>Feature sequence01 354 1190 gene locus_tag LOCUS_00010 354 1190 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_00010 1181 2101 gene locus_tag LOCUS_00020 1181 2101 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_00020 2611 3282 gene locus_tag LOCUS_00030 gene yrfG 2611 3282 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942337.1 protein_id gnl|my_center|LOCUS_00030 3476 4294 gene locus_tag LOCUS_00040 3476 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4336 7647 gene locus_tag LOCUS_00050 4336 7647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 8421 7705 gene locus_tag LOCUS_00060 8421 7705 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583102.1 protein_id gnl|my_center|LOCUS_00060 9271 9978 gene locus_tag LOCUS_00070 9271 9978 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939178.1 protein_id gnl|my_center|LOCUS_00070 10482 9919 gene locus_tag LOCUS_00080 10482 9919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 10540 11355 gene locus_tag LOCUS_00090 10540 11355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11352 12038 gene locus_tag LOCUS_00100 11352 12038 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939817.1 protein_id gnl|my_center|LOCUS_00100 14162 12054 gene locus_tag LOCUS_00110 14162 12054 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_00110 14499 16568 gene locus_tag LOCUS_00120 gene rnr 14499 16568 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942131.1 protein_id gnl|my_center|LOCUS_00120 16576 17376 gene locus_tag LOCUS_00130 16576 17376 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942121.1 protein_id gnl|my_center|LOCUS_00130 17369 17944 gene locus_tag LOCUS_00140 17369 17944 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437817.1 protein_id gnl|my_center|LOCUS_00140 17954 18997 gene locus_tag LOCUS_00150 17954 18997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 19130 20143 gene locus_tag LOCUS_00160 19130 20143 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942298.1 protein_id gnl|my_center|LOCUS_00160 20202 20486 gene locus_tag LOCUS_00170 gene gatC 20202 20486 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_00170 20597 22054 gene locus_tag LOCUS_00180 gene gatA 20597 22054 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943992.1 protein_id gnl|my_center|LOCUS_00180 22085 23176 gene locus_tag LOCUS_00190 gene hisC 22085 23176 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_00190 23180 23905 gene locus_tag LOCUS_00200 gene cmk 23180 23905 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943242.1 protein_id gnl|my_center|LOCUS_00200 23926 24270 gene locus_tag LOCUS_00210 23926 24270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 24565 25449 gene locus_tag LOCUS_00220 24565 25449 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545377.1 protein_id gnl|my_center|LOCUS_00220 26151 25456 gene locus_tag LOCUS_00230 26151 25456 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_00230 26571 27110 gene locus_tag LOCUS_00240 gene aroL 26571 27110 CDS product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938191.1 protein_id gnl|my_center|LOCUS_00240 27188 28270 gene locus_tag LOCUS_00250 gene aroC 27188 28270 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258378.1 protein_id gnl|my_center|LOCUS_00250 28424 30031 gene locus_tag LOCUS_00260 gene glgA 28424 30031 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707514.1 protein_id gnl|my_center|LOCUS_00260 30016 30822 gene locus_tag LOCUS_00270 30016 30822 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937706.1 protein_id gnl|my_center|LOCUS_00270 30879 31883 gene locus_tag LOCUS_00280 gene gap 30879 31883 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942274.1 protein_id gnl|my_center|LOCUS_00280 32187 33653 gene locus_tag LOCUS_00290 32187 33653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00290 33756 33634 gene locus_tag LOCUS_00300 33756 33634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 33757 36456 gene locus_tag LOCUS_00310 33757 36456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00310 36487 38424 gene locus_tag LOCUS_00320 36487 38424 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_00320 38424 39266 gene locus_tag LOCUS_00330 38424 39266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 39621 40631 gene locus_tag LOCUS_00340 39621 40631 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146535726.1 protein_id gnl|my_center|LOCUS_00340 40794 43121 gene locus_tag LOCUS_00350 40794 43121 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146536093.1 protein_id gnl|my_center|LOCUS_00350 44598 43417 gene locus_tag LOCUS_00360 gene hemW 44598 43417 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_00360 45305 44580 gene locus_tag LOCUS_00370 gene radC 45305 44580 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328269.1 protein_id gnl|my_center|LOCUS_00370 46759 45326 gene locus_tag LOCUS_00380 gene gatB 46759 45326 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943991.1 protein_id gnl|my_center|LOCUS_00380 47376 46837 gene locus_tag LOCUS_00390 47376 46837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791831.1 protein_id gnl|my_center|LOCUS_00390 47994 47389 gene locus_tag LOCUS_00400 47994 47389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 48208 48283 gene locus_tag LOCUS_t00010 48208 48283 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 48288 48365 gene locus_tag LOCUS_t00020 48288 48365 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 49594 49271 gene locus_tag LOCUS_00410 49594 49271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 50689 49601 gene locus_tag LOCUS_00420 50689 49601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 51985 50918 gene locus_tag LOCUS_00430 51985 50918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 52269 51988 gene locus_tag LOCUS_00440 52269 51988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 52712 52473 gene locus_tag LOCUS_00450 52712 52473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 53071 52724 gene locus_tag LOCUS_00460 53071 52724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 54500 53076 gene locus_tag LOCUS_00470 54500 53076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 54654 54535 gene locus_tag LOCUS_00480 54654 54535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 55060 54806 gene locus_tag LOCUS_00490 55060 54806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 55408 55133 gene locus_tag LOCUS_00500 55408 55133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 55619 55398 gene locus_tag LOCUS_00510 55619 55398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 55738 56175 gene locus_tag LOCUS_00520 55738 56175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 56226 56933 gene locus_tag LOCUS_00530 56226 56933 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480548.1 protein_id gnl|my_center|LOCUS_00530 57049 58698 gene locus_tag LOCUS_00540 57049 58698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 58698 59012 gene locus_tag LOCUS_00550 58698 59012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 59005 59283 gene locus_tag LOCUS_00560 59005 59283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 59665 59946 gene locus_tag LOCUS_00570 59665 59946 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201974.1 protein_id gnl|my_center|LOCUS_00570 59948 60223 gene locus_tag LOCUS_00580 59948 60223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 61514 61071 gene locus_tag LOCUS_00590 61514 61071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 61884 61585 gene locus_tag LOCUS_00600 61884 61585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 63469 62045 gene locus_tag LOCUS_00610 63469 62045 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937845.1 protein_id gnl|my_center|LOCUS_00610 64593 63514 gene locus_tag LOCUS_00620 64593 63514 CDS product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937555.1 protein_id gnl|my_center|LOCUS_00620 67105 64577 gene locus_tag LOCUS_00630 67105 64577 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791698.1 protein_id gnl|my_center|LOCUS_00630 67782 67393 gene locus_tag LOCUS_00640 67782 67393 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546829.1 protein_id gnl|my_center|LOCUS_00640 69001 67799 gene locus_tag LOCUS_00650 69001 67799 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545007.1 protein_id gnl|my_center|LOCUS_00650 70769 69099 gene locus_tag LOCUS_00660 70769 69099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 71300 70848 gene locus_tag LOCUS_00670 71300 70848 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545501.1 protein_id gnl|my_center|LOCUS_00670 73411 71297 gene locus_tag LOCUS_00680 73411 71297 CDS product thiosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937484.1 protein_id gnl|my_center|LOCUS_00680 73831 73472 gene locus_tag LOCUS_00690 73831 73472 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937557.1 protein_id gnl|my_center|LOCUS_00690 75400 73838 gene locus_tag LOCUS_00700 75400 73838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 75864 75397 gene locus_tag LOCUS_00710 75864 75397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 78964 76454 gene locus_tag LOCUS_00720 78964 76454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 80059 78974 gene locus_tag LOCUS_00730 80059 78974 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546630.1 protein_id gnl|my_center|LOCUS_00730 80318 80728 gene locus_tag LOCUS_00740 80318 80728 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940354.1 protein_id gnl|my_center|LOCUS_00740 80904 81278 gene locus_tag LOCUS_00750 80904 81278 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392799.1 protein_id gnl|my_center|LOCUS_00750 81282 81788 gene locus_tag LOCUS_00760 81282 81788 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875797.1 protein_id gnl|my_center|LOCUS_00760 81999 83189 gene locus_tag LOCUS_00770 81999 83189 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940443.1 protein_id gnl|my_center|LOCUS_00770 83235 83918 gene locus_tag LOCUS_00780 83235 83918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 84694 83969 gene locus_tag LOCUS_00790 84694 83969 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047978.1 protein_id gnl|my_center|LOCUS_00790 85439 84699 gene locus_tag LOCUS_00800 85439 84699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 87136 85508 gene locus_tag LOCUS_00810 gene hcp 87136 85508 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791786.1 protein_id gnl|my_center|LOCUS_00810 89446 87611 gene locus_tag LOCUS_00820 gene glmS 89446 87611 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940943.1 protein_id gnl|my_center|LOCUS_00820 91041 89653 gene locus_tag LOCUS_00830 91041 89653 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_00830 91920 91048 gene locus_tag LOCUS_00840 91920 91048 CDS product XrtA-associated tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942627.1 protein_id gnl|my_center|LOCUS_00840 93532 91934 gene locus_tag LOCUS_00850 93532 91934 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942628.1 protein_id gnl|my_center|LOCUS_00850 95107 93629 gene locus_tag LOCUS_00860 95107 93629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 95716 95147 gene locus_tag LOCUS_00870 95716 95147 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_00870 95978 96286 gene locus_tag LOCUS_00880 95978 96286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 96844 96362 gene locus_tag LOCUS_00890 gene fliW 96844 96362 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510650.1 protein_id gnl|my_center|LOCUS_00890 97089 96850 gene locus_tag LOCUS_00900 gene csrA 97089 96850 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219727.1 protein_id gnl|my_center|LOCUS_00900 99879 97189 gene locus_tag LOCUS_00910 99879 97189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 102409 99881 gene locus_tag LOCUS_00920 102409 99881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 102988 102416 gene locus_tag LOCUS_00930 102988 102416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 103332 102985 gene locus_tag LOCUS_00940 103332 102985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 104424 103333 gene locus_tag LOCUS_00950 104424 103333 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937822.1 protein_id gnl|my_center|LOCUS_00950 105422 104706 gene locus_tag LOCUS_00960 gene flgH 105422 104706 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073127.1 protein_id gnl|my_center|LOCUS_00960 106176 105448 gene locus_tag LOCUS_00970 106176 105448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 106968 106186 gene locus_tag LOCUS_00980 gene flgG 106968 106186 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937819.1 protein_id gnl|my_center|LOCUS_00980 107805 107074 gene locus_tag LOCUS_00990 gene flgF 107805 107074 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943677.1 protein_id gnl|my_center|LOCUS_00990 108319 108026 gene locus_tag LOCUS_01000 108319 108026 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545507.1 protein_id gnl|my_center|LOCUS_01000 108466 109161 gene locus_tag LOCUS_01010 gene sfsA 108466 109161 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943351.1 protein_id gnl|my_center|LOCUS_01010 109175 109870 gene locus_tag LOCUS_01020 gene queC 109175 109870 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941151.1 protein_id gnl|my_center|LOCUS_01020 109892 110887 gene locus_tag LOCUS_01030 109892 110887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 111063 111599 gene locus_tag LOCUS_01040 111063 111599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 111695 112750 gene locus_tag LOCUS_01050 gene nadA 111695 112750 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869444.1 protein_id gnl|my_center|LOCUS_01050 113431 112769 gene locus_tag LOCUS_01060 113431 112769 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080979.1 protein_id gnl|my_center|LOCUS_01060 115801 113510 gene locus_tag LOCUS_01070 gene prsT 115801 113510 CDS product PEP-CTERM system TPR-repeat protein PrsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942631.1 protein_id gnl|my_center|LOCUS_01070 116157 118838 gene locus_tag LOCUS_01080 gene polA 116157 118838 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941209.1 protein_id gnl|my_center|LOCUS_01080 118957 120843 gene locus_tag LOCUS_01090 118957 120843 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938364.1 protein_id gnl|my_center|LOCUS_01090 121209 120916 gene locus_tag LOCUS_01100 121209 120916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 121826 121233 gene locus_tag LOCUS_01110 gene plsY 121826 121233 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_01110 122105 122572 gene locus_tag LOCUS_01120 122105 122572 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065697.1 protein_id gnl|my_center|LOCUS_01120 122895 123509 gene locus_tag LOCUS_01130 122895 123509 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942241.1 protein_id gnl|my_center|LOCUS_01130 123795 123502 gene locus_tag LOCUS_01140 123795 123502 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943239.1 protein_id gnl|my_center|LOCUS_01140 124724 123885 gene locus_tag LOCUS_01150 gene sppA 124724 123885 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545082.1 protein_id gnl|my_center|LOCUS_01150 126562 124826 gene locus_tag LOCUS_01160 126562 124826 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940408.1 protein_id gnl|my_center|LOCUS_01160 127166 126708 gene locus_tag LOCUS_01170 127166 126708 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_01170 127830 127144 gene locus_tag LOCUS_01180 127830 127144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 128098 129063 gene locus_tag LOCUS_01190 128098 129063 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813418.1 protein_id gnl|my_center|LOCUS_01190 129215 130546 gene locus_tag LOCUS_01200 129215 130546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 130543 131463 gene locus_tag LOCUS_01210 gene bioB 130543 131463 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546730.1 protein_id gnl|my_center|LOCUS_01210 131465 132625 gene locus_tag LOCUS_01220 gene bioF 131465 132625 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_01220 132948 136061 gene locus_tag LOCUS_01230 132948 136061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 136058 136495 gene locus_tag LOCUS_01240 136058 136495 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889046.1 protein_id gnl|my_center|LOCUS_01240 137377 136553 gene locus_tag LOCUS_01250 gene mutM 137377 136553 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114647.1 protein_id gnl|my_center|LOCUS_01250 140497 137381 gene locus_tag LOCUS_01260 140497 137381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 140610 141317 gene locus_tag LOCUS_01270 gene rph 140610 141317 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545252.1 protein_id gnl|my_center|LOCUS_01270 141299 142438 gene locus_tag LOCUS_01280 gene tgt 141299 142438 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_01280 142625 142966 gene locus_tag LOCUS_01290 gene yajC 142625 142966 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943256.1 protein_id gnl|my_center|LOCUS_01290 143159 145909 gene locus_tag LOCUS_01300 143159 145909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 145909 146967 gene locus_tag LOCUS_01310 145909 146967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 146964 147824 gene locus_tag LOCUS_01320 146964 147824 CDS product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281360.1 protein_id gnl|my_center|LOCUS_01320 148416 149345 gene locus_tag LOCUS_01330 148416 149345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 150589 149315 gene locus_tag LOCUS_01340 150589 149315 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943192.1 protein_id gnl|my_center|LOCUS_01340 150685 151716 gene locus_tag LOCUS_01350 gene mnmA 150685 151716 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_01350 151713 153032 gene locus_tag LOCUS_01360 gene mtaB 151713 153032 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_01360 153029 154282 gene locus_tag LOCUS_01370 153029 154282 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812916.1 protein_id gnl|my_center|LOCUS_01370 154400 155434 gene locus_tag LOCUS_01380 gene recA 154400 155434 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940821.1 protein_id gnl|my_center|LOCUS_01380 155605 158250 gene locus_tag LOCUS_01390 gene alaS 155605 158250 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940824.1 protein_id gnl|my_center|LOCUS_01390 158488 158913 gene locus_tag LOCUS_01400 158488 158913 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258897.1 protein_id gnl|my_center|LOCUS_01400 159098 159559 gene locus_tag LOCUS_01410 159098 159559 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792710.1 protein_id gnl|my_center|LOCUS_01410 159559 160104 gene locus_tag LOCUS_01420 gene atpH 159559 160104 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938079.1 protein_id gnl|my_center|LOCUS_01420 160108 161631 gene locus_tag LOCUS_01430 gene atpA 160108 161631 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938078.1 protein_id gnl|my_center|LOCUS_01430 161649 162530 gene locus_tag LOCUS_01440 161649 162530 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938077.1 protein_id gnl|my_center|LOCUS_01440 162608 164026 gene locus_tag LOCUS_01450 gene atpD 162608 164026 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938076.1 protein_id gnl|my_center|LOCUS_01450 164105 164524 gene locus_tag LOCUS_01460 164105 164524 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938075.1 protein_id gnl|my_center|LOCUS_01460 165080 164607 gene locus_tag LOCUS_01470 165080 164607 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707397.1 protein_id gnl|my_center|LOCUS_01470 165490 166899 gene locus_tag LOCUS_01480 gene gltA 165490 166899 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272418.1 protein_id gnl|my_center|LOCUS_01480 166930 168603 gene locus_tag LOCUS_01490 gene gspE 166930 168603 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070691812.1 protein_id gnl|my_center|LOCUS_01490 168590 169813 gene locus_tag LOCUS_01500 gene exeF 168590 169813 CDS product GspF family T2SS innner membrane protein variant ExeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704542.1 protein_id gnl|my_center|LOCUS_01500 169859 170296 gene locus_tag LOCUS_01510 169859 170296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 170471 171010 gene locus_tag LOCUS_01520 170471 171010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 170997 171368 gene locus_tag LOCUS_01530 170997 171368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 171382 172377 gene locus_tag LOCUS_01540 171382 172377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 172374 173519 gene locus_tag LOCUS_01550 172374 173519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 173516 174079 gene locus_tag LOCUS_01560 173516 174079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 174072 174890 gene locus_tag LOCUS_01570 174072 174890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 175095 177236 gene locus_tag LOCUS_01580 gene gspD 175095 177236 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394575.1 protein_id gnl|my_center|LOCUS_01580 177251 177583 gene locus_tag LOCUS_01590 177251 177583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938753.1 protein_id gnl|my_center|LOCUS_01590 177871 177698 gene locus_tag LOCUS_01600 177871 177698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 178235 177915 gene locus_tag LOCUS_01610 178235 177915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 178562 178245 gene locus_tag LOCUS_01620 178562 178245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 178906 178649 gene locus_tag LOCUS_01630 178906 178649 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002035794.1 protein_id gnl|my_center|LOCUS_01630 179271 180512 gene locus_tag LOCUS_01640 179271 180512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 180687 182528 gene locus_tag LOCUS_01650 180687 182528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 182599 183573 gene locus_tag LOCUS_01660 182599 183573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 184911 183550 gene locus_tag LOCUS_01670 184911 183550 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435615.1 protein_id gnl|my_center|LOCUS_01670 185155 185646 gene locus_tag LOCUS_01680 185155 185646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 185822 186031 gene locus_tag LOCUS_01690 185822 186031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 186238 187056 gene locus_tag LOCUS_01700 186238 187056 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941055.1 protein_id gnl|my_center|LOCUS_01700 187109 187801 gene locus_tag LOCUS_01710 187109 187801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 187811 188125 gene locus_tag LOCUS_01720 187811 188125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 188191 189000 gene locus_tag LOCUS_01730 188191 189000 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903995.1 protein_id gnl|my_center|LOCUS_01730 189043 190908 gene locus_tag LOCUS_01740 gene mnmG 189043 190908 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944073.1 protein_id gnl|my_center|LOCUS_01740 191090 191527 gene locus_tag LOCUS_01750 191090 191527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 191524 193074 gene locus_tag LOCUS_01760 191524 193074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 193076 194422 gene locus_tag LOCUS_01770 193076 194422 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_01770 194736 195377 gene locus_tag LOCUS_01780 194736 195377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 195506 196690 gene locus_tag LOCUS_01790 195506 196690 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 protein_id gnl|my_center|LOCUS_01790 196957 200115 gene locus_tag LOCUS_01800 196957 200115 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943334.1 protein_id gnl|my_center|LOCUS_01800 200126 201541 gene locus_tag LOCUS_01810 gene adeC 200126 201541 CDS product AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153304094.1 protein_id gnl|my_center|LOCUS_01810 201538 202995 gene locus_tag LOCUS_01820 201538 202995 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924853.1 protein_id gnl|my_center|LOCUS_01820 203216 204511 gene locus_tag LOCUS_01830 203216 204511 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924854.1 protein_id gnl|my_center|LOCUS_01830 204514 205236 gene locus_tag LOCUS_01840 204514 205236 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546252.1 protein_id gnl|my_center|LOCUS_01840 205236 206441 gene locus_tag LOCUS_01850 205236 206441 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545925.1 protein_id gnl|my_center|LOCUS_01850 209289 206539 gene locus_tag LOCUS_01860 209289 206539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 209903 209286 gene locus_tag LOCUS_01870 209903 209286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 210475 210714 gene locus_tag LOCUS_01880 210475 210714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 211571 210699 gene locus_tag LOCUS_01890 211571 210699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 212370 211894 gene locus_tag LOCUS_01900 212370 211894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 212798 213157 gene locus_tag LOCUS_01910 212798 213157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 214879 214532 gene locus_tag LOCUS_01920 gene mazF 214879 214532 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392535.1 protein_id gnl|my_center|LOCUS_01920 215139 214879 gene locus_tag LOCUS_01930 gene chpS 215139 214879 CDS product type II toxin-antitoxin system antitoxin ChpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223210.1 protein_id gnl|my_center|LOCUS_01930 216727 215585 gene locus_tag LOCUS_01940 216727 215585 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957826.1 protein_id gnl|my_center|LOCUS_01940 217442 218575 gene locus_tag LOCUS_01950 217442 218575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 221993 218823 gene locus_tag LOCUS_01960 221993 218823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 223767 222259 gene locus_tag LOCUS_01970 223767 222259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 224345 223857 gene locus_tag LOCUS_01980 224345 223857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 225642 224446 gene locus_tag LOCUS_01990 225642 224446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 226963 225659 gene locus_tag LOCUS_02000 226963 225659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 228246 226975 gene locus_tag LOCUS_02010 228246 226975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 233541 228331 gene locus_tag LOCUS_02020 233541 228331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 234422 233781 gene locus_tag LOCUS_02030 234422 233781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 234657 234397 gene locus_tag LOCUS_02040 234657 234397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 236713 235319 gene locus_tag LOCUS_02050 236713 235319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 237412 239430 gene locus_tag LOCUS_02060 237412 239430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 239649 239984 gene locus_tag LOCUS_02070 239649 239984 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705754.1 protein_id gnl|my_center|LOCUS_02070 240110 240490 gene locus_tag LOCUS_02080 240110 240490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 241004 240774 gene locus_tag LOCUS_02090 241004 240774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 240948 241133 gene locus_tag LOCUS_02100 240948 241133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 241139 242347 gene locus_tag LOCUS_02110 241139 242347 CDS product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_02110 243502 242393 gene locus_tag LOCUS_02120 243502 242393 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792396.1 protein_id gnl|my_center|LOCUS_02120 244506 243979 gene locus_tag LOCUS_02130 gene msrB 244506 243979 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792822.1 protein_id gnl|my_center|LOCUS_02130 244719 245129 gene locus_tag LOCUS_02140 244719 245129 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404557.1 protein_id gnl|my_center|LOCUS_02140 245162 246394 gene locus_tag LOCUS_02150 245162 246394 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941367.1 protein_id gnl|my_center|LOCUS_02150 247386 246460 gene locus_tag LOCUS_02160 247386 246460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 248184 247402 gene locus_tag LOCUS_02170 248184 247402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 248605 250458 gene locus_tag LOCUS_02180 248605 250458 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108753.1 protein_id gnl|my_center|LOCUS_02180 250862 250482 gene locus_tag LOCUS_02190 250862 250482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 251099 253492 gene locus_tag LOCUS_02200 251099 253492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 254304 253513 gene locus_tag LOCUS_02210 254304 253513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 254923 254522 gene locus_tag LOCUS_02220 254923 254522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 256096 255134 gene locus_tag LOCUS_02230 gene dusB 256096 255134 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256119.1 protein_id gnl|my_center|LOCUS_02230 256305 256138 gene locus_tag LOCUS_02240 256305 256138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 256443 257423 gene locus_tag LOCUS_02250 256443 257423 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256790.1 protein_id gnl|my_center|LOCUS_02250 257564 257842 gene locus_tag LOCUS_02260 257564 257842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 257811 258164 gene locus_tag LOCUS_02270 257811 258164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 258446 259297 gene locus_tag LOCUS_02280 258446 259297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 259951 260139 gene locus_tag LOCUS_02290 259951 260139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 260203 261735 gene locus_tag LOCUS_02300 260203 261735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 262234 262647 gene locus_tag LOCUS_02310 262234 262647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 263320 263631 gene locus_tag LOCUS_02320 263320 263631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 >Feature sequence02 393 599 gene locus_tag LOCUS_02330 393 599 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022341.1 protein_id gnl|my_center|LOCUS_02330 592 816 gene locus_tag LOCUS_02340 592 816 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755925.1 protein_id gnl|my_center|LOCUS_02340 1088 1011 gene locus_tag LOCUS_t00030 1088 1011 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1256 1331 gene locus_tag LOCUS_t00040 1256 1331 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2255 1374 gene locus_tag LOCUS_02350 2255 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 2953 2252 gene locus_tag LOCUS_02360 2953 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 4664 2955 gene locus_tag LOCUS_02370 4664 2955 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939228.1 protein_id gnl|my_center|LOCUS_02370 6019 4661 gene locus_tag LOCUS_02380 6019 4661 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460589.1 protein_id gnl|my_center|LOCUS_02380 7297 6032 gene locus_tag LOCUS_02390 7297 6032 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_02390 7905 7306 gene locus_tag LOCUS_02400 7905 7306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 8570 7977 gene locus_tag