_17840 2759 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 3314 2910 gene locus_tag LOCUS_17850 3314 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 4112 3330 gene locus_tag LOCUS_17860 4112 3330 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_17860 5074 4097 gene locus_tag LOCUS_17870 5074 4097 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_17870 <5980 5114 gene locus_tag LOCUS_17880 <5980 5114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964112.1:GDP-mannose 4,6-dehydratase >Feature sequence209 1508 483 gene locus_tag LOCUS_17890 1508 483 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942020.1 protein_id gnl|my_center|LOCUS_17890 2321 3376 gene locus_tag LOCUS_17900 2321 3376 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941362.1 protein_id gnl|my_center|LOCUS_17900 <5979 3592 gene locus_tag LOCUS_17910 <5979 3592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877688.1:molybdopterin-dependent oxidoreductase >Feature sequence210 703 2145 gene locus_tag LOCUS_17920 gene lysS 703 2145 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_17920 2234 3454 gene locus_tag LOCUS_17930 2234 3454 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_17930 3447 4121 gene locus_tag LOCUS_17940 gene lolD 3447 4121 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263326.1 protein_id gnl|my_center|LOCUS_17940 4131 4631 gene locus_tag LOCUS_17950 4131 4631 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128393.1 protein_id gnl|my_center|LOCUS_17950 4793 5848 gene locus_tag LOCUS_17960 4793 5848 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391708.1 protein_id gnl|my_center|LOCUS_17960 >Feature sequence211 373 1659 gene locus_tag LOCUS_17970 373 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 1752 2696 gene locus_tag LOCUS_17980 1752 2696 CDS product DUF2950 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941869.1 protein_id gnl|my_center|LOCUS_17980 2678 3874 gene locus_tag LOCUS_17990 2678 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234705500.1 protein_id gnl|my_center|LOCUS_17990 4706 5326 gene locus_tag LOCUS_18000 4706 5326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 >Feature sequence212 1592 657 gene locus_tag LOCUS_18010 1592 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 2917 1652 gene locus_tag LOCUS_18020 2917 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 3446 2982 gene locus_tag LOCUS_18030 3446 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 4125 3742 gene locus_tag LOCUS_18040 4125 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 5414 4209 gene locus_tag LOCUS_18050 5414 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 4267 4346 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence213 108 1112 gene locus_tag LOCUS_18060 108 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 1076 2458 gene locus_tag LOCUS_18070 1076 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 3673 2621 gene locus_tag LOCUS_18080 3673 2621 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082568.1 protein_id gnl|my_center|LOCUS_18080 5580 3655 gene locus_tag LOCUS_18090 5580 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 >Feature sequence214 863 117 gene locus_tag LOCUS_18100 863 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 1919 933 gene locus_tag LOCUS_18110 1919 933 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356704.1 protein_id gnl|my_center|LOCUS_18110 2575 1934 gene locus_tag LOCUS_18120 2575 1934 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816806.1 protein_id gnl|my_center|LOCUS_18120 2774 3673 gene locus_tag LOCUS_18130 2774 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 5529 3841 gene locus_tag LOCUS_18140 gene hcp 5529 3841 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791786.1 protein_id gnl|my_center|LOCUS_18140 >Feature sequence215 343 59 gene locus_tag LOCUS_18150 343 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 616 2433 gene locus_tag LOCUS_18160 616 2433 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879233.1 protein_id gnl|my_center|LOCUS_18160 2581 3069 gene locus_tag LOCUS_18170 2581 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 3438 4412 gene locus_tag LOCUS_18180 3438 4412 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542473.1 protein_id gnl|my_center|LOCUS_18180 4575 5558 gene locus_tag LOCUS_18190 4575 5558 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798964.1 protein_id gnl|my_center|LOCUS_18190 >Feature sequence216 1951 353 gene locus_tag LOCUS_18200 gene bshC 1951 353 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231847126.1 protein_id gnl|my_center|LOCUS_18200 3422 2040 gene locus_tag LOCUS_18210 gene pyk 3422 2040 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943944.1 protein_id gnl|my_center|LOCUS_18210 4712 3561 gene locus_tag LOCUS_18220 4712 3561 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705579.1 protein_id gnl|my_center|LOCUS_18220 4971 5684 gene locus_tag LOCUS_18230 4971 5684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 >Feature sequence217 540 31 gene locus_tag LOCUS_18240 540 31 CDS product DMP19 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038648.1 protein_id gnl|my_center|LOCUS_18240 867 739 gene locus_tag LOCUS_18250 867 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 1660 1427 gene locus_tag LOCUS_18260 1660 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 1857 1693 gene locus_tag LOCUS_18270 1857 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 3816 5774 gene locus_tag LOCUS_18280 gene dnaK 3816 5774 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_18280 >Feature sequence218 463 846 gene locus_tag LOCUS_18290 gene rplS 463 846 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_18290 918 1724 gene locus_tag LOCUS_18300 918 1724 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_18300 1721 3478 gene locus_tag LOCUS_18310 1721 3478 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924857.1 protein_id gnl|my_center|LOCUS_18310 3871 3635 gene locus_tag LOCUS_18320 3871 3635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 5134 3938 gene locus_tag LOCUS_18330 5134 3938 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392801.1 protein_id gnl|my_center|LOCUS_18330 >Feature sequence219 615 52 gene locus_tag LOCUS_18340 615 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 907 626 gene locus_tag LOCUS_18350 907 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 2315 1029 gene locus_tag LOCUS_18360 2315 1029 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_18360 2463 2317 gene locus_tag LOCUS_18370 2463 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 3442 2465 gene locus_tag LOCUS_18380 3442 2465 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18380 4680 3457 gene locus_tag LOCUS_18390 gene alaC 4680 3457 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546347.1 protein_id gnl|my_center|LOCUS_18390 5018 4779 gene locus_tag LOCUS_18400 5018 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 <5803 5033 gene locus_tag LOCUS_18410 <5803 5033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393263.1:lipoyl synthase >Feature sequence220 1484 537 gene locus_tag LOCUS_18420 1484 537 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868480.1 protein_id gnl|my_center|LOCUS_18420 2635 1481 gene locus_tag LOCUS_18430 gene porA 2635 1481 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877345.1 protein_id gnl|my_center|LOCUS_18430 4314 2632 gene locus_tag LOCUS_18440 4314 2632 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_18440 4889 4311 gene locus_tag LOCUS_18450 4889 4311 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868483.1 protein_id gnl|my_center|LOCUS_18450 5103 5735 gene locus_tag LOCUS_18460 5103 5735 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973468.1 protein_id gnl|my_center|LOCUS_18460 >Feature sequence221 638 2530 gene locus_tag LOCUS_18470 638 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 2743 3624 gene locus_tag LOCUS_18480 2743 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 3746 3922 gene locus_tag LOCUS_18490 3746 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 4037 4714 gene locus_tag LOCUS_18500 4037 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 5257 4688 gene locus_tag LOCUS_18510 5257 4688 CDS product NADAR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034360921.1 protein_id gnl|my_center|LOCUS_18510 5450 5229 gene locus_tag LOCUS_18520 5450 5229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 >Feature sequence222 241 2064 gene locus_tag LOCUS_18530 241 2064 CDS product fumarate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061070.1 protein_id gnl|my_center|LOCUS_18530 2064 2729 gene locus_tag LOCUS_18540 2064 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 3430 2936 gene locus_tag LOCUS_18550 gene amrA 3430 2936 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941768.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18550 4525 3455 gene locus_tag LOCUS_18560 gene amrB 4525 3455 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980136.1 protein_id gnl|my_center|LOCUS_18560 4961 4530 gene locus_tag LOCUS_18570 4961 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 5512 5015 gene locus_tag LOCUS_18580 5512 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 >Feature sequence223 2098 1571 gene locus_tag LOCUS_18590 gene nuoE 2098 1571 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_18590 2851 2168 gene locus_tag LOCUS_18600 2851 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 3282 4541 gene locus_tag LOCUS_18610 3282 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 >Feature sequence224 1431 220 gene locus_tag LOCUS_18620 1431 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 2293 1547 gene locus_tag LOCUS_18630 2293 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 2633 2265 gene locus_tag LOCUS_18640 2633 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 3465 2731 gene locus_tag LOCUS_18650 3465 2731 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393713.1 protein_id gnl|my_center|LOCUS_18650 4146 3562 gene locus_tag LOCUS_18660 4146 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 5062 4286 gene locus_tag LOCUS_18670 5062 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 >Feature sequence225 133 312 gene locus_tag LOCUS_18680 133 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 707 2122 gene locus_tag LOCUS_18690 707 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 2138 3013 gene locus_tag LOCUS_18700 2138 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 3269 3084 gene locus_tag LOCUS_18710 3269 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 3249 3542 gene locus_tag LOCUS_18720 3249 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 >Feature sequence226 762 1334 gene locus_tag LOCUS_18730 762 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 2614 1802 gene locus_tag LOCUS_18740 2614 1802 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065502.1 protein_id gnl|my_center|LOCUS_18740 3554 4606 gene locus_tag LOCUS_18750 3554 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 >Feature sequence227 1457 318 gene locus_tag LOCUS_18760 1457 318 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_18760 2964 2065 gene locus_tag LOCUS_18770 2964 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 >Feature sequence228 1227 334 gene locus_tag LOCUS_18780 1227 334 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083536.1 protein_id gnl|my_center|LOCUS_18780 2278 1295 gene locus_tag LOCUS_18790 2278 1295 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256388.1 protein_id gnl|my_center|LOCUS_18790 2707 3936 gene locus_tag LOCUS_18800 2707 3936 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064343.1 protein_id gnl|my_center|LOCUS_18800 3951 4916 gene locus_tag LOCUS_18810 3951 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 >Feature sequence229 688 428 gene locus_tag LOCUS_18820 688 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 1342 2589 gene locus_tag LOCUS_18830 1342 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 2996 3778 gene locus_tag LOCUS_18840 2996 3778 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445567.1 protein_id gnl|my_center|LOCUS_18840 >Feature sequence230 4251 5129 gene locus_tag LOCUS_18850 4251 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 5126 5257 gene locus_tag LOCUS_18860 5126 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 >Feature sequence231 <1 550 gene locus_tag LOCUS_18870 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082231.1:23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN 670 1644 gene locus_tag LOCUS_18880 670 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 3098 1965 gene locus_tag LOCUS_18890 3098 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545363.1 protein_id gnl|my_center|LOCUS_18890 3456 4436 gene locus_tag LOCUS_18900 3456 4436 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963619.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence232 1330 305 gene locus_tag LOCUS_18910 gene galT 1330 305 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546259.1 protein_id gnl|my_center|LOCUS_18910 2661 1636 gene locus_tag LOCUS_18920 2661 1636 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_18920 3104 2709 gene locus_tag LOCUS_18930 3104 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18930 4019 3399 gene locus_tag LOCUS_18940 gene cobB 4019 3399 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240270.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18940 5303 4380 gene locus_tag LOCUS_18950 5303 4380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 >Feature sequence233 608 976 gene locus_tag LOCUS_18960 608 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 3435 1012 gene locus_tag LOCUS_18970 3435 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 1042 1077 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3558 3439 gene locus_tag LOCUS_18980 3558 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 3746 3552 gene locus_tag LOCUS_18990 3746 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 4333 3743 gene locus_tag LOCUS_19000 4333 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 5004 4348 gene locus_tag LOCUS_19010 5004 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 >Feature sequence234 1506 703 gene locus_tag LOCUS_19020 1506 703 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085567.1 protein_id gnl|my_center|LOCUS_19020 3301 1634 gene locus_tag LOCUS_19030 3301 1634 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869041.1 protein_id gnl|my_center|LOCUS_19030 3762 3307 gene locus_tag LOCUS_19040 3762 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 4488 3874 gene locus_tag LOCUS_19050 4488 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 >Feature sequence235 1433 1053 gene locus_tag LOCUS_19060 1433 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 1836 1384 gene locus_tag LOCUS_19070 1836 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 2460 2131 gene locus_tag LOCUS_19080 2460 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 2809 2462 gene locus_tag LOCUS_19090 2809 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 3398 2760 gene locus_tag LOCUS_19100 3398 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 3594 4310 gene locus_tag LOCUS_19110 3594 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19110 4244 4732 gene locus_tag LOCUS_19120 4244 4732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 <5612 4823 gene locus_tag LOCUS_19130 <5612 4823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000004512.1:lysine--tRNA ligase >Feature sequence236 2337 1681 gene locus_tag LOCUS_19140 2337 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 2932 2489 gene locus_tag LOCUS_19150 2932 2489 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966842.1 protein_id gnl|my_center|LOCUS_19150 4317 3169 gene locus_tag LOCUS_19160 4317 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 <5587 4292 gene locus_tag LOCUS_19170 <5587 4292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943139.1:fused MFS/spermidine synthase 4339 4365 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence237 1978 44 gene locus_tag LOCUS_19180 1978 44 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138655632.1 protein_id gnl|my_center|LOCUS_19180 2835 2254 gene locus_tag LOCUS_19190 2835 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 3502 3038 gene locus_tag LOCUS_19200 3502 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 3958 5511 gene locus_tag LOCUS_19210 3958 5511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 >Feature sequence238 23 703 gene locus_tag LOCUS_19220 23 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 1692 1856 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3176 2445 gene locus_tag LOCUS_19230 3176 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 3720 3181 gene locus_tag LOCUS_19240 3720 3181 CDS product DUF4416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544933.1 protein_id gnl|my_center|LOCUS_19240 4535 3720 gene locus_tag LOCUS_19250 4535 3720 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933874.1 protein_id gnl|my_center|LOCUS_19250 5039 4569 gene locus_tag LOCUS_19260 5039 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 >Feature sequence239 <1 970 gene locus_tag LOCUS_19270 <1 970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942086.1:mercury methylation corrinoid protein HgcA 1103 1378 gene locus_tag LOCUS_19280 gene hgcB 1103 1378 CDS product mercury methylation ferredoxin HgcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942087.1 protein_id gnl|my_center|LOCUS_19280 1811 3307 gene locus_tag LOCUS_19290 1811 3307 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940912.1 protein_id gnl|my_center|LOCUS_19290 3483 4016 gene locus_tag LOCUS_19300 3483 4016 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195801.1 protein_id gnl|my_center|LOCUS_19300 5201 4107 gene locus_tag LOCUS_19310 5201 4107 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879220.1 protein_id gnl|my_center|LOCUS_19310 >Feature sequence240 1507 752 gene locus_tag LOCUS_19320 1507 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 1424 1717 gene locus_tag LOCUS_19330 1424 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 3218 2259 gene locus_tag LOCUS_19340 3218 2259 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242543.1 protein_id gnl|my_center|LOCUS_19340 3454 3215 gene locus_tag LOCUS_19350 3454 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 4649 3705 gene locus_tag LOCUS_19360 gene alr 4649 3705 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_19360 4575 4787 gene locus_tag LOCUS_19370 4575 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 5570 4956 gene locus_tag LOCUS_19380 5570 4956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 >Feature sequence241 621 79 gene locus_tag LOCUS_19390 621 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 1404 634 gene locus_tag LOCUS_19400 1404 634 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460483.1 protein_id gnl|my_center|LOCUS_19400 1655 1728 gene locus_tag LOCUS_t00110 1655 1728 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1737 1810 gene locus_tag LOCUS_t00120 1737 1810 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2466 1915 gene locus_tag LOCUS_19410 2466 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 3254 2457 gene locus_tag LOCUS_19420 3254 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 4975 3266 gene locus_tag LOCUS_19430 4975 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 5555 4890 gene locus_tag LOCUS_19440 5555 4890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 >Feature sequence242 328 1125 gene locus_tag LOCUS_19450 328 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 1255 3114 gene locus_tag LOCUS_19460 1255 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 3111 3935 gene locus_tag LOCUS_19470 3111 3935 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787899.1 protein_id gnl|my_center|LOCUS_19470 >Feature sequence243 902 312 gene locus_tag LOCUS_19480 902 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 1024 1109 gene locus_tag LOCUS_t00130 1024 1109 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1594 1328 gene locus_tag LOCUS_19490 1594 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 2056 1862 gene locus_tag LOCUS_19500 2056 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 4454 4140 gene locus_tag LOCUS_19510 4454 4140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 4829 4596 gene locus_tag LOCUS_19520 4829 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 >Feature sequence244 1 153 gene locus_tag LOCUS_19530 1 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 143 742 gene locus_tag LOCUS_19540 gene recR 143 742 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_19540 739 1629 gene locus_tag LOCUS_19550 gene xerD 739 1629 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390080.1 protein_id gnl|my_center|LOCUS_19550 1791 2603 gene locus_tag LOCUS_19560 1791 2603 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023815.1 protein_id gnl|my_center|LOCUS_19560 2600 3310 gene locus_tag LOCUS_19570 2600 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19570 3420 3986 gene locus_tag LOCUS_19580 3420 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19580 4153 5208 gene locus_tag LOCUS_19590 4153 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 >Feature sequence245 697 1008 gene locus_tag LOCUS_19600 697 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 1263 1024 gene locus_tag LOCUS_19610 1263 1024 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022122.1 protein_id gnl|my_center|LOCUS_19610 1571 1416 gene locus_tag LOCUS_19620 1571 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 1561 2094 gene locus_tag LOCUS_19630 1561 2094 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399302.1 protein_id gnl|my_center|LOCUS_19630 2495 2713 gene locus_tag LOCUS_19640 2495 2713 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083352.1 protein_id gnl|my_center|LOCUS_19640 3104 4756 gene locus_tag LOCUS_19650 3104 4756 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015051728.1 protein_id gnl|my_center|LOCUS_19650 5298 4753 gene locus_tag LOCUS_19660 5298 4753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 >Feature sequence246 1638 871 gene locus_tag LOCUS_19670 1638 871 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433117.1 protein_id gnl|my_center|LOCUS_19670 2444 1659 gene locus_tag LOCUS_19680 2444 1659 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_19680 3440 2697 gene locus_tag LOCUS_19690 3440 2697 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061277.1 protein_id gnl|my_center|LOCUS_19690 4392 3427 gene locus_tag LOCUS_19700 4392 3427 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876717.1 protein_id gnl|my_center|LOCUS_19700 5470 4712 gene locus_tag LOCUS_19710 5470 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 >Feature sequence247 1105 539 gene locus_tag LOCUS_19720 1105 539 CDS product pyruvate kinase alpha/beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393991.1 protein_id gnl|my_center|LOCUS_19720 2103 1129 gene locus_tag LOCUS_19730 2103 1129 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881382.1 protein_id gnl|my_center|LOCUS_19730 2530 3315 gene locus_tag LOCUS_19740 2530 3315 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_19740 3768 4937 gene locus_tag LOCUS_19750 3768 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 >Feature sequence248 1014 709 gene locus_tag LOCUS_19760 1014 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 1102 1434 gene locus_tag LOCUS_19770 1102 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 1392 2393 gene locus_tag LOCUS_19780 1392 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 2476 3531 gene locus_tag LOCUS_19790 2476 3531 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 protein_id gnl|my_center|LOCUS_19790 5194 3692 gene locus_tag LOCUS_19800 5194 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 >Feature sequence249 321 4103 gene locus_tag LOCUS_19810 321 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 >Feature sequence250 1176 523 gene locus_tag LOCUS_19820 1176 523 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262785.1 protein_id gnl|my_center|LOCUS_19820 1969 1535 gene locus_tag LOCUS_19830 gene rplM 1969 1535 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004560141.1 protein_id gnl|my_center|LOCUS_19830 2397 2218 gene locus_tag LOCUS_19840 2397 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 3244 2399 gene locus_tag LOCUS_19850 gene mshM 3244 2399 CDS product MSHA fimbrial biogenesis protein MshM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704366.1 protein_id gnl|my_center|LOCUS_19850 4402 3284 gene locus_tag LOCUS_19860 4402 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 4702 5040 gene locus_tag LOCUS_19870 4702 5040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 5046 5252 gene locus_tag LOCUS_19880 5046 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 >Feature sequence251 918 25 gene locus_tag LOCUS_19890 gene nadA 918 25 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940699.1 protein_id gnl|my_center|LOCUS_19890 1267 908 gene locus_tag LOCUS_19900 1267 908 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027487.1 protein_id gnl|my_center|LOCUS_19900 2500 1598 gene locus_tag LOCUS_19910 gene panC 2500 1598 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080408.1 protein_id gnl|my_center|LOCUS_19910 3303 2497 gene locus_tag LOCUS_19920 gene panB 3303 2497 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_19920 3901 3407 gene locus_tag LOCUS_19930 gene folK 3901 3407 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173770.1 protein_id gnl|my_center|LOCUS_19930 4279 3902 gene locus_tag LOCUS_19940 gene folB 4279 3902 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861219.1 protein_id gnl|my_center|LOCUS_19940 <5467 4814 gene locus_tag LOCUS_19950 <5467 4814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392408.1:LL-diaminopimelate aminotransferase >Feature sequence252 <1 727 gene locus_tag LOCUS_19960 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003437761.1:cobyric acid synthase 2250 745 gene locus_tag LOCUS_19970 2250 745 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941000.1 protein_id gnl|my_center|LOCUS_19970 2575 3372 gene locus_tag LOCUS_19980 2575 3372 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941353.1 protein_id gnl|my_center|LOCUS_19980 4689 3409 gene locus_tag LOCUS_19990 4689 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 <5466 4721 gene locus_tag LOCUS_20000 <5466 4721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965035.1:Stk1 family PASTA domain-containing Ser/Thr kinase >Feature sequence253 1955 2809 gene locus_tag LOCUS_20010 1955 2809 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941312.1 protein_id gnl|my_center|LOCUS_20010 3144 3977 gene locus_tag LOCUS_20020 3144 3977 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941313.1 protein_id gnl|my_center|LOCUS_20020 4151 4978 gene locus_tag LOCUS_20030 gene rsmI 4151 4978 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391594.1 protein_id gnl|my_center|LOCUS_20030 >Feature sequence254 275 102 gene locus_tag LOCUS_20040 275 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 526 1254 gene locus_tag LOCUS_20050 526 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 1142 2506 gene locus_tag LOCUS_20060 1142 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 2757 4997 gene locus_tag LOCUS_20070 2757 4997 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459738.1 protein_id gnl|my_center|LOCUS_20070 >Feature sequence255 551 78 gene locus_tag LOCUS_20080 551 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 1076 672 gene locus_tag LOCUS_20090 1076 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 1644 3128 gene locus_tag LOCUS_20100 1644 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 4080 3313 gene locus_tag LOCUS_20110 gene fliP 4080 3313 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081361032.1 protein_id gnl|my_center|LOCUS_20110 4726 4070 gene locus_tag LOCUS_20120 4726 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 5133 4723 gene locus_tag LOCUS_20130 5133 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 >Feature sequence256 <1 681 gene locus_tag LOCUS_20140 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496733.1:tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 709 1395 gene locus_tag LOCUS_20150 709 1395 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867638.1 protein_id gnl|my_center|LOCUS_20150 1631 2638 gene locus_tag LOCUS_20160 1631 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 2769 3440 gene locus_tag LOCUS_20170 2769 3440 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_20170 3443 3844 gene locus_tag LOCUS_20180 gene tolR 3443 3844 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_20180 5219 4047 gene locus_tag LOCUS_20190 5219 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 >Feature sequence257 242 9 gene locus_tag LOCUS_20200 242 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 311 457 gene locus_tag LOCUS_20210 311 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 701 853 gene locus_tag LOCUS_20220 701 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 997 2064 gene locus_tag LOCUS_20230 997 2064 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942506.1 protein_id gnl|my_center|LOCUS_20230 2045 2800 gene locus_tag LOCUS_20240 2045 2800 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942505.1 protein_id gnl|my_center|LOCUS_20240 2908 3453 gene locus_tag LOCUS_20250 2908 3453 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940603.1 protein_id gnl|my_center|LOCUS_20250 3658 4239 gene locus_tag LOCUS_20260 3658 4239 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943910.1 protein_id gnl|my_center|LOCUS_20260 <5380 4251 gene locus_tag LOCUS_20270 <5380 4251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943547.1:ATP-binding protein >Feature sequence258 732 1655 gene locus_tag LOCUS_20280 732 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 1759 2109 gene locus_tag LOCUS_20290 1759 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 2172 3077 gene locus_tag LOCUS_20300 2172 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 3139 3498 gene locus_tag LOCUS_20310 3139 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 3543 4628 gene locus_tag LOCUS_20320 3543 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 >Feature sequence259 1822 455 gene locus_tag LOCUS_20330 1822 455 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895572.1 protein_id gnl|my_center|LOCUS_20330 2109 3014 gene locus_tag LOCUS_20340 2109 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 2966 3373 gene locus_tag LOCUS_20350 2966 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 5121 3517 gene locus_tag LOCUS_20360 5121 3517 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143441.1 protein_id gnl|my_center|LOCUS_20360 >Feature sequence260 2295 2711 gene locus_tag LOCUS_20370 2295 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 2761 3156 gene locus_tag LOCUS_20380 2761 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 3153 4754 gene locus_tag LOCUS_20390 3153 4754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 >Feature sequence261 2352 1312 gene locus_tag LOCUS_20400 2352 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 3337 2411 gene locus_tag LOCUS_20410 3337 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 3702 3334 gene locus_tag LOCUS_20420 3702 3334 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940992.1 protein_id gnl|my_center|LOCUS_20420 4286 3699 gene locus_tag LOCUS_20430 4286 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 4743 4291 gene locus_tag LOCUS_20440 gene gspG 4743 4291 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_20440 <5347 4759 gene locus_tag LOCUS_20450 <5347 4759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940995.1:type II secretion system inner membrane protein GspF >Feature sequence262 <1 645 gene locus_tag LOCUS_20460 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861405.1:class I SAM-dependent methyltransferase 804 1622 gene locus_tag LOCUS_20470 804 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 2507 1767 gene locus_tag LOCUS_20480 2507 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 4228 2504 gene locus_tag LOCUS_20490 4228 2504 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870027.1 protein_id gnl|my_center|LOCUS_20490 5214 4228 gene locus_tag LOCUS_20500 5214 4228 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459270.1 protein_id gnl|my_center|LOCUS_20500 >Feature sequence263 1459 377 gene locus_tag LOCUS_20510 1459 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 1495 1579 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2259 3275 gene locus_tag LOCUS_20520 2259 3275 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_20520 3309 4172 gene locus_tag LOCUS_20530 3309 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 4153 4788 gene locus_tag LOCUS_20540 4153 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 >Feature sequence264 1769 90 gene locus_tag LOCUS_20550 1769 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 2959 2588 gene locus_tag LOCUS_20560 2959 2588 CDS product Lin0512 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086800.1 protein_id gnl|my_center|LOCUS_20560 3155 3901 gene locus_tag LOCUS_20570 3155 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 3898 4257 gene locus_tag LOCUS_20580 3898 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 4369 4533 gene locus_tag LOCUS_20590 4369 4533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 >Feature sequence265 1524 2435 gene locus_tag LOCUS_20600 1524 2435 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228840.1 protein_id gnl|my_center|LOCUS_20600 3588 2986 gene locus_tag LOCUS_20610 3588 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 3937 5262 gene locus_tag LOCUS_20620 3937 5262 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539284.1 protein_id gnl|my_center|LOCUS_20620 >Feature sequence266 105 509 gene locus_tag LOCUS_20630 105 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 846 1472 gene locus_tag LOCUS_20640 846 1472 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272276.1 protein_id gnl|my_center|LOCUS_20640 2142 3509 gene locus_tag LOCUS_20650 2142 3509 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937988.1 protein_id gnl|my_center|LOCUS_20650 3585 4556 gene locus_tag LOCUS_20660 3585 4556 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085927.1 protein_id gnl|my_center|LOCUS_20660 4620 4781 gene locus_tag LOCUS_20670 4620 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 >Feature sequence267 547 353 gene locus_tag LOCUS_20680 547 353 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868845.1 protein_id