LOCUS_02410 8570 7977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 9307 8570 gene locus_tag LOCUS_02420 gene fabG 9307 8570 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039074.1 protein_id gnl|my_center|LOCUS_02420 9750 9304 gene locus_tag LOCUS_02430 9750 9304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 10048 10314 gene locus_tag LOCUS_02440 10048 10314 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964357.1 protein_id gnl|my_center|LOCUS_02440 10311 12482 gene locus_tag LOCUS_02450 10311 12482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 12751 13479 gene locus_tag LOCUS_02460 12751 13479 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124968.1 protein_id gnl|my_center|LOCUS_02460 13620 14798 gene locus_tag LOCUS_02470 13620 14798 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979599.1 protein_id gnl|my_center|LOCUS_02470 14892 15212 gene locus_tag LOCUS_02480 14892 15212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 15209 15475 gene locus_tag LOCUS_02490 15209 15475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 15476 16531 gene locus_tag LOCUS_02500 15476 16531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 16549 17547 gene locus_tag LOCUS_02510 16549 17547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 17571 18821 gene locus_tag LOCUS_02520 gene fabF 17571 18821 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_02520 18856 20121 gene locus_tag LOCUS_02530 gene fabF 18856 20121 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942250.1 protein_id gnl|my_center|LOCUS_02530 20121 20600 gene locus_tag LOCUS_02540 20121 20600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 20597 21448 gene locus_tag LOCUS_02550 20597 21448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 21890 21534 gene locus_tag LOCUS_02560 21890 21534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 21973 22728 gene locus_tag LOCUS_02570 21973 22728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 22736 25792 gene locus_tag LOCUS_02580 22736 25792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 25796 26629 gene locus_tag LOCUS_02590 25796 26629 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964353.1 protein_id gnl|my_center|LOCUS_02590 27832 26675 gene locus_tag LOCUS_02600 27832 26675 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964369.1 protein_id gnl|my_center|LOCUS_02600 29134 27836 gene locus_tag LOCUS_02610 29134 27836 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965310.1 protein_id gnl|my_center|LOCUS_02610 29643 30272 gene locus_tag LOCUS_02620 29643 30272 CDS product acyloxyacyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944026.1 protein_id gnl|my_center|LOCUS_02620 30298 30741 gene locus_tag LOCUS_02630 30298 30741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 30759 31766 gene locus_tag LOCUS_02640 30759 31766 CDS product BtrH N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964365.1 protein_id gnl|my_center|LOCUS_02640 31862 32545 gene locus_tag LOCUS_02650 31862 32545 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100836.1 protein_id gnl|my_center|LOCUS_02650 32586 33890 gene locus_tag LOCUS_02660 32586 33890 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099434.1 protein_id gnl|my_center|LOCUS_02660 33945 34202 gene locus_tag LOCUS_02670 33945 34202 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964357.1 protein_id gnl|my_center|LOCUS_02670 35369 34299 gene locus_tag LOCUS_02680 35369 34299 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080828.1 protein_id gnl|my_center|LOCUS_02680 36159 35407 gene locus_tag LOCUS_02690 36159 35407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 37422 36172 gene locus_tag LOCUS_02700 37422 36172 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074037.1 protein_id gnl|my_center|LOCUS_02700 37699 37442 gene locus_tag LOCUS_02710 37699 37442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 38709 38143 gene locus_tag LOCUS_02720 38709 38143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 39094 38726 gene locus_tag LOCUS_02730 39094 38726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 39553 40536 gene locus_tag LOCUS_02740 39553 40536 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546489.1 protein_id gnl|my_center|LOCUS_02740 40565 41011 gene locus_tag LOCUS_02750 40565 41011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545633.1 protein_id gnl|my_center|LOCUS_02750 41229 41891 gene locus_tag LOCUS_02760 41229 41891 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080979.1 protein_id gnl|my_center|LOCUS_02760 44774 42123 gene locus_tag LOCUS_02770 44774 42123 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791698.1 protein_id gnl|my_center|LOCUS_02770 47298 44749 gene locus_tag LOCUS_02780 47298 44749 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937463.1 protein_id gnl|my_center|LOCUS_02780 48707 47295 gene locus_tag LOCUS_02790 48707 47295 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546582.1 protein_id gnl|my_center|LOCUS_02790 49183 48788 gene locus_tag LOCUS_02800 49183 48788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 51820 49226 gene locus_tag LOCUS_02810 51820 49226 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545874.1 protein_id gnl|my_center|LOCUS_02810 52692 51892 gene locus_tag LOCUS_02820 52692 51892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 53625 52696 gene locus_tag LOCUS_02830 53625 52696 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389853.1 protein_id gnl|my_center|LOCUS_02830 54291 53695 gene locus_tag LOCUS_02840 54291 53695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 56165 54768 gene locus_tag LOCUS_02850 56165 54768 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924829.1 protein_id gnl|my_center|LOCUS_02850 57007 56162 gene locus_tag LOCUS_02860 gene glyQ 57007 56162 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941241.1 protein_id gnl|my_center|LOCUS_02860 57655 59304 gene locus_tag LOCUS_02870 57655 59304 CDS product DUF3373 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942839.1 protein_id gnl|my_center|LOCUS_02870 59389 60183 gene locus_tag LOCUS_02880 gene pgeF 59389 60183 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940760.1 protein_id gnl|my_center|LOCUS_02880 60209 61555 gene locus_tag LOCUS_02890 gene rsmB 60209 61555 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_02890 61713 64556 gene locus_tag LOCUS_02900 gene uvrA 61713 64556 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_02900 64804 65301 gene locus_tag LOCUS_02910 gene secB 64804 65301 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772050.1 protein_id gnl|my_center|LOCUS_02910 68006 65367 gene locus_tag LOCUS_02920 68006 65367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 69874 68150 gene locus_tag LOCUS_02930 gene mshL 69874 68150 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545709.1 protein_id gnl|my_center|LOCUS_02930 71869 70007 gene locus_tag LOCUS_02940 71869 70007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 72450 71872 gene locus_tag LOCUS_02950 72450 71872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 73140 72481 gene locus_tag LOCUS_02960 73140 72481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 73643 73137 gene locus_tag LOCUS_02970 73643 73137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 74860 73757 gene locus_tag LOCUS_02980 gene pilM 74860 73757 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_02980 75527 76144 gene locus_tag LOCUS_02990 gene lepB 75527 76144 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941922.1 protein_id gnl|my_center|LOCUS_02990 76245 77183 gene locus_tag LOCUS_03000 76245 77183 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941926.1 protein_id gnl|my_center|LOCUS_03000 77180 78478 gene locus_tag LOCUS_03010 77180 78478 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_03010 78874 78521 gene locus_tag LOCUS_03020 78874 78521 CDS product flagellar basal body rod C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940153.1 protein_id gnl|my_center|LOCUS_03020 81325 79109 gene locus_tag LOCUS_03030 gene topA 81325 79109 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_03030 82683 81574 gene locus_tag LOCUS_03040 gene dprA 82683 81574 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_03040 84317 82695 gene locus_tag LOCUS_03050 gene rpoD 84317 82695 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_03050 86161 84377 gene locus_tag LOCUS_03060 86161 84377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 86566 87279 gene locus_tag LOCUS_03070 86566 87279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 87276 89360 gene locus_tag LOCUS_03080 87276 89360 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532918.1 protein_id gnl|my_center|LOCUS_03080 89646 89368 gene locus_tag LOCUS_03090 89646 89368 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250981.1 protein_id gnl|my_center|LOCUS_03090 91669 89663 gene locus_tag LOCUS_03100 gene ligA 91669 89663 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_03100 91871 91674 gene locus_tag LOCUS_03110 91871 91674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 92056 92874 gene locus_tag LOCUS_03120 92056 92874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 93769 92810 gene locus_tag LOCUS_03130 93769 92810 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258713.1 protein_id gnl|my_center|LOCUS_03130 94685 93777 gene locus_tag LOCUS_03140 94685 93777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940985.1 protein_id gnl|my_center|LOCUS_03140 97032 94804 gene locus_tag LOCUS_03150 gene clpA 97032 94804 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938893.1 protein_id gnl|my_center|LOCUS_03150 97403 97089 gene locus_tag LOCUS_03160 gene clpS 97403 97089 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545154.1 protein_id gnl|my_center|LOCUS_03160 98808 97486 gene locus_tag LOCUS_03170 98808 97486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 100554 99064 gene locus_tag LOCUS_03180 100554 99064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 101899 100595 gene locus_tag LOCUS_03190 101899 100595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 102279 103055 gene locus_tag LOCUS_03200 102279 103055 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705460.1 protein_id gnl|my_center|LOCUS_03200 103146 103391 gene locus_tag LOCUS_03210 103146 103391 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061623.1 protein_id gnl|my_center|LOCUS_03210 103411 105528 gene locus_tag LOCUS_03220 103411 105528 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932948.1 protein_id gnl|my_center|LOCUS_03220 105865 105710 gene locus_tag LOCUS_03230 105865 105710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 105803 107005 gene locus_tag LOCUS_03240 105803 107005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 108621 107002 gene locus_tag LOCUS_03250 gene nadB 108621 107002 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_03250 108730 109359 gene locus_tag LOCUS_03260 108730 109359 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938666.1 protein_id gnl|my_center|LOCUS_03260 109675 109415 gene locus_tag LOCUS_03270 109675 109415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 109877 109668 gene locus_tag LOCUS_03280 109877 109668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 110026 110430 gene locus_tag LOCUS_03290 110026 110430 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393898.1 protein_id gnl|my_center|LOCUS_03290 111147 110455 gene locus_tag LOCUS_03300 111147 110455 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261737.1 protein_id gnl|my_center|LOCUS_03300 112562 111330 gene locus_tag LOCUS_03310 112562 111330 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507840.1 protein_id gnl|my_center|LOCUS_03310 113221 112559 gene locus_tag LOCUS_03320 113221 112559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 114293 113226 gene locus_tag LOCUS_03330 114293 113226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 114764 114300 gene locus_tag LOCUS_03340 114764 114300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 115675 114905 gene locus_tag LOCUS_03350 115675 114905 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546155.1 protein_id gnl|my_center|LOCUS_03350 116552 115686 gene locus_tag LOCUS_03360 gene motA 116552 115686 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939877.1 protein_id gnl|my_center|LOCUS_03360 117008 118273 gene locus_tag LOCUS_03370 gene hisS 117008 118273 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942303.1 protein_id gnl|my_center|LOCUS_03370 118393 120186 gene locus_tag LOCUS_03380 gene aspS 118393 120186 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_03380 120292 121749 gene locus_tag LOCUS_03390 gene guaB 120292 121749 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942835.1 protein_id gnl|my_center|LOCUS_03390 121817 123367 gene locus_tag LOCUS_03400 gene guaA 121817 123367 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_03400 123401 124183 gene locus_tag LOCUS_03410 123401 124183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 124428 125669 gene locus_tag LOCUS_03420 124428 125669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 125681 126853 gene locus_tag LOCUS_03430 125681 126853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 126863 128965 gene locus_tag LOCUS_03440 126863 128965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 129439 129082 gene locus_tag LOCUS_tm00010 129439 129082 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 129921 129466 gene locus_tag LOCUS_03450 gene smpB 129921 129466 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123905.1 protein_id gnl|my_center|LOCUS_03450 131762 129951 gene locus_tag LOCUS_03460 131762 129951 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266274.1 protein_id gnl|my_center|LOCUS_03460 132071 135061 gene locus_tag LOCUS_03470 132071 135061 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942279.1 protein_id gnl|my_center|LOCUS_03470 135058 136110 gene locus_tag LOCUS_03480 135058 136110 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_03480 136272 137189 gene locus_tag LOCUS_03490 gene holB 136272 137189 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_03490 137264 138193 gene locus_tag LOCUS_03500 137264 138193 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942871.1 protein_id gnl|my_center|LOCUS_03500 138201 140126 gene locus_tag LOCUS_03510 gene metG 138201 140126 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939333.1 protein_id gnl|my_center|LOCUS_03510 140131 140907 gene locus_tag LOCUS_03520 140131 140907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 140904 141653 gene locus_tag LOCUS_03530 140904 141653 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545992.1 protein_id gnl|my_center|LOCUS_03530 141695 141997 gene locus_tag LOCUS_03540 141695 141997 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941530.1 protein_id gnl|my_center|LOCUS_03540 142045 142902 gene locus_tag LOCUS_03550 142045 142902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 142899 143195 gene locus_tag LOCUS_03560 gene yggU 142899 143195 CDS product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417561.1 protein_id gnl|my_center|LOCUS_03560 143219 143716 gene locus_tag LOCUS_03570 143219 143716 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583986.1 protein_id gnl|my_center|LOCUS_03570 143720 144226 gene locus_tag LOCUS_03580 143720 144226 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524404.1 protein_id gnl|my_center|LOCUS_03580 144223 146904 gene locus_tag LOCUS_03590 gene mutS 144223 146904 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_03590 146897 148531 gene locus_tag LOCUS_03600 146897 148531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 148933 148532 gene locus_tag LOCUS_03610 148933 148532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 149581 150693 gene locus_tag LOCUS_03620 gene mtnA 149581 150693 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970692.1 protein_id gnl|my_center|LOCUS_03620 151808 150690 gene locus_tag LOCUS_03630 151808 150690 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031746.1 protein_id gnl|my_center|LOCUS_03630 152830 151805 gene locus_tag LOCUS_03640 152830 151805 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_03640 153705 152827 gene locus_tag LOCUS_03650 153705 152827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 154140 155270 gene locus_tag LOCUS_03660 gene dnaN 154140 155270 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_03660 155416 157731 gene locus_tag LOCUS_03670 gene gyrB 155416 157731 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072061.1 protein_id gnl|my_center|LOCUS_03670 157809 160289 gene locus_tag LOCUS_03680 gene gyrA 157809 160289 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940682.1 protein_id gnl|my_center|LOCUS_03680 160289 161314 gene locus_tag LOCUS_03690 160289 161314 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_03690 161517 162476 gene locus_tag LOCUS_03700 gene selD 161517 162476 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051345820.1 protein_id gnl|my_center|LOCUS_03700 162915 163127 gene locus_tag LOCUS_03710 162915 163127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 164513 163269 gene locus_tag LOCUS_03720 164513 163269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 164795 165937 gene locus_tag LOCUS_03730 164795 165937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 166089 166394 gene locus_tag LOCUS_03740 166089 166394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941914.1 protein_id gnl|my_center|LOCUS_03740 166417 167574 gene locus_tag LOCUS_03750 166417 167574 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941915.1 protein_id gnl|my_center|LOCUS_03750 167578 168273 gene locus_tag LOCUS_03760 167578 168273 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941916.1 protein_id gnl|my_center|LOCUS_03760 168278 169288 gene locus_tag LOCUS_03770 168278 169288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941917.1 protein_id gnl|my_center|LOCUS_03770 >Feature sequence03 <1 582 gene locus_tag LOCUS_03780 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941801.1:methyl-accepting chemotaxis protein 697 1545 gene locus_tag LOCUS_03790 697 1545 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941804.1 protein_id gnl|my_center|LOCUS_03790 1542 2051 gene locus_tag LOCUS_03800 1542 2051 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941805.1 protein_id gnl|my_center|LOCUS_03800 2048 3121 gene locus_tag LOCUS_03810 2048 3121 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941806.1 protein_id gnl|my_center|LOCUS_03810 3995 3150 gene locus_tag LOCUS_03820 3995 3150 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941846.1 protein_id gnl|my_center|LOCUS_03820 4531 4331 gene locus_tag LOCUS_03830 4531 4331 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942550.1 protein_id gnl|my_center|LOCUS_03830 4971 6113 gene locus_tag LOCUS_03840 4971 6113 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552205.1 protein_id gnl|my_center|LOCUS_03840 6761 6147 gene locus_tag LOCUS_03850 6761 6147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 7617 6790 gene locus_tag LOCUS_03860 7617 6790 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941333.1 protein_id gnl|my_center|LOCUS_03860 8345 7614 gene locus_tag LOCUS_03870 8345 7614 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819827.1 protein_id gnl|my_center|LOCUS_03870 8548 8865 gene locus_tag LOCUS_03880 8548 8865 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938537.1 protein_id gnl|my_center|LOCUS_03880 9760 8921 gene locus_tag LOCUS_03890 9760 8921 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929171.1 protein_id gnl|my_center|LOCUS_03890 10130 9816 gene locus_tag LOCUS_03900 10130 9816 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941982.1 protein_id gnl|my_center|LOCUS_03900 10420 11025 gene locus_tag LOCUS_03910 10420 11025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 11164 12750 gene locus_tag LOCUS_03920 11164 12750 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940375.1 protein_id gnl|my_center|LOCUS_03920 12894 13637 gene locus_tag LOCUS_03930 12894 13637 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589510.1 protein_id gnl|my_center|LOCUS_03930 14388 13786 gene locus_tag LOCUS_03940 14388 13786 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064948.1 protein_id gnl|my_center|LOCUS_03940 14692 15123 gene locus_tag LOCUS_03950 14692 15123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 15139 16431 gene locus_tag LOCUS_03960 15139 16431 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938700.1 protein_id gnl|my_center|LOCUS_03960 16903 16550 gene locus_tag LOCUS_03970 16903 16550 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147081.1 protein_id gnl|my_center|LOCUS_03970 17168 16890 gene locus_tag LOCUS_03980 17168 16890 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045599895.1 protein_id gnl|my_center|LOCUS_03980 18924 17446 gene locus_tag LOCUS_03990 18924 17446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 19853 19065 gene locus_tag LOCUS_04000 19853 19065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 21080 20037 gene locus_tag LOCUS_04010 21080 20037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 21352 21155 gene locus_tag LOCUS_04020 21352 21155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 21712 22779 gene locus_tag LOCUS_04030 21712 22779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 22893 24635 gene locus_tag LOCUS_04040 22893 24635 CDS product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939485.1 protein_id gnl|my_center|LOCUS_04040 27178 24803 gene locus_tag LOCUS_04050 27178 24803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 28431 27181 gene locus_tag LOCUS_04060 28431 27181 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141120.1 protein_id gnl|my_center|LOCUS_04060 28738 29568 gene locus_tag LOCUS_04070 28738 29568 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065502.1 protein_id gnl|my_center|LOCUS_04070 29549 30871 gene locus_tag LOCUS_04080 29549 30871 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140384.1 protein_id gnl|my_center|LOCUS_04080 30943 31650 gene locus_tag LOCUS_04090 30943 31650 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440228.1 protein_id gnl|my_center|LOCUS_04090 32321 31653 gene locus_tag LOCUS_04100 32321 31653 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061306.1 protein_id gnl|my_center|LOCUS_04100 32706 32404 gene locus_tag LOCUS_04110 32706 32404 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771921.1 protein_id gnl|my_center|LOCUS_04110 33329 33529 gene locus_tag LOCUS_04120 33329 33529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 34415 33801 gene locus_tag LOCUS_04130 34415 33801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 34903 36369 gene locus_tag LOCUS_04140 34903 36369 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941505.1 protein_id gnl|my_center|LOCUS_04140 36563 38293 gene locus_tag LOCUS_04150 36563 38293 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065602.1 protein_id gnl|my_center|LOCUS_04150 38474 39325 gene locus_tag LOCUS_04160 38474 39325 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545968.1 protein_id gnl|my_center|LOCUS_04160 39435 40697 gene locus_tag LOCUS_04170 39435 40697 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932061.1 protein_id gnl|my_center|LOCUS_04170 41124 42092 gene locus_tag LOCUS_04180 41124 42092 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546724.1 protein_id gnl|my_center|LOCUS_04180 42423 42806 gene locus_tag LOCUS_04190 42423 42806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 43134 43319 gene locus_tag LOCUS_04200 43134 43319 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940534.1 protein_id gnl|my_center|LOCUS_04200 43437 43934 gene locus_tag LOCUS_04210 43437 43934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 44007 44219 gene locus_tag LOCUS_04220 44007 44219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 44284 44832 gene locus_tag LOCUS_04230 44284 44832 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021181.1 protein_id gnl|my_center|LOCUS_04230 45246 44995 gene locus_tag LOCUS_04240 45246 44995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 45151 48582 gene locus_tag LOCUS_04250 45151 48582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 48579 49034 gene locus_tag LOCUS_04260 48579 49034 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021289.1 protein_id gnl|my_center|LOCUS_04260 49079 49687 gene locus_tag LOCUS_04270 49079 49687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 51837 49759 gene locus_tag LOCUS_04280 gene lon 51837 49759 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545787.1 protein_id gnl|my_center|LOCUS_04280 52217 52393 gene locus_tag LOCUS_04290 52217 52393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 53008 52559 gene locus_tag LOCUS_04300 53008 52559 CDS product DUF4149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941706.1 protein_id gnl|my_center|LOCUS_04300 53234 53028 gene locus_tag LOCUS_04310 53234 53028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 53661 54926 gene locus_tag LOCUS_04320 53661 54926 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451037.1 protein_id gnl|my_center|LOCUS_04320 55254 56216 gene locus_tag LOCUS_04330 55254 56216 CDS product Tim44 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941752.1 protein_id gnl|my_center|LOCUS_04330 56515 57273 gene locus_tag LOCUS_04340 56515 57273 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943654.1 protein_id gnl|my_center|LOCUS_04340 57323 58126 gene locus_tag LOCUS_04350 57323 58126 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943655.1 protein_id gnl|my_center|LOCUS_04350 59338 58181 gene locus_tag LOCUS_04360 59338 58181 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259674.1 protein_id gnl|my_center|LOCUS_04360 59528 60565 gene locus_tag LOCUS_04370 59528 60565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 60618 61535 gene locus_tag LOCUS_04380 60618 61535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 61540 61758 gene locus_tag LOCUS_04390 61540 61758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 61838 62356 gene locus_tag LOCUS_04400 61838 62356 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083201.1 protein_id gnl|my_center|LOCUS_04400 62827 62399 gene locus_tag LOCUS_04410 62827 62399 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933554.1 protein_id gnl|my_center|LOCUS_04410 63299 65074 gene locus_tag LOCUS_04420 63299 65074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 65547 66959 gene locus_tag LOCUS_04430 65547 66959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 67313 69376 gene locus_tag LOCUS_04440 67313 69376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 69408 71084 gene locus_tag LOCUS_04450 69408 71084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 71071 72885 gene locus_tag LOCUS_04460 71071 72885 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943144.1 protein_id gnl|my_center|LOCUS_04460 73297 75117 gene locus_tag LOCUS_04470 gene ftsH 73297 75117 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_04470 75962 76888 gene locus_tag LOCUS_04480 75962 76888 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937841.1 protein_id gnl|my_center|LOCUS_04480 76902 78158 gene locus_tag LOCUS_04490 gene nrfD 76902 78158 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937840.1 protein_id gnl|my_center|LOCUS_04490 78416 80233 gene locus_tag LOCUS_04500 78416 80233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 81728 80394 gene locus_tag LOCUS_04510 81728 80394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 82943 81852 gene locus_tag LOCUS_04520 82943 81852 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943140.1 protein_id gnl|my_center|LOCUS_04520 83847 82957 gene locus_tag LOCUS_04530 83847 82957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 85083 83905 gene locus_tag LOCUS_04540 85083 83905 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039643456.1 protein_id gnl|my_center|LOCUS_04540 87029 85083 gene locus_tag LOCUS_04550 87029 85083 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044893.1 protein_id gnl|my_center|LOCUS_04550 88641 87010 gene locus_tag LOCUS_04560 88641 87010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 89036 88629 gene locus_tag LOCUS_04570 89036 88629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 90727 89252 gene locus_tag LOCUS_04580 90727 89252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 91381 90830 gene locus_tag LOCUS_04590 91381 90830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 93731 91674 gene locus_tag LOCUS_04600 93731 91674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943136.1 protein_id gnl|my_center|LOCUS_04600 95154 94024 gene locus_tag LOCUS_04610 95154 94024 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943140.1 protein_id gnl|my_center|LOCUS_04610 95792 95475 gene locus_tag LOCUS_04620 95792 95475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 96724 96527 gene locus_tag LOCUS_04630 96724 96527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 97607 97371 gene locus_tag LOCUS_04640 97607 97371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 97781 99160 gene locus_tag LOCUS_04650 97781 99160 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329168.1 protein_id gnl|my_center|LOCUS_04650 99218 99751 gene locus_tag LOCUS_04660 99218 99751 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329169.1 protein_id gnl|my_center|LOCUS_04660 100792 99752 gene locus_tag LOCUS_04670 100792 99752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 102294 101131 gene locus_tag LOCUS_04680 102294 101131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 102879 103304 gene locus_tag LOCUS_04690 102879 103304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 103682 104875 gene locus_tag LOCUS_04700 103682 104875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 104911 105450 gene locus_tag LOCUS_04710 104911 105450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 105665 106480 gene locus_tag LOCUS_04720 105665 106480 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941330.1 protein_id gnl|my_center|LOCUS_04720 106592 107500 gene locus_tag LOCUS_04730 106592 107500 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039643290.1 protein_id gnl|my_center|LOCUS_04730 107790 109517 gene locus_tag LOCUS_04740 107790 109517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 109517 110863 gene locus_tag LOCUS_04750 gene gnfM 109517 110863 CDS product nitrogen fixation sigma-54 dependent transcriptional regulator GnfM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941668.1 protein_id gnl|my_center|LOCUS_04750 110973 112181 gene locus_tag LOCUS_04760 110973 112181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943169.1 protein_id gnl|my_center|LOCUS_04760 112198 112626 gene locus_tag LOCUS_04770 112198 112626 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943168.1 protein_id gnl|my_center|LOCUS_04770 112657 114351 gene locus_tag LOCUS_04780 112657 114351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 114807 118487 gene locus_tag LOCUS_04790 114807 118487 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941924.1 protein_id gnl|my_center|LOCUS_04790 118934 120424 gene locus_tag LOCUS_04800 118934 120424 CDS product choice-of-anchor F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943218.1 protein_id gnl|my_center|LOCUS_04800 120500 120823 gene locus_tag