gnl|my_center|LOCUS_20680 1348 701 gene locus_tag LOCUS_20690 1348 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 1623 1393 gene locus_tag LOCUS_20700 1623 1393 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878154.1 protein_id gnl|my_center|LOCUS_20700 4101 1642 gene locus_tag LOCUS_20710 gene mutS 4101 1642 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476178.1 protein_id gnl|my_center|LOCUS_20710 4871 4098 gene locus_tag LOCUS_20720 4871 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20720 >Feature sequence268 81 275 gene locus_tag LOCUS_20730 81 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 2166 397 gene locus_tag LOCUS_20740 2166 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 2761 2201 gene locus_tag LOCUS_20750 2761 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 3036 3311 gene locus_tag LOCUS_20760 3036 3311 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403362.1 protein_id gnl|my_center|LOCUS_20760 3623 4531 gene locus_tag LOCUS_20770 3623 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 >Feature sequence269 2374 1925 gene locus_tag LOCUS_20780 2374 1925 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356741.1 protein_id gnl|my_center|LOCUS_20780 2521 4473 gene locus_tag LOCUS_20790 2521 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 4593 4509 gene locus_tag LOCUS_t00140 4593 4509 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence270 1234 1515 gene locus_tag LOCUS_20800 1234 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 1539 2357 gene locus_tag LOCUS_20810 1539 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 2950 4608 gene locus_tag LOCUS_20820 gene glpA 2950 4608 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128118.1 protein_id gnl|my_center|LOCUS_20820 >Feature sequence271 2158 1016 gene locus_tag LOCUS_20830 2158 1016 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_20830 3462 2191 gene locus_tag LOCUS_20840 3462 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 4469 3459 gene locus_tag LOCUS_20850 4469 3459 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256314.1 protein_id gnl|my_center|LOCUS_20850 <5256 4560 gene locus_tag LOCUS_20860 <5256 4560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877828.1:glycosyltransferase family 2 protein >Feature sequence272 924 1145 gene locus_tag LOCUS_20870 924 1145 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007190.1 protein_id gnl|my_center|LOCUS_20870 1648 2652 gene locus_tag LOCUS_20880 1648 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 2710 3876 gene locus_tag LOCUS_20890 2710 3876 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496660.1 protein_id gnl|my_center|LOCUS_20890 3818 4765 gene locus_tag LOCUS_20900 3818 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 >Feature sequence273 <1 2391 gene locus_tag LOCUS_20910 <1 2391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003235011.1:ATP-dependent protease ATP-binding subunit ClpC 2480 4768 gene locus_tag LOCUS_20920 gene bamA 2480 4768 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546857.1 protein_id gnl|my_center|LOCUS_20920 >Feature sequence274 913 1683 gene locus_tag LOCUS_20930 gene iolB 913 1683 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583016.1 protein_id gnl|my_center|LOCUS_20930 1915 2700 gene locus_tag LOCUS_20940 gene kduD 1915 2700 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097013.1 protein_id gnl|my_center|LOCUS_20940 2765 3832 gene locus_tag LOCUS_20950 2765 3832 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_20950 4046 5017 gene locus_tag LOCUS_20960 4046 5017 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888346.1 protein_id gnl|my_center|LOCUS_20960 >Feature sequence275 <1 510 gene locus_tag LOCUS_20970 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870041.1:2-oxoacid:ferredoxin oxidoreductase subunit beta 656 1252 gene locus_tag LOCUS_20980 656 1252 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942116.1 protein_id gnl|my_center|LOCUS_20980 1388 2020 gene locus_tag LOCUS_20990 1388 2020 CDS product DUF3786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813269.1 protein_id gnl|my_center|LOCUS_20990 2017 2205 gene locus_tag LOCUS_21000 2017 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 2542 2766 gene locus_tag LOCUS_21010 2542 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 3005 2739 gene locus_tag LOCUS_21020 3005 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 4157 3261 gene locus_tag LOCUS_21030 4157 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 >Feature sequence276 91 240 gene locus_tag LOCUS_21040 gene rpmG 91 240 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881260.1 protein_id gnl|my_center|LOCUS_21040 295 371 gene locus_tag LOCUS_t00150 295 371 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 408 596 gene locus_tag LOCUS_21050 408 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 616 1503 gene locus_tag LOCUS_21060 616 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 1602 2027 gene locus_tag LOCUS_21070 gene rplK 1602 2027 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003718336.1 protein_id gnl|my_center|LOCUS_21070 2064 2774 gene locus_tag LOCUS_21080 gene rplA 2064 2774 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_21080 2907 4085 gene locus_tag LOCUS_21090 gene metK 2907 4085 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163127.1 protein_id gnl|my_center|LOCUS_21090 >Feature sequence277 62 1237 gene locus_tag LOCUS_21100 62 1237 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_21100 1263 1706 gene locus_tag LOCUS_21110 1263 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 1914 2774 gene locus_tag LOCUS_21120 1914 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 4388 2883 gene locus_tag LOCUS_21130 4388 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 >Feature sequence278 <1 950 gene locus_tag LOCUS_21140 <1 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392521.1:2-hydroxyacyl-CoA dehydratase family protein 947 2593 gene locus_tag LOCUS_21150 947 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 3945 2716 gene locus_tag LOCUS_21160 3945 2716 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528130.1 protein_id gnl|my_center|LOCUS_21160 4742 4512 gene locus_tag LOCUS_21170 4742 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 >Feature sequence279 <1 1459 gene locus_tag LOCUS_21180 <1 1459 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879591.1:thiamine pyrophosphate-binding protein 1986 2042 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2106 2477 gene locus_tag LOCUS_21190 2106 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 2531 3841 gene locus_tag LOCUS_21200 gene gabT 2531 3841 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093009.1 protein_id gnl|my_center|LOCUS_21200 >Feature sequence280 1769 399 gene locus_tag LOCUS_21210 1769 399 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057779.1 protein_id gnl|my_center|LOCUS_21210 2179 1982 gene locus_tag LOCUS_21220 2179 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 2417 2205 gene locus_tag LOCUS_21230 2417 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 2899 2468 gene locus_tag LOCUS_21240 2899 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 3026 2889 gene locus_tag LOCUS_21250 3026 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 3453 3253 gene locus_tag LOCUS_21260 3453 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 3695 3450 gene locus_tag LOCUS_21270 3695 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 3893 3744 gene locus_tag LOCUS_21280 3893 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 4333 5097 gene locus_tag LOCUS_21290 4333 5097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 >Feature sequence281 957 508 gene locus_tag LOCUS_21300 957 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 2111 891 gene locus_tag LOCUS_21310 2111 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 2635 2132 gene locus_tag LOCUS_21320 2635 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 3002 2661 gene locus_tag LOCUS_21330 3002 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 3902 3087 gene locus_tag LOCUS_21340 3902 3087 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_21340 3375 3399 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4870 4214 gene locus_tag LOCUS_21350 4870 4214 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943674.1 protein_id gnl|my_center|LOCUS_21350 >Feature sequence282 <1 1019 gene locus_tag LOCUS_21360 <1 1019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243665.1:tRNA nuclease WapA 1760 3553 gene locus_tag LOCUS_21370 1760 3553 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938364.1 protein_id gnl|my_center|LOCUS_21370 4521 3490 gene locus_tag LOCUS_21380 4521 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 <5083 4518 gene locus_tag LOCUS_21390 <5083 4518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948973.1:M14 family metallopeptidase >Feature sequence283 3258 904 gene locus_tag LOCUS_21400 3258 904 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022605.1 protein_id gnl|my_center|LOCUS_21400 <5076 3346 gene locus_tag LOCUS_21410 <5076 3346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003403397.1:arylsulfatase AtsD >Feature sequence284 529 2283 gene locus_tag LOCUS_21420 529 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 2779 2528 gene locus_tag LOCUS_21430 2779 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 3104 4060 gene locus_tag LOCUS_21440 3104 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 >Feature sequence285 1151 2329 gene locus_tag LOCUS_21450 1151 2329 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894393.1 protein_id gnl|my_center|LOCUS_21450 2446 2757 gene locus_tag LOCUS_21460 2446 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 <5065 3350 gene locus_tag LOCUS_21470 <5065 3350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037393370.1:thiamine pyrophosphate-binding protein >Feature sequence286 943 2226 gene locus_tag LOCUS_21480 943 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 2242 3033 gene locus_tag LOCUS_21490 2242 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 <5055 3043 gene locus_tag LOCUS_21500 <5055 3043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943139.1:fused MFS/spermidine synthase >Feature sequence287 1979 150 gene locus_tag LOCUS_21510 gene glmS 1979 150 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228994.1 protein_id gnl|my_center|LOCUS_21510 2336 2067 gene locus_tag LOCUS_21520 2336 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 3064 2456 gene locus_tag LOCUS_21530 gene cobC 3064 2456 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_21530 3599 3102 gene locus_tag LOCUS_21540 gene lepB 3599 3102 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870097.1 protein_id gnl|my_center|LOCUS_21540 <5045 3720 gene locus_tag LOCUS_21550 <5045 3720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941668.1:nitrogen fixation sigma-54 dependent transcriptional regulator GnfM >Feature sequence288 <1 1239 gene locus_tag LOCUS_21560 <1 1239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932547.1:CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein 1247 1456 gene locus_tag LOCUS_21570 1247 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21570 1466 3499 gene locus_tag LOCUS_21580 1466 3499 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878165.1 protein_id gnl|my_center|LOCUS_21580 3516 4691 gene locus_tag LOCUS_21590 gene qmoC 3516 4691 CDS product quinone-interacting membrane-bound oxidoreductase complex subunit QmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938150.1 protein_id gnl|my_center|LOCUS_21590 >Feature sequence289 1921 641 gene locus_tag LOCUS_21600 1921 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942546.1 protein_id gnl|my_center|LOCUS_21600 2877 2131 gene locus_tag LOCUS_21610 2877 2131 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_21610 2909 3097 gene locus_tag LOCUS_21620 2909 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 3302 3376 gene locus_tag LOCUS_t00160 3302 3376 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence290 862 554 gene locus_tag LOCUS_21630 862 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926944.1 protein_id gnl|my_center|LOCUS_21630 2886 1012 gene locus_tag LOCUS_21640 gene aprA 2886 1012 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879166.1 protein_id gnl|my_center|LOCUS_21640 3348 2905 gene locus_tag LOCUS_21650 gene aprB 3348 2905 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879165.1 protein_id gnl|my_center|LOCUS_21650 4753 3518 gene locus_tag LOCUS_21660 gene sat 4753 3518 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_21660 >Feature sequence291 1164 1838 gene locus_tag LOCUS_21670 1164 1838 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522833.1 protein_id gnl|my_center|LOCUS_21670 1835 3109 gene locus_tag LOCUS_21680 1835 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 3217 3570 gene locus_tag LOCUS_21690 3217 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 4690 3608 gene locus_tag LOCUS_21700 4690 3608 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256918.1 protein_id gnl|my_center|LOCUS_21700 >Feature sequence292 687 61 gene locus_tag LOCUS_21710 687 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 1786 776 gene locus_tag LOCUS_21720 1786 776 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766012.1 protein_id gnl|my_center|LOCUS_21720 2178 2459 gene locus_tag LOCUS_21730 2178 2459 CDS product HgcAB-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877983.1 protein_id gnl|my_center|LOCUS_21730 2456 3346 gene locus_tag LOCUS_21740 gene arsM 2456 3346 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023683.1 protein_id gnl|my_center|LOCUS_21740 3608 4246 gene locus_tag LOCUS_21750 3608 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 <4972 4417 gene locus_tag LOCUS_21760 <4972 4417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878705.1:3-keto-5-aminohexanoate cleavage protein >Feature sequence293 <1 1529 gene locus_tag LOCUS_21770 <1 1529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007332509.1:ATPase, T2SS/T4P/T4SS family 1942 2988 gene locus_tag LOCUS_21780 gene dnaA 1942 2988 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391551.1 protein_id gnl|my_center|LOCUS_21780 2985 3470 gene locus_tag LOCUS_21790 2985 3470 CDS product protein tyrosine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112150398.1 protein_id gnl|my_center|LOCUS_21790 3683 4102 gene locus_tag LOCUS_21800 3683 4102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21800 >Feature sequence294 1235 2998 gene locus_tag LOCUS_21810 1235 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 4236 3589 gene locus_tag LOCUS_21820 4236 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 >Feature sequence295 1398 490 gene locus_tag LOCUS_21830 1398 490 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545048.