LOCUS_04810 120500 120823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 120954 121754 gene locus_tag LOCUS_04820 120954 121754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 125738 121779 gene locus_tag LOCUS_04830 gene hrpA 125738 121779 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001785213.1 protein_id gnl|my_center|LOCUS_04830 125890 127095 gene locus_tag LOCUS_04840 125890 127095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 129776 127146 gene locus_tag LOCUS_04850 129776 127146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 130076 132922 gene locus_tag LOCUS_04860 130076 132922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 133044 133562 gene locus_tag LOCUS_04870 133044 133562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 134924 133674 gene locus_tag LOCUS_04880 134924 133674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 136458 135025 gene locus_tag LOCUS_04890 136458 135025 CDS product sulfur transferase selenocysteine-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546309.1 transl_except (pos:complement(135805..135807),aa:Sec) note codon on position 218 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_04890 136708 137853 gene locus_tag LOCUS_04900 136708 137853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 138170 137928 gene locus_tag LOCUS_04910 138170 137928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 138546 138280 gene locus_tag LOCUS_04920 138546 138280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 138725 139645 gene locus_tag LOCUS_04930 138725 139645 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942175.1 protein_id gnl|my_center|LOCUS_04930 139743 141965 gene locus_tag LOCUS_04940 139743 141965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 142107 142535 gene locus_tag LOCUS_04950 142107 142535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 143123 142464 gene locus_tag LOCUS_04960 143123 142464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 143358 143588 gene locus_tag LOCUS_04970 143358 143588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 145579 143675 gene locus_tag LOCUS_04980 145579 143675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 147814 145715 gene locus_tag LOCUS_04990 147814 145715 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_04990 >Feature sequence04 152 1591 gene locus_tag LOCUS_05000 152 1591 CDS product choice-of-anchor F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943218.1 protein_id gnl|my_center|LOCUS_05000 2298 1774 gene locus_tag LOCUS_05010 2298 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05010 2705 2295 gene locus_tag LOCUS_05020 2705 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05020 2977 2660 gene locus_tag LOCUS_05030 2977 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05030 3245 2994 gene locus_tag LOCUS_05040 3245 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05040 4035 3316 gene locus_tag LOCUS_05050 4035 3316 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102969.1 protein_id gnl|my_center|LOCUS_05050 5159 4032 gene locus_tag LOCUS_05060 5159 4032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 6605 5274 gene locus_tag LOCUS_05070 6605 5274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 7627 6602 gene locus_tag LOCUS_05080 7627 6602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 7842 7654 gene locus_tag LOCUS_05090 7842 7654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 8177 8926 gene locus_tag LOCUS_05100 8177 8926 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221202124.1 protein_id gnl|my_center|LOCUS_05100 9024 9476 gene locus_tag LOCUS_05110 9024 9476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 10497 9493 gene locus_tag LOCUS_05120 10497 9493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 11287 10778 gene locus_tag LOCUS_05130 gene tadA 11287 10778 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872231.1 protein_id gnl|my_center|LOCUS_05130 11384 12424 gene locus_tag LOCUS_05140 11384 12424 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546176.1 protein_id gnl|my_center|LOCUS_05140 12531 12842 gene locus_tag LOCUS_05150 12531 12842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 13818 13030 gene locus_tag LOCUS_05160 13818 13030 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258270.1 protein_id gnl|my_center|LOCUS_05160 15594 13858 gene locus_tag LOCUS_05170 15594 13858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 15519 15908 gene locus_tag LOCUS_05180 15519 15908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 15913 19212 gene locus_tag LOCUS_05190 15913 19212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 19222 21021 gene locus_tag LOCUS_05200 19222 21021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 21167 23914 gene locus_tag LOCUS_05210 21167 23914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 23949 24461 gene locus_tag LOCUS_05220 23949 24461 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_05220 24493 25335 gene locus_tag LOCUS_05230 24493 25335 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941804.1 protein_id gnl|my_center|LOCUS_05230 25510 25989 gene locus_tag LOCUS_05240 25510 25989 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062386646.1 protein_id gnl|my_center|LOCUS_05240 25986 26849 gene locus_tag LOCUS_05250 25986 26849 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358679.1 protein_id gnl|my_center|LOCUS_05250 26951 28000 gene locus_tag LOCUS_05260 26951 28000 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164481.1 protein_id gnl|my_center|LOCUS_05260 28529 28020 gene locus_tag LOCUS_05270 28529 28020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 28782 29897 gene locus_tag LOCUS_05280 28782 29897 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546749.1 protein_id gnl|my_center|LOCUS_05280 29912 30643 gene locus_tag LOCUS_05290 29912 30643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 32143 30770 gene locus_tag LOCUS_05300 32143 30770 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924829.1 protein_id gnl|my_center|LOCUS_05300 33582 32140 gene locus_tag LOCUS_05310 33582 32140 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546582.1 protein_id gnl|my_center|LOCUS_05310 34018 34176 gene locus_tag LOCUS_05320 34018 34176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 34201 34710 gene locus_tag LOCUS_05330 34201 34710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 34773 35006 gene locus_tag LOCUS_05340 34773 35006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 35049 36398 gene locus_tag LOCUS_05350 35049 36398 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940556.1 protein_id gnl|my_center|LOCUS_05350 36391 37248 gene locus_tag LOCUS_05360 36391 37248 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227298.1 protein_id gnl|my_center|LOCUS_05360 38209 37382 gene locus_tag LOCUS_05370 38209 37382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 38447 38653 gene locus_tag LOCUS_05380 38447 38653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 38848 39198 gene locus_tag LOCUS_05390 38848 39198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05390 39204 40130 gene locus_tag LOCUS_05400 39204 40130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 40526 40092 gene locus_tag LOCUS_05410 40526 40092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 41145 41372 gene locus_tag LOCUS_05420 41145 41372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 41387 42466 gene locus_tag LOCUS_05430 41387 42466 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_05430 42741 43151 gene locus_tag LOCUS_05440 42741 43151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 43467 44153 gene locus_tag LOCUS_05450 gene fabG1 43467 44153 CDS product 3-oxoacyl-ACP reductase FabG1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057861.1 protein_id gnl|my_center|LOCUS_05450 45323 44166 gene locus_tag LOCUS_05460 45323 44166 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410070.1 protein_id gnl|my_center|LOCUS_05460 45824 47095 gene locus_tag LOCUS_05470 gene pseB 45824 47095 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097864.1 protein_id gnl|my_center|LOCUS_05470 47095 48291 gene locus_tag LOCUS_05480 gene pseC 47095 48291 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869432.1 protein_id gnl|my_center|LOCUS_05480 48288 49838 gene locus_tag LOCUS_05490 48288 49838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 49813 50874 gene locus_tag LOCUS_05500 gene pseI 49813 50874 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965486.1 protein_id gnl|my_center|LOCUS_05500 50871 51590 gene locus_tag LOCUS_05510 gene pseF 50871 51590 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867757.1 protein_id gnl|my_center|LOCUS_05510 51583 52203 gene locus_tag LOCUS_05520 51583 52203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 52369 52860 gene locus_tag LOCUS_05530 52369 52860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 52864 54399 gene locus_tag LOCUS_05540 52864 54399 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088170.1 protein_id gnl|my_center|LOCUS_05540 54558 55403 gene locus_tag LOCUS_05550 54558 55403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_05550 55400 56242 gene locus_tag LOCUS_05560 55400 56242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 56242 57309 gene locus_tag LOCUS_05570 56242 57309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 57321 58004 gene locus_tag LOCUS_05580 57321 58004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 58015 59055 gene locus_tag LOCUS_05590 58015 59055 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967057.1 protein_id gnl|my_center|LOCUS_05590 59181 59891 gene locus_tag LOCUS_05600 59181 59891 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088174.1 protein_id gnl|my_center|LOCUS_05600 59884 60804 gene locus_tag LOCUS_05610 59884 60804 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002733687.1 protein_id gnl|my_center|LOCUS_05610 60801 62111 gene locus_tag LOCUS_05620 60801 62111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 62108 63079 gene locus_tag LOCUS_05630 62108 63079 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_05630 63120 63887 gene locus_tag LOCUS_05640 63120 63887 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393713.1 protein_id gnl|my_center|LOCUS_05640 63877 64245 gene locus_tag LOCUS_05650 63877 64245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 64265 64924 gene locus_tag LOCUS_05660 64265 64924 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517243.1 protein_id gnl|my_center|LOCUS_05660 64966 67308 gene locus_tag LOCUS_05670 64966 67308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 68919 68674 gene locus_tag LOCUS_05680 68919 68674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 68970 69611 gene locus_tag LOCUS_05690 68970 69611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 69673 71601 gene locus_tag LOCUS_05700 69673 71601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 72674 73771 gene locus_tag LOCUS_05710 72674 73771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 73808 75733 gene locus_tag LOCUS_05720 73808 75733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 75876 76583 gene locus_tag LOCUS_05730 75876 76583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 76580 78004 gene locus_tag LOCUS_05740 76580 78004 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_05740 78070 79422 gene locus_tag LOCUS_05750 78070 79422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 79424 80584 gene locus_tag LOCUS_05760 79424 80584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 80588 82006 gene locus_tag LOCUS_05770 80588 82006 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_05770 82071 83222 gene locus_tag LOCUS_05780 82071 83222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 83371 84270 gene locus_tag LOCUS_05790 83371 84270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 84304 85176 gene locus_tag LOCUS_05800 84304 85176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 85252 86235 gene locus_tag LOCUS_05810 85252 86235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 86283 87680 gene locus_tag LOCUS_05820 86283 87680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 87688 88767 gene locus_tag LOCUS_05830 87688 88767 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940262.1 protein_id gnl|my_center|LOCUS_05830 88799 90055 gene locus_tag LOCUS_05840 88799 90055 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461032.1 protein_id gnl|my_center|LOCUS_05840 90062 90709 gene locus_tag LOCUS_05850 90062 90709 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220030.1 protein_id gnl|my_center|LOCUS_05850 90723 91688 gene locus_tag LOCUS_05860 90723 91688 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_05860 91685 92947 gene locus_tag LOCUS_05870 91685 92947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 92968 94410 gene locus_tag LOCUS_05880 92968 94410 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944025.1 protein_id gnl|my_center|LOCUS_05880 94741 94496 gene locus_tag LOCUS_05890 94741 94496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 94628 95914 gene locus_tag LOCUS_05900 94628 95914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 95915 96916 gene locus_tag LOCUS_05910 95915 96916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 96925 97554 gene locus_tag LOCUS_05920 96925 97554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 97551 97934 gene locus_tag LOCUS_05930 97551 97934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 97861 98106 gene locus_tag LOCUS_05940 97861 98106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 98122 99996 gene locus_tag LOCUS_05950 98122 99996 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391425.1 protein_id gnl|my_center|LOCUS_05950 100054 101118 gene locus_tag LOCUS_05960 100054 101118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 101899 103800 gene locus_tag LOCUS_05970 101899 103800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 103826 104422 gene locus_tag LOCUS_05980 103826 104422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 104422 105465 gene locus_tag LOCUS_05990 gene allD 104422 105465 CDS product ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244926.1 protein_id gnl|my_center|LOCUS_05990 105462 106196 gene locus_tag LOCUS_06000 105462 106196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 106189 107397 gene locus_tag LOCUS_06010 106189 107397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 107400 108746 gene locus_tag LOCUS_06020 107400 108746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 108821 110281 gene locus_tag LOCUS_06030 108821 110281 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_06030 110430 111143 gene locus_tag LOCUS_06040 110430 111143 CDS product CmcI family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001988952.1 protein_id gnl|my_center|LOCUS_06040 111171 112787 gene locus_tag LOCUS_06050 111171 112787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 112777 113970 gene locus_tag LOCUS_06060 gene lhgO 112777 113970 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_06060 115359 114022 gene locus_tag LOCUS_06070 115359 114022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 116145 115384 gene locus_tag LOCUS_06080 116145 115384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 117079 116456 gene locus_tag LOCUS_06090 117079 116456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 118236 117082 gene locus_tag LOCUS_06100 118236 117082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 119042 118284 gene locus_tag LOCUS_06110 gene hisF 119042 118284 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391341.1 protein_id gnl|my_center|LOCUS_06110 119656 119036 gene locus_tag LOCUS_06120 gene hisH 119656 119036 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_06120 120804 119653 gene locus_tag LOCUS_06130 gene pseA 120804 119653 CDS product pseudaminic acid biosynthesis protein PseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856493.1 protein_id gnl|my_center|LOCUS_06130 123373 120884 gene locus_tag LOCUS_06140 123373 120884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 123509 126388 gene locus_tag LOCUS_06150 123509 126388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 126577 128994 gene locus_tag LOCUS_06160 126577 128994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 129174 131435 gene locus_tag LOCUS_06170 129174 131435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 131484 131975 gene locus_tag LOCUS_06180 131484 131975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 131992 132408 gene locus_tag LOCUS_06190 131992 132408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 132434 132856 gene locus_tag LOCUS_06200 132434 132856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 133107 134384 gene locus_tag LOCUS_06210 gene sat 133107 134384 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938590.1 protein_id gnl|my_center|LOCUS_06210 134915 134472 gene locus_tag LOCUS_06220 134915 134472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 135071 136147 gene locus_tag LOCUS_06230 gene aroB 135071 136147 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545319.1 protein_id gnl|my_center|LOCUS_06230 137507 136278 gene locus_tag LOCUS_06240 137507 136278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 >Feature sequence05 <1 575 gene locus_tag LOCUS_06250 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943078.1:class I SAM-dependent methyltransferase 861 1451 gene locus_tag LOCUS_06260 861 1451 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227071.1 protein_id gnl|my_center|LOCUS_06260 1491 1976 gene locus_tag LOCUS_06270 1491 1976 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943074.1 protein_id gnl|my_center|LOCUS_06270 2240 2605 gene locus_tag LOCUS_06280 2240 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 4043 2664 gene locus_tag LOCUS_06290 4043 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 4844 6067 gene locus_tag LOCUS_06300 4844 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 7239 6334 gene locus_tag LOCUS_06310 7239 6334 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023152.1 protein_id gnl|my_center|LOCUS_06310 9439 7394 gene locus_tag LOCUS_06320 9439 7394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 9732 9472 gene locus_tag LOCUS_06330 9732 9472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 11791 10403 gene locus_tag LOCUS_06340 11791 10403 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546691.1 protein_id gnl|my_center|LOCUS_06340 13284 11944 gene locus_tag LOCUS_06350 gene der 13284 11944 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942865.1 protein_id gnl|my_center|LOCUS_06350 14318 13287 gene locus_tag LOCUS_06360 14318 13287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 15216 14350 gene locus_tag LOCUS_06370 15216 14350 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868078.1 protein_id gnl|my_center|LOCUS_06370 16208 15372 gene locus_tag LOCUS_06380 gene lpxI 16208 15372 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791912.1 protein_id gnl|my_center|LOCUS_06380 16998 16198 gene locus_tag LOCUS_06390 gene lpxA 16998 16198 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_06390 17592 17146 gene locus_tag LOCUS_06400 gene fabZ 17592 17146 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939641.1 protein_id gnl|my_center|LOCUS_06400 18646 17585 gene locus_tag LOCUS_06410 gene lpxD 18646 17585 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_06410 19119 18829 gene locus_tag LOCUS_06420 19119 18829 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_06420 20598 19306 gene locus_tag LOCUS_06430 gene eno 20598 19306 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942923.1 protein_id gnl|my_center|LOCUS_06430 21984 20776 gene locus_tag LOCUS_06440 21984 20776 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_06440 22335 22598 gene locus_tag LOCUS_06450 22335 22598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 23263 22718 gene locus_tag LOCUS_06460 23263 22718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 23676 23296 gene locus_tag LOCUS_06470 gene cheY 23676 23296 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007649667.1 protein_id gnl|my_center|LOCUS_06470 23897 24838 gene locus_tag LOCUS_06480 23897 24838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 25745 25029 gene locus_tag LOCUS_06490 25745 25029 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367602.1 protein_id gnl|my_center|LOCUS_06490 25992 30137 gene locus_tag LOCUS_06500 25992 30137 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122252.1 protein_id gnl|my_center|LOCUS_06500 30371 30805 gene locus_tag LOCUS_06510 30371 30805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 31284 30826 gene locus_tag LOCUS_06520 31284 30826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943969.1 protein_id gnl|my_center|LOCUS_06520 32952 31342 gene locus_tag LOCUS_06530 32952 31342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 33617 35890 gene locus_tag LOCUS_06540 33617 35890 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943083.1 protein_id gnl|my_center|LOCUS_06540 36380 35925 gene locus_tag LOCUS_06550 36380 35925 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090684.1 protein_id gnl|my_center|LOCUS_06550 37175 36471 gene locus_tag LOCUS_06560 gene aat 37175 36471 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938894.1 protein_id gnl|my_center|LOCUS_06560 37867 37172 gene locus_tag LOCUS_06570 gene hypB 37867 37172 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880399.1 protein_id gnl|my_center|LOCUS_06570 38362 38018 gene locus_tag LOCUS_06580 38362 38018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 38840 38328 gene locus_tag LOCUS_06590 38840 38328 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941451.1 protein_id gnl|my_center|LOCUS_06590 39869 38862 gene locus_tag LOCUS_06600 gene hypE 39869 38862 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940978.1 protein_id gnl|my_center|LOCUS_06600 41005 39920 gene locus_tag LOCUS_06610 gene hypD 41005 39920 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940977.1 protein_id gnl|my_center|LOCUS_06610 41280 41002 gene locus_tag LOCUS_06620 41280 41002 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940976.1 protein_id gnl|my_center|LOCUS_06620 43694 41322 gene locus_tag LOCUS_06630 gene hypF 43694 41322 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_06630 44364 43705 gene locus_tag LOCUS_06640 gene cybH 44364 43705 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940797.1 protein_id gnl|my_center|LOCUS_06640 46074 44374 gene locus_tag LOCUS_06650 46074 44374 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941450.1 protein_id gnl|my_center|LOCUS_06650 47188 46100 gene locus_tag LOCUS_06660 47188 46100 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941447.1 protein_id gnl|my_center|LOCUS_06660 48429 47386 gene locus_tag LOCUS_06670 gene waaC 48429 47386 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_06670 48790 49764 gene locus_tag LOCUS_06680 48790 49764 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073496.1 protein_id gnl|my_center|LOCUS_06680 49893 50111 gene locus_tag LOCUS_06690 49893 50111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 50783 50127 gene locus_tag LOCUS_06700 50783 50127 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025306754.1 protein_id gnl|my_center|LOCUS_06700 51904 50810 gene locus_tag LOCUS_06710 51904 50810 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940986.1 protein_id gnl|my_center|LOCUS_06710 51872 52045 gene locus_tag LOCUS_06720 51872 52045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 52171 53727 gene locus_tag LOCUS_06730 52171 53727 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942559.1 protein_id gnl|my_center|LOCUS_06730 53865 54719 gene locus_tag LOCUS_06740 53865 54719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 54727 57372 gene locus_tag LOCUS_06750 54727 57372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 57959 57384 gene locus_tag LOCUS_06760 57959 57384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 59866 57977 gene locus_tag LOCUS_06770 59866 57977 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_06770 60037 60363 gene locus_tag LOCUS_06780 60037 60363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 60499 60948 gene locus_tag LOCUS_06790 60499 60948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 60963 61976 gene locus_tag LOCUS_06800 gene amrS 60963 61976 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546747.1 protein_id gnl|my_center|LOCUS_06800 62827 62072 gene locus_tag LOCUS_06810 62827 62072 CDS product CsgG/HfaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888368.1 protein_id gnl|my_center|LOCUS_06810 63011 64858 gene locus_tag LOCUS_06820 63011 64858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 64873 65694 gene locus_tag LOCUS_06830 64873 65694 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_06830 65714 66484 gene locus_tag LOCUS_06840 gene ugpQ 65714 66484 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815363.1 protein_id gnl|my_center|LOCUS_06840 66519 67787 gene locus_tag LOCUS_06850 66519 67787 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968391.1 protein_id gnl|my_center|LOCUS_06850 71475 67831 gene locus_tag LOCUS_06860 71475 67831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 72246 71617 gene locus_tag LOCUS_06870 72246 71617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 73575 72499 gene locus_tag LOCUS_06880 73575 72499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 73969 75135 gene locus_tag LOCUS_06890 73969 75135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 75147 77084 gene locus_tag LOCUS_06900 75147 77084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 77696 77112 gene locus_tag LOCUS_06910 gene gmhB 77696 77112 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_06910 78660 77671 gene locus_tag LOCUS_06920 gene waaF 78660 77671 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_06920 79120 79902 gene locus_tag LOCUS_06930 gene rpsB 79120 79902 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942566.1 protein_id gnl|my_center|LOCUS_06930 80046 80639 gene locus_tag LOCUS_06940 gene tsf 80046 80639 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942565.1 protein_id gnl|my_center|LOCUS_06940 80667 81395 gene locus_tag LOCUS_06950 gene pyrH 80667 81395 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904124.1 protein_id gnl|my_center|LOCUS_06950 81388 81942 gene locus_tag LOCUS_06960 gene frr 81388 81942 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942563.1 protein_id gnl|my_center|LOCUS_06960 81939 82718 gene locus_tag LOCUS_06970 81939 82718 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_06970 82715 83512 gene locus_tag LOCUS_06980 82715 83512 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942561.1 protein_id gnl|my_center|LOCUS_06980 83518 84753 gene locus_tag LOCUS_06990 83518 84753 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942560.1 protein_id gnl|my_center|LOCUS_06990 84750 85826 gene locus_tag LOCUS_07000 gene rseP 84750 85826 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942559.1 protein_id gnl|my_center|LOCUS_07000 85823 86599 gene locus_tag LOCUS_07010 gene tsaB 85823 86599 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817349.1 protein_id gnl|my_center|LOCUS_07010 86844 89741 gene locus_tag LOCUS_07020 86844 89741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 90140 89787 gene locus_tag LOCUS_07030 90140 89787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 93434 90165 gene locus_tag LOCUS_07040 93434 90165 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420345.1 protein_id gnl|my_center|LOCUS_07040 93654 94004 gene locus_tag LOCUS_07050 93654 94004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 94810 94040 gene locus_tag LOCUS_07060 94810 94040 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932553.1 protein_id gnl|my_center|LOCUS_07060 95470 95210 gene locus_tag LOCUS_07070 95470 95210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 97268 95493 gene locus_tag LOCUS_07080 97268 95493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 97614 98348 gene locus_tag LOCUS_07090 97614 98348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 98461 99897 gene locus_tag LOCUS_07100 98461 99897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 99894 100352 gene locus_tag LOCUS_07110 99894 100352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 100420 101931 gene locus_tag LOCUS_07120 100420 101931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 102279 103265 gene locus_tag LOCUS_07130 gene rfaE1 102279 103265 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546729.1 protein_id gnl|my_center|LOCUS_07130 103262 104149 gene locus_tag LOCUS_07140 103262 104149 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965023.1 protein_id gnl|my_center|LOCUS_07140 104187 104495 gene locus_tag LOCUS_07150 104187 104495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 104492 105097 gene locus_tag LOCUS_07160 gene gmk 104492 105097 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016348898.1 protein_id gnl|my_center|LOCUS_07160 105104 105859 gene locus_tag LOCUS_07170 gene rlmB 105104 105859 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073677.1 protein_id gnl|my_center|LOCUS_07170 106522 110754 gene locus_tag LOCUS_07180 106522 110754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 110785 111615 gene locus_tag LOCUS_07190 110785 111615 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002079012.1 protein_id gnl|my_center|LOCUS_07190 111612 112235 gene locus_tag LOCUS_07200 111612 112235 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105137.1 protein_id gnl|my_center|LOCUS_07200 112265 114586 gene locus_tag LOCUS_07210 112265 114586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 115988 114762 gene locus_tag LOCUS_07220 115988 114762 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986828.1 protein_id gnl|my_center|LOCUS_07220 116290 116205 gene locus_tag LOCUS_t00050 116290 116205 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 116789 116301 gene locus_tag LOCUS_07230 gene secG 116789 116301 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813995.1 protein_id gnl|my_center|LOCUS_07230 117612 116857 gene locus_tag LOCUS_07240 gene tpiA 117612 116857 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391808.1 protein_id gnl|my_center|LOCUS_07240 118813 117629 gene locus_tag LOCUS_07250 gene pgk 118813 117629 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942273.1 protein_id gnl|my_center|LOCUS_07250 119565 119122 gene locus_tag LOCUS_07260 gene rimI 119565 119122 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942401.1 protein_id gnl|my_center|LOCUS_07260 120770 119562 gene locus_tag LOCUS_07270 120770 119562 CDS product glyceraldehyde 3-phosphate dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546756.1 protein_id gnl|my_center|LOCUS_07270 121833 120922 gene locus_tag LOCUS_07280 gene cysK 121833 120922 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257225.1 protein_id gnl|my_center|LOCUS_07280 123073 121820 gene locus_tag LOCUS_07290 123073 121820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 123302 124123 gene locus_tag LOCUS_07300 123302 124123 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943877.1 protein_id gnl|my_center|LOCUS_07300 124239 124315 gene locus_tag LOCUS_t00060 124239 124315 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 124513 125337 gene locus_tag