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21830 2759 1557 gene locus_tag LOCUS_21840 2759 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 3576 2827 gene locus_tag LOCUS_21850 3576 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 3881 3642 gene locus_tag LOCUS_21860 3881 3642 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903557.1 protein_id gnl|my_center|LOCUS_21860 4516 4169 gene locus_tag LOCUS_21870 4516 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 >Feature sequence296 443 616 gene locus_tag LOCUS_21880 443 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 1989 865 gene locus_tag LOCUS_21890 1989 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 3478 1958 gene locus_tag LOCUS_21900 3478 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 4862 3465 gene locus_tag LOCUS_21910 4862 3465 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_21910 >Feature sequence297 533 1474 gene locus_tag LOCUS_21920 gene cynR 533 1474 CDS product transcriptional regulator CynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237346.1 protein_id gnl|my_center|LOCUS_21920 1744 3309 gene locus_tag LOCUS_21930 gene lnt 1744 3309 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_21930 >Feature sequence298 80 1087 gene locus_tag LOCUS_21940 80 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 1296 1907 gene locus_tag LOCUS_21950 1296 1907 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926777.1 protein_id gnl|my_center|LOCUS_21950 1909 3243 gene locus_tag LOCUS_21960 1909 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 3296 4183 gene locus_tag LOCUS_21970 3296 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 <4889 4316 gene locus_tag LOCUS_21980 <4889 4316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583336.1:MFS transporter >Feature sequence299 2790 907 gene locus_tag LOCUS_21990 2790 907 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_21990 4861 2897 gene locus_tag LOCUS_22000 gene nuoL 4861 2897 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_22000 >Feature sequence300 3169 1388 gene locus_tag LOCUS_22010 3169 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 3540 3166 gene locus_tag LOCUS_22020 3540 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 4256 3537 gene locus_tag LOCUS_22030 4256 3537 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393713.1 protein_id gnl|my_center|LOCUS_22030 <4862 4246 gene locus_tag LOCUS_22040 <4862 4246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012289114.1:class I SAM-dependent methyltransferase >Feature sequence301 439 188 gene locus_tag LOCUS_22050 439 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22050 1606 443 gene locus_tag LOCUS_22060 1606 443 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943303.1 protein_id gnl|my_center|LOCUS_22060 1760 2416 gene locus_tag LOCUS_22070 1760 2416 CDS product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937368.1 protein_id gnl|my_center|LOCUS_22070 4787 2430 gene locus_tag LOCUS_22080 4787 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 >Feature sequence302 1757 978 gene locus_tag LOCUS_22090 1757 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 3086 1998 gene locus_tag LOCUS_22100 3086 1998 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878758.1 protein_id gnl|my_center|LOCUS_22100 4277 3693 gene locus_tag LOCUS_22110 4277 3693 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258084.1 protein_id gnl|my_center|LOCUS_22110 >Feature sequence303 48 1472 gene locus_tag LOCUS_22120 48 1472 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946753.1 protein_id gnl|my_center|LOCUS_22120 1628 2605 gene locus_tag LOCUS_22130 1628 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22130 2647 3435 gene locus_tag LOCUS_22140 2647 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22140 >Feature sequence304 2027 363 gene locus_tag LOCUS_22150 2027 363 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972394.1 protein_id gnl|my_center|LOCUS_22150 2491 2282 gene locus_tag LOCUS_22160 2491 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 <4819 2768 gene locus_tag LOCUS_22170 <4819 2768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958448.1:APC family permease >Feature sequence305 558 1052 gene locus_tag LOCUS_22180 558 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 1220 2230 gene locus_tag LOCUS_22190 1220 2230 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815232.1 protein_id gnl|my_center|LOCUS_22190 2289 2981 gene locus_tag LOCUS_22200 2289 2981 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867925.1 protein_id gnl|my_center|LOCUS_22200 3224 3511 gene locus_tag LOCUS_22210 3224 3511 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546355.1 protein_id gnl|my_center|LOCUS_22210 >Feature sequence306 919 32 gene locus_tag LOCUS_22220 919 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 2022 937 gene locus_tag LOCUS_22230 2022 937 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986796.1 protein_id gnl|my_center|LOCUS_22230 2696 2019 gene locus_tag LOCUS_22240 2696 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 <4810 3103 gene locus_tag LOCUS_22250 <4810 3103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974204.1:glucan 1,4-alpha-glucosidase >Feature sequence307 703 2157 gene locus_tag LOCUS_22260 703 2157 CDS product hydroxymethylglutaryl-CoA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919307.1 protein_id gnl|my_center|LOCUS_22260 2255 3289 gene locus_tag LOCUS_22270 2255 3289 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919308.1 protein_id gnl|my_center|LOCUS_22270 3586 3915 gene locus_tag LOCUS_22280 3586 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 4129 4202 gene locus_tag LOCUS_t00170 4129 4202 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4297 4473 gene locus_tag LOCUS_22290 4297 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 >Feature sequence308 80 319 gene locus_tag LOCUS_22300 gene acpP 80 319 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_22300 391 1071 gene locus_tag LOCUS_22310 391 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 1058 4054 gene locus_tag LOCUS_22320 1058 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 >Feature sequence309 1061 549 gene locus_tag LOCUS_22330 gene thpR 1061 549 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876222.1 protein_id gnl|my_center|LOCUS_22330 2062 1358 gene locus_tag LOCUS_22340 2062 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 2710 2489 gene locus_tag LOCUS_22350 2710 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 2917 2717 gene locus_tag LOCUS_22360 2917 2717 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878572.1 protein_id gnl|my_center|LOCUS_22360 3868 4650 gene locus_tag LOCUS_22370 3868 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 >Feature sequence310 <1 1369 gene locus_tag LOCUS_22380 <1 1369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943302.1:efflux RND transporter permease subunit 1788 4082 gene locus_tag LOCUS_22390 gene mrfA 1788 4082 CDS product ATP-dependent helicase MrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246149.1 protein_id gnl|my_center|LOCUS_22390 >Feature sequence311 98 370 gene locus_tag LOCUS_22400 98 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957044.1 protein_id gnl|my_center|LOCUS_22400 372 656 gene locus_tag LOCUS_22410 372 656 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_22410 878 1108 gene locus_tag LOCUS_22420 878 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 1093 1428 gene locus_tag LOCUS_22430 1093 1428 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373724.1 protein_id gnl|my_center|LOCUS_22430 1572 2162 gene locus_tag LOCUS_22440 1572 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 2298 2390 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2404 2664 gene locus_tag LOCUS_22450 2404 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 2867 3109 gene locus_tag LOCUS_22460 2867 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 3106 3369 gene locus_tag LOCUS_22470 3106 3369 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 protein_id gnl|my_center|LOCUS_22470 >Feature sequence312 1213 293 gene locus_tag LOCUS_22480 1213 293 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118555.1 protein_id gnl|my_center|LOCUS_22480 1776 1384 gene locus_tag LOCUS_22490 1776 1384 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118554.1 protein_id gnl|my_center|LOCUS_22490 4078 2669 gene locus_tag LOCUS_22500 4078 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 4583 4410 gene locus_tag LOCUS_22510 4583 4410 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545155.1 protein_id gnl|my_center|LOCUS_22510 >Feature sequence313 2352 2636 gene locus_tag LOCUS_22520 2352 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 >Feature sequence314 711 466 gene locus_tag LOCUS_22530 711 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22530 1423 701 gene locus_tag LOCUS_22540 1423 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22540 1741 1433 gene locus_tag LOCUS_22550 1741 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22550 2557 1757 gene locus_tag LOCUS_22560 2557 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22560 3315 2710 gene locus_tag LOCUS_22570 3315 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 4424 3312 gene locus_tag LOCUS_22580 4424 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 >Feature sequence315 <1 723 gene locus_tag LOCUS_22590 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_049979583.1:SDR family oxidoreductase 2934 817 gene locus_tag LOCUS_22600 2934 817 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_22600 2960 3089 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttaattcggggacaccatg 4247 3129 gene locus_tag LOCUS_22610 4247 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 >Feature sequence316 260 799 gene locus_tag LOCUS_22620 260 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 882 1421 gene locus_tag LOCUS_22630 882 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 1432 1728 gene locus_tag LOCUS_22640 1432 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 2042 2404 gene locus_tag LOCUS_22650 2042 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 3391 4671 gene locus_tag LOCUS_22660 gene orpR 3391 4671 CDS product sigma 54-interacting transcriptional regulator OrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939383.1 protein_id gnl|my_center|LOCUS_22660 >Feature sequence317 <1 787 gene locus_tag LOCUS_22670 <1 787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_177224003.1:transketolase 784 1800 gene locus_tag LOCUS_22680 784 1800 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_22680 1802 2596 gene locus_tag LOCUS_22690 1802 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 3394 3816 gene locus_tag LOCUS_22700 3394 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 3707 3739 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3942 4622 gene locus_tag LOCUS_22710 3942 4622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 >Feature sequence318 190 1353 gene locus_tag LOCUS_22720 190 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922607.1 protein_id gnl|my_center|LOCUS_22720 1827 2168 gene locus_tag LOCUS_22730 1827 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 3208 2510 gene locus_tag LOCUS_22740 3208 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 4232 3285 gene locus_tag LOCUS_22750 4232 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 >Feature sequence319 1682 537 gene locus_tag LOCUS_22760 1682 537 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391834.1 protein_id gnl|my_center|LOCUS_22760 2488 3804 gene locus_tag LOCUS_22770 2488 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 >Feature sequence320 63 1109 gene locus_tag LOCUS_22780 gene argC 63 1109 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 protein_id gnl|my_center|LOCUS_22780 1435 2031 gene locus_tag LOCUS_22790 1435 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 2042 2593 gene locus_tag LOCUS_22800 2042 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 2620 3282 gene locus_tag LOCUS_22810 2620 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 >Feature sequence321 2612 330 gene locus_tag LOCUS_22820 2612 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 4136 3273 gene locus_tag LOCUS_22830 gene ubiA 4136 3273 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941108.1 protein_id gnl|my_center|LOCUS_22830 >Feature sequence322 730 35 gene locus_tag LOCUS_22840 730 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 2006 996 gene locus_tag LOCUS_22850 2006 996 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929529.1 protein_id gnl|my_center|LOCUS_22850 2817 2581 gene locus_tag LOCUS_22860 2817 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 3140 2814 gene locus_tag LOCUS_22870 3140 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 <4589 3431 gene locus_tag LOCUS_22880 <4589 3431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482627.1:CusA/CzcA family heavy metal efflux RND transporter >Feature sequence323 1244 1411 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1537 2448 gene locus_tag LOCUS_22890 1537 2448 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938962.1 protein_id gnl|my_center|LOCUS_22890 2461 3417 gene locus_tag LOCUS_22900 2461 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_22900 3524 3784 gene locus_tag LOCUS_22910 3524 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 >Feature sequence324 659 1714 gene locus_tag LOCUS_22920 659 1714 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 protein_id gnl|my_center|LOCUS_22920 1927 2931 gene locus_tag LOCUS_22930 1927 2931 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545714.1 protein_id gnl|my_center|LOCUS_22930 3209 3406 gene locus_tag LOCUS_22940 3209 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 4460 3975 gene locus_tag LOCUS_22950 4460 3975 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809130.1 protein_id gnl|my_center|LOCUS_22950 >Feature sequence325 220 1821 gene locus_tag LOCUS_22960 220 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 2180 2434 gene locus_tag LOCUS_22970 2180 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 2431 2670 gene locus_tag LOCUS_22980 2431 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 3030 2857 gene locus_tag LOCUS_22990 3030 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 3166 3486 gene locus_tag LOCUS_23000 3166 3486 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582526.1 protein_id gnl|my_center|LOCUS_23000 3483 3833 gene locus_tag LOCUS_23010 3483 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 >Feature sequence326 615 1484 gene locus_tag LOCUS_23020 gene hisG 615 1484 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_23020 1751 2131 gene locus_tag LOCUS_23030 1751 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 2329 3600 gene locus_tag LOCUS_23040 2329 3600 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462314.1 protein_id gnl|my_center|LOCUS_23040 >Feature sequence327 1928 792 gene locus_tag LOCUS_23050 1928 792 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256328.1 protein_id gnl|my_center|LOCUS_23050 2355 2795 gene locus_tag LOCUS_23060 2355 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 >Feature sequence328 2109 2309 gene locus_tag LOCUS_23070 2109 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 2302 2475 gene locus_tag LOCUS_23080 2302 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 2761 2462 gene locus_tag LOCUS_23090 2761 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 3986 2907 gene locus_tag LOCUS_23100 3986 2907 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878758.1 protein_id gnl|my_center|LOCUS_23100 <4527 3970 gene locus_tag LOCUS_23110 <4527 3970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005093098.1:TetR/AcrR family transcriptional regulator >Feature sequence329 588 2408 gene locus_tag LOCUS_23120 588 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 2553 4244 gene locus_tag LOCUS_23130 2553 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 >Feature sequence330 317 1414 gene locus_tag LOCUS_23140 317 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 1529 3469 gene locus_tag LOCUS_23150 1529 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 3466 3834 gene locus_tag LOCUS_23160 3466 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 >Feature sequence331 1506 745 gene locus_tag LOCUS_23170 1506 745 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625442.1 protein_id gnl|my_center|LOCUS_23170 2392 1685 gene locus_tag LOCUS_23180 2392 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 3604 2468 gene locus_tag LOCUS_23190 gene narH 3604 2468 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692648.1 protein_id gnl|my_center|LOCUS_23190 4333 3653 gene locus_tag LOCUS_23200 4333 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 >Feature sequence332 <1 929 gene locus_tag LOCUS_23210 <1 929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876731.1:sodium-extruding oxaloacetate decarboxylase subunit alpha 1635 2903 gene locus_tag LOCUS_23220 1635 2903 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939561.1 protein_id gnl|my_center|LOCUS_23220 2896 3288 gene locus_tag LOCUS_23230 2896 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23230 3210 3222 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3285 3752 gene locus_tag LOCUS_23240 3285 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 >Feature sequence333 230 1072 gene locus_tag LOCUS_23250 230 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 1203 1364 gene locus_tag LOCUS_23260 1203 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 3162 1408 gene locus_tag LOCUS_23270 3162 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 3540 3803 gene locus_tag LOCUS_23280 3540 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 4108 3848 gene locus_tag LOCUS_23290 4108 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 >Feature sequence334 1703 618 gene locus_tag LOCUS_23300 1703 618 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814733.1 protein_id gnl|my_center|LOCUS_23300 1831 1700 gene locus_tag LOCUS_23310 1831 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 1863 1979 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2881 3150 gene locus_tag LOCUS_23320 2881 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 >Feature sequence335 515 66 gene locus_tag LOCUS_23330 gene nusB 515 66 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460271.1 protein_id gnl|my_center|LOCUS_23330 991 527 gene locus_tag LOCUS_23340 gene ribE 991 527 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392435.1 protein_id gnl|my_center|LOCUS_23340 2241 1045 gene locus_tag LOCUS_23350 2241 1045 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546813.1 protein_id gnl|my_center|LOCUS_23350 2891 2256 gene locus_tag LOCUS_23360 gene ribE 2891 2256 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493908.1 protein_id gnl|my_center|LOCUS_23360 3921 2893 gene locus_tag LOCUS_23370 gene ribD 3921 2893 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_23370 >Feature sequence336 1072 1881 gene locus_tag LOCUS_23380 1072 1881 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941438.1 protein_id gnl|my_center|LOCUS_23380 1968 3386 gene locus_tag LOCUS_23390 1968 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23390 3329 3351 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3415 4068 gene locus_tag LOCUS_23400 3415 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 >Feature sequence337 344 1000 gene locus_tag LOCUS_23410 344 1000 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030700.1 protein_id gnl|my_center|LOCUS_23410 1191 1679 gene locus_tag LOCUS_23420 1191 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 3146 1746 gene locus_tag LOCUS_23430 3146 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 3855 3148 gene locus_tag LOCUS_23440 3855 3148 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584029.1 