LOCUS_07310 124513 125337 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028263.1 protein_id gnl|my_center|LOCUS_07310 125422 126141 gene locus_tag LOCUS_07320 125422 126141 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_07320 126145 126570 gene locus_tag LOCUS_07330 126145 126570 CDS product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546858.1 protein_id gnl|my_center|LOCUS_07330 127202 128452 gene locus_tag LOCUS_07340 127202 128452 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919606.1 protein_id gnl|my_center|LOCUS_07340 129375 128419 gene locus_tag LOCUS_07350 129375 128419 CDS product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389754.1 protein_id gnl|my_center|LOCUS_07350 130462 130052 gene locus_tag LOCUS_07360 130462 130052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 132397 130850 gene locus_tag LOCUS_07370 132397 130850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 133478 132390 gene locus_tag LOCUS_07380 133478 132390 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525235.1 protein_id gnl|my_center|LOCUS_07380 134228 133782 gene locus_tag LOCUS_07390 134228 133782 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224535.1 protein_id gnl|my_center|LOCUS_07390 134607 134323 gene locus_tag LOCUS_07400 134607 134323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 134863 134567 gene locus_tag LOCUS_07410 134863 134567 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869995.1 protein_id gnl|my_center|LOCUS_07410 135141 134860 gene locus_tag LOCUS_07420 135141 134860 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086649.1 protein_id gnl|my_center|LOCUS_07420 136814 135252 gene locus_tag LOCUS_07430 136814 135252 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368514.1 protein_id gnl|my_center|LOCUS_07430 >Feature sequence06 930 523 gene locus_tag LOCUS_07440 930 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 2142 934 gene locus_tag LOCUS_07450 2142 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 2772 2245 gene locus_tag LOCUS_07460 2772 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 5102 2772 gene locus_tag LOCUS_07470 5102 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 6664 5105 gene locus_tag LOCUS_07480 6664 5105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 7099 6731 gene locus_tag LOCUS_07490 7099 6731 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258036.1 protein_id gnl|my_center|LOCUS_07490 7455 7105 gene locus_tag LOCUS_07500 7455 7105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 8343 7462 gene locus_tag LOCUS_07510 8343 7462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 9499 8399 gene locus_tag LOCUS_07520 9499 8399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258033.1 protein_id gnl|my_center|LOCUS_07520 10100 9510 gene locus_tag LOCUS_07530 10100 9510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 10851 10105 gene locus_tag LOCUS_07540 10851 10105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258031.1 protein_id gnl|my_center|LOCUS_07540 11334 10927 gene locus_tag LOCUS_07550 11334 10927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 12146 11364 gene locus_tag LOCUS_07560 12146 11364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 14382 12160 gene locus_tag LOCUS_07570 14382 12160 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941639.1 protein_id gnl|my_center|LOCUS_07570 15218 14379 gene locus_tag LOCUS_07580 15218 14379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 16456 15230 gene locus_tag LOCUS_07590 16456 15230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 17399 16521 gene locus_tag LOCUS_07600 17399 16521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 17908 17408 gene locus_tag LOCUS_07610 17908 17408 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258023.1 protein_id gnl|my_center|LOCUS_07610 20038 18092 gene locus_tag LOCUS_07620 20038 18092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 20621 22042 gene locus_tag LOCUS_07630 20621 22042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 22035 23081 gene locus_tag LOCUS_07640 22035 23081 CDS product NrtA/SsuA/CpmA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967169.1 protein_id gnl|my_center|LOCUS_07640 23092 24150 gene locus_tag LOCUS_07650 23092 24150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 24147 26564 gene locus_tag LOCUS_07660 24147 26564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 26617 27060 gene locus_tag LOCUS_07670 26617 27060 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229349.1 protein_id gnl|my_center|LOCUS_07670 27114 28997 gene locus_tag LOCUS_07680 27114 28997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 29270 29959 gene locus_tag LOCUS_07690 29270 29959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 30019 30393 gene locus_tag LOCUS_07700 30019 30393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 30717 35081 gene locus_tag LOCUS_07710 30717 35081 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200903603.1 protein_id gnl|my_center|LOCUS_07710 36450 35290 gene locus_tag LOCUS_07720 36450 35290 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990623.1 protein_id gnl|my_center|LOCUS_07720 38243 36888 gene locus_tag LOCUS_07730 38243 36888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 38136 38384 gene locus_tag LOCUS_07740 38136 38384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 38620 40350 gene locus_tag LOCUS_07750 38620 40350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 40384 41694 gene locus_tag LOCUS_07760 40384 41694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 41822 42211 gene locus_tag LOCUS_07770 41822 42211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 42230 42835 gene locus_tag LOCUS_07780 42230 42835 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_07780 42846 44174 gene locus_tag LOCUS_07790 42846 44174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 44198 44395 gene locus_tag LOCUS_07800 44198 44395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 44632 44423 gene locus_tag LOCUS_07810 44632 44423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 45175 44675 gene locus_tag LOCUS_07820 45175 44675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 45579 46550 gene locus_tag LOCUS_07830 45579 46550 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941034.1 protein_id gnl|my_center|LOCUS_07830 46647 47045 gene locus_tag LOCUS_07840 46647 47045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 49357 47042 gene locus_tag LOCUS_07850 49357 47042 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166873.1 protein_id gnl|my_center|LOCUS_07850 49868 50341 gene locus_tag LOCUS_07860 49868 50341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 51330 50407 gene locus_tag LOCUS_07870 51330 50407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 52090 51551 gene locus_tag LOCUS_07880 52090 51551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 53402 52446 gene locus_tag LOCUS_07890 53402 52446 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167917.1 protein_id gnl|my_center|LOCUS_07890 54112 54405 gene locus_tag LOCUS_07900 54112 54405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 54573 55481 gene locus_tag LOCUS_07910 54573 55481 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018271.1 protein_id gnl|my_center|LOCUS_07910 55478 56269 gene locus_tag LOCUS_07920 55478 56269 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392394.1 protein_id gnl|my_center|LOCUS_07920 57893 58498 gene locus_tag LOCUS_07930 57893 58498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 58667 58921 gene locus_tag LOCUS_07940 58667 58921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 58918 59376 gene locus_tag LOCUS_07950 58918 59376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 59363 59659 gene locus_tag LOCUS_07960 59363 59659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 60281 60448 gene locus_tag LOCUS_07970 60281 60448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07970 60456 60773 gene locus_tag LOCUS_07980 60456 60773 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942189.1 protein_id gnl|my_center|LOCUS_07980 60962 61180 gene locus_tag LOCUS_07990 60962 61180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 62674 61586 gene locus_tag LOCUS_08000 62674 61586 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546841.1 protein_id gnl|my_center|LOCUS_08000 63087 62695 gene locus_tag LOCUS_08010 63087 62695 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544974.1 protein_id gnl|my_center|LOCUS_08010 66476 63165 gene locus_tag LOCUS_08020 66476 63165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 66963 66463 gene locus_tag LOCUS_08030 66963 66463 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545087.1 protein_id gnl|my_center|LOCUS_08030 68610 66997 gene locus_tag LOCUS_08040 68610 66997 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039643456.1 protein_id gnl|my_center|LOCUS_08040 71359 68612 gene locus_tag LOCUS_08050 71359 68612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 72244 71369 gene locus_tag LOCUS_08060 72244 71369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 73976 72408 gene locus_tag LOCUS_08070 73976 72408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 75172 73982 gene locus_tag LOCUS_08080 75172 73982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 76240 75749 gene locus_tag LOCUS_08090 76240 75749 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545664.1 protein_id gnl|my_center|LOCUS_08090 76769 76245 gene locus_tag LOCUS_08100 76769 76245 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545664.1 protein_id gnl|my_center|LOCUS_08100 77151 76858 gene locus_tag LOCUS_08110 77151 76858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 77309 77175 gene locus_tag LOCUS_08120 77309 77175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 78343 77672 gene locus_tag LOCUS_08130 78343 77672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 78750 78364 gene locus_tag LOCUS_08140 78750 78364 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940222.1 protein_id gnl|my_center|LOCUS_08140 80473 78743 gene locus_tag LOCUS_08150 80473 78743 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545995.1 protein_id gnl|my_center|LOCUS_08150 80823 80470 gene locus_tag LOCUS_08160 80823 80470 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940220.1 protein_id gnl|my_center|LOCUS_08160 82293 80833 gene locus_tag LOCUS_08170 82293 80833 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940219.1 protein_id gnl|my_center|LOCUS_08170 83463 82678 gene locus_tag LOCUS_08180 83463 82678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 85233 84376 gene locus_tag LOCUS_08190 85233 84376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 87859 85718 gene locus_tag LOCUS_08200 87859 85718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 88523 90010 gene locus_tag LOCUS_08210 88523 90010 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941261.1 protein_id gnl|my_center|LOCUS_08210 90191 91105 gene locus_tag LOCUS_08220 90191 91105 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_08220 91102 92883 gene locus_tag LOCUS_08230 91102 92883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 92894 94174 gene locus_tag LOCUS_08240 92894 94174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 95134 94235 gene locus_tag LOCUS_08250 95134 94235 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340302.1 protein_id gnl|my_center|LOCUS_08250 96657 95134 gene locus_tag LOCUS_08260 96657 95134 CDS product alternate F1F0 ATPase, F1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022405.1 protein_id gnl|my_center|LOCUS_08260 97543 96776 gene locus_tag LOCUS_08270 97543 96776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 98010 97732 gene locus_tag LOCUS_08280 98010 97732 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328511.1 protein_id gnl|my_center|LOCUS_08280 98853 98029 gene locus_tag LOCUS_08290 98853 98029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 99556 98993 gene locus_tag LOCUS_08300 99556 98993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 99905 99588 gene locus_tag LOCUS_08310 99905 99588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 102159 100111 gene locus_tag LOCUS_08320 102159 100111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 103072 102152 gene locus_tag LOCUS_08330 103072 102152 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793043.1 protein_id gnl|my_center|LOCUS_08330 103507 103223 gene locus_tag LOCUS_08340 103507 103223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 103732 103514 gene locus_tag LOCUS_08350 103732 103514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 104019 104270 gene locus_tag LOCUS_08360 104019 104270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 104274 104540 gene locus_tag LOCUS_08370 104274 104540 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007281268.1 protein_id gnl|my_center|LOCUS_08370 104832 105083 gene locus_tag LOCUS_08380 gene yefM 104832 105083 CDS product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259256.1 protein_id gnl|my_center|LOCUS_08380 105080 105334 gene locus_tag LOCUS_08390 gene yoeB 105080 105334 CDS product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_08390 105730 105401 gene locus_tag LOCUS_08400 105730 105401 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665986.1 protein_id gnl|my_center|LOCUS_08400 105974 105714 gene locus_tag LOCUS_08410 105974 105714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 106366 106881 gene locus_tag LOCUS_08420 106366 106881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 107694 107527 gene locus_tag LOCUS_08430 107694 107527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 108439 108203 gene locus_tag LOCUS_08440 108439 108203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 108676 108452 gene locus_tag LOCUS_08450 108676 108452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 109275 108919 gene locus_tag LOCUS_08460 109275 108919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 110259 109783 gene locus_tag LOCUS_08470 110259 109783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 111339 110665 gene locus_tag LOCUS_08480 111339 110665 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328512.1 protein_id gnl|my_center|LOCUS_08480 111647 111336 gene locus_tag LOCUS_08490 111647 111336 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932708.1 protein_id gnl|my_center|LOCUS_08490 111952 111647 gene locus_tag LOCUS_08500 111952 111647 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022410.1 protein_id gnl|my_center|LOCUS_08500 112356 111958 gene locus_tag LOCUS_08510 112356 111958 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120166.1 protein_id gnl|my_center|LOCUS_08510 113771 112371 gene locus_tag LOCUS_08520 gene atpD 113771 112371 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442644.1 protein_id gnl|my_center|LOCUS_08520 117744 114130 gene locus_tag LOCUS_08530 gene dnaE 117744 114130 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_08530 118674 117889 gene locus_tag LOCUS_08540 118674 117889 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937844.1 protein_id gnl|my_center|LOCUS_08540 118856 118683 gene locus_tag LOCUS_08550 118856 118683 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937959.1 protein_id gnl|my_center|LOCUS_08550 119202 120344 gene locus_tag LOCUS_08560 gene rfaG 119202 120344 CDS product lipopolysaccharide glucosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634283.1 protein_id gnl|my_center|LOCUS_08560 120341 121231 gene locus_tag LOCUS_08570 120341 121231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 121363 123138 gene locus_tag LOCUS_08580 121363 123138 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545590.1 protein_id gnl|my_center|LOCUS_08580 123166 124011 gene locus_tag LOCUS_08590 123166 124011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 124021 125148 gene locus_tag LOCUS_08600 124021 125148 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546260.1 protein_id gnl|my_center|LOCUS_08600 125145 126293 gene locus_tag LOCUS_08610 125145 126293 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259281.1 protein_id gnl|my_center|LOCUS_08610 126290 127417 gene locus_tag LOCUS_08620 126290 127417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 127448 128305 gene locus_tag LOCUS_08630 127448 128305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 128307 129740 gene locus_tag LOCUS_08640 128307 129740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 129737 130651 gene locus_tag LOCUS_08650 129737 130651 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966631.1 protein_id gnl|my_center|LOCUS_08650 130693 131736 gene locus_tag LOCUS_08660 130693 131736 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532743.1 protein_id gnl|my_center|LOCUS_08660 131822 132022 gene locus_tag LOCUS_08670 131822 132022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 132388 132029 gene locus_tag LOCUS_08680 132388 132029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 134243 132708 gene locus_tag LOCUS_08690 134243 132708 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_08690 134480 134253 gene locus_tag LOCUS_08700 134480 134253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 134793 135344 gene locus_tag LOCUS_08710 134793 135344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 >Feature sequence07 1192 161 gene locus_tag LOCUS_08720 gene ybgF 1192 161 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926896.1 protein_id gnl|my_center|LOCUS_08720 2645 1257 gene locus_tag LOCUS_08730 gene tolB 2645 1257 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932320.1 protein_id gnl|my_center|LOCUS_08730 3657 2680 gene locus_tag LOCUS_08740 3657 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 4086 3661 gene locus_tag LOCUS_08750 gene tolR 4086 3661 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_08750 4791 4099 gene locus_tag LOCUS_08760 gene tolQ 4791 4099 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_08760 5217 6527 gene locus_tag LOCUS_08770 5217 6527 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_08770 6517 7728 gene locus_tag LOCUS_08780 6517 7728 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942463.1 protein_id gnl|my_center|LOCUS_08780 7743 8189 gene locus_tag LOCUS_08790 7743 8189 CDS product YbgC/FadM family acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944070.1 protein_id gnl|my_center|LOCUS_08790 8285 8851 gene locus_tag LOCUS_08800 8285 8851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 8854 11085 gene locus_tag LOCUS_08810 8854 11085 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546592.1 protein_id gnl|my_center|LOCUS_08810 11131 11940 gene locus_tag LOCUS_08820 11131 11940 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183894.1 protein_id gnl|my_center|LOCUS_08820 13692 12043 gene locus_tag LOCUS_08830 13692 12043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 14260 13781 gene locus_tag LOCUS_08840 14260 13781 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941854.1 protein_id gnl|my_center|LOCUS_08840 15582 14260 gene locus_tag LOCUS_08850 15582 14260 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940649.1 protein_id gnl|my_center|LOCUS_08850 15882 17120 gene locus_tag LOCUS_08860 15882 17120 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942444.1 protein_id gnl|my_center|LOCUS_08860 17136 18728 gene locus_tag LOCUS_08870 gene cimA 17136 18728 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942443.1 protein_id gnl|my_center|LOCUS_08870 18712 19122 gene locus_tag LOCUS_08880 18712 19122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 19781 19134 gene locus_tag LOCUS_08890 19781 19134 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545579.1 protein_id gnl|my_center|LOCUS_08890 21182 19851 gene locus_tag LOCUS_08900 gene miaB 21182 19851 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942838.1 protein_id gnl|my_center|LOCUS_08900 22360 21179 gene locus_tag LOCUS_08910 22360 21179 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940356.1 protein_id gnl|my_center|LOCUS_08910 22711 22493 gene locus_tag LOCUS_08920 22711 22493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 24156 22708 gene locus_tag LOCUS_08930 gene purB 24156 22708 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_08930 26163 24361 gene locus_tag LOCUS_08940 gene recJ 26163 24361 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020281.1 protein_id gnl|my_center|LOCUS_08940 27142 26207 gene locus_tag LOCUS_08950 gene miaA 27142 26207 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081395.1 protein_id gnl|my_center|LOCUS_08950 27575 28654 gene locus_tag LOCUS_08960 gene serC 27575 28654 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_08960 28660 29529 gene locus_tag LOCUS_08970 28660 29529 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433836.1 protein_id gnl|my_center|LOCUS_08970 30906 29707 gene locus_tag LOCUS_08980 30906 29707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 31258 31656 gene locus_tag LOCUS_08990 31258 31656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 31680 32735 gene locus_tag LOCUS_09000 gene rlmN 31680 32735 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_09000 33173 32742 gene locus_tag LOCUS_09010 33173 32742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 33633 33349 gene locus_tag LOCUS_09020 33633 33349 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762233.1 protein_id gnl|my_center|LOCUS_09020 34001 33639 gene locus_tag LOCUS_09030 34001 33639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 35211 34039 gene locus_tag LOCUS_09040 35211 34039 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913616.1 protein_id gnl|my_center|LOCUS_09040 37726 35516 gene locus_tag LOCUS_09050 37726 35516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 39220 37745 gene locus_tag LOCUS_09060 gene bepA 39220 37745 CDS product beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098231.1 protein_id gnl|my_center|LOCUS_09060 39447 41111 gene locus_tag LOCUS_09070 gene recN 39447 41111 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_09070 41128 42144 gene locus_tag LOCUS_09080 41128 42144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 protein_id gnl|my_center|LOCUS_09080 42198 42273 gene locus_tag LOCUS_t00070 42198 42273 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 42690 45743 gene locus_tag LOCUS_09090 42690 45743 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023457.1 protein_id gnl|my_center|LOCUS_09090 45781 47865 gene locus_tag LOCUS_09100 45781 47865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 48189 48311 gene locus_tag LOCUS_09110 48189 48311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 48355 49275 gene locus_tag LOCUS_09120 48355 49275 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765521.1 protein_id gnl|my_center|LOCUS_09120 49348 49424 gene locus_tag LOCUS_t00080 49348 49424 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 49616 50674 gene locus_tag LOCUS_09130 49616 50674 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329385.1 protein_id gnl|my_center|LOCUS_09130 51180 52544 gene locus_tag LOCUS_09140 gene rhlB 51180 52544 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119269.1 protein_id gnl|my_center|LOCUS_09140 53008 52628 gene locus_tag LOCUS_09150 53008 52628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 53631 53248 gene locus_tag LOCUS_09160 53631 53248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 54000 53686 gene locus_tag LOCUS_09170 54000 53686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 55742 54306 gene locus_tag LOCUS_09180 55742 54306 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941905.1 protein_id gnl|my_center|LOCUS_09180 57709 55910 gene locus_tag LOCUS_09190 57709 55910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 59580 57778 gene locus_tag LOCUS_09200 59580 57778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 60482 59577 gene locus_tag LOCUS_09210 60482 59577 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942090.1 protein_id gnl|my_center|LOCUS_09210 60934 61545 gene locus_tag LOCUS_09220 60934 61545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09220 61624 62829 gene locus_tag LOCUS_09230 61624 62829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09230 63071 64363 gene locus_tag LOCUS_09240 gene gptM 63071 64363 CDS product geopeptide radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942092.1 protein_id gnl|my_center|LOCUS_09240 64619 65083 gene locus_tag LOCUS_09250 64619 65083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09250 66606 65263 gene locus_tag LOCUS_09260 66606 65263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 67337 66750 gene locus_tag LOCUS_09270 67337 66750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 67624 68163 gene locus_tag LOCUS_09280 67624 68163 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036141.1 protein_id gnl|my_center|LOCUS_09280 68168 68788 gene locus_tag LOCUS_09290 68168 68788 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889526.1 protein_id gnl|my_center|LOCUS_09290 68868 69911 gene locus_tag LOCUS_09300 68868 69911 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392449.1 protein_id gnl|my_center|LOCUS_09300 71068 70112 gene locus_tag LOCUS_09310 71068 70112 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_09310 72287 71184 gene locus_tag LOCUS_09320 72287 71184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 72756 73370 gene locus_tag LOCUS_09330 gene ppiB 72756 73370 CDS product peptidylprolyl isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256002.1 protein_id gnl|my_center|LOCUS_09330 75422 73437 gene locus_tag LOCUS_09340 75422 73437 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679930.1 protein_id gnl|my_center|LOCUS_09340 77408 75579 gene locus_tag LOCUS_09350 77408 75579 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667902.1 protein_id gnl|my_center|LOCUS_09350 77828 79600 gene locus_tag LOCUS_09360 77828 79600 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404064.1 protein_id gnl|my_center|LOCUS_09360 79610 83230 gene locus_tag LOCUS_09370 79610 83230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 84713 83502 gene locus_tag LOCUS_09380 gene coaBC 84713 83502 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965027.1 protein_id gnl|my_center|LOCUS_09380 85253 84735 gene locus_tag LOCUS_09390 85253 84735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 85776 85237 gene locus_tag LOCUS_09400 85776 85237 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943161.1 protein_id gnl|my_center|LOCUS_09400 85969 86793 gene locus_tag LOCUS_09410 85969 86793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 86925 87629 gene locus_tag LOCUS_09420 86925 87629 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_09420 87841 87713 gene locus_tag LOCUS_09430 87841 87713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 88311 88691 gene locus_tag LOCUS_09440 88311 88691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 88762 89184 gene locus_tag LOCUS_09450 88762 89184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 89285 90214 gene locus_tag LOCUS_09460 89285 90214 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855308.1 protein_id gnl|my_center|LOCUS_09460 90217 91146 gene locus_tag LOCUS_09470 90217 91146 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838396.1 protein_id gnl|my_center|LOCUS_09470 91182 91571 gene locus_tag LOCUS_09480 91182 91571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 91876 93681 gene locus_tag LOCUS_09490 91876 93681 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957653.1 protein_id gnl|my_center|LOCUS_09490 94361 93816 gene locus_tag LOCUS_09500 94361 93816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 94362 94601 gene locus_tag LOCUS_09510 94362 94601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 94598 96319 gene locus_tag LOCUS_09520 94598 96319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 96489 97121 gene locus_tag LOCUS_09530 96489 97121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 98390 97314 gene locus_tag LOCUS_09540 98390 97314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943375.1 protein_id gnl|my_center|LOCUS_09540 100010 98460 gene locus_tag LOCUS_09550 100010 98460 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990624.1 protein_id gnl|my_center|LOCUS_09550 100561 100037 gene locus_tag LOCUS_09560 100561 100037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 101268 100570 gene locus_tag LOCUS_09570 gene mip 101268 100570 CDS product macrophage infectivity potentiator Mip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213317.1 protein_id gnl|my_center|LOCUS_09570 102018 101392 gene locus_tag LOCUS_09580 102018 101392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 104579 102114 gene locus_tag LOCUS_09590 104579 102114 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943296.1 protein_id gnl|my_center|LOCUS_09590 107712 105193 gene locus_tag LOCUS_09600 107712 105193 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714164.1 protein_id gnl|my_center|LOCUS_09600 107859 108056 gene locus_tag LOCUS_09610 107859 108056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 109143 108076 gene locus_tag LOCUS_09620 109143 108076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 109663 109337 gene locus_tag LOCUS_09630 109663 109337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 110207 109857 gene locus_tag LOCUS_09640 110207 109857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 110456 110250 gene locus_tag LOCUS_09650 110456 110250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09650 113220 110542 gene locus_tag LOCUS_09660 113220 110542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09660 113173 113355 gene locus_tag LOCUS_09670 113173 113355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 113595 113407 gene locus_tag LOCUS_09680 113595 113407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 117790 113672 gene locus_tag LOCUS_09690 gene fdhF 117790 113672 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482725.1 transl_except (pos:complement(115307..115309),aa:Sec) note codon on position 828 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_09690 119176 117821 gene locus_tag LOCUS_09700 gene acsC 119176 117821 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545537.1 protein_id gnl|my_center|LOCUS_09700 121502 119298 gene locus_tag LOCUS_09710 gene acsB 121502 119298 CDS product acetyl-CoA decarbonylase/synthase complex subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392716.1 protein_id gnl|my_center|LOCUS_09710 124176 121540 gene locus_tag LOCUS_09720 124176 121540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 126307 124310 gene locus_tag LOCUS_09730 gene cooS 126307 124310 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066467.1 protein_id gnl|my_center|LOCUS_09730 127214 126327 gene locus_tag LOCUS_09740 gene folD 127214 126327 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230259.1 protein_id gnl|my_center|LOCUS_09740 129653 127434 gene locus_tag LOCUS_09750 gene pilB 129653 127434 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_09750 >Feature sequence08 213 2321 gene locus_tag LOCUS_09760 213 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 3373 2438 gene locus_tag LOCUS_09770 3373 2438 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940692.1 protein_id gnl|my_center|LOCUS_09770 3755 3615 gene locus_tag LOCUS_09780 3755 3615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 4021 6348 gene