protein_id gnl|my_center|LOCUS_23440 4285 3845 gene locus_tag LOCUS_23450 4285 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23450 >Feature sequence338 316 1677 gene locus_tag LOCUS_23460 316 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 2071 1730 gene locus_tag LOCUS_23470 2071 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 2365 3093 gene locus_tag LOCUS_23480 2365 3093 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227561.1 protein_id gnl|my_center|LOCUS_23480 3455 3847 gene locus_tag LOCUS_23490 3455 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 >Feature sequence339 478 897 gene locus_tag LOCUS_23500 478 897 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937568.1 protein_id gnl|my_center|LOCUS_23500 1706 3475 gene locus_tag LOCUS_23510 1706 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 >Feature sequence340 1850 987 gene locus_tag LOCUS_23520 1850 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 2329 1949 gene locus_tag LOCUS_23530 2329 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 3012 3179 gene locus_tag LOCUS_23540 3012 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 >Feature sequence341 1033 104 gene locus_tag LOCUS_23550 gene miaA 1033 104 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_23550 2902 1076 gene locus_tag LOCUS_23560 gene mutL 2902 1076 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532334.1 protein_id gnl|my_center|LOCUS_23560 3123 3176 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence342 489 2009 gene locus_tag LOCUS_23570 489 2009 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941354.1 protein_id gnl|my_center|LOCUS_23570 2166 3599 gene locus_tag LOCUS_23580 gene gatB 2166 3599 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393504.1 protein_id gnl|my_center|LOCUS_23580 3676 3999 gene locus_tag LOCUS_23590 3676 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 >Feature sequence343 2301 1099 gene locus_tag LOCUS_23600 2301 1099 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545761.1 protein_id gnl|my_center|LOCUS_23600 3473 2547 gene locus_tag LOCUS_23610 gene argF 3473 2547 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_23610 <4362 3454 gene locus_tag LOCUS_23620 <4362 3454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393770.1:acetylornithine transaminase >Feature sequence344 2462 1083 gene locus_tag LOCUS_23630 gene hemL 2462 1083 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496557.1 protein_id gnl|my_center|LOCUS_23630 4284 2884 gene locus_tag LOCUS_23640 gene hemL 4284 2884 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496557.1 protein_id gnl|my_center|LOCUS_23640 >Feature sequence345 582 1658 gene locus_tag LOCUS_23650 582 1658 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878758.1 protein_id gnl|my_center|LOCUS_23650 2087 2113 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2162 3058 gene locus_tag LOCUS_23660 2162 3058 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940234.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23660 3080 3754 gene locus_tag LOCUS_23670 3080 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 >Feature sequence346 <1 2679 gene locus_tag LOCUS_23680 <1 2679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_063171192.1:molybdopterin oxidoreductase family protein 2672 3307 gene locus_tag LOCUS_23690 2672 3307 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809567.1 protein_id gnl|my_center|LOCUS_23690 >Feature sequence347 1090 1263 gene locus_tag LOCUS_23700 1090 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 1429 3609 gene locus_tag LOCUS_23710 1429 3609 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942516.1 protein_id gnl|my_center|LOCUS_23710 4208 3660 gene locus_tag LOCUS_23720 4208 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 >Feature sequence348 638 1546 gene locus_tag LOCUS_23730 638 1546 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870179.1 protein_id gnl|my_center|LOCUS_23730 1793 2449 gene locus_tag LOCUS_23740 1793 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 2532 4133 gene locus_tag LOCUS_23750 2532 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 >Feature sequence349 151 429 gene locus_tag LOCUS_23760 151 429 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_23760 966 445 gene locus_tag LOCUS_23770 966 445 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943406.1 protein_id gnl|my_center|LOCUS_23770 1135 1007 gene locus_tag LOCUS_23780 1135 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 1641 1150 gene locus_tag LOCUS_23790 1641 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 2285 3601 gene locus_tag LOCUS_23800 2285 3601 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030377.1 protein_id gnl|my_center|LOCUS_23800 4052 3804 gene locus_tag LOCUS_23810 4052 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 >Feature sequence350 1844 213 gene locus_tag LOCUS_23820 1844 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 2691 3209 gene locus_tag LOCUS_23830 2691 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23830 3262 3675 gene locus_tag LOCUS_23840 3262 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23840 >Feature sequence351 1856 879 gene locus_tag LOCUS_23850 1856 879 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943294.1 protein_id gnl|my_center|LOCUS_23850 2949 1849 gene locus_tag LOCUS_23860 gene pdhA 2949 1849 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943293.1 protein_id gnl|my_center|LOCUS_23860 3522 2965 gene locus_tag LOCUS_23870 3522 2965 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404046.1 protein_id gnl|my_center|LOCUS_23870 >Feature sequence352 3 866 gene locus_tag LOCUS_23880 3 866 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941192.1 protein_id gnl|my_center|LOCUS_23880 961 2169 gene locus_tag LOCUS_23890 gene ilvA 961 2169 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272642.1 protein_id gnl|my_center|LOCUS_23890 3040 2507 gene locus_tag LOCUS_23900 3040 2507 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584147.1 protein_id gnl|my_center|LOCUS_23900 <4240 3043 gene locus_tag LOCUS_23910 <4240 3043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940636.1:sigma 54-interacting transcriptional regulator >Feature sequence353 1976 666 gene locus_tag LOCUS_23920 1976 666 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976337.1 protein_id gnl|my_center|LOCUS_23920 <4240 2683 gene locus_tag LOCUS_23930 <4240 2683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162890715.1:PAS domain-containing sensor histidine kinase >Feature sequence354 <1 794 gene locus_tag LOCUS_23940 <1 794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000978074.1:polysaccharide export protein 1574 927 gene locus_tag LOCUS_23950 1574 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 2789 2028 gene locus_tag LOCUS_23960 gene cbiQ 2789 2028 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545677.1 protein_id gnl|my_center|LOCUS_23960 3497 2796 gene locus_tag LOCUS_23970 3497 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 4098 3469 gene locus_tag LOCUS_23980 gene cbiM 4098 3469 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938357.1 protein_id gnl|my_center|LOCUS_23980 >Feature sequence355 2703 2317 gene locus_tag LOCUS_23990 2703 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 2852 4027 gene locus_tag LOCUS_24000 2852 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 >Feature sequence356 625 2394 gene locus_tag LOCUS_24010 625 2394 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940770.1 protein_id gnl|my_center|LOCUS_24010 >Feature sequence357 <1 933 gene locus_tag LOCUS_24020 <1 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937573.1:(Fe-S)-binding protein 1070 2500 gene locus_tag LOCUS_24030 1070 2500 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546279.1 protein_id gnl|my_center|LOCUS_24030 2650 4137 gene locus_tag LOCUS_24040 2650 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 >Feature sequence358 790 392 gene locus_tag LOCUS_24050 790 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 1060 2397 gene locus_tag LOCUS_24060 1060 2397 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582827.1 protein_id gnl|my_center|LOCUS_24060 3424 2642 gene locus_tag LOCUS_24070 3424 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 <4160 3454 gene locus_tag LOCUS_24080 <4160 3454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099262600.1:GGDEF domain-containing protein >Feature sequence359 271 1734 gene locus_tag LOCUS_24090 271 1734 CDS product 4-hydroxyphenylacetate 3-hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878527.1 protein_id gnl|my_center|LOCUS_24090 1827 2672 gene locus_tag LOCUS_24100 1827 2672 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088350.1 protein_id gnl|my_center|LOCUS_24100 2776 3978 gene locus_tag LOCUS_24110 2776 3978 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879732.1 protein_id gnl|my_center|LOCUS_24110 >Feature sequence360 188 493 gene locus_tag LOCUS_24120 188 493 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389622.1 protein_id gnl|my_center|LOCUS_24120 506 1228 gene locus_tag LOCUS_24130 506 1228 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963620.1 protein_id gnl|my_center|LOCUS_24130 1654 2634 gene locus_tag LOCUS_24140 1654 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 3927 2704 gene locus_tag LOCUS_24150 3927 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 >Feature sequence361 253 3039 gene locus_tag LOCUS_24160 253 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 2556 2638 gene locus_tag LOCUS_t00180 2556 2638 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 <4124 3036 gene locus_tag LOCUS_24170 <4124 3036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964893.1:MFS transporter >Feature sequence362 3 236 gene locus_tag LOCUS_24180 3 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 295 435 gene locus_tag LOCUS_24190 295 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24190 481 1260 gene locus_tag LOCUS_24200 481 1260 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24200 1257 2450 gene locus_tag LOCUS_24210 gene lpxB 1257 2450 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_24210 2440 3588 gene locus_tag LOCUS_24220 2440 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 >Feature sequence363 1162 3003 gene locus_tag LOCUS_24230 1162 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 3377 4084 gene locus_tag LOCUS_24240 3377 4084 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940564.1 protein_id gnl|my_center|LOCUS_24240 >Feature sequence364 551 153 gene locus_tag LOCUS_24250 551 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 1993 668 gene locus_tag LOCUS_24260 1993 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 3915 2257 gene locus_tag LOCUS_24270 3915 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 >Feature sequence365 956 75 gene locus_tag LOCUS_24280 956 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 2032 2188 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2190 2711 gene locus_tag LOCUS_24290 2190 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 2836 4101 gene locus_tag LOCUS_24300 2836 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 >Feature sequence366 170 2242 gene locus_tag LOCUS_24310 170 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 2667 2879 gene locus_tag LOCUS_24320 2667 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 2947 3105 gene locus_tag LOCUS_24330 2947 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 >Feature sequence367 602 964 gene locus_tag LOCUS_24340 602 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 2358 1141 gene locus_tag LOCUS_24350 2358 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 3373 2324 gene locus_tag LOCUS_24360 3373 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 4050 3631 gene locus_tag LOCUS_24370 4050 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 >Feature sequence368 577 696 gene locus_tag LOCUS_24380 577 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 882 938 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1023 1709 gene locus_tag LOCUS_24390 1023 1709 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_24390 2005 3774 gene locus_tag LOCUS_24400 2005 3774 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722633.1 protein_id gnl|my_center|LOCUS_24400 >Feature sequence369 122 1021 gene locus_tag LOCUS_24410 122 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 1023 1829 gene locus_tag LOCUS_24420 1023 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 1837 2898 gene locus_tag LOCUS_24430 1837 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 >Feature sequence370 289 198 gene locus_tag LOCUS_t00190 289 198 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1515 673 gene locus_tag LOCUS_24440 gene ccsB 1515 673 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941276.1 protein_id gnl|my_center|LOCUS_24440 3302 1515 gene locus_tag LOCUS_24450 3302 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 >Feature sequence371 <1 1073 gene locus_tag LOCUS_24460 <1 1073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546471.1:acyl-CoA dehydrogenase family protein 1070 1807 gene locus_tag LOCUS_24470 1070 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 1908 2810 gene locus_tag LOCUS_24480 1908 2810 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410917.1 protein_id gnl|my_center|LOCUS_24480 >Feature sequence372 45 896 gene locus_tag LOCUS_24490 45 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 921 2693 gene locus_tag LOCUS_24500 gene aspS 921 2693 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393178.1 protein_id gnl|my_center|LOCUS_24500 3729 2698 gene locus_tag LOCUS_24510 gene cydB 3729 2698 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940528.1 protein_id gnl|my_center|LOCUS_24510 3179 3192 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence373 2500 854 gene locus_tag LOCUS_24520 gene rseP 2500 854 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881281.1 protein_id gnl|my_center|LOCUS_24520 3654 2497 gene locus_tag LOCUS_24530 3654 2497 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_24530 >Feature sequence374 570 854 gene locus_tag LOCUS_24540 570 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 2252 1437 gene locus_tag LOCUS_24550 2252 1437 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921011.1 protein_id gnl|my_center|LOCUS_24550 3749 2394 gene locus_tag LOCUS_24560 3749 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 3794 3913 gene locus_tag LOCUS_24570 3794 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 >Feature sequence375 67 375 gene locus_tag LOCUS_24580 67 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24580 375 1484 gene locus_tag LOCUS_24590 375 1484 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392163.1 protein_id gnl|my_center|LOCUS_24590 1690 2214 gene locus_tag LOCUS_24600 1690 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 2498 2650 gene locus_tag LOCUS_24610 2498 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 2719 3489 gene locus_tag LOCUS_24620 2719 3489 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090527.1 protein_id gnl|my_center|LOCUS_24620 >Feature sequence376 <1 796 gene locus_tag LOCUS_24630 <1 796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941157.1:YifB family Mg chelatase-like AAA ATPase 904 1266 gene locus_tag LOCUS_24640 904 1266 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_24640 1928 3031 gene locus_tag LOCUS_24650 1928 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 >Feature sequence377 1569 457 gene locus_tag LOCUS_24660 1569 457 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109306.1 protein_id gnl|my_center|LOCUS_24660 <3971 1612 gene locus_tag LOCUS_24670 <3971 1612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870232.1:DUF6079 family protein >Feature sequence378 297 1709 gene locus_tag LOCUS_24680 gene acdAII 297 1709 CDS product acetate--CoA ligase I subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868410.1 protein_id gnl|my_center|LOCUS_24680 2378 1968 gene locus_tag LOCUS_24690 2378 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 <3967 2496 gene locus_tag LOCUS_24700 <3967 2496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461578.1:ASKHA domain-containing protein >Feature sequence379 197 667 gene locus_tag LOCUS_24710 197 667 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_24710 974 2971 gene locus_tag LOCUS_24720 gene uvrB 974 2971 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 protein_id gnl|my_center|LOCUS_24720 3890 3225 gene locus_tag LOCUS_24730 3890 3225 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949054.1 protein_id gnl|my_center|LOCUS_24730 >Feature sequence380 295 1038 gene locus_tag LOCUS_24740 295 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 1863 2342 gene locus_tag LOCUS_24750 1863 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 2441 3925 gene locus_tag LOCUS_24760 gene glgA 2441 3925 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_24760 >Feature sequence381 676 203 gene locus_tag LOCUS_24770 676 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 1547 666 gene locus_tag LOCUS_24780 1547 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 2361 1540 gene locus_tag LOCUS_24790 gene larE 2361 1540 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_24790 3392 2553 gene locus_tag LOCUS_24800 3392 2553 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061125.1 