locus_tag LOCUS_09790 4021 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 6345 6986 gene locus_tag LOCUS_09800 6345 6986 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940928.1 protein_id gnl|my_center|LOCUS_09800 7240 9312 gene locus_tag LOCUS_09810 7240 9312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 9357 9869 gene locus_tag LOCUS_09820 9357 9869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 10408 9938 gene locus_tag LOCUS_09830 10408 9938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 10289 10828 gene locus_tag LOCUS_09840 10289 10828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 11895 10840 gene locus_tag LOCUS_09850 11895 10840 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188702.1 protein_id gnl|my_center|LOCUS_09850 13172 11892 gene locus_tag LOCUS_09860 13172 11892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 13524 14741 gene locus_tag LOCUS_09870 13524 14741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 16937 14805 gene locus_tag LOCUS_09880 16937 14805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 17954 16953 gene locus_tag LOCUS_09890 17954 16953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 18797 17976 gene locus_tag LOCUS_09900 18797 17976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 19672 18803 gene locus_tag LOCUS_09910 19672 18803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 21312 19669 gene locus_tag LOCUS_09920 21312 19669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 22533 21412 gene locus_tag LOCUS_09930 22533 21412 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939260.1 protein_id gnl|my_center|LOCUS_09930 23381 22536 gene locus_tag LOCUS_09940 23381 22536 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939259.1 protein_id gnl|my_center|LOCUS_09940 23712 25886 gene locus_tag LOCUS_09950 gene vgrG1b 23712 25886 CDS product type VI secretion system spike protein VgrG1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147059.1 protein_id gnl|my_center|LOCUS_09950 25936 26421 gene locus_tag LOCUS_09960 25936 26421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339340.1 protein_id gnl|my_center|LOCUS_09960 26624 27646 gene locus_tag LOCUS_09970 26624 27646 CDS product DUF2169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943804.1 protein_id gnl|my_center|LOCUS_09970 27639 28709 gene locus_tag LOCUS_09980 27639 28709 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943788.1 protein_id gnl|my_center|LOCUS_09980 28709 29863 gene locus_tag LOCUS_09990 28709 29863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 29894 30703 gene locus_tag LOCUS_10000 29894 30703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 30700 31971 gene locus_tag LOCUS_10010 30700 31971 CDS product TIGR02270 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943798.1 protein_id gnl|my_center|LOCUS_10010 32007 32192 gene locus_tag LOCUS_10020 32007 32192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 32226 32840 gene locus_tag LOCUS_10030 32226 32840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 33467 32973 gene locus_tag LOCUS_10040 33467 32973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 35386 33464 gene locus_tag LOCUS_10050 35386 33464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 35732 37153 gene locus_tag LOCUS_10060 35732 37153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 37143 38195 gene locus_tag LOCUS_10070 37143 38195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 38195 39307 gene locus_tag LOCUS_10080 38195 39307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 40535 39324 gene locus_tag LOCUS_10090 40535 39324 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_10090 40966 41460 gene locus_tag LOCUS_10100 40966 41460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 42323 41532 gene locus_tag LOCUS_10110 42323 41532 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_10110 42494 42742 gene locus_tag LOCUS_10120 42494 42742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 43954 42914 gene locus_tag LOCUS_10130 43954 42914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 45693 44200 gene locus_tag LOCUS_10140 45693 44200 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939946.1 protein_id gnl|my_center|LOCUS_10140 46142 46014 gene locus_tag LOCUS_10150 46142 46014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 46247 46444 gene locus_tag LOCUS_10160 46247 46444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 46392 47165 gene locus_tag LOCUS_10170 46392 47165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 47211 47801 gene locus_tag LOCUS_10180 47211 47801 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294661.1 protein_id gnl|my_center|LOCUS_10180 48204 47788 gene locus_tag LOCUS_10190 48204 47788 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943269.1 protein_id gnl|my_center|LOCUS_10190 48513 48821 gene locus_tag LOCUS_10200 48513 48821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 48818 50188 gene locus_tag LOCUS_10210 48818 50188 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762046.1 protein_id gnl|my_center|LOCUS_10210 50182 50886 gene locus_tag LOCUS_10220 50182 50886 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762240.1 protein_id gnl|my_center|LOCUS_10220 51073 52020 gene locus_tag LOCUS_10230 51073 52020 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220518.1 protein_id gnl|my_center|LOCUS_10230 52024 52338 gene locus_tag LOCUS_10240 52024 52338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 52355 54502 gene locus_tag LOCUS_10250 gene glgP 52355 54502 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880430.1 protein_id gnl|my_center|LOCUS_10250 54542 55003 gene locus_tag LOCUS_10260 54542 55003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 55185 55559 gene locus_tag LOCUS_10270 55185 55559 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878542.1 protein_id gnl|my_center|LOCUS_10270 55642 56052 gene locus_tag LOCUS_10280 55642 56052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 56738 56109 gene locus_tag LOCUS_10290 gene can 56738 56109 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 protein_id gnl|my_center|LOCUS_10290 57476 57126 gene locus_tag LOCUS_10300 57476 57126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 58920 58135 gene locus_tag LOCUS_10310 58920 58135 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940883.1 protein_id gnl|my_center|LOCUS_10310 59882 58917 gene locus_tag LOCUS_10320 59882 58917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 59992 60663 gene locus_tag LOCUS_10330 59992 60663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 60656 61408 gene locus_tag LOCUS_10340 60656 61408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 61496 62413 gene locus_tag LOCUS_10350 gene mptA 61496 62413 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496622.1 protein_id gnl|my_center|LOCUS_10350 62417 63862 gene locus_tag LOCUS_10360 62417 63862 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258188.1 protein_id gnl|my_center|LOCUS_10360 63959 66445 gene locus_tag LOCUS_10370 63959 66445 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_10370 66529 67587 gene locus_tag LOCUS_10380 66529 67587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 67702 68589 gene locus_tag LOCUS_10390 67702 68589 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140660.1 protein_id gnl|my_center|LOCUS_10390 68576 69562 gene locus_tag LOCUS_10400 68576 69562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 71408 69630 gene locus_tag LOCUS_10410 71408 69630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 72958 71558 gene locus_tag LOCUS_10420 gene pyk 72958 71558 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834388.1 protein_id gnl|my_center|LOCUS_10420 73423 74733 gene locus_tag LOCUS_10430 73423 74733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 74898 75281 gene locus_tag LOCUS_10440 74898 75281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 76289 75885 gene locus_tag LOCUS_10450 76289 75885 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941201.1 protein_id gnl|my_center|LOCUS_10450 76991 79885 gene locus_tag LOCUS_10460 76991 79885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 79878 82145 gene locus_tag LOCUS_10470 79878 82145 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942572.1 protein_id gnl|my_center|LOCUS_10470 82212 82865 gene locus_tag LOCUS_10480 82212 82865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 82986 83579 gene locus_tag LOCUS_10490 82986 83579 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023187661.1 protein_id gnl|my_center|LOCUS_10490 83576 84238 gene locus_tag LOCUS_10500 83576 84238 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107436.1 protein_id gnl|my_center|LOCUS_10500 84257 86959 gene locus_tag LOCUS_10510 84257 86959 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261883.1 protein_id gnl|my_center|LOCUS_10510 86952 89705 gene locus_tag LOCUS_10520 86952 89705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 89884 92202 gene locus_tag LOCUS_10530 89884 92202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 92237 93496 gene locus_tag LOCUS_10540 92237 93496 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389026.1 protein_id gnl|my_center|LOCUS_10540 93493 96999 gene locus_tag LOCUS_10550 93493 96999 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390981.1 protein_id gnl|my_center|LOCUS_10550 98991 97018 gene locus_tag LOCUS_10560 98991 97018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 99822 98995 gene locus_tag LOCUS_10570 99822 98995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 100423 100866 gene locus_tag LOCUS_10580 100423 100866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 102556 101078 gene locus_tag LOCUS_10590 102556 101078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 102924 102553 gene locus_tag LOCUS_10600 102924 102553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 104749 102959 gene locus_tag LOCUS_10610 104749 102959 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175139359.1 protein_id gnl|my_center|LOCUS_10610 105112 105435 gene locus_tag LOCUS_10620 105112 105435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 105744 108212 gene locus_tag LOCUS_10630 105744 108212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 108395 108787 gene locus_tag LOCUS_10640 108395 108787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 109944 108850 gene locus_tag LOCUS_10650 109944 108850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 110179 112227 gene locus_tag LOCUS_10660 110179 112227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 112389 112757 gene locus_tag LOCUS_10670 112389 112757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 115350 112987 gene locus_tag LOCUS_10680 115350 112987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 115798 116772 gene locus_tag LOCUS_10690 115798 116772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 116776 117453 gene locus_tag LOCUS_10700 116776 117453 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144248.1 protein_id gnl|my_center|LOCUS_10700 117514 118977 gene locus_tag LOCUS_10710 117514 118977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 119928 119032 gene locus_tag LOCUS_10720 119928 119032 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028341.1 protein_id gnl|my_center|LOCUS_10720 120079 120375 gene locus_tag LOCUS_10730 120079 120375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 120738 120430 gene locus_tag LOCUS_10740 120738 120430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 >Feature sequence09 303 1118 gene locus_tag LOCUS_10750 303 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 1115 2428 gene locus_tag LOCUS_10760 1115 2428 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_10760 2592 3989 gene locus_tag LOCUS_10770 2592 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 5298 4369 gene locus_tag LOCUS_10780 5298 4369 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938927.1 protein_id gnl|my_center|LOCUS_10780 5628 6071 gene locus_tag LOCUS_10790 5628 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 6114 6764 gene locus_tag LOCUS_10800 6114 6764 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932569.1 protein_id gnl|my_center|LOCUS_10800 7208 6768 gene locus_tag LOCUS_10810 7208 6768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 7494 8291 gene locus_tag LOCUS_10820 gene mazG 7494 8291 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071648.1 protein_id gnl|my_center|LOCUS_10820 8489 9142 gene locus_tag LOCUS_10830 8489 9142 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940907.1 protein_id gnl|my_center|LOCUS_10830 10178 9204 gene locus_tag LOCUS_10840 gene hemB 10178 9204 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940811.1 protein_id gnl|my_center|LOCUS_10840 12020 10269 gene locus_tag LOCUS_10850 12020 10269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 13518 12121 gene locus_tag LOCUS_10860 13518 12121 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_10860 15763 13562 gene locus_tag LOCUS_10870 15763 13562 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_10870 16220 15732 gene locus_tag LOCUS_10880 16220 15732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 17011 16337 gene locus_tag LOCUS_10890 17011 16337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 18593 16989 gene locus_tag LOCUS_10900 gene hflX 18593 16989 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941674.1 protein_id gnl|my_center|LOCUS_10900 20786 18870 gene locus_tag LOCUS_10910 gene selB 20786 18870 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_10910 21427 20789 gene locus_tag LOCUS_10920 21427 20789 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_10920 22434 21481 gene locus_tag LOCUS_10930 22434 21481 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939133.1 protein_id gnl|my_center|LOCUS_10930 22721 24292 gene locus_tag LOCUS_10940 22721 24292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 24372 24527 gene locus_tag LOCUS_10950 24372 24527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 25192 24650 gene locus_tag LOCUS_10960 25192 24650 CDS product DUF3334 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462648.1 protein_id gnl|my_center|LOCUS_10960 25612 27417 gene locus_tag LOCUS_10970 25612 27417 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783199.1 protein_id gnl|my_center|LOCUS_10970 27433 27921 gene locus_tag LOCUS_10980 27433 27921 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943377.1 protein_id gnl|my_center|LOCUS_10980 28847 28371 gene locus_tag LOCUS_10990 28847 28371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 29184 28867 gene locus_tag LOCUS_11000 29184 28867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 29634 30041 gene locus_tag LOCUS_11010 29634 30041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 30078 31133 gene locus_tag LOCUS_11020 30078 31133 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792562.1 protein_id gnl|my_center|LOCUS_11020 32463 31225 gene locus_tag LOCUS_11030 32463 31225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 32392 32556 gene locus_tag LOCUS_11040 32392 32556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 33725 32616 gene locus_tag LOCUS_11050 33725 32616 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921980.1 protein_id gnl|my_center|LOCUS_11050 34369 34013 gene locus_tag LOCUS_11060 34369 34013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 34527 35696 gene locus_tag LOCUS_11070 34527 35696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 37494 35704 gene locus_tag LOCUS_11080 gene typA 37494 35704 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219266.1 protein_id gnl|my_center|LOCUS_11080 38302 37727 gene locus_tag LOCUS_11090 38302 37727 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940353.1 protein_id gnl|my_center|LOCUS_11090 38969 38418 gene locus_tag LOCUS_11100 38969 38418 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405774.1 protein_id gnl|my_center|LOCUS_11100 40431 38980 gene locus_tag LOCUS_11110 40431 38980 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390242.1 protein_id gnl|my_center|LOCUS_11110 40675 41805 gene locus_tag LOCUS_11120 40675 41805 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943408.1 protein_id gnl|my_center|LOCUS_11120 41837 44899 gene locus_tag LOCUS_11130 41837 44899 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943409.1 protein_id gnl|my_center|LOCUS_11130 45714 44917 gene locus_tag LOCUS_11140 gene truA 45714 44917 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067314.1 protein_id gnl|my_center|LOCUS_11140 46125 45718 gene locus_tag LOCUS_11150 46125 45718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 46523 46987 gene locus_tag LOCUS_11160 46523 46987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 47232 47795 gene locus_tag LOCUS_11170 47232 47795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 47834 48505 gene locus_tag LOCUS_11180 47834 48505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 48570 49361 gene locus_tag LOCUS_11190 48570 49361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 49490 50785 gene locus_tag LOCUS_11200 49490 50785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 51370 50801 gene locus_tag LOCUS_11210 51370 50801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11210 52367 51360 gene locus_tag LOCUS_11220 52367 51360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11220 53675 52380 gene locus_tag LOCUS_11230 gene ahcY 53675 52380 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947737.1 protein_id gnl|my_center|LOCUS_11230 54850 53675 gene locus_tag LOCUS_11240 gene metK 54850 53675 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_11240 55332 55258 gene locus_tag LOCUS_t00090 55332 55258 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 55979 55407 gene locus_tag LOCUS_11250 55979 55407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 57517 55976 gene locus_tag LOCUS_11260 gene malQ 57517 55976 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259030.1 protein_id gnl|my_center|LOCUS_11260 57813 59135 gene locus_tag LOCUS_11270 57813 59135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 59147 61684 gene locus_tag LOCUS_11280 59147 61684 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942301.1 protein_id gnl|my_center|LOCUS_11280 62753 61671 gene locus_tag LOCUS_11290 62753 61671 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546105.1 protein_id gnl|my_center|LOCUS_11290 62975 63820 gene locus_tag LOCUS_11300 62975 63820 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459951.1 protein_id gnl|my_center|LOCUS_11300 63917 65302 gene locus_tag LOCUS_11310 63917 65302 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_11310 65389 65793 gene locus_tag LOCUS_11320 65389 65793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 65786 66169 gene locus_tag LOCUS_11330 65786 66169 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545864.1 protein_id gnl|my_center|LOCUS_11330 67132 66305 gene locus_tag LOCUS_11340 67132 66305 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_11340 68014 67241 gene locus_tag LOCUS_11350 gene proC 68014 67241 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943177.1 protein_id gnl|my_center|LOCUS_11350 69416 68430 gene locus_tag LOCUS_11360 gene lpxC 69416 68430 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 protein_id gnl|my_center|LOCUS_11360 70701 69655 gene locus_tag LOCUS_11370 gene lpxK 70701 69655 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_11370 71978 70698 gene locus_tag LOCUS_11380 71978 70698 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_11380 72029 72769 gene locus_tag LOCUS_11390 72029 72769 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105341.1 protein_id gnl|my_center|LOCUS_11390 74351 72759 gene locus_tag LOCUS_11400 gene murJ 74351 72759 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946821.1 protein_id gnl|my_center|LOCUS_11400 75055 74348 gene locus_tag LOCUS_11410 75055 74348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 76559 75087 gene locus_tag LOCUS_11420 gene ilvC 76559 75087 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074006.1 protein_id gnl|my_center|LOCUS_11420 76907 76698 gene locus_tag LOCUS_11430 76907 76698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 76875 77789 gene locus_tag LOCUS_11440 gene ilvY 76875 77789 CDS product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704174.1 protein_id gnl|my_center|LOCUS_11440 77872 78702 gene locus_tag LOCUS_11450 77872 78702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 78677 79615 gene locus_tag LOCUS_11460 78677 79615 CDS product ABC transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941545.1 protein_id gnl|my_center|LOCUS_11460 81489 79786 gene locus_tag LOCUS_11470 81489 79786 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869775.1 protein_id gnl|my_center|LOCUS_11470 83158 82433 gene locus_tag LOCUS_11480 83158 82433 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975997.1 protein_id gnl|my_center|LOCUS_11480 84094 83246 gene locus_tag LOCUS_11490 84094 83246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 84896 84057 gene locus_tag LOCUS_11500 84896 84057 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529615.1 protein_id gnl|my_center|LOCUS_11500 87006 84913 gene locus_tag LOCUS_11510 gene cirA 87006 84913 CDS product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489247.1 protein_id gnl|my_center|LOCUS_11510 87241 89034 gene locus_tag LOCUS_11520 87241 89034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 89021 91081 gene locus_tag LOCUS_11530 89021 91081 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256147.1 protein_id gnl|my_center|LOCUS_11530 91712 91155 gene locus_tag LOCUS_11540 91712 91155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 91888 93192 gene locus_tag LOCUS_11550 91888 93192 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978607.1 protein_id gnl|my_center|LOCUS_11550 93248 94501 gene locus_tag LOCUS_11560 93248 94501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 96245 94467 gene locus_tag LOCUS_11570 96245 94467 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942999.1 protein_id gnl|my_center|LOCUS_11570 97541 96378 gene locus_tag LOCUS_11580 97541 96378 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_11580 97823 99106 gene locus_tag LOCUS_11590 97823 99106 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941850.1 protein_id gnl|my_center|LOCUS_11590 99486 99256 gene locus_tag LOCUS_11600 gene tatA 99486 99256 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933280.1 protein_id gnl|my_center|LOCUS_11600 99752 99576 gene locus_tag LOCUS_11610 99752 99576 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943808.1 protein_id gnl|my_center|LOCUS_11610 101302 99974 gene locus_tag LOCUS_11620 101302 99974 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939112.1 protein_id gnl|my_center|LOCUS_11620 102163 101327 gene locus_tag LOCUS_11630 102163 101327 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174269896.1 protein_id gnl|my_center|LOCUS_11630 103284 102166 gene locus_tag LOCUS_11640 103284 102166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 104131 103289 gene locus_tag LOCUS_11650 104131 103289 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073121.1 protein_id gnl|my_center|LOCUS_11650 104511 104435 gene locus_tag LOCUS_t00100 104511 104435 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 104936 104664 gene locus_tag LOCUS_11660 gene hupB 104936 104664 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005315375.1 protein_id gnl|my_center|LOCUS_11660 105870 105058 gene locus_tag LOCUS_11670 gene larE 105870 105058 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_11670 107039 105870 gene locus_tag LOCUS_11680 107039 105870 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940198.1 protein_id gnl|my_center|LOCUS_11680 107649 107050 gene locus_tag LOCUS_11690 107649 107050 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228227.1 protein_id gnl|my_center|LOCUS_11690 107913 109019 gene locus_tag LOCUS_11700 gene pheA 107913 109019 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_11700 110066 109002 gene locus_tag LOCUS_11710 gene moaA 110066 109002 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546124.1 protein_id gnl|my_center|LOCUS_11710 110279 111313 gene locus_tag LOCUS_11720 gene tsaD 110279 111313 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860650.1 protein_id gnl|my_center|LOCUS_11720 111310 111846 gene locus_tag LOCUS_11730 111310 111846 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055993.1 protein_id gnl|my_center|LOCUS_11730 111815 112675 gene locus_tag LOCUS_11740 gene rsmA 111815 112675 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942509.1 protein_id gnl|my_center|LOCUS_11740 112689 113849 gene locus_tag LOCUS_11750 112689 113849 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545883.1 protein_id gnl|my_center|LOCUS_11750 114087 114416 gene locus_tag LOCUS_11760 114087 114416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 114426 115046 gene locus_tag LOCUS_11770 114426 115046 CDS product DUF166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024310.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence10 965 390 gene locus_tag LOCUS_11780 965 390 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020385.1 protein_id gnl|my_center|LOCUS_11780 1777 980 gene locus_tag LOCUS_11790 1777 980 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765730.1 protein_id gnl|my_center|LOCUS_11790 2128 3936 gene locus_tag LOCUS_11800 2128 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 5813 3933 gene locus_tag LOCUS_11810 5813 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 6408 5908 gene locus_tag LOCUS_11820 6408 5908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 6750 6439 gene locus_tag LOCUS_11830 6750 6439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 7219 6764 gene locus_tag LOCUS_11840 7219 6764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 7582 7256 gene locus_tag LOCUS_11850 7582 7256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 7959 7582 gene locus_tag LOCUS_11860 7959 7582 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626534.1 protein_id gnl|my_center|LOCUS_11860 10101 8074 gene locus_tag LOCUS_11870 10101 8074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 10637 10113 gene locus_tag LOCUS_11880 10637 10113 CDS product methanogen output domain 1-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331451.1 protein_id gnl|my_center|LOCUS_11880 12883 11018 gene locus_tag LOCUS_11890 12883 11018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 14803 12890 gene locus_tag LOCUS_11900 14803 12890 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922174.1 protein_id gnl|my_center|LOCUS_11900 15879 14800 gene locus_tag LOCUS_11910 15879 14800 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121996.1 protein_id gnl|my_center|LOCUS_11910 16898 15876 gene locus_tag LOCUS_11920 16898 15876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 17783 16905 gene locus_tag LOCUS_11930 17783 16905 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_11930 18769 17780 gene locus_tag LOCUS_11940 18769 17780 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_11940 18995 19381 gene locus_tag LOCUS_11950 18995 19381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 19445 19807 gene locus_tag LOCUS_11960 19445 19807 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941946.1 protein_id gnl|my_center|LOCUS_11960 20823 19882 gene locus_tag LOCUS_11970 20823 19882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 21169 21426 gene locus_tag LOCUS_11980 21169 21426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 21599 23152 gene locus_tag LOCUS_11990 21599 23152 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933195.1 protein_id gnl|my_center|LOCUS_11990 23152 23703 gene locus_tag LOCUS_12000 23152 23703 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_12000 24562 23747 gene locus_tag LOCUS_12010 24562 23747 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792195.1 protein_id gnl|my_center|LOCUS_12010 25526 24597 gene locus_tag LOCUS_12020 gene trxB 25526 24597 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_12020 25849 25526 gene locus_tag LOCUS_12030 gene trxA 25849 25526 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939125.1 protein_id gnl|my_center|LOCUS_12030 26107 28038 gene locus_tag LOCUS_12040 gene acsV 26107 28038 CDS product corrinoid activation/regeneration protein AcsV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436926.1 protein_id gnl|my_center|LOCUS_12040 28045 28809 gene locus_tag LOCUS_12050 28045 28809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 28880 29488 gene locus_tag LOCUS_12060 28880 29488 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941436.1 protein_id gnl|my_center|LOCUS_12060 30416 29622 gene locus_tag LOCUS_12070 30416 29622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 30949 31845 gene locus_tag LOCUS_12080 30949 31845 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392711.1 protein_id gnl|my_center|LOCUS_12080 31929 32531 gene locus_tag LOCUS_12090 31929 32531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 32558 33895 gene locus_tag LOCUS_12100 32558 33895 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337849.1 protein_id gnl|my_center|LOCUS_12100 34065 34433 gene locus_tag LOCUS_12110 34065 34433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 35144 34539 gene locus_tag LOCUS_12120 35144 34539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939792.1 protein_id gnl|my_center|LOCUS_12120 35247 36620 gene locus_tag LOCUS_12130 gene cpsG 35247 36620 CDS product colanic acid biosynthesis phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164216.1 protein_id gnl|my_center|LOCUS_12130 39008 36780 gene locus_tag LOCUS_12140 39008 36780 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932043.1 protein_id gnl|my_center|LOCUS_12140 39556 41175 gene locus_tag LOCUS_12150 39556 41175 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873769.1 protein_id gnl|my_center|LOCUS_12150 41557 41255 gene locus_tag LOCUS_12160 41557 41255 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140130.1 protein_id gnl|my_center|LOCUS_12160 41729 41535 gene locus_tag LOCUS_12170 41729 41535 CDS product DUF2281 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140129.1 protein_id gnl|my_center|LOCUS_12170 42670 41741 gene locus_tag LOCUS_12180 42670 41741 CDS product DUF2950 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941869.1 protein_id gnl|my_center|LOCUS_12180 44354 42756 gene locus_tag LOCUS_12190 44354 42756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 44935 44708 gene locus_tag LOCUS_12200 44935 44708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 46090 46881 gene locus_tag LOCUS_12210 gene blaOXA 46090 46881 CDS product oxacillin-hydrolyzing class D beta-lactamase OXA-50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099707.1 protein_id gnl|my_center|LOCUS_12210 46988 48178 gene locus_tag LOCUS_12220 46988 48178 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517778.1 protein_id gnl|my_center|LOCUS_12220 48556 49209 gene locus_tag LOCUS_12230 48556 49209 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942188.