protein_id gnl|my_center|LOCUS_24800 3945 3394 gene locus_tag LOCUS_24810 3945 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 >Feature sequence382 374 1177 gene locus_tag LOCUS_24820 374 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 1694 1894 gene locus_tag LOCUS_24830 1694 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 2135 3430 gene locus_tag LOCUS_24840 2135 3430 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727913.1 protein_id gnl|my_center|LOCUS_24840 >Feature sequence383 1734 298 gene locus_tag LOCUS_24850 gene abfD 1734 298 CDS product 4-hydroxybutyryl-CoA dehydratase/vinylacetyl-CoA-Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430738.1 protein_id gnl|my_center|LOCUS_24850 3036 1939 gene locus_tag LOCUS_24860 3036 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 3108 3722 gene locus_tag LOCUS_24870 3108 3722 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134795.1 protein_id gnl|my_center|LOCUS_24870 >Feature sequence384 1929 232 gene locus_tag LOCUS_24880 1929 232 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878005.1 protein_id gnl|my_center|LOCUS_24880 2134 2331 gene locus_tag LOCUS_24890 2134 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 3134 2532 gene locus_tag LOCUS_24900 3134 2532 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943271.1 protein_id gnl|my_center|LOCUS_24900 >Feature sequence385 626 39 gene locus_tag LOCUS_24910 626 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 1389 655 gene locus_tag LOCUS_24920 1389 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 1852 3180 gene locus_tag LOCUS_24930 1852 3180 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684564.1 protein_id gnl|my_center|LOCUS_24930 3295 3777 gene locus_tag LOCUS_24940 3295 3777 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404673.1 protein_id gnl|my_center|LOCUS_24940 >Feature sequence386 265 1518 gene locus_tag LOCUS_24950 265 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 1511 1810 gene locus_tag LOCUS_24960 1511 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 1883 3562 gene locus_tag LOCUS_24970 gene ilvB 1883 3562 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545836.1 protein_id gnl|my_center|LOCUS_24970 >Feature sequence387 813 514 gene locus_tag LOCUS_24980 813 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 1516 932 gene locus_tag LOCUS_24990 1516 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 2959 1757 gene locus_tag LOCUS_25000 2959 1757 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462194.1 protein_id gnl|my_center|LOCUS_25000 >Feature sequence388 1258 218 gene locus_tag LOCUS_25010 1258 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 2683 1412 gene locus_tag LOCUS_25020 2683 1412 CDS product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053727.1 protein_id gnl|my_center|LOCUS_25020 2961 3461 gene locus_tag LOCUS_25030 2961 3461 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454132.1 protein_id gnl|my_center|LOCUS_25030 >Feature sequence389 1418 615 gene locus_tag LOCUS_25040 1418 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 2917 1886 gene locus_tag LOCUS_25050 2917 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 1942 2011 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence390 3 578 gene locus_tag LOCUS_25060 3 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 2445 733 gene locus_tag LOCUS_25070 2445 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25070 <3844 2421 gene locus_tag LOCUS_25080 <3844 2421 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003357577.1:DNA helicase PcrA >Feature sequence391 350 1012 gene locus_tag LOCUS_25090 350 1012 CDS product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937368.1 protein_id gnl|my_center|LOCUS_25090 1357 2445 gene locus_tag LOCUS_25100 1357 2445 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924853.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25100 >Feature sequence392 3341 1923 gene locus_tag LOCUS_25110 3341 1923 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892598.1 protein_id gnl|my_center|LOCUS_25110 >Feature sequence393 84 995 gene locus_tag LOCUS_25120 gene prmC 84 995 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257490.1 protein_id gnl|my_center|LOCUS_25120 992 1687 gene locus_tag LOCUS_25130 gene radC 992 1687 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013377.1 protein_id gnl|my_center|LOCUS_25130 1778 2338 gene locus_tag LOCUS_25140 1778 2338 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971370.1 protein_id gnl|my_center|LOCUS_25140 2313 3086 gene locus_tag LOCUS_25150 gene pssA 2313 3086 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546557.1 protein_id gnl|my_center|LOCUS_25150 >Feature sequence394 394 44 gene locus_tag LOCUS_25160 394 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 1117 1740 gene locus_tag LOCUS_25170 gene purN 1117 1740 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393541.1 protein_id gnl|my_center|LOCUS_25170 2610 3800 gene locus_tag LOCUS_25180 2610 3800 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279209.1 protein_id gnl|my_center|LOCUS_25180 >Feature sequence395 938 75 gene locus_tag LOCUS_25190 938 75 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064910.1 protein_id gnl|my_center|LOCUS_25190 2271 1114 gene locus_tag LOCUS_25200 2271 1114 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943453.1 protein_id gnl|my_center|LOCUS_25200 3684 2551 gene locus_tag LOCUS_25210 3684 2551 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943452.1 protein_id gnl|my_center|LOCUS_25210 >Feature sequence396 2789 1527 gene locus_tag LOCUS_25220 2789 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 <3823 3158 gene locus_tag LOCUS_25230 <3823 3158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224292.1:bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein >Feature sequence397 659 1630 gene locus_tag LOCUS_25240 gene rbsK 659 1630 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257591.1 protein_id gnl|my_center|LOCUS_25240 1797 2588 gene locus_tag LOCUS_25250 1797 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 2729 3745 gene locus_tag LOCUS_25260 gene bdhA 2729 3745 CDS product (R,R)-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645822.1 protein_id gnl|my_center|LOCUS_25260 >Feature sequence398 8 1027 gene locus_tag LOCUS_25270 8 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 1024 3273 gene locus_tag LOCUS_25280 1024 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 >Feature sequence399 2095 833 gene locus_tag LOCUS_25290 2095 833 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877563.1 protein_id gnl|my_center|LOCUS_25290 3024 2419 gene locus_tag LOCUS_25300 3024 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 3425 2934 gene locus_tag LOCUS_25310 3425 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25310 >Feature sequence400 <1 627 gene locus_tag LOCUS_25320 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705074.1:isocitrate dehydrogenase 1189 1641 gene locus_tag LOCUS_25330 1189 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 1825 3645 gene locus_tag LOCUS_25340 1825 3645 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072773675.1 protein_id gnl|my_center|LOCUS_25340 >Feature sequence401 1367 42 gene locus_tag LOCUS_25350 1367 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 1984 3183 gene locus_tag LOCUS_25360 1984 3183 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728380.1 protein_id gnl|my_center|LOCUS_25360 >Feature sequence402 204 656 gene locus_tag LOCUS_25370 204 656 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940354.1 protein_id gnl|my_center|LOCUS_25370 646 1218 gene locus_tag LOCUS_25380 646 1218 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392800.1 protein_id gnl|my_center|LOCUS_25380 1543 2058 gene locus_tag LOCUS_25390 1543 2058 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938859.1 protein_id gnl|my_center|LOCUS_25390 2070 2684 gene locus_tag LOCUS_25400 2070 2684 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876457.1 protein_id gnl|my_center|LOCUS_25400 2733 3740 gene locus_tag LOCUS_25410 2733 3740 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940529.1 protein_id gnl|my_center|LOCUS_25410 >Feature sequence403 <1 1893 gene locus_tag LOCUS_25420 <1 1893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943139.1:fused MFS/spermidine synthase 2336 1917 gene locus_tag LOCUS_25430 2336 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25430 2795 2373 gene locus_tag LOCUS_25440 2795 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 >Feature sequence404 <1 535 gene locus_tag LOCUS_25450 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546063.1:potassium channel protein 1614 631 gene locus_tag LOCUS_25460 1614 631 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816053.1 protein_id gnl|my_center|LOCUS_25460 2447 1662 gene locus_tag LOCUS_25470 2447 1662 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817158.1 protein_id gnl|my_center|LOCUS_25470 3279 2497 gene locus_tag LOCUS_25480 3279 2497 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229549.1 protein_id gnl|my_center|LOCUS_25480 >Feature sequence405 1480 341 gene locus_tag LOCUS_25490 1480 341 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941973.1 protein_id gnl|my_center|LOCUS_25490 1825 2709 gene locus_tag LOCUS_25500 1825 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 2870 3190 gene locus_tag LOCUS_25510 2870 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 <3754 3202 gene locus_tag LOCUS_25520 <3754 3202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460067.1:UxaA family hydrolase >Feature sequence406 2428 923 gene locus_tag LOCUS_25530 2428 923 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114294.1 protein_id gnl|my_center|LOCUS_25530 <3691 2462 gene locus_tag LOCUS_25540 <3691 2462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114295.1:FAD/NAD(P)-binding oxidoreductase >Feature sequence407 1289 2560 gene locus_tag LOCUS_25550 1289 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 >Feature sequence408 <1 1881 gene locus_tag LOCUS_25560 <1 1881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012255936.1:molybdopterin-dependent oxidoreductase 1697 1787 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1872 2222 gene locus_tag LOCUS_25570 1872 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 2455 2781 gene locus_tag LOCUS_25580 2455 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 2849 3592 gene locus_tag LOCUS_25590 2849 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 >Feature sequence409 1791 82 gene locus_tag LOCUS_25600 1791 82 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144207.1 protein_id gnl|my_center|LOCUS_25600 >Feature sequence410 1450 929 gene locus_tag LOCUS_25610 1450 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25610 2466 1447 gene locus_tag LOCUS_25620 gene galT 2466 1447 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546259.1 protein_id gnl|my_center|LOCUS_25620 <3655 2684 gene locus_tag LOCUS_25630 <3655 2684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941686.1:glycogen/starch synthase >Feature sequence411 1803 1375 gene locus_tag LOCUS_25640 1803 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 2927 1791 gene locus_tag LOCUS_25650 gene rffA 2927 1791 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950550.1 protein_id gnl|my_center|LOCUS_25650 <3649 2936 gene locus_tag LOCUS_25660 <3649 2936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_114948346.1:class I SAM-dependent methyltransferase >Feature sequence412 2429 1050 gene locus_tag LOCUS_25670 2429 1050 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066616.1 protein_id gnl|my_center|LOCUS_25670 3476 2433 gene locus_tag LOCUS_25680 3476 2433 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879345.1 protein_id gnl|my_center|LOCUS_25680 >Feature sequence413 1468 446 gene locus_tag LOCUS_25690 1468 446 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613588.1 protein_id gnl|my_center|LOCUS_25690 1937 1488 gene locus_tag LOCUS_25700 1937 1488 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021906.1 protein_id gnl|my_center|LOCUS_25700 >Feature sequence414 1319 57 gene locus_tag LOCUS_25710 1319 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 3049 1934 gene locus_tag LOCUS_25720 3049 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 >Feature sequence415 28 2040 gene locus_tag LOCUS_25730 gene ligA 28 2040 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_25730 3513 2347 gene locus_tag LOCUS_25740 3513 2347 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392827.1 protein_id gnl|my_center|LOCUS_25740 >Feature sequence416 837 226 gene locus_tag LOCUS_25750 837 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 1848 1195 gene locus_tag LOCUS_25760 1848 1195 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939847.1 protein_id gnl|my_center|LOCUS_25760 2270 2824 gene locus_tag LOCUS_25770 2270 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 2911 3453 gene locus_tag LOCUS_25780 2911 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 >Feature sequence417 129 728 gene locus_tag LOCUS_25790 gene cysC 129 728 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140515.1 protein_id gnl|my_center|LOCUS_25790 1045 1923 gene locus_tag LOCUS_25800 1045 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 2974 1970 gene locus_tag LOCUS_25810 2974 1970 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327684.1 protein_id gnl|my_center|LOCUS_25810 >Feature sequence418 574 1797 gene locus_tag LOCUS_25820 574 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 1942 2136 gene locus_tag LOCUS_25830 1942 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 2647 2988 gene locus_tag LOCUS_25840 2647 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 2991 3407 gene locus_tag LOCUS_25850 2991 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 >Feature sequence419 397 1221 gene locus_tag LOCUS_25860 397 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 1281 2360 gene locus_tag LOCUS_25870 1281 2360 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878758.1 protein_id gnl|my_center|LOCUS_25870 2747 2861 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2881 3528 gene locus_tag LOCUS_25880 2881 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 >Feature sequence420 647 1798 gene locus_tag LOCUS_25890 647 1798 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686571.1 protein_id gnl|my_center|LOCUS_25890 2153 3421 gene locus_tag LOCUS_25900 2153 3421 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027081.1 protein_id gnl|my_center|LOCUS_25900 >Feature sequence421 703 1227 gene locus_tag LOCUS_25910 gene hpt 703 1227 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_25910 1388 2347 gene locus_tag LOCUS_25920 1388 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25920 2376 3176 gene locus_tag LOCUS_25930 2376 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25930 >Feature sequence422 733 1854 gene locus_tag LOCUS_25940 gene gltA 733 1854 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393026.