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12230 49443 49637 gene locus_tag LOCUS_12240 49443 49637 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405863.1 protein_id gnl|my_center|LOCUS_12240 49639 50004 gene locus_tag LOCUS_12250 49639 50004 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106996.1 protein_id gnl|my_center|LOCUS_12250 50218 51654 gene locus_tag LOCUS_12260 50218 51654 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948598.1 protein_id gnl|my_center|LOCUS_12260 52140 51730 gene locus_tag LOCUS_12270 52140 51730 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940222.1 protein_id gnl|my_center|LOCUS_12270 53882 52137 gene locus_tag LOCUS_12280 53882 52137 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940221.1 protein_id gnl|my_center|LOCUS_12280 54238 53879 gene locus_tag LOCUS_12290 54238 53879 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940220.1 protein_id gnl|my_center|LOCUS_12290 54899 54249 gene locus_tag LOCUS_12300 54899 54249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12300 55642 54902 gene locus_tag LOCUS_12310 55642 54902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12310 56021 56329 gene locus_tag LOCUS_12320 56021 56329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 56376 56918 gene locus_tag LOCUS_12330 56376 56918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 56994 57440 gene locus_tag LOCUS_12340 56994 57440 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545664.1 protein_id gnl|my_center|LOCUS_12340 57537 59243 gene locus_tag LOCUS_12350 57537 59243 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940474.1 protein_id gnl|my_center|LOCUS_12350 59269 59673 gene locus_tag LOCUS_12360 59269 59673 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940473.1 protein_id gnl|my_center|LOCUS_12360 59794 61125 gene locus_tag LOCUS_12370 59794 61125 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793113.1 protein_id gnl|my_center|LOCUS_12370 61122 61808 gene locus_tag LOCUS_12380 61122 61808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545191.1 protein_id gnl|my_center|LOCUS_12380 62195 64753 gene locus_tag LOCUS_12390 62195 64753 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940472.1 protein_id gnl|my_center|LOCUS_12390 64863 65237 gene locus_tag LOCUS_12400 64863 65237 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546418.1 protein_id gnl|my_center|LOCUS_12400 68369 65274 gene locus_tag LOCUS_12410 68369 65274 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 protein_id gnl|my_center|LOCUS_12410 70243 68369 gene locus_tag LOCUS_12420 70243 68369 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109168.1 protein_id gnl|my_center|LOCUS_12420 70422 70240 gene locus_tag LOCUS_12430 70422 70240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 71531 70623 gene locus_tag LOCUS_12440 71531 70623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 71590 71766 gene locus_tag LOCUS_12450 71590 71766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 73914 71794 gene locus_tag LOCUS_12460 73914 71794 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368420.1 protein_id gnl|my_center|LOCUS_12460 74827 74429 gene locus_tag LOCUS_12470 74827 74429 CDS product SET domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928001.1 protein_id gnl|my_center|LOCUS_12470 75269 74802 gene locus_tag LOCUS_12480 75269 74802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 76761 75481 gene locus_tag LOCUS_12490 76761 75481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 76946 77491 gene locus_tag LOCUS_12500 76946 77491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 79221 77584 gene locus_tag LOCUS_12510 79221 77584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 79433 79852 gene locus_tag LOCUS_12520 79433 79852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 79866 81053 gene locus_tag LOCUS_12530 79866 81053 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088518.1 protein_id gnl|my_center|LOCUS_12530 81068 83368 gene locus_tag LOCUS_12540 81068 83368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 83370 84164 gene locus_tag LOCUS_12550 83370 84164 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_12550 84176 85426 gene locus_tag LOCUS_12560 84176 85426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 85631 86908 gene locus_tag LOCUS_12570 85631 86908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 87751 87341 gene locus_tag LOCUS_12580 87751 87341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 88142 89626 gene locus_tag LOCUS_12590 88142 89626 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938336.1 protein_id gnl|my_center|LOCUS_12590 90008 90808 gene locus_tag LOCUS_12600 90008 90808 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 protein_id gnl|my_center|LOCUS_12600 91428 90868 gene locus_tag LOCUS_12610 91428 90868 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940170.1 protein_id gnl|my_center|LOCUS_12610 91574 91963 gene locus_tag LOCUS_12620 91574 91963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 92174 92560 gene locus_tag LOCUS_12630 92174 92560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 92577 92825 gene locus_tag LOCUS_12640 92577 92825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 94313 93057 gene locus_tag LOCUS_12650 94313 93057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 94438 94737 gene locus_tag LOCUS_12660 94438 94737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 95107 94808 gene locus_tag LOCUS_12670 gene yajD 95107 94808 CDS product HNH nuclease YajD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418869.1 protein_id gnl|my_center|LOCUS_12670 95495 95220 gene locus_tag LOCUS_12680 95495 95220 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480331.1 protein_id gnl|my_center|LOCUS_12680 96764 95922 gene locus_tag LOCUS_12690 96764 95922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 97028 98806 gene locus_tag LOCUS_12700 97028 98806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 99657 98860 gene locus_tag LOCUS_12710 99657 98860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 100661 99654 gene locus_tag LOCUS_12720 100661 99654 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460055.1 protein_id gnl|my_center|LOCUS_12720 101576 100668 gene locus_tag LOCUS_12730 101576 100668 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583782.1 protein_id gnl|my_center|LOCUS_12730 102496 101573 gene locus_tag LOCUS_12740 102496 101573 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141813.1 protein_id gnl|my_center|LOCUS_12740 104620 102632 gene locus_tag LOCUS_12750 104620 102632 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926958.1 protein_id gnl|my_center|LOCUS_12750 104758 104624 gene locus_tag LOCUS_12760 104758 104624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 105702 106766 gene locus_tag LOCUS_12770 gene cobT 105702 106766 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393223.1 protein_id gnl|my_center|LOCUS_12770 106862 107662 gene locus_tag LOCUS_12780 gene cobS 106862 107662 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257084.1 protein_id gnl|my_center|LOCUS_12780 107640 110231 gene locus_tag LOCUS_12790 107640 110231 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052877.1 protein_id gnl|my_center|LOCUS_12790 110231 111178 gene locus_tag LOCUS_12800 gene cbiB 110231 111178 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943620.1 protein_id gnl|my_center|LOCUS_12800 111194 112519 gene locus_tag LOCUS_12810 gene thiC 111194 112519 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943635.1 protein_id gnl|my_center|LOCUS_12810 <115096 112532 gene locus_tag LOCUS_12820 <115096 112532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256120.1:Ig-like domain-containing protein >Feature sequence11 181 17 gene locus_tag LOCUS_12830 181 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546079.1 protein_id gnl|my_center|LOCUS_12830 2008 194 gene locus_tag LOCUS_12840 2008 194 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546525.1 protein_id gnl|my_center|LOCUS_12840 2501 5053 gene locus_tag LOCUS_12850 2501 5053 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937846.1 protein_id gnl|my_center|LOCUS_12850 5083 5373 gene locus_tag LOCUS_12860 5083 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12860 5428 6531 gene locus_tag LOCUS_12870 5428 6531 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938245.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12870 6560 7015 gene locus_tag LOCUS_12880 6560 7015 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208527.1 protein_id gnl|my_center|LOCUS_12880 7054 7797 gene locus_tag LOCUS_12890 7054 7797 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328012.1 protein_id gnl|my_center|LOCUS_12890 8632 7952 gene locus_tag LOCUS_12900 8632 7952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 10335 8752 gene locus_tag LOCUS_12910 10335 8752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919016.1 protein_id gnl|my_center|LOCUS_12910 11141 12493 gene locus_tag LOCUS_12920 11141 12493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881423.1 protein_id gnl|my_center|LOCUS_12920 12506 13387 gene locus_tag LOCUS_12930 12506 13387 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881422.1 protein_id gnl|my_center|LOCUS_12930 13398 14195 gene locus_tag LOCUS_12940 13398 14195 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881421.1 protein_id gnl|my_center|LOCUS_12940 14298 15200 gene locus_tag LOCUS_12950 gene gnd 14298 15200 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256404.1 protein_id gnl|my_center|LOCUS_12950 15368 16924 gene locus_tag LOCUS_12960 gene zwf 15368 16924 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_12960 16902 17903 gene locus_tag LOCUS_12970 gene glk 16902 17903 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259043.1 protein_id gnl|my_center|LOCUS_12970 17890 18603 gene locus_tag LOCUS_12980 17890 18603 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277074.1 protein_id gnl|my_center|LOCUS_12980 18590 18721 gene locus_tag LOCUS_12990 18590 18721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 19025 19573 gene locus_tag LOCUS_13000 gene rfbC 19025 19573 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096184.1 protein_id gnl|my_center|LOCUS_13000 19579 20442 gene locus_tag LOCUS_13010 gene rfbD 19579 20442 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929228.1 protein_id gnl|my_center|LOCUS_13010 20426 21541 gene locus_tag LOCUS_13020 gene rfbB 20426 21541 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143225.1 protein_id gnl|my_center|LOCUS_13020 21701 22612 gene locus_tag LOCUS_13030 21701 22612 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103406.1 protein_id gnl|my_center|LOCUS_13030 22624 23760 gene locus_tag LOCUS_13040 22624 23760 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824901.1 protein_id gnl|my_center|LOCUS_13040 23909 24934 gene locus_tag LOCUS_13050 23909 24934 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941622.1 protein_id gnl|my_center|LOCUS_13050 27077 25032 gene locus_tag LOCUS_13060 27077 25032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 28487 27102 gene locus_tag LOCUS_13070 28487 27102 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_13070 29947 28544 gene locus_tag LOCUS_13080 29947 28544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 30900 29944 gene locus_tag LOCUS_13090 30900 29944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 33231 30949 gene locus_tag LOCUS_13100 33231 30949 CDS product type II secretion system protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895558.1 protein_id gnl|my_center|LOCUS_13100 33983 33243 gene locus_tag LOCUS_13110 33983 33243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 34567 33980 gene locus_tag LOCUS_13120 34567 33980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 35952 34564 gene locus_tag LOCUS_13130 35952 34564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 37118 36063 gene locus_tag LOCUS_13140 gene gspK 37118 36063 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940990.1 protein_id gnl|my_center|LOCUS_13140 37792 37115 gene locus_tag LOCUS_13150 37792 37115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 38183 37782 gene locus_tag LOCUS_13160 38183 37782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 38762 38262 gene locus_tag LOCUS_13170 38762 38262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 40079 38838 gene locus_tag LOCUS_13180 40079 38838 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_13180 41600 40083 gene locus_tag LOCUS_13190 gene gspE 41600 40083 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070691812.1 protein_id gnl|my_center|LOCUS_13190 42406 42750 gene locus_tag LOCUS_13200 42406 42750 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088373.1 protein_id gnl|my_center|LOCUS_13200 42884 43087 gene locus_tag LOCUS_13210 42884 43087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 43581 44744 gene locus_tag LOCUS_13220 43581 44744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 45172 46980 gene locus_tag LOCUS_13230 45172 46980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 47090 47743 gene locus_tag LOCUS_13240 47090 47743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 47965 50214 gene locus_tag LOCUS_13250 47965 50214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 51069 50644 gene locus_tag LOCUS_13260 51069 50644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 52295 51066 gene locus_tag LOCUS_13270 52295 51066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 52486 54633 gene locus_tag LOCUS_13280 52486 54633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 54623 55570 gene locus_tag LOCUS_13290 54623 55570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 55567 56751 gene locus_tag LOCUS_13300 55567 56751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 56757 58631 gene locus_tag LOCUS_13310 gene asnB 56757 58631 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_13310 58636 59751 gene locus_tag LOCUS_13320 58636 59751 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931322.1 protein_id gnl|my_center|LOCUS_13320 59958 60449 gene locus_tag LOCUS_13330 59958 60449 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957191.1 protein_id gnl|my_center|LOCUS_13330 60451 60957 gene locus_tag LOCUS_13340 gene rfaH 60451 60957 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268290.1 protein_id gnl|my_center|LOCUS_13340 61105 62700 gene locus_tag LOCUS_13350 61105 62700 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957831.1 protein_id gnl|my_center|LOCUS_13350 62726 63598 gene locus_tag LOCUS_13360 gene neuB 62726 63598 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230564.1 protein_id gnl|my_center|LOCUS_13360 63595 64755 gene locus_tag LOCUS_13370 gene neuC 63595 64755 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289362.1 protein_id gnl|my_center|LOCUS_13370 64847 65860 gene locus_tag LOCUS_13380 64847 65860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 65863 66807 gene locus_tag LOCUS_13390 65863 66807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 67579 67397 gene locus_tag LOCUS_13400 67579 67397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 67673 68365 gene locus_tag LOCUS_13410 67673 68365 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132016.1 protein_id gnl|my_center|LOCUS_13410 68380 69345 gene locus_tag LOCUS_13420 68380 69345 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762320.1 protein_id gnl|my_center|LOCUS_13420 69442 70173 gene locus_tag LOCUS_13430 69442 70173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 70243 71259 gene locus_tag LOCUS_13440 70243 71259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 71655 72470 gene locus_tag LOCUS_13450 71655 72470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 72625 74445 gene locus_tag LOCUS_13460 gene asnB 72625 74445 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_13460 74429 75124 gene locus_tag LOCUS_13470 74429 75124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 75152 76510 gene locus_tag LOCUS_13480 75152 76510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 76507 77199 gene locus_tag LOCUS_13490 76507 77199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 77612 78229 gene locus_tag LOCUS_13500 77612 78229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 78234 79262 gene locus_tag LOCUS_13510 78234 79262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 79333 81147 gene locus_tag LOCUS_13520 79333 81147 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698821.1 protein_id gnl|my_center|LOCUS_13520 81189 82451 gene locus_tag LOCUS_13530 81189 82451 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222496.1 protein_id gnl|my_center|LOCUS_13530 82488 84305 gene locus_tag LOCUS_13540 82488 84305 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698821.1 protein_id gnl|my_center|LOCUS_13540 84689 85150 gene locus_tag LOCUS_13550 84689 85150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 85156 85389 gene locus_tag LOCUS_13560 85156 85389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 85974 87032 gene locus_tag LOCUS_13570 85974 87032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 87043 88500 gene locus_tag LOCUS_13580 87043 88500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 88755 90713 gene locus_tag LOCUS_13590 88755 90713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 >Feature sequence12 544 200 gene locus_tag LOCUS_13600 544 200 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880034.1 protein_id gnl|my_center|LOCUS_13600 669 1985 gene locus_tag LOCUS_13610 669 1985 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 protein_id gnl|my_center|LOCUS_13610 2660 2013 gene locus_tag LOCUS_13620 2660 2013 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942171.1 protein_id gnl|my_center|LOCUS_13620 3150 2650 gene locus_tag LOCUS_13630 3150 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 3381 4391 gene locus_tag LOCUS_13640 3381 4391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 4404 4871 gene locus_tag LOCUS_13650 4404 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 4925 5000 gene locus_tag LOCUS_t00110 4925 5000 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 5832 7145 gene locus_tag LOCUS_13660 5832 7145 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106970097.1 protein_id gnl|my_center|LOCUS_13660 7142 7789 gene locus_tag LOCUS_13670 7142 7789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 7808 8158 gene locus_tag LOCUS_13680 7808 8158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 8177 8464 gene locus_tag LOCUS_13690 8177 8464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 8977 8519 gene locus_tag LOCUS_13700 8977 8519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 11475 8974 gene locus_tag LOCUS_13710 11475 8974 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202769.1 protein_id gnl|my_center|LOCUS_13710 12749 11574 gene locus_tag LOCUS_13720 12749 11574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 12778 12933 gene locus_tag LOCUS_13730 12778 12933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 13414 13271 gene locus_tag LOCUS_13740 13414 13271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 13742 13545 gene locus_tag LOCUS_13750 13742 13545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 14180 13980 gene locus_tag LOCUS_13760 14180 13980 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942550.1 protein_id gnl|my_center|LOCUS_13760 16680 14530 gene locus_tag LOCUS_13770 16680 14530 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_13770 18390 16696 gene locus_tag LOCUS_13780 18390 16696 CDS product protein arginine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943113.1 protein_id gnl|my_center|LOCUS_13780 18929 18408 gene locus_tag LOCUS_13790 18929 18408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 20120 19101 gene locus_tag LOCUS_13800 20120 19101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 21045 20143 gene locus_tag LOCUS_13810 21045 20143 CDS product NHL repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943130.1 protein_id gnl|my_center|LOCUS_13810 22333 21050 gene locus_tag LOCUS_13820 22333 21050 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039643456.1 protein_id gnl|my_center|LOCUS_13820 24325 22337 gene locus_tag LOCUS_13830 24325 22337 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044893.1 protein_id gnl|my_center|LOCUS_13830 26174 24366 gene locus_tag LOCUS_13840 26174 24366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 27643 26231 gene locus_tag LOCUS_13850 27643 26231 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943134.1 protein_id gnl|my_center|LOCUS_13850 28244 27660 gene locus_tag LOCUS_13860 28244 27660 CDS product DUF799 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943135.1 protein_id gnl|my_center|LOCUS_13860 30579 28429 gene locus_tag LOCUS_13870 30579 28429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943136.1 protein_id gnl|my_center|LOCUS_13870 32230 30761 gene locus_tag LOCUS_13880 32230 30761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943137.1 protein_id gnl|my_center|LOCUS_13880 33411 32242 gene locus_tag LOCUS_13890 33411 32242 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943138.1 protein_id gnl|my_center|LOCUS_13890 34935 33823 gene locus_tag LOCUS_13900 gene omcS 34935 33823 CDS product c-type cytochrome OmcS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943141.1 protein_id gnl|my_center|LOCUS_13900 36624 35656 gene locus_tag LOCUS_13910 36624 35656 CDS product NHL repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943142.1 protein_id gnl|my_center|LOCUS_13910 37177 37869 gene locus_tag LOCUS_13920 37177 37869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 39295 37895 gene locus_tag LOCUS_13930 39295 37895 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_13930 40758 39292 gene locus_tag LOCUS_13940 40758 39292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 41820 40876 gene locus_tag LOCUS_13950 gene phnD 41820 40876 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246947.1 protein_id gnl|my_center|LOCUS_13950 41994 42764 gene locus_tag LOCUS_13960 41994 42764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 43260 44114 gene locus_tag LOCUS_13970 43260 44114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937941.1 protein_id gnl|my_center|LOCUS_13970 44166 44642 gene locus_tag LOCUS_13980 44166 44642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 44820 45377 gene locus_tag LOCUS_13990 44820 45377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791841.1 protein_id gnl|my_center|LOCUS_13990 45553 47640 gene locus_tag LOCUS_14000 gene fusA 45553 47640 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682356.1 protein_id gnl|my_center|LOCUS_14000 47651 48361 gene locus_tag LOCUS_14010 47651 48361 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670541.1 protein_id gnl|my_center|LOCUS_14010 48457 49233 gene locus_tag LOCUS_14020 48457 49233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 49452 50777 gene locus_tag LOCUS_14030 49452 50777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 50899 53577 gene locus_tag LOCUS_14040 50899 53577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 53624 53839 gene locus_tag LOCUS_14050 53624 53839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 54281 53970 gene locus_tag LOCUS_14060 54281 53970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 54583 54374 gene locus_tag LOCUS_14070 54583 54374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 55436 55125 gene locus_tag LOCUS_14080 55436 55125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 55741 55532 gene locus_tag LOCUS_14090 55741 55532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 55989 55792 gene locus_tag LOCUS_14100 55989 55792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 57124 56474 gene locus_tag LOCUS_14110 57124 56474 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933408.1 protein_id gnl|my_center|LOCUS_14110 57931 58587 gene locus_tag LOCUS_14120 57931 58587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 58562 59509 gene locus_tag LOCUS_14130 58562 59509 CDS product ABC transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941545.1 protein_id gnl|my_center|LOCUS_14130 59686 61800 gene locus_tag LOCUS_14140 59686 61800 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385039.1 protein_id gnl|my_center|LOCUS_14140 61958 63379 gene locus_tag LOCUS_14150 61958 63379 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809373.1 protein_id gnl|my_center|LOCUS_14150 64268 63558 gene locus_tag LOCUS_14160 gene tatC 64268 63558 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815810.1 protein_id gnl|my_center|LOCUS_14160 64636 64268 gene locus_tag LOCUS_14170 64636 64268 CDS product TatA/E family twin arginine-targeting protein translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940700.1 protein_id gnl|my_center|LOCUS_14170 64827 66128 gene locus_tag LOCUS_14180 64827 66128 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943920.1 protein_id gnl|my_center|LOCUS_14180 66932 66300 gene locus_tag LOCUS_14190 66932 66300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 67566 66970 gene locus_tag LOCUS_14200 67566 66970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 67995 67675 gene locus_tag LOCUS_14210 67995 67675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 68842 68078 gene locus_tag LOCUS_14220 68842 68078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 69051 68884 gene locus_tag LOCUS_14230 69051 68884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 69708 69983 gene locus_tag LOCUS_14240 69708 69983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 70152 71258 gene locus_tag LOCUS_14250 gene dnaJ 70152 71258 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940712.1 protein_id gnl|my_center|LOCUS_14250 71274 71783 gene locus_tag LOCUS_14260 gene moaC 71274 71783 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390440.1 protein_id gnl|my_center|LOCUS_14260 71841 72203 gene locus_tag LOCUS_14270 gene dksA 71841 72203 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940956.1 protein_id gnl|my_center|LOCUS_14270 72247 73245 gene locus_tag LOCUS_14280 gene galT 72247 73245 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546259.1 protein_id gnl|my_center|LOCUS_14280 73271 73621 gene locus_tag LOCUS_14290 73271 73621 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081556.1 protein_id gnl|my_center|LOCUS_14290 73646 74419 gene locus_tag LOCUS_14300 gene folE2 73646 74419 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_14300 74425 76506 gene locus_tag LOCUS_14310 gene glyS 74425 76506 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941242.1 protein_id gnl|my_center|LOCUS_14310 77093 76635 gene locus_tag LOCUS_14320 77093 76635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 77859 78977 gene locus_tag LOCUS_14330 gene ald 77859 78977 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227783.1 protein_id gnl|my_center|LOCUS_14330 79036 79995 gene locus_tag LOCUS_14340 79036 79995 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792769.1 protein_id gnl|my_center|LOCUS_14340 81255 80020 gene locus_tag LOCUS_14350 81255 80020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 81814 81299 gene locus_tag LOCUS_14360 81814 81299 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808807.1 protein_id gnl|my_center|LOCUS_14360 82861 81842 gene locus_tag LOCUS_14370 82861 81842 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266701.1 protein_id gnl|my_center|LOCUS_14370 83904 83050 gene locus_tag LOCUS_14380 83904 83050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 84079 85368 gene locus_tag LOCUS_14390 gene hemL 84079 85368 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 protein_id gnl|my_center|LOCUS_14390 85448 85672 gene locus_tag LOCUS_14400 85448 85672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 85672 86097 gene locus_tag LOCUS_14410 85672 86097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 86107 86832 gene locus_tag LOCUS_14420 86107 86832 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941002.1 protein_id gnl|my_center|LOCUS_14420 >Feature sequence13 369 157 gene locus_tag LOCUS_14430 369 157 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932662.1 protein_id gnl|my_center|LOCUS_14430 747 454 gene locus_tag LOCUS_14440 747 454 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022250.1 protein_id gnl|my_center|LOCUS_14440 1620 805 gene locus_tag LOCUS_14450 1620 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 2525 1617 gene locus_tag LOCUS_14460 2525 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 3548 2526 gene locus_tag LOCUS_14470 3548 2526 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941971.1 protein_id gnl|my_center|LOCUS_14470 5572 3599 gene locus_tag LOCUS_14480 5572 3599 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693783.1 protein_id gnl|my_center|LOCUS_14480 5689 6132 gene locus_tag LOCUS_14490 5689 6132 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941779.1 protein_id gnl|my_center|LOCUS_14490 7231 6116 gene locus_tag LOCUS_14500 7231 6116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 7403 7693 gene locus_tag LOCUS_14510 7403 7693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 8669 7800 gene locus_tag LOCUS_14520 8669 7800 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889131.1 protein_id gnl|my_center|LOCUS_14520 9581 8784 gene locus_tag LOCUS_14530 9581 8784 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_14530 9818 12187 gene locus_tag LOCUS_14540 gene lon 9818 12187 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943811.1 protein_id gnl|my_center|LOCUS_14540 12395 13339 gene locus_tag LOCUS_14550 gene mltG 12395 13339 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941176.1 protein_id gnl|my_center|LOCUS_14550 13399 13857 gene locus_tag LOCUS_14560 gene gspG 13399 13857 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196811.1 protein_id gnl|my_center|LOCUS_14560 15657 13987 gene locus_tag LOCUS_14570 15657 13987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 16715 15777 gene locus_tag LOCUS_14580 16715 15777 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933107.1 protein_id gnl|my_center|LOCUS_14580 16984 18645 gene locus_tag LOCUS_14590 gene ilvD 16984 18645 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_14590 18650 20929 gene locus_tag LOCUS_14600 gene lptD 18650 20929 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943003.1 protein_id gnl|my_center|LOCUS_14600 20946 21905 gene locus_tag LOCUS_14610 20946 21905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330175.1 protein_id gnl|my_center|LOCUS_14610 21932 22960 gene locus_tag LOCUS_14620 gene mltB 21932 22960 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 protein_id gnl|my_center|LOCUS_14620 23062 23217 gene locus_tag LOCUS_14630 23062 23217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 25291 23303 gene locus_tag LOCUS_14640 gene acs 25291 23303 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940228.1 protein_id gnl|my_center|LOCUS_14640 25747 26868 gene locus_tag LOCUS_14650 25747 26868 CDS product MltA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549948.1 protein_id gnl|my_center|LOCUS_14650 26966 28150 gene locus_tag LOCUS_14660 26966 28150 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545245.1 protein_id gnl|my_center|LOCUS_14660 28263 28982 gene locus_tag LOCUS_14670 28263 28982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 32039 29085 gene locus_tag LOCUS_14680 32039 29085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 32393 32058 gene locus_tag LOCUS_14690 32393 32058 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943844.1 protein_id gnl|my_center|LOCUS_14690 33493 32834 gene locus_tag LOCUS_14700 gene rsmG 33493 32834 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226919.1 protein_id gnl|my_center|LOCUS_14700 34855 33506 gene locus_tag LOCUS_14710 gene hisD 34855 33506 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938097.1 protein_id gnl|my_center|LOCUS_14710 36894 35158 gene locus_tag LOCUS_14720 gene extM 36894 35158 CDS product selenite/tellurite reduction operon c-type cytochrome ExtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943566.1 protein_id gnl|my_center|LOCUS_14720 38533 36896 gene locus_tag LOCUS_14730 38533 36896 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392090.1 protein_id gnl|my_center|LOCUS_14730 38757 40076 gene locus_tag LOCUS_14740 38757 40076 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_14740 40140 41210 gene locus_tag LOCUS_14750 40140 41210 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546519.1 protein_id gnl|my_center|LOCUS_14750 41303 42331 gene locus_tag LOCUS_14760 gene hemE 41303 42331 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944063.1 protein_id gnl|my_center|LOCUS_14760 42338 42913 gene locus_tag LOCUS_14770 42338 42913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 42917 43894 gene locus_tag LOCUS_14780 gene hemH 42917 43894 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943924.1 protein_id gnl|my_center|LOCUS_14780 45018 43906 gene locus_tag LOCUS_14790 gene rodA 45018 43906 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_14790 47024 45099 gene locus_tag LOCUS_14800 gene mrdA 47024 45099 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_14800 47582 47046 gene locus_tag LOCUS_14810 47582 47046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 48445 47585 gene locus_tag LOCUS_14820 48445 47585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 49492 48455 gene locus_tag LOCUS_14830 49492 48455 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_14830 49815 49890 gene locus_tag LOCUS_t00120 49815 49890 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 50483 51361 gene locus_tag LOCUS_14840 50483 51361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 51565 52281 gene locus_tag LOCUS_14850 51565 52281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 52414 53160 gene locus_tag LOCUS_14860 52414 53160 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943078.1 protein_id gnl|my_center|LOCUS_14860 53627 54532 gene locus_tag LOCUS_14870 53627 54532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 54886 55077 gene locus_tag LOCUS_14880 54886 55077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 55074 56543 gene locus_tag LOCUS_14890 55074 56543 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_14890 56913 57314 gene locus_tag LOCUS_14900 56913 57314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 57284 57820 gene locus_tag LOCUS_14910 57284 57820 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392493.1 protein_id gnl|my_center|LOCUS_14910 57902 58456 gene locus_tag LOCUS_14920 57902 58456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 58453 59571 gene locus_tag LOCUS_14930 58453 59571 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257853.1 protein_id gnl|my_center|LOCUS_14930 59584 60567 gene locus_tag LOCUS_14940 gene nuoH 59584 60567 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392496.1 protein_id gnl|my_center|LOCUS_14940 60570 61157 gene locus_tag LOCUS_14950 60570 61157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 61157 61690 gene locus_tag LOCUS_14960 61157 61690 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124337.1 protein_id gnl|my_center|LOCUS_14960 61690 62010 gene locus_tag LOCUS_14970 gene nuoK 61690 62010 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392499.1 protein_id gnl|my_center|LOCUS_14970 62025 63524 gene locus_tag LOCUS_14980 62025 63524 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967807.1 protein_id gnl|my_center|LOCUS_14980 63521 63769 gene locus_tag LOCUS_14990 63521 63769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 63762 65537 gene locus_tag LOCUS_15000 63762 65537 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969263.1 protein_id gnl|my_center|LOCUS_15000 65710 67095 gene locus_tag LOCUS_15010 65710 67095 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389442.1 protein_id gnl|my_center|LOCUS_15010 67225 68601 gene locus_tag LOCUS_15020 67225 68601 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460435.1 protein_id gnl|my_center|LOCUS_15020 68796 68871 gene locus_tag LOCUS_t00130 68796 68871 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 69124 69588 gene locus_tag LOCUS_15030 69124 69588 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583566.1 protein_id gnl|my_center|LOCUS_15030 69669 70931 gene locus_tag LOCUS_15040 gene nusA 69669 70931 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937816.1 protein_id gnl|my_center|LOCUS_15040 71356 74244 gene locus_tag LOCUS_15050 71356 74244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 74361 74714 gene locus_tag LOCUS_15060 gene rbfA 74361 74714 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262599.1 protein_id gnl|my_center|LOCUS_15060 74674 75651 gene locus_tag LOCUS_15070 74674 75651 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_15070 75652 76380 gene locus_tag LOCUS_15080 gene truB 75652 76380 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810552.1 protein_id gnl|my_center|LOCUS_15080 76437 76706 gene locus_tag LOCUS_15090 gene rpsO 76437 76706 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808855.1 protein_id gnl|my_center|LOCUS_15090 77147 79240 gene locus_tag LOCUS_15100 gene pnp 77147 79240 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_15100 79256 80527 gene locus_tag LOCUS_15110 79256 80527 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942239.1 protein_id gnl|my_center|LOCUS_15110 >Feature sequence14 349 1986 gene locus_tag LOCUS_15120 349 1986 CDS product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941025.1 protein_id gnl|my_center|LOCUS_15120 2711 3145 gene locus_tag LOCUS_15130 2711 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 3151 3798 gene locus_tag LOCUS_15140 3151 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 3795 4337 gene locus_tag LOCUS_15150 3795 4337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 4389 5000 gene locus_tag LOCUS_15160 4389 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 5116 11205 gene locus_tag LOCUS_15170 5116 11205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 11762 11361 gene locus_tag LOCUS_15180 11762 11361 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075890604.1 protein_id gnl|my_center|LOCUS_15180 11986 11762 gene locus_tag LOCUS_15190 11986 11762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 12145 12366 gene locus_tag LOCUS_15200 12145 12366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 12649 13362 gene locus_tag LOCUS_15210 12649 13362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 13458 14207 gene locus_tag LOCUS_15220 13458 14207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 14191 15009 gene locus_tag LOCUS_15230 14191 15009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 15006 15893 gene locus_tag LOCUS_15240 15006 15893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 16269 15937 gene locus_tag LOCUS_15250 16269 15937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 16745 16672 gene locus_tag LOCUS_t00140 16745 16672 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 17604 16804 gene locus_tag LOCUS_15260 gene amrB 17604 16804 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942474.1 protein_id gnl|my_center|LOCUS_15260 19273 17804 gene locus_tag LOCUS_15270 gene cysS 19273 17804 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943976.1 protein_id gnl|my_center|LOCUS_15270 19378 19851 gene locus_tag LOCUS_15280 19378 19851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 19987 21582 gene locus_tag LOCUS_15290 gene serA 19987 21582 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_15290 21605 21913 gene locus_tag LOCUS_15300 21605 21913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 21914 22792 gene locus_tag LOCUS_15310 gene ispE 21914 22792 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941321.1 protein_id gnl|my_center|LOCUS_15310 22807 22881 gene locus_tag LOCUS_t00150 22807 22881 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 22972 23922 gene locus_tag LOCUS_15320 22972 23922 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_15320 24030 24602 gene locus_tag LOCUS_15330 24030 24602 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082103.1 protein_id gnl|my_center|LOCUS_15330 24901 25473 gene locus_tag LOCUS_15340 gene pth 24901 25473 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814896.1 protein_id gnl|my_center|LOCUS_15340 25647 26138 gene locus_tag LOCUS_15350 25647 26138 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938863.1 protein_id gnl|my_center|LOCUS_15350 26588 26277 gene locus_tag LOCUS_15360 26588 26277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 26619 27170 gene locus_tag LOCUS_15370 26619 27170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 27200 27952 gene locus_tag LOCUS_15380 27200 27952 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898511.1 protein_id gnl|my_center|LOCUS_15380 28673 28996 gene locus_tag LOCUS_15390 28673 28996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 29129 30124 gene locus_tag LOCUS_15400 29129 30124 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035417.1 protein_id gnl|my_center|LOCUS_15400 31177 30287 gene locus_tag LOCUS_15410 31177 30287 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880542.1 protein_id gnl|my_center|LOCUS_15410 32777 31182 gene locus_tag LOCUS_15420 32777 31182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 33183 33605 gene locus_tag LOCUS_15430 33183 33605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 34379 33642 gene locus_tag LOCUS_15440 gene ttcA 34379 33642 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940803.1 protein_id gnl|my_center|LOCUS_15440 35014 34379 gene locus_tag LOCUS_15450 35014 34379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 35645 35052 gene locus_tag LOCUS_15460 gene hisB 35645 35052 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_15460 35878 35952 gene locus_tag LOCUS_t00160 35878 35952 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 36069 36497 gene locus_tag LOCUS_15470 gene rplM 36069 36497 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939788.1 protein_id gnl|my_center|LOCUS_15470 36514 36906 gene locus_tag LOCUS_15480 gene rpsI 36514 36906 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943504.1 protein_id gnl|my_center|LOCUS_15480 37161 38198 gene locus_tag LOCUS_15490 gene argC 37161 38198 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943503.1 protein_id gnl|my_center|LOCUS_15490 38241 39023 gene locus_tag LOCUS_15500 gene truA 38241 39023 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596150.1 protein_id gnl|my_center|LOCUS_15500 39048 40253 gene locus_tag LOCUS_15510 39048 40253 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_15510 40568 40383 gene locus_tag LOCUS_15520 40568 40383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 41203 40658 gene locus_tag LOCUS_15530 41203 40658 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044348005.1 protein_id gnl|my_center|LOCUS_15530 41331 42179 gene locus_tag LOCUS_15540 41331 42179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 42176 42742 gene locus_tag LOCUS_15550 42176 42742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 42771 43166 gene locus_tag LOCUS_15560 42771 43166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 44074 43190 gene locus_tag LOCUS_15570 gene pstB 44074 43190 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118636.1 protein_id gnl|my_center|LOCUS_15570 45251 44193 gene locus_tag LOCUS_15580 45251 44193 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_15580 46562 45288 gene locus_tag LOCUS_15590 gene pstA 46562 45288 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388358.1 protein_id gnl|my_center|LOCUS_15590 47968 46580 gene locus_tag LOCUS_15600 gene pstC 47968 46580 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388357.1 protein_id gnl|my_center|LOCUS_15600 48641 47979 gene locus_tag LOCUS_15610 gene phoU 48641 47979 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545517.1 protein_id gnl|my_center|LOCUS_15610 48969 48760 gene locus_tag LOCUS_15620 48969 48760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 48920 50764 gene locus_tag LOCUS_15630 gene phoR 48920 50764 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_15630 51131 51883 gene locus_tag LOCUS_15640 51131 51883 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944071.1 protein_id gnl|my_center|LOCUS_15640 52789 51950 gene locus_tag LOCUS_15650 gene nadC 52789 51950 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_15650 53307 52870 gene locus_tag LOCUS_15660 53307 52870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 53642 53953 gene locus_tag LOCUS_15670 53642 53953 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546703.1 protein_id gnl|my_center|LOCUS_15670 53954 55651 gene locus_tag LOCUS_15680 53954 55651 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_15680 55704 57197 gene locus_tag LOCUS_15690 55704 57197 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259178.1 protein_id gnl|my_center|LOCUS_15690 58407 57217 gene locus_tag LOCUS_15700 58407 57217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 58788 59108 gene locus_tag LOCUS_15710 58788 59108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 59287 60351 gene locus_tag LOCUS_15720 59287 60351 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842311.1 protein_id gnl|my_center|LOCUS_15720 60649 60452 gene locus_tag LOCUS_15730 60649 60452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 60882 60652 gene locus_tag LOCUS_15740 60882 60652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 60811 61950 gene locus_tag LOCUS_15750 60811 61950 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212188.1 protein_id gnl|my_center|LOCUS_15750 62003 62410 gene locus_tag LOCUS_15760 62003 62410 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483612.1 protein_id gnl|my_center|LOCUS_15760 62414 62710 gene locus_tag LOCUS_15770 62414 62710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 62623 62802 gene locus_tag LOCUS_15780 62623 62802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 62814 65534 gene locus_tag LOCUS_15790 62814 65534 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939279.1 protein_id gnl|my_center|LOCUS_15790 66654 65671 gene locus_tag LOCUS_15800 66654 65671 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039254.1 protein_id gnl|my_center|LOCUS_15800 67844 66651 gene locus_tag LOCUS_15810 67844 66651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 68413 67907 gene locus_tag LOCUS_15820 gene mog 68413 67907 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943343.1 protein_id gnl|my_center|LOCUS_15820 70485 68422 gene locus_tag LOCUS_15830 gene fusA 70485 68422 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942578.1 protein_id gnl|my_center|LOCUS_15830 71119 72663 gene locus_tag LOCUS_15840 71119 72663 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942447.1 protein_id gnl|my_center|LOCUS_15840 72672 73142 gene locus_tag LOCUS_15850 72672 73142 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942446.1 protein_id gnl|my_center|LOCUS_15850 74464 73373 gene locus_tag LOCUS_15860 74464 73373 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330337.1 protein_id gnl|my_center|LOCUS_15860 74862 74623 gene locus_tag LOCUS_15870 74862 74623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 75000 75347 gene locus_tag LOCUS_15880 75000 75347 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965250.1 protein_id gnl|my_center|LOCUS_15880 75365 75592 gene locus_tag LOCUS_15890 75365 75592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 75585 75848 gene locus_tag LOCUS_15900 75585 75848 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129080272.1 protein_id gnl|my_center|LOCUS_15900 76554 76168 gene locus_tag LOCUS_15910 76554 76168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 <78063 76560 gene locus_tag LOCUS_15920 <78063 76560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267592.1:RHS repeat-associated core domain-containing protein >Feature sequence15 322 2046 gene locus_tag LOCUS_15930 322 2046 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943502.1 protein_id gnl|my_center|LOCUS_15930 2243 3286 gene locus_tag LOCUS_15940 2243 3286 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583756.1 protein_id gnl|my_center|LOCUS_15940 3300 3788 gene locus_tag LOCUS_15950 3300 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 4021 4968 gene locus_tag LOCUS_15960 4021 4968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 5053 5967 gene locus_tag LOCUS_15970 5053 5967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 7656 5989 gene locus_tag LOCUS_15980 7656 5989 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986940.1 protein_id gnl|my_center|LOCUS_15980 7856 8644 gene locus_tag LOCUS_15990 7856 8644 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941483.1 protein_id gnl|my_center|LOCUS_15990 8641 9417 gene locus_tag LOCUS_16000 8641 9417 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_16000 9414 9860 gene locus_tag LOCUS_16010 gene mlaD 9414 9860 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545373.1 protein_id gnl|my_center|LOCUS_16010 9916 10563 gene locus_tag LOCUS_16020 9916 10563 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941479.1 protein_id gnl|my_center|LOCUS_16020 10567 11403 gene locus_tag LOCUS_16030 10567 11403 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938538.1 protein_id gnl|my_center|LOCUS_16030 11668 12144 gene locus_tag LOCUS_16040 11668 12144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 12235 12783 gene locus_tag LOCUS_16050 12235 12783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 12848 13039 gene locus_tag LOCUS_16060 gene rpmF 12848 13039 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942244.1 protein_id gnl|my_center|LOCUS_16060 13235 14203 gene locus_tag LOCUS_16070 gene plsX 13235 14203 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942245.1 protein_id gnl|my_center|LOCUS_16070 14216 15181 gene locus_tag LOCUS_16080 14216 15181 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942246.1 protein_id gnl|my_center|LOCUS_16080 15219 16367 gene locus_tag LOCUS_16090 15219 16367 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_16090 16374 17153 gene locus_tag LOCUS_16100 16374 17153 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546330.1 protein_id gnl|my_center|LOCUS_16100 17158 18351 gene locus_tag LOCUS_16110 17158 18351 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048235.1 protein_id gnl|my_center|LOCUS_16110 18382 19137 gene locus_tag LOCUS_16120 gene fabG 18382 19137 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989818.1 protein_id gnl|my_center|LOCUS_16120 19218 19448 gene locus_tag LOCUS_16130 gene acpP 19218 19448 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406112.1 protein_id gnl|my_center|LOCUS_16130 19580 20821 gene locus_tag LOCUS_16140 gene fabF 19580 20821 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_16140 20825 21247 gene locus_tag LOCUS_16150 gene rpiB 20825 21247 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546357.1 protein_id gnl|my_center|LOCUS_16150 21319 22575 gene locus_tag LOCUS_16160 21319 22575 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_16160 22565 23032 gene locus_tag LOCUS_16170 22565 23032 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938498.1 protein_id gnl|my_center|LOCUS_16170 23142 23621 gene locus_tag LOCUS_16180 gene nrdR 23142 23621 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_16180 23632 24753 gene locus_tag LOCUS_16190 gene ribD 23632 24753 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_16190 24825 25421 gene locus_tag LOCUS_16200 24825 25421 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942332.1 protein_id gnl|my_center|LOCUS_16200 25554 26777 gene locus_tag LOCUS_16210 25554 26777 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_16210 26855 27322 gene locus_tag LOCUS_16220 gene ribE 26855 27322 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099502.1 protein_id gnl|my_center|LOCUS_16220 27319 27753 gene locus_tag LOCUS_16230 gene nusB 27319 27753 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460271.1 protein_id gnl|my_center|LOCUS_16230 27779 29923 gene locus_tag LOCUS_16240 27779 29923 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943733.1 protein_id gnl|my_center|LOCUS_16240 29959 30741 gene locus_tag LOCUS_16250 gene hisJ 29959 30741 CDS product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227864.1 protein_id gnl|my_center|LOCUS_16250 31152 30757 gene locus_tag LOCUS_16260 31152 30757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938981.1 protein_id gnl|my_center|LOCUS_16260 31269 33527 gene locus_tag LOCUS_16270 31269 33527 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403289.1 protein_id gnl|my_center|LOCUS_16270 33582 34928 gene locus_tag LOCUS_16280 33582 34928 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_16280 34943 35251 gene locus_tag LOCUS_16290 34943 35251 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092213181.1 protein_id gnl|my_center|LOCUS_16290 35470 37236 gene locus_tag LOCUS_16300 35470 37236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 40016 37335 gene locus_tag LOCUS_16310 40016 37335 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942688.1 protein_id gnl|my_center|LOCUS_16310 41196 40132 gene locus_tag LOCUS_16320 41196 40132 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546176.1 protein_id gnl|my_center|LOCUS_16320 43384 41414 gene locus_tag LOCUS_16330 43384 41414 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932067.1 protein_id gnl|my_center|LOCUS_16330 43487 43786 gene locus_tag LOCUS_16340 43487 43786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 44674 43847 gene locus_tag LOCUS_16350 44674 43847 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687512.1 protein_id gnl|my_center|LOCUS_16350 45672 44770 gene locus_tag LOCUS_16360 45672 44770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 47995 45776 gene locus_tag LOCUS_16370 gene glgP 47995 45776 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545636.1 protein_id gnl|my_center|LOCUS_16370 48364 48927 gene locus_tag LOCUS_16380 gene pal 48364 48927 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932322.1 protein_id gnl|my_center|LOCUS_16380 49046 49603 gene locus_tag LOCUS_16390 49046 49603 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545058.1 protein_id gnl|my_center|LOCUS_16390 51361 49895 gene locus_tag LOCUS_16400 51361 49895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 53244 51358 gene locus_tag LOCUS_16410 gene dxs 53244 51358 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_16410 54142 53252 gene locus_tag LOCUS_16420 54142 53252 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_16420 54628 54383 gene locus_tag LOCUS_16430 gene xseB 54628 54383 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124944.1 protein_id gnl|my_center|LOCUS_16430 54704 55651 gene locus_tag LOCUS_16440 gene xerC 54704 55651 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545085.1 protein_id gnl|my_center|LOCUS_16440 55812 56363 gene locus_tag LOCUS_16450 gene hslV 55812 56363 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392543.1 protein_id gnl|my_center|LOCUS_16450 56399 57739 gene locus_tag LOCUS_16460 gene hslU 56399 57739 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_16460 57783 58301 gene locus_tag LOCUS_16470 57783 58301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 59134 58376 gene locus_tag LOCUS_16480 59134 58376 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460477.1 protein_id gnl|my_center|LOCUS_16480 59209 60369 gene locus_tag LOCUS_16490 59209 60369 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_16490 60399 61817 gene locus_tag LOCUS_16500 60399 61817 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586529.1 protein_id gnl|my_center|LOCUS_16500 61885 62631 gene locus_tag LOCUS_16510 61885 62631 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705735.1 protein_id gnl|my_center|LOCUS_16510 62664 64361 gene locus_tag LOCUS_16520 gene ispH 62664 64361 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011417689.1 protein_id gnl|my_center|LOCUS_16520 64401 65522 gene locus_tag LOCUS_16530 gene ftsY 64401 65522 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941793.1 protein_id gnl|my_center|LOCUS_16530 65519 66346 gene locus_tag LOCUS_16540 65519 66346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 66377 67564 gene locus_tag LOCUS_16550 66377 67564 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941722.1 protein_id gnl|my_center|LOCUS_16550 67565 68635 gene locus_tag LOCUS_16560 67565 68635 CDS product DUF3524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403829.1 protein_id gnl|my_center|LOCUS_16560 69003 68845 gene locus_tag LOCUS_16570 69003 68845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 71250 69049 gene locus_tag LOCUS_16580 gene glgB 71250 69049 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_16580 71511 72077 gene locus_tag LOCUS_16590 71511 72077 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532765.1 protein_id gnl|my_center|LOCUS_16590 72386 72775 gene locus_tag LOCUS_16600 72386 72775 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938301.1 protein_id gnl|my_center|LOCUS_16600 72775 73239 gene locus_tag LOCUS_16610 gene rlmH 72775 73239 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053094.1 protein_id gnl|my_center|LOCUS_16610 73568 73347 gene locus_tag LOCUS_16620 73568 73347 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791779.1 protein_id gnl|my_center|LOCUS_16620 73791 74756 gene locus_tag LOCUS_16630 73791 74756 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938291.1 protein_id gnl|my_center|LOCUS_16630 74945 77395 gene locus_tag LOCUS_16640 gene ppsA 74945 77395 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056610.1 protein_id gnl|my_center|LOCUS_16640 >Feature sequence16 1673 2026 gene locus_tag LOCUS_16650 1673 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 2048 5026 gene locus_tag LOCUS_16660 2048 5026 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939035.1 protein_id gnl|my_center|LOCUS_16660 5023 6831 gene locus_tag LOCUS_16670 5023 6831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 9573 7219 gene locus_tag LOCUS_16680 gene lon 9573 7219 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_16680 10031 9591 gene locus_tag LOCUS_16690 10031 9591 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083188.1 protein_id gnl|my_center|LOCUS_16690 10313 10699 gene locus_tag LOCUS_16700 10313 10699 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072235.1 protein_id gnl|my_center|LOCUS_16700 12733 10844 gene locus_tag LOCUS_16710 12733 10844 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112594.1 protein_id gnl|my_center|LOCUS_16710 14255 12738 gene locus_tag LOCUS_16720 14255 12738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 14691 15257 gene locus_tag LOCUS_16730 14691 15257 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123161.1 protein_id gnl|my_center|LOCUS_16730 15581 15279 gene locus_tag LOCUS_16740 15581 15279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 16791 15589 gene locus_tag LOCUS_16750 16791 15589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 18418 16799 gene locus_tag LOCUS_16760 18418 16799 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237994.1 protein_id gnl|my_center|LOCUS_16760 18432 18599 gene locus_tag LOCUS_16770 18432 18599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 19712 18645 gene locus_tag LOCUS_16780 gene purM 19712 18645 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942402.1 protein_id gnl|my_center|LOCUS_16780 20252 20911 gene locus_tag LOCUS_16790 20252 20911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 21035 21111 gene locus_tag LOCUS_t00170 21035 21111 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 21680 21300 gene locus_tag LOCUS_16800 21680 21300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 24121 21827 gene locus_tag LOCUS_16810 24121 21827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 25226 24360 gene locus_tag LOCUS_16820 gene znuB 25226 24360 CDS product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211197.1 protein_id gnl|my_center|LOCUS_16820 26022 25219 gene locus_tag LOCUS_16830 26022 25219 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267339.1 protein_id gnl|my_center|LOCUS_16830 26957 26019 gene locus_tag LOCUS_16840 26957 26019 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057897.1 protein_id gnl|my_center|LOCUS_16840 27336 27689 gene locus_tag LOCUS_16850 27336 27689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 27707 27892 gene locus_tag LOCUS_16860 27707 27892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 27905 28180 gene locus_tag LOCUS_16870 27905 28180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 28177 28518 gene locus_tag LOCUS_16880 28177 28518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 28558 29898 gene locus_tag LOCUS_16890 28558 29898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 29973 30179 gene locus_tag LOCUS_16900 29973 30179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 30261 30518 gene locus_tag LOCUS_16910 30261 30518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 30670 31263 gene locus_tag LOCUS_16920 30670 31263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 33906 31636 gene locus_tag LOCUS_16930 33906 31636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 34847 33921 gene locus_tag LOCUS_16940 gene mdh 34847 33921 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325654.1 protein_id gnl|my_center|LOCUS_16940 35714 34956 gene locus_tag LOCUS_16950 gene kdsB 35714 34956 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072444.1 protein_id gnl|my_center|LOCUS_16950 35830 36600 gene locus_tag LOCUS_16960 35830 36600 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266962.1 protein_id gnl|my_center|LOCUS_16960 37928 36726 gene locus_tag LOCUS_16970 37928 36726 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072442.1 protein_id gnl|my_center|LOCUS_16970 37928 38086 gene locus_tag LOCUS_16980 37928 38086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 39287 38118 gene locus_tag LOCUS_16990 39287 38118 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870021.1 protein_id gnl|my_center|LOCUS_16990 39556 40098 gene locus_tag LOCUS_17000 gene yjgA 39556 40098 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101581.1 protein_id gnl|my_center|LOCUS_17000 40155 40595 gene locus_tag LOCUS_17010 40155 40595 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545112.1 protein_id gnl|my_center|LOCUS_17010 40728 41471 gene locus_tag LOCUS_17020 40728 41471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 41491 42630 gene locus_tag LOCUS_17030 41491 42630 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_17030 42761 44389 gene locus_tag LOCUS_17040 42761 44389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 44573 44812 gene locus_tag LOCUS_17050 44573 44812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 44809 45219 gene locus_tag LOCUS_17060 44809 45219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 45513 45334 