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25940 2162 2779 gene locus_tag LOCUS_25950 2162 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 >Feature sequence423 180 1817 gene locus_tag LOCUS_25960 180 1817 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_25960 1810 2592 gene locus_tag LOCUS_25970 1810 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 2740 3189 gene locus_tag LOCUS_25980 gene smpB 2740 3189 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583706.1 protein_id gnl|my_center|LOCUS_25980 3209 3561 gene locus_tag LOCUS_tm00010 3209 3561 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence424 857 30 gene locus_tag LOCUS_25990 857 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 1742 1365 gene locus_tag LOCUS_26000 1742 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 1957 1733 gene locus_tag LOCUS_26010 1957 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 2250 2020 gene locus_tag LOCUS_26020 2250 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 2525 2262 gene locus_tag LOCUS_26030 2525 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 <3545 2525 gene locus_tag LOCUS_26040 <3545 2525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968694.1:class I SAM-dependent DNA methyltransferase >Feature sequence425 <1 832 gene locus_tag LOCUS_26050 <1 832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113783.1:acyl-CoA synthetase 1273 1473 gene locus_tag LOCUS_26060 1273 1473 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546429.1 protein_id gnl|my_center|LOCUS_26060 2201 1545 gene locus_tag LOCUS_26070 2201 1545 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438774.1 protein_id gnl|my_center|LOCUS_26070 2431 3024 gene locus_tag LOCUS_26080 2431 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 3039 3284 gene locus_tag LOCUS_26090 3039 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 >Feature sequence426 1223 27 gene locus_tag LOCUS_26100 1223 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 2323 1460 gene locus_tag LOCUS_26110 2323 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 3312 2314 gene locus_tag LOCUS_26120 3312 2314 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657813.1 protein_id gnl|my_center|LOCUS_26120 >Feature sequence427 <1 632 gene locus_tag LOCUS_26130 <1 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460067.1:UxaA family hydrolase 1920 1003 gene locus_tag LOCUS_26140 1920 1003 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071875.1 protein_id gnl|my_center|LOCUS_26140 2189 2662 gene locus_tag LOCUS_26150 2189 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 >Feature sequence428 244 990 gene locus_tag LOCUS_26160 244 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 1099 1230 gene locus_tag LOCUS_26170 1099 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 1719 2882 gene locus_tag LOCUS_26180 1719 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 3224 3379 gene locus_tag LOCUS_26190 3224 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 >Feature sequence429 74 694 gene locus_tag LOCUS_26200 74 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 1005 921 gene locus_tag LOCUS_t00200 1005 921 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1940 1245 gene locus_tag LOCUS_26210 1940 1245 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957975.1 protein_id gnl|my_center|LOCUS_26210 2192 2267 gene locus_tag LOCUS_t00210 2192 2267 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 <3488 2449 gene locus_tag LOCUS_26220 <3488 2449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257267.1:response regulator >Feature sequence430 48 518 gene locus_tag LOCUS_26230 48 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 692 619 gene locus_tag LOCUS_t00220 692 619 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3145 1682 gene locus_tag LOCUS_26240 gene dacB 3145 1682 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839168.1 protein_id gnl|my_center|LOCUS_26240 3479 3138 gene locus_tag LOCUS_26250 3479 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 >Feature sequence431 845 1753 gene locus_tag LOCUS_26260 845 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 1954 3291 gene locus_tag LOCUS_26270 1954 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223273.1 protein_id gnl|my_center|LOCUS_26270 >Feature sequence432 1070 255 gene locus_tag LOCUS_26280 1070 255 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104791.1 protein_id gnl|my_center|LOCUS_26280 2785 1340 gene locus_tag LOCUS_26290 2785 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 >Feature sequence433 143 1831 gene locus_tag LOCUS_26300 143 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 2080 3342 gene locus_tag LOCUS_26310 2080 3342 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095742.1 protein_id gnl|my_center|LOCUS_26310 >Feature sequence434 172 723 gene locus_tag LOCUS_26320 172 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 753 1799 gene locus_tag LOCUS_26330 gene lpxD 753 1799 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_26330 2018 2163 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2234 3106 gene locus_tag LOCUS_26340 2234 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 >Feature sequence435 2258 885 gene locus_tag LOCUS_26350 2258 885 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_26350 2518 2243 gene locus_tag LOCUS_26360 2518 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 >Feature sequence436 1303 1677 gene locus_tag LOCUS_26370 1303 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 >Feature sequence437 256 891 gene locus_tag LOCUS_26380 256 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 902 1273 gene locus_tag LOCUS_26390 902 1273 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187552.1 protein_id gnl|my_center|LOCUS_26390 1424 1834 gene locus_tag LOCUS_26400 1424 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 1872 2765 gene locus_tag LOCUS_26410 1872 2765 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023463.1 protein_id gnl|my_center|LOCUS_26410 >Feature sequence438 647 165 gene locus_tag LOCUS_26420 647 165 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250569.1 protein_id gnl|my_center|LOCUS_26420 >Feature sequence439 1640 1200 gene locus_tag LOCUS_26430 1640 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 1864 2199 gene locus_tag LOCUS_26440 1864 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 >Feature sequence440 741 232 gene locus_tag LOCUS_26450 741 232 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064927.1 protein_id gnl|my_center|LOCUS_26450 2112 832 gene locus_tag LOCUS_26460 2112 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 <3379 2109 gene locus_tag LOCUS_26470 <3379 2109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545860.1:cytochrome c family protein >Feature sequence441 <1 913 gene locus_tag LOCUS_26480 <1 913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015942576.1:nif11-like peptide radical SAM maturase 936 1256 gene locus_tag LOCUS_26490 936 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 1333 2376 gene locus_tag LOCUS_26500 1333 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 2396 2992 gene locus_tag LOCUS_26510 2396 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 >Feature sequence442 1420 782 gene locus_tag LOCUS_26520 1420 782 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940677.1 protein_id gnl|my_center|LOCUS_26520 1940 1951 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence443 3 1082 gene locus_tag LOCUS_26530 gene bioB 3 1082 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_26530 1198 2400 gene locus_tag LOCUS_26540 gene bioF 1198 2400 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_26540 >Feature sequence444 1395 427 gene locus_tag LOCUS_26550 1395 427 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257987.1 protein_id gnl|my_center|LOCUS_26550 2702 1527 gene locus_tag LOCUS_26560 2702 1527 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878822.1 protein_id gnl|my_center|LOCUS_26560 >Feature sequence445 337 468 gene locus_tag LOCUS_26570 337 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 752 1027 gene locus_tag LOCUS_26580 752 1027 CDS product HgcAB-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877983.1 protein_id gnl|my_center|LOCUS_26580 1283 2152 gene locus_tag LOCUS_26590 1283 2152 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941196.1 protein_id gnl|my_center|LOCUS_26590 >Feature sequence446 1213 143 gene locus_tag LOCUS_26600 1213 143 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878191.1 protein_id gnl|my_center|LOCUS_26600 2243 1329 gene locus_tag LOCUS_26610 2243 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 3112 2459 gene locus_tag LOCUS_26620 3112 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 >Feature sequence447 339 25 gene locus_tag LOCUS_26630 339 25 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393250.1 protein_id gnl|my_center|LOCUS_26630 623 336 gene locus_tag LOCUS_26640 623 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 3023 627 gene locus_tag LOCUS_26650 gene pheT 3023 627 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393251.1 protein_id gnl|my_center|LOCUS_26650 >Feature sequence448 801 2330 gene locus_tag LOCUS_26660 801 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 2273 2422 gene locus_tag LOCUS_26670 2273 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 2883 2434 gene locus_tag LOCUS_26680 2883 2434 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242881.1 protein_id gnl|my_center|LOCUS_26680 >Feature sequence449 1397 297 gene locus_tag LOCUS_26690 1397 297 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392449.1 protein_id gnl|my_center|LOCUS_26690 2194 1601 gene locus_tag LOCUS_26700 2194 1601 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889526.1 protein_id gnl|my_center|LOCUS_26700 2461 3207 gene locus_tag LOCUS_26710 2461 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 >Feature sequence450 1110 949 gene locus_tag LOCUS_26720 1110 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 1239 1607 gene locus_tag LOCUS_26730 1239 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 1909 2463 gene locus_tag LOCUS_26740 1909 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 3126 2734 gene locus_tag LOCUS_26750 3126 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 >Feature sequence451 525 97 gene locus_tag LOCUS_26760 525 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 1389 532 gene locus_tag LOCUS_26770 1389 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 1349 1630 gene locus_tag LOCUS_26780 1349 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 2113 2310 gene locus_tag LOCUS_26790 2113 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 3156 2338 gene locus_tag LOCUS_26800 3156 2338 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103932.1 protein_id gnl|my_center|LOCUS_26800 >Feature sequence452 2868 742 gene locus_tag LOCUS_26810 2868 742 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583261.1 protein_id gnl|my_center|LOCUS_26810 >Feature sequence453 <1 715 gene locus_tag LOCUS_26820 <1 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879276.1:thiamine pyrophosphate-binding protein 862 1914 gene locus_tag LOCUS_26830 862 1914 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_26830 1899 2219 gene locus_tag LOCUS_26840 1899 2219 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087993.1 protein_id gnl|my_center|LOCUS_26840 2495 3211 gene locus_tag LOCUS_26850 2495 3211 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877942.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26850 2512 2556 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence454 <1 1266 gene locus_tag LOCUS_26860 <1 1266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005810415.1:dimethyl sulfoxide reductase subunit A 1574 1939 gene locus_tag LOCUS_26870 1574 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 2083 2217 gene locus_tag LOCUS_26880 2083 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 2284 2949 gene locus_tag LOCUS_26890 2284 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 >Feature sequence455 1006 632 gene locus_tag LOCUS_26900 gene ndhC 1006 632 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258748.1 protein_id gnl|my_center|LOCUS_26900 1525 1016 gene locus_tag LOCUS_26910 gene nuoE 1525 1016 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969256.1 protein_id gnl|my_center|LOCUS_26910 2781 1567 gene locus_tag LOCUS_26920 gene nuoD 2781 1567 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_26920 <3298 2784 gene locus_tag LOCUS_26930 <3298 2784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941008.1:NADH-quinone oxidoreductase subunit C >Feature sequence456 3075 520 gene locus_tag LOCUS_26940 3075 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 >Feature sequence457 1855 515 gene locus_tag LOCUS_26950 1855 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 3167 2046 gene locus_tag LOCUS_26960 gene hemW 3167 2046 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_26960 >Feature sequence458 <3222 228 gene locus_tag LOCUS_26970 <3222 228 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932908.1:preprotein translocase subunit SecA >Feature sequence459 431 559 gene locus_tag LOCUS_26980 431 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 1022 1501 gene locus_tag LOCUS_26990 gene brxF 1022 1501 CDS product BREX-3 system P-loop-containing protein BrxF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870233.1 protein_id gnl|my_center|LOCUS_26990 >Feature sequence460 1422 2324 gene locus_tag LOCUS_27000 1422 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 >Feature sequence461 415 278 gene locus_tag LOCUS_27010 415 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 2685 724 gene locus_tag LOCUS_27020 2685 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 1471 1533 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence462 1733 1494 gene locus_tag LOCUS_27030 1733 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 2757 1816 gene locus_tag LOCUS_27040 2757 1816 CDS product bifunctional fructose-bisphosphatase/inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876504.1 protein_id gnl|my_center|LOCUS_27040 >Feature sequence463 1400 705 gene locus_tag LOCUS_27050 1400 705 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063534.1 protein_id gnl|my_center|LOCUS_27050 >Feature sequence464 662 447 gene locus_tag LOCUS_27060 662 447 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392439.1 protein_id gnl|my_center|LOCUS_27060 927 1118 gene locus_tag LOCUS_27070 gene rpmB 927 1118 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012547624.1 protein_id gnl|my_center|LOCUS_27070 1172 1426 gene locus_tag LOCUS_27080 1172 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 1640 2011 gene locus_tag LOCUS_27090 1640 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 2008 2340 gene locus_tag LOCUS_27100 2008 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 2715 2401 gene locus_tag LOCUS_27110 2715 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 3172 2843 gene locus_tag LOCUS_27120 3172 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 >Feature sequence465 2099 1317 gene locus_tag LOCUS_27130 2099 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 2206 2784 gene locus_tag LOCUS_27140 2206 2784 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083201.1 protein_id gnl|my_center|LOCUS_27140 >Feature sequence466 887 483 gene locus_tag LOCUS_27150 887 483 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082423.1 protein_id gnl|my_center|LOCUS_27150 1748 1086 gene locus_tag LOCUS_27160 1748 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 1916 1752 gene locus_tag LOCUS_27170 1916 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 2353 2865 gene locus_tag LOCUS_27180 2353 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 >Feature sequence467 960 1607 gene locus_tag LOCUS_27190 960 1607 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143203.1 protein_id gnl|my_center|LOCUS_27190 2105 3022 gene locus_tag LOCUS_27200 gene selD 2105 3022 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011344950.1 protein_id gnl|my_center|LOCUS_27200 >Feature sequence468 90 1736 gene locus_tag LOCUS_27210 90 1736 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109309.1 protein_id gnl|my_center|LOCUS_27210 2139 2624 gene locus_tag LOCUS_27220 2139 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 >Feature sequence469 2595 1492 gene locus_tag LOCUS_27230 gene rodA 2595 1492 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_27230 <3107 2595 gene locus_tag LOCUS_27240 <3107 2595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938087.1:penicillin-binding protein 2 >Feature sequence470 123 509 gene locus_tag LOCUS_27250 123 509 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_27250 845 2632 gene locus_tag LOCUS_27260 845 2632 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226611.1 protein_id gnl|my_center|LOCUS_27260 >Feature sequence471 1558 26 gene locus_tag LOCUS_27270 1558 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 2790 1555 gene locus_tag LOCUS_27280 2790 1555 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868852.1 protein_id gnl|my_center|LOCUS_27280 >Feature sequence472 1707 328 gene locus_tag LOCUS_27290 gene glmU 1707 328 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706816.1 protein_id gnl|my_center|LOCUS_27290 1874 1801 gene locus_tag LOCUS_t00230 1874 1801 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence473 1604 1023 gene locus_tag LOCUS_27300 1604 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 2982 1738 gene locus_tag LOCUS_27310 2982 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 >Feature sequence474 109 1059 gene locus_tag LOCUS_27320 109 1059 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393143.1 protein_id gnl|my_center|LOCUS_27320 1140 2138 gene locus_tag LOCUS_27330 gene gutB 1140 2138 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 protein_id gnl|my_center|LOCUS_27330 >Feature sequence475 1717 965 gene locus_tag LOCUS_27340 gene recO 1717 965 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060357.1 protein_id gnl|my_center|LOCUS_27340 >Feature sequence476 <1 1299 gene locus_tag LOCUS_27350 <1 1299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941960.1:phosphotransferase <3048 1303 gene locus_tag LOCUS_27360 <3048 1303 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249027.1:aldehyde ferredoxin oxidoreductase family protein >Feature sequence477 300 1487 gene locus_tag LOCUS_27370 300 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27370 1735 2934 gene locus_tag LOCUS_27380 1735 2934 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020191.1 protein_id gnl|my_center|LOCUS_27380 >Feature sequence478 <3013 1790 gene locus_tag LOCUS_27390 <3013 1790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005575582.1:alkaline phosphatase family protein >Feature sequence479 21 668 gene locus_tag LOCUS_27400 21 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 704 2038 gene locus_tag LOCUS_27410 704 2038 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 protein_id gnl|my_center|LOCUS_27410 >Feature sequence480 1 375 gene locus_tag LOCUS_27420 1 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 1074 2183 gene locus_tag LOCUS_27430 1074 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 >Feature sequence481 <1 1410 gene locus_tag LOCUS_27440 <1 1410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_033492290.1:GIY-YIG nuclease family protein 2724 1654 gene locus_tag LOCUS_27450 2724 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 >Feature sequence482 1603 2787 gene locus_tag LOCUS_27460 1603 2787 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870036.1 protein_id gnl|my_center|LOCUS_27460 >Feature sequence483 130 396 gene locus_tag LOCUS_27470 130 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 393 809 gene locus_tag LOCUS_27480 393 809 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967235.1 protein_id gnl|my_center|LOCUS_27480 868 1065 gene locus_tag LOCUS_27490 868 1065 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670205.1 protein_id gnl|my_center|LOCUS_27490 1062 1469 gene locus_tag LOCUS_27500 1062 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 >Feature sequence484 <1 1743 gene locus_tag LOCUS_27510 <1 1743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022820.1:CoB-CoM heterodisulfide reductase HdrA2 >Feature sequence485 1058 744 gene locus_tag LOCUS_27520 1058 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 1681 1058 gene locus_tag LOCUS_27530 1681 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 2281 2940 gene locus_tag LOCUS_27540 2281 2940 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065078.1 protein_id gnl|my_center|LOCUS_27540 >Feature sequence486 1237 455 gene locus_tag LOCUS_27550 1237 455 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403241.1 protein_id gnl|my_center|LOCUS_27550 2622 1234 gene locus_tag LOCUS_27560 2622 1234 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880656.1 protein_id gnl|my_center|LOCUS_27560 >Feature sequence487 666 2018 gene locus_tag LOCUS_27570 666 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255956.1 protein_id gnl|my_center|LOCUS_27570 2030 2878 gene locus_tag LOCUS_27580 2030 2878 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979652.1 protein_id gnl|my_center|LOCUS_27580 >Feature sequence488 <1 618 gene locus_tag LOCUS_27590 <1 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940438.1:HDOD domain-containing protein >Feature sequence489 804 1817 gene locus_tag LOCUS_27600 804 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 >Feature sequence490 1884 700 gene locus_tag LOCUS_27610 gene ahbC 1884 700 CDS product 12,18-didecarboxysiroheme deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022974.1 protein_id gnl|my_center|LOCUS_27610 >Feature sequence491 544 990 gene locus_tag LOCUS_27620 gene mraZ 544 990 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965432.1 protein_id gnl|my_center|LOCUS_27620 1039 1419 gene locus_tag LOCUS_27630 1039 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 1400 2443 gene locus_tag LOCUS_27640 gene rsmH 1400 2443 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943702.1 protein_id gnl|my_center|LOCUS_27640 >Feature sequence492 847 191 gene locus_tag LOCUS_27650 gene nth 847 191 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065874.1 protein_id gnl|my_center|LOCUS_27650 <2875 1083 gene locus_tag LOCUS_27660 <2875 1083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943038.1:PocR ligand-binding domain-containing protein >Feature sequence493 1300 344 gene locus_tag LOCUS_27670 1300 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 2109 1297 gene locus_tag LOCUS_27680 2109 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 2749 2039 gene locus_tag LOCUS_27690 2749 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 >Feature sequence494 <1 1268 gene locus_tag LOCUS_27700 <1 1268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868288.1:alkaline phosphatase family protein >Feature sequence495 989 567 gene locus_tag LOCUS_27710 989 567 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 protein_id gnl|my_center|LOCUS_27710 794 827 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1452 1195 gene locus_tag LOCUS_27720 1452 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 1717 1412 gene locus_tag LOCUS_27730 1717 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 <2853 1879 gene locus_tag LOCUS_27740 <2853 1879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015942637.1:metalloenzyme >Feature sequence496 1757 1122 gene locus_tag LOCUS_27750 1757 1122 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140484.1 protein_id gnl|my_center|LOCUS_27750 2642 2001 gene locus_tag LOCUS_27760 2642 2001 CDS product DUF6448 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943772.1 protein_id gnl|my_center|LOCUS_27760 >Feature sequence497 503 189 gene locus_tag LOCUS_27770 503 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 936 505 gene locus_tag LOCUS_27780 936 505 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881100.1 protein_id gnl|my_center|LOCUS_27780 1877 945 gene locus_tag LOCUS_27790 1877 945 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140767.1 protein_id gnl|my_center|LOCUS_27790 2701 1889 gene locus_tag LOCUS_27800 gene thiF 2701 1889 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880850.1 protein_id gnl|my_center|LOCUS_27800 >Feature sequence498 <2828 780 gene locus_tag LOCUS_27810 <2828 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112888.1:molybdopterin oxidoreductase family protein >Feature sequence499 651 448 gene locus_tag LOCUS_27820 651 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 1319 678 gene locus_tag LOCUS_27830 1319 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27830 1341 1392 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2078 2746 gene locus_tag LOCUS_27840 2078 2746 CDS product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940507.1 protein_id gnl|my_center|LOCUS_27840 >Feature sequence500 1893 643 gene locus_tag LOCUS_27850 1893 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 >Feature sequence501 227 1282 gene locus_tag LOCUS_27860 227 1282 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546105.1 protein_id gnl|my_center|LOCUS_27860 1303 2412 gene locus_tag LOCUS_27870 1303 2412 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_27870 2426 2614 gene locus_tag LOCUS_27880 2426 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 >Feature sequence502 798 619 gene locus_tag LOCUS_27890 798 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 2292 835 gene locus_tag LOCUS_27900 gene gcvPB 2292 835 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393440.1 protein_id gnl|my_center|LOCUS_27900 <2797 2289 gene locus_tag LOCUS_27910 <2797 2289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460675.1:aminomethyl-transferring glycine dehydrogenase subunit GcvPA >Feature sequence503 64 666 gene locus_tag LOCUS_27920 64 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 866 1630 gene locus_tag LOCUS_27930 866 1630 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_27930 <2792 1768 gene locus_tag LOCUS_27940 <2792 1768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528502.1:DHA2 family efflux MFS transporter permease subunit >Feature sequence504 691 371 gene locus_tag LOCUS_27950 691 371 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545631.1 protein_id gnl|my_center|LOCUS_27950 1025 861 gene locus_tag LOCUS_27960 1025 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 2137 1025 gene locus_tag LOCUS_27970 2137 1025 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140271.1 protein_id gnl|my_center|LOCUS_27970 2373 2254 gene locus_tag LOCUS_27980 2373 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 >Feature sequence505 1040 726 gene locus_tag LOCUS_27990 1040 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 2708 1047 gene locus_tag LOCUS_28000 2708 1047 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941262.1 protein_id gnl|my_center|LOCUS_28000 >Feature sequence506 303 16 gene locus_tag LOCUS_28010 303 16 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921003.1 protein_id gnl|my_center|LOCUS_28010 687 382 gene locus_tag LOCUS_28020 687 382 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257967.1 protein_id gnl|my_center|LOCUS_28020 1046 723 gene locus_tag LOCUS_28030 1046 723 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_28030 1341 1063 gene locus_tag LOCUS_28040 1341 1063 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_28040 2070 1441 gene locus_tag LOCUS_28050 2070 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 >Feature sequence507 272 1651 gene locus_tag LOCUS_28060 272 1651 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902969.1 protein_id gnl|my_center|LOCUS_28060 >Feature sequence508 539 108 gene locus_tag LOCUS_28070 539 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 991 620 gene locus_tag LOCUS_28080 991 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 1442 1002 gene locus_tag LOCUS_28090 1442 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 2066 1578 gene locus_tag LOCUS_28100 2066 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 >Feature sequence509 1975 857 gene locus_tag LOCUS_28110 1975 857 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_28110 2673 2017 gene locus_tag LOCUS_28120 gene lipB 2673 2017 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258689.1 protein_id gnl|my_center|LOCUS_28120 >Feature sequence510 1684 422 gene locus_tag LOCUS_28130 1684 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 2109 1681 gene locus_tag LOCUS_28140 2109 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 2754 2395 gene locus_tag LOCUS_28150 2754 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 >Feature sequence511 1209 1706 gene locus_tag LOCUS_28160 1209 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 1660 1998 gene locus_tag LOCUS_28170 1660 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 >Feature sequence512 63 2009 gene locus_tag LOCUS_28180 63 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 >Feature sequence513 439 2475 gene locus_tag LOCUS_28190 439 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 >Feature sequence514 648 1445 gene locus_tag LOCUS_28200 648 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 1442 2446 gene locus_tag LOCUS_28210 1442 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 >Feature sequence515 316 1317 gene locus_tag LOCUS_28220 316 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 2570 1401 gene locus_tag LOCUS_28230 2570 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 >Feature sequence516 2146 320 gene locus_tag LOCUS_28240 2146 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 >Feature sequence517 756 1022 gene locus_tag LOCUS_28250 756 1022 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944701.1 protein_id gnl|my_center|LOCUS_28250 1212 1829 gene locus_tag LOCUS_28260 1212 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 >Feature sequence518 112 1032 gene locus_tag LOCUS_28270 112 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 1840 1058 gene locus_tag LOCUS_28280 1840 1058 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921905.1 protein_id gnl|my_center|LOCUS_28280 >Feature sequence519 1084 149 gene locus_tag LOCUS_28290 1084 149 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393400.1 protein_id gnl|my_center|LOCUS_28290 2139 1081 gene locus_tag LOCUS_28300 2139 1081 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943449.1 protein_id gnl|my_center|LOCUS_28300 >Feature sequence520 106 564 gene locus_tag LOCUS_28310 106 564 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_28310 766 1614 gene locus_tag LOCUS_28320 gene htpX 766 1614 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360263.1 protein_id gnl|my_center|LOCUS_28320 >Feature sequence521 >Feature sequence522 525 1145 gene locus_tag LOCUS_28330 525 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 1177 2622 gene locus_tag LOCUS_28340 1177 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 >Feature sequence523 62 592 gene locus_tag LOCUS_28350 62 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 925 994 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1249 1040 gene locus_tag LOCUS_28360 1249 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 1567 1445 gene locus_tag LOCUS_28370 1567 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 1824 2006 gene locus_tag LOCUS_28380 1824 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 >Feature sequence524 <2648 1170 gene locus_tag LOCUS_28390 <2648 1170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012896469.1:glycerol kinase GlpK >Feature sequence525 23 1417 gene locus_tag LOCUS_28400 23 1417 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530690.1 protein_id gnl|my_center|LOCUS_28400 1591 1604 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2582 1758 gene locus_tag LOCUS_28410 2582 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 >Feature sequence526 876 145 gene locus_tag LOCUS_28420 876 145 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523383.1 protein_id gnl|my_center|LOCUS_28420 1472 873 gene locus_tag LOCUS_28430 1472 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 2496 1747 gene locus_tag LOCUS_28440 2496 1747 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_28440 >Feature sequence527 >Feature sequence528 746 21 gene locus_tag LOCUS_28450 746 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 1660 719 gene locus_tag LOCUS_28460 1660 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 1943 2575 gene locus_tag LOCUS_28470 1943 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 >Feature sequence529 2036 753 gene locus_tag LOCUS_28480 2036 753 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_28480 >Feature sequence530 <1 1256 gene locus_tag LOCUS_28490 <1 1256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072957.1:sigma-54 dependent transcriptional regulator 1497 2018 gene locus_tag LOCUS_28500 1497 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 2123 2569 gene locus_tag LOCUS_28510 2123 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 >Feature sequence531 74 286 gene locus_tag LOCUS_28520 74 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 >Feature sequence532 567 707 gene locus_tag LOCUS_28530 567 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 931 2235 gene locus_tag LOCUS_28540 931 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 >Feature sequence533 1888 728 gene locus_tag LOCUS_28550 1888 728 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879085.1 protein_id gnl|my_center|LOCUS_28550 1972 2091 gene locus_tag LOCUS_28560 1972 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 2229 2302 gene locus_tag LOCUS_t00240 2229 2302 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence534 1018 434 gene locus_tag LOCUS_28570 1018 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 2066 1059 gene locus_tag LOCUS_28580 2066 1059 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975510.1 protein_id gnl|my_center|LOCUS_28580 >Feature sequence535 529 44 gene locus_tag LOCUS_28590 529 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 975 637 gene locus_tag LOCUS_28600 975 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 >Feature sequence536 >Feature sequence537 511 1641 gene locus_tag LOCUS_28610 511 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 >Feature sequence538 <1 867 gene locus_tag LOCUS_28620 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257798.1:DEAD/DEAH box helicase note possible pseudo, frameshifted 716 766 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1145 1969 gene locus_tag LOCUS_28630 1145 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 >Feature sequence539 1098 7 gene locus_tag LOCUS_28640 1098 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 2178 1258 gene locus_tag LOCUS_28650 2178 1258 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257319.1 protein_id gnl|my_center|LOCUS_28650 >Feature sequence540 1501 1091 gene locus_tag LOCUS_28660 1501 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 1806 1498 gene locus_tag LOCUS_28670 1806 1498 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812480.1 protein_id gnl|my_center|LOCUS_28670 2036 1917 gene locus_tag LOCUS_28680 2036 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 2301 2480 gene locus_tag LOCUS_28690 2301 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 >Feature sequence541 2074 665 gene locus_tag LOCUS_28700 2074 665 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088880.1 protein_id gnl|my_center|LOCUS_28700 >Feature sequence542 >Feature sequence543 164 871 gene locus_tag LOCUS_28710 164 871 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460898.1 protein_id gnl|my_center|LOCUS_28710 912 2423 gene locus_tag LOCUS_28720 912 2423 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028844369.1 protein_id gnl|my_center|LOCUS_28720 >Feature sequence544 1201 815 gene locus_tag LOCUS_28730 1201 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 2454 1300 gene locus_tag LOCUS_28740 2454 1300 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027926.1 protein_id gnl|my_center|LOCUS_28740 >Feature sequence545 427 759 gene locus_tag LOCUS_28750 427 759 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946155.1 protein_id gnl|my_center|LOCUS_28750 1373 804 gene locus_tag LOCUS_28760 1373 804 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704554.1 protein_id gnl|my_center|LOCUS_28760 >Feature sequence546 1651 809 gene locus_tag LOCUS_28770 1651 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 1975 1664 gene locus_tag LOCUS_28780 1975 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 2107 2232 gene locus_tag LOCUS_28790 2107 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 >Feature sequence547 <2506 1175 gene locus_tag LOCUS_28800 <2506 1175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006742214.1:polysaccharide biosynthesis tyrosine autokinase >Feature sequence548 1707 226 gene locus_tag LOCUS_28810 1707 226 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769536.1 protein_id gnl|my_center|LOCUS_28810