gene locus_tag LOCUS_17070 45513 45334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 46072 45914 gene locus_tag LOCUS_17080 46072 45914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 48228 46564 gene locus_tag LOCUS_17090 48228 46564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 49007 48225 gene locus_tag LOCUS_17100 49007 48225 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_17100 50500 49007 gene locus_tag LOCUS_17110 50500 49007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 52216 50555 gene locus_tag LOCUS_17120 52216 50555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 53311 52403 gene locus_tag LOCUS_17130 53311 52403 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939203.1 protein_id gnl|my_center|LOCUS_17130 54840 53329 gene locus_tag LOCUS_17140 54840 53329 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811612.1 protein_id gnl|my_center|LOCUS_17140 55138 55482 gene locus_tag LOCUS_17150 55138 55482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 57597 55666 gene locus_tag LOCUS_17160 57597 55666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 59054 57612 gene locus_tag LOCUS_17170 59054 57612 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546372.1 protein_id gnl|my_center|LOCUS_17170 61083 59599 gene locus_tag LOCUS_17180 61083 59599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 61177 61037 gene locus_tag LOCUS_17190 61177 61037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 61412 61188 gene locus_tag LOCUS_17200 61412 61188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 61575 61850 gene locus_tag LOCUS_17210 61575 61850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 61847 62305 gene locus_tag LOCUS_17220 61847 62305 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_17220 64060 62345 gene locus_tag LOCUS_17230 gene recD 64060 62345 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932748.1 protein_id gnl|my_center|LOCUS_17230 67574 64047 gene locus_tag LOCUS_17240 gene recB 67574 64047 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942181.1 protein_id gnl|my_center|LOCUS_17240 69647 67587 gene locus_tag LOCUS_17250 69647 67587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 69837 70211 gene locus_tag LOCUS_17260 69837 70211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 70233 71087 gene locus_tag LOCUS_17270 70233 71087 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942704.1 protein_id gnl|my_center|LOCUS_17270 72708 71221 gene locus_tag LOCUS_17280 72708 71221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 >Feature sequence17 1247 696 gene locus_tag LOCUS_17290 1247 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 7420 2096 gene locus_tag LOCUS_17300 7420 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17300 10369 7508 gene locus_tag LOCUS_17310 10369 7508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17310 11760 10366 gene locus_tag LOCUS_17320 11760 10366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 13541 11757 gene locus_tag LOCUS_17330 13541 11757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 14296 13577 gene locus_tag LOCUS_17340 14296 13577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 15012 14536 gene locus_tag LOCUS_17350 15012 14536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 15779 15048 gene locus_tag LOCUS_17360 15779 15048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 16029 15880 gene locus_tag LOCUS_17370 16029 15880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 16301 16522 gene locus_tag LOCUS_17380 16301 16522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 16583 17299 gene locus_tag LOCUS_17390 16583 17299 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932882.1 protein_id gnl|my_center|LOCUS_17390 17391 18299 gene locus_tag LOCUS_17400 17391 18299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 19137 18574 gene locus_tag LOCUS_17410 19137 18574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 21558 19339 gene locus_tag LOCUS_17420 21558 19339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 22339 23673 gene locus_tag LOCUS_17430 22339 23673 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943098.1 protein_id gnl|my_center|LOCUS_17430 23910 24605 gene locus_tag LOCUS_17440 23910 24605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 24725 24997 gene locus_tag LOCUS_17450 24725 24997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 25231 28326 gene locus_tag LOCUS_17460 25231 28326 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011114777.1 protein_id gnl|my_center|LOCUS_17460 31098 28597 gene locus_tag LOCUS_17470 31098 28597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 31469 31095 gene locus_tag LOCUS_17480 31469 31095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 33240 31717 gene locus_tag LOCUS_17490 33240 31717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 34040 33237 gene locus_tag LOCUS_17500 34040 33237 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_17500 36621 34033 gene locus_tag LOCUS_17510 36621 34033 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003915882.1 protein_id gnl|my_center|LOCUS_17510 37307 36618 gene locus_tag LOCUS_17520 37307 36618 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966824.1 protein_id gnl|my_center|LOCUS_17520 37899 37351 gene locus_tag LOCUS_17530 37899 37351 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973941.1 protein_id gnl|my_center|LOCUS_17530 38716 37991 gene locus_tag LOCUS_17540 38716 37991 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546015.1 protein_id gnl|my_center|LOCUS_17540 40668 38737 gene locus_tag LOCUS_17550 40668 38737 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545360.1 protein_id gnl|my_center|LOCUS_17550 42514 40727 gene locus_tag LOCUS_17560 42514 40727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 44827 42785 gene locus_tag LOCUS_17570 44827 42785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 46725 45031 gene locus_tag LOCUS_17580 46725 45031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 48281 46740 gene locus_tag LOCUS_17590 48281 46740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 48717 48325 gene locus_tag LOCUS_17600 48717 48325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 49010 50122 gene locus_tag LOCUS_17610 49010 50122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 50115 51659 gene locus_tag LOCUS_17620 50115 51659 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_17620 51761 53257 gene locus_tag LOCUS_17630 gene accC 51761 53257 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202499.1 protein_id gnl|my_center|LOCUS_17630 53306 53806 gene locus_tag LOCUS_17640 53306 53806 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786452.1 protein_id gnl|my_center|LOCUS_17640 53961 54773 gene locus_tag LOCUS_17650 53961 54773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 55062 55790 gene locus_tag LOCUS_17660 55062 55790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 55824 57596 gene locus_tag LOCUS_17670 55824 57596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 57598 58719 gene locus_tag LOCUS_17680 57598 58719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 59289 58909 gene locus_tag LOCUS_17690 59289 58909 CDS product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767605.1 protein_id gnl|my_center|LOCUS_17690 60481 59297 gene locus_tag LOCUS_17700 gene amrS 60481 59297 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867880.1 protein_id gnl|my_center|LOCUS_17700 62614 60566 gene locus_tag LOCUS_17710 62614 60566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 64151 62664 gene locus_tag LOCUS_17720 gene amrB 64151 62664 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444593.1 protein_id gnl|my_center|LOCUS_17720 65453 64335 gene locus_tag LOCUS_17730 gene dacB 65453 64335 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369511.1 protein_id gnl|my_center|LOCUS_17730 65424 65744 gene locus_tag LOCUS_17740 65424 65744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 66971 65625 gene locus_tag LOCUS_17750 66971 65625 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943015.1 protein_id gnl|my_center|LOCUS_17750 67259 67864 gene locus_tag LOCUS_17760 67259 67864 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966335.1 protein_id gnl|my_center|LOCUS_17760 67864 68811 gene locus_tag LOCUS_17770 67864 68811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_17770 69276 70211 gene locus_tag LOCUS_17780 gene hemC 69276 70211 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943896.1 protein_id gnl|my_center|LOCUS_17780 70192 71754 gene locus_tag LOCUS_17790 gene cobA 70192 71754 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943897.1 protein_id gnl|my_center|LOCUS_17790 >Feature sequence18 2303 213 gene locus_tag LOCUS_17800 2303 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 3153 2506 gene locus_tag LOCUS_17810 3153 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 3394 4515 gene locus_tag LOCUS_17820 3394 4515 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933793.1 protein_id gnl|my_center|LOCUS_17820 5232 4735 gene locus_tag LOCUS_17830 5232 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 5419 5237 gene locus_tag LOCUS_17840 5419 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 5853 5641 gene locus_tag LOCUS_17850 5853 5641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 6464 5952 gene locus_tag LOCUS_17860 6464 5952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 7265 6921 gene locus_tag LOCUS_17870 7265 6921 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669261.1 protein_id gnl|my_center|LOCUS_17870 7979 9775 gene locus_tag LOCUS_17880 7979 9775 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942079.1 protein_id gnl|my_center|LOCUS_17880 9777 10568 gene locus_tag LOCUS_17890 9777 10568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 10565 13072 gene locus_tag LOCUS_17900 10565 13072 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943854.1 protein_id gnl|my_center|LOCUS_17900 13124 14656 gene locus_tag LOCUS_17910 gene rng 13124 14656 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_17910 16914 14680 gene locus_tag LOCUS_17920 16914 14680 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013008044.1 protein_id gnl|my_center|LOCUS_17920 19106 16917 gene locus_tag LOCUS_17930 19106 16917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 20441 19140 gene locus_tag LOCUS_17940 20441 19140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 21082 21786 gene locus_tag LOCUS_17950 21082 21786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 22350 30044 gene locus_tag LOCUS_17960 22350 30044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 30493 31260 gene locus_tag LOCUS_17970 30493 31260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 31275 32462 gene locus_tag LOCUS_17980 31275 32462 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037252469.1 protein_id gnl|my_center|LOCUS_17980 32805 33605 gene locus_tag LOCUS_17990 32805 33605 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028849.1 protein_id gnl|my_center|LOCUS_17990 33987 34298 gene locus_tag LOCUS_18000 gene rplU 33987 34298 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392094.1 protein_id gnl|my_center|LOCUS_18000 34367 34630 gene locus_tag LOCUS_18010 gene rpmA 34367 34630 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938227.1 protein_id gnl|my_center|LOCUS_18010 34773 35792 gene locus_tag LOCUS_18020 gene obgE 34773 35792 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392098.1 protein_id gnl|my_center|LOCUS_18020 35794 36951 gene locus_tag LOCUS_18030 gene proB 35794 36951 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_18030 37182 38441 gene locus_tag LOCUS_18040 37182 38441 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943829.1 protein_id gnl|my_center|LOCUS_18040 38463 39110 gene locus_tag LOCUS_18050 gene nadD 38463 39110 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964574.1 protein_id gnl|my_center|LOCUS_18050 40010 39270 gene locus_tag LOCUS_18060 gene folE2 40010 39270 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_18060 40275 40679 gene locus_tag LOCUS_18070 40275 40679 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068915.1 protein_id gnl|my_center|LOCUS_18070 40833 41447 gene locus_tag LOCUS_18080 40833 41447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 41459 42025 gene locus_tag LOCUS_18090 gene purN 41459 42025 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326621.1 protein_id gnl|my_center|LOCUS_18090 42046 42594 gene locus_tag LOCUS_18100 gene pyrR 42046 42594 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887753.1 protein_id gnl|my_center|LOCUS_18100 42763 44148 gene locus_tag LOCUS_18110 42763 44148 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938056.1 protein_id gnl|my_center|LOCUS_18110 44145 46340 gene locus_tag LOCUS_18120 44145 46340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 46618 47967 gene locus_tag LOCUS_18130 46618 47967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 48191 49261 gene locus_tag LOCUS_18140 48191 49261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 49777 50421 gene locus_tag LOCUS_18150 49777 50421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 50425 50826 gene locus_tag LOCUS_18160 gene tolR 50425 50826 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126827401.1 protein_id gnl|my_center|LOCUS_18160 51025 53007 gene locus_tag LOCUS_18170 51025 53007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 55386 53170 gene locus_tag LOCUS_18180 55386 53170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 55700 55428 gene locus_tag LOCUS_18190 55700 55428 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941715.1 protein_id gnl|my_center|LOCUS_18190 56956 55820 gene locus_tag LOCUS_18200 56956 55820 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941716.1 protein_id gnl|my_center|LOCUS_18200 57092 57325 gene locus_tag LOCUS_18210 57092 57325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 57908 57372 gene locus_tag LOCUS_18220 57908 57372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 58424 57915 gene locus_tag LOCUS_18230 58424 57915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 59788 58631 gene locus_tag LOCUS_18240 59788 58631 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942829.1 protein_id gnl|my_center|LOCUS_18240 60388 60185 gene locus_tag LOCUS_18250 60388 60185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 60756 60385 gene locus_tag LOCUS_18260 60756 60385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 61344 61150 gene locus_tag LOCUS_18270 61344 61150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 61610 62140 gene locus_tag LOCUS_18280 61610 62140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 62294 62479 gene locus_tag LOCUS_18290 62294 62479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 64350 62491 gene locus_tag LOCUS_18300 64350 62491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 65057 64863 gene locus_tag LOCUS_18310 65057 64863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 65603 65325 gene locus_tag LOCUS_18320 65603 65325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 66242 65907 gene locus_tag LOCUS_18330 66242 65907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 66443 66685 gene locus_tag LOCUS_18340 66443 66685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 66670 67008 gene locus_tag LOCUS_18350 66670 67008 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458809.1 protein_id gnl|my_center|LOCUS_18350 67371 67697 gene locus_tag LOCUS_18360 67371 67697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 67704 68012 gene locus_tag LOCUS_18370 67704 68012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 68135 68443 gene locus_tag LOCUS_18380 68135 68443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 >Feature sequence19 997 683 gene locus_tag LOCUS_18390 997 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 1224 994 gene locus_tag LOCUS_18400 1224 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 1882 1658 gene locus_tag LOCUS_18410 1882 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 2180 1920 gene locus_tag LOCUS_18420 2180 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 3435 2707 gene locus_tag LOCUS_18430 3435 2707 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639909.1 protein_id gnl|my_center|LOCUS_18430 3830 3516 gene locus_tag LOCUS_18440 3830 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 4274 6727 gene locus_tag LOCUS_18450 4274 6727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 6717 7463 gene locus_tag LOCUS_18460 6717 7463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 7464 8006 gene locus_tag LOCUS_18470 gene tssJ 7464 8006 CDS product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941097.1 protein_id gnl|my_center|LOCUS_18470 8288 9679 gene locus_tag LOCUS_18480 gene tssK 8288 9679 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941098.1 protein_id gnl|my_center|LOCUS_18480 9682 10359 gene locus_tag LOCUS_18490 9682 10359 CDS product DotU family type IV/VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044923.1 protein_id gnl|my_center|LOCUS_18490 10359 13844 gene locus_tag LOCUS_18500 10359 13844 CDS product type VI secretion protein IcmF/TssM N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943786.1 protein_id gnl|my_center|LOCUS_18500 13832 14572 gene locus_tag LOCUS_18510 13832 14572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 14803 15627 gene locus_tag LOCUS_18520 14803 15627 CDS product type VI secretion system accessory protein TagJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523685.1 protein_id gnl|my_center|LOCUS_18520 15608 16987 gene locus_tag LOCUS_18530 15608 16987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 17074 17604 gene locus_tag LOCUS_18540 gene tssB 17074 17604 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318241.1 protein_id gnl|my_center|LOCUS_18540 17619 19115 gene locus_tag LOCUS_18550 gene tssC 17619 19115 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343625.1 protein_id gnl|my_center|LOCUS_18550 19272 19760 gene locus_tag LOCUS_18560 19272 19760 CDS product type VI secretion system tube protein Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318810.1 protein_id gnl|my_center|LOCUS_18560 19779 20249 gene locus_tag LOCUS_18570 gene tssE 19779 20249 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318239.1 protein_id gnl|my_center|LOCUS_18570 20256 22061 gene locus_tag LOCUS_18580 gene tssF 20256 22061 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343627.1 protein_id gnl|my_center|LOCUS_18580 22025 23065 gene locus_tag LOCUS_18590 gene tssG 22025 23065 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269329.1 protein_id gnl|my_center|LOCUS_18590 23370 26021 gene locus_tag LOCUS_18600 gene tssH 23370 26021 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269330.1 protein_id gnl|my_center|LOCUS_18600 26067 26921 gene locus_tag LOCUS_18610 26067 26921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 27537 28361 gene locus_tag LOCUS_18620 27537 28361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 29671 31077 gene locus_tag LOCUS_18630 29671 31077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 31291 31431 gene locus_tag LOCUS_18640 31291 31431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 31465 31953 gene locus_tag LOCUS_18650 31465 31953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 32099 32347 gene locus_tag LOCUS_18660 32099 32347 CDS product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 protein_id gnl|my_center|LOCUS_18660 34352 32745 gene locus_tag LOCUS_18670 34352 32745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 35029 35505 gene locus_tag LOCUS_18680 35029 35505 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940746.1 protein_id gnl|my_center|LOCUS_18680 35502 36272 gene locus_tag LOCUS_18690 35502 36272 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940747.1 protein_id gnl|my_center|LOCUS_18690 36280 37530 gene locus_tag LOCUS_18700 gene nrfD 36280 37530 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940748.1 protein_id gnl|my_center|LOCUS_18700 38730 37759 gene locus_tag LOCUS_18710 38730 37759 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256666.1 protein_id gnl|my_center|LOCUS_18710 39527 38766 gene locus_tag LOCUS_18720 39527 38766 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_18720 41443 39530 gene locus_tag LOCUS_18730 41443 39530 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_18730 42203 41457 gene locus_tag LOCUS_18740 42203 41457 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941836.1 protein_id gnl|my_center|LOCUS_18740 43214 42249 gene locus_tag LOCUS_18750 43214 42249 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583585.1 protein_id gnl|my_center|LOCUS_18750 43312 44352 gene locus_tag LOCUS_18760 43312 44352 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942398.1 protein_id gnl|my_center|LOCUS_18760 44776 46122 gene locus_tag LOCUS_18770 gene mgtE 44776 46122 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870202.1 protein_id gnl|my_center|LOCUS_18770 46195 47547 gene locus_tag LOCUS_18780 46195 47547 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937720.1 protein_id gnl|my_center|LOCUS_18780 47623 48282 gene locus_tag LOCUS_18790 47623 48282 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937719.1 protein_id gnl|my_center|LOCUS_18790 48303 48911 gene locus_tag LOCUS_18800 48303 48911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 48908 51319 gene locus_tag LOCUS_18810 48908 51319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 52382 51438 gene locus_tag LOCUS_18820 52382 51438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 53307 53008 gene locus_tag LOCUS_18830 53307 53008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 53233 55749 gene locus_tag LOCUS_18840 53233 55749 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210266672.1 protein_id gnl|my_center|LOCUS_18840 56056 57906 gene locus_tag LOCUS_18850 56056 57906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 58796 57942 gene locus_tag LOCUS_18860 58796 57942 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116544.1 protein_id gnl|my_center|LOCUS_18860 59390 58929 gene locus_tag LOCUS_18870 59390 58929 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207517.1 protein_id gnl|my_center|LOCUS_18870 60144 59467 gene locus_tag LOCUS_18880 60144 59467 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160069703.1 protein_id gnl|my_center|LOCUS_18880 60412 60918 gene locus_tag LOCUS_18890 60412 60918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 62669 60930 gene locus_tag LOCUS_18900 62669 60930 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706852.1 protein_id gnl|my_center|LOCUS_18900 63596 62691 gene locus_tag LOCUS_18910 63596 62691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 65329 63728 gene locus_tag LOCUS_18920 65329 63728 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527943.1 protein_id gnl|my_center|LOCUS_18920 66363 65326 gene locus_tag LOCUS_18930 66363 65326 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524778.1 protein_id gnl|my_center|LOCUS_18930 >Feature sequence20 2165 1077 gene locus_tag LOCUS_18940 2165 1077 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942536.1 protein_id gnl|my_center|LOCUS_18940 2869 2366 gene locus_tag LOCUS_18950 2869 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 3113 4339 gene locus_tag LOCUS_18960 3113 4339 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 protein_id gnl|my_center|LOCUS_18960 5057 4395 gene locus_tag LOCUS_18970 5057 4395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 6547 5375 gene locus_tag LOCUS_18980 6547 5375 CDS product phosphatidylserine/phosphatidylglycerophosphate/cardiolipin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268810.1 protein_id gnl|my_center|LOCUS_18980 8180 6591 gene locus_tag LOCUS_18990 8180 6591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 10081 8366 gene locus_tag LOCUS_19000 10081 8366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 10955 10125 gene locus_tag LOCUS_19010 10955 10125 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044926.1 protein_id gnl|my_center|LOCUS_19010 11162 12730 gene locus_tag LOCUS_19020 11162 12730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 12966 13421 gene locus_tag LOCUS_19030 12966 13421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 13522 13770 gene locus_tag LOCUS_19040 13522 13770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 14235 13813 gene locus_tag LOCUS_19050 14235 13813 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085221.1 protein_id gnl|my_center|LOCUS_19050 14483 14232 gene locus_tag LOCUS_19060 14483 14232 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197529995.1 protein_id gnl|my_center|LOCUS_19060 14546 14959 gene locus_tag LOCUS_19070 14546 14959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 15064 15594 gene locus_tag LOCUS_19080 15064 15594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036263.1 protein_id gnl|my_center|LOCUS_19080 15578 16288 gene locus_tag LOCUS_19090 15578 16288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015462938.1 protein_id gnl|my_center|LOCUS_19090 16532 17293 gene locus_tag LOCUS_19100 16532 17293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 17693 17427 gene locus_tag LOCUS_19110 17693 17427 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080314.1 protein_id gnl|my_center|LOCUS_19110 18142 17744 gene locus_tag LOCUS_19120 18142 17744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 18484 18409 gene locus_tag LOCUS_t00180 18484 18409 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 20769 18553 gene locus_tag LOCUS_19130 20769 18553 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207578.1 protein_id gnl|my_center|LOCUS_19130 21648 20830 gene locus_tag LOCUS_19140 21648 20830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 22025 21645 gene locus_tag LOCUS_19150 22025 21645 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881197.1 protein_id gnl|my_center|LOCUS_19150 22440 22006 gene locus_tag LOCUS_19160 gene exbB 22440 22006 CDS product TonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881140.1 protein_id gnl|my_center|LOCUS_19160 23250 22444 gene locus_tag LOCUS_19170 gene hadI 23250 22444 CDS product 2-hydroxyisocaproyl-CoA dehydratase activator HadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888223.1 protein_id gnl|my_center|LOCUS_19170 24515 23247 gene locus_tag LOCUS_19180 24515 23247 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869008.1 protein_id gnl|my_center|LOCUS_19180 25491 24505 gene locus_tag LOCUS_19190 25491 24505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 26515 25484 gene locus_tag LOCUS_19200 26515 25484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 27780 26827 gene locus_tag LOCUS_19210 27780 26827 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387829.1 protein_id gnl|my_center|LOCUS_19210 28270 28620 gene locus_tag LOCUS_19220 28270 28620 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920612.1 protein_id gnl|my_center|LOCUS_19220 28617 29924 gene locus_tag LOCUS_19230 28617 29924 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_19230 30046 30135 gene locus_tag LOCUS_t00190 30046 30135 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 30256 30909 gene locus_tag LOCUS_19240 30256 30909 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021775.1 protein_id gnl|my_center|LOCUS_19240 31067 32293 gene locus_tag LOCUS_19250 31067 32293 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_19250 33400 32300 gene locus_tag LOCUS_19260 33400 32300 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_19260 33507 34310 gene locus_tag LOCUS_19270 33507 34310 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942917.1 protein_id gnl|my_center|LOCUS_19270 34822 34307 gene locus_tag LOCUS_19280 34822 34307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 35325 38444 gene locus_tag LOCUS_19290 gene fdnG 35325 38444 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546362.1 transl_except (pos:35928..35930,aa:Sec) note codon on position 202 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_19290 38455 39222 gene locus_tag LOCUS_19300 38455 39222 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545194.1 protein_id gnl|my_center|LOCUS_19300 39224 39829 gene locus_tag LOCUS_19310 gene fdoI 39224 39829 CDS product formate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209610.1 protein_id gnl|my_center|LOCUS_19310 39911 40498 gene locus_tag LOCUS_19320 39911 40498 CDS product disulfide bond formation protein D, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546591.1 transl_except (pos:40058..40060,aa:Sec) note codon on position 50 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_19320 40503 41561 gene locus_tag LOCUS_19330 40503 41561 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546373.1 protein_id gnl|my_center|LOCUS_19330 41570 42340 gene locus_tag LOCUS_19340 gene fdhE 41570 42340 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544950.1 protein_id gnl|my_center|LOCUS_19340 43129 42362 gene locus_tag LOCUS_19350 43129 42362 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706862.1 protein_id gnl|my_center|LOCUS_19350 45060 43138 gene locus_tag LOCUS_19360 45060 43138 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545932.1 protein_id gnl|my_center|LOCUS_19360 46322 45057 gene locus_tag LOCUS_19370 46322 45057 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542268.1 protein_id gnl|my_center|LOCUS_19370 47034 46381 gene locus_tag LOCUS_19380 47034 46381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 47834 47157 gene locus_tag LOCUS_19390 47834 47157 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938048.1 protein_id gnl|my_center|LOCUS_19390 48528 47824 gene locus_tag LOCUS_19400 48528 47824 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943339.1 protein_id gnl|my_center|LOCUS_19400 49624 48728 gene locus_tag LOCUS_19410 49624 48728 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970367.1 protein_id gnl|my_center|LOCUS_19410 50566 49628 gene locus_tag LOCUS_19420 50566 49628 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791454.1 protein_id gnl|my_center|LOCUS_19420 51377 51027 gene locus_tag LOCUS_19430 51377 51027 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255937.1 protein_id gnl|my_center|LOCUS_19430 51731 52387 gene locus_tag LOCUS_19440 51731 52387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 52411 53649 gene locus_tag LOCUS_19450 52411 53649 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542268.1 protein_id gnl|my_center|LOCUS_19450 55081 53714 gene locus_tag LOCUS_19460 55081 53714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 55703 55074 gene locus_tag LOCUS_19470 55703 55074 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_19470 57428 55941 gene locus_tag LOCUS_19480 57428 55941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 58285 57428 gene locus_tag LOCUS_19490 58285 57428 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832012.1 protein_id gnl|my_center|LOCUS_19490 59283 58342 gene locus_tag LOCUS_19500 59283 58342 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536188.1 protein_id gnl|my_center|LOCUS_19500 61282 59285 gene locus_tag LOCUS_19510 61282 59285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 62301 61279 gene locus_tag LOCUS_19520 62301 61279 CDS product DmsE family decaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941884.1 protein_id gnl|my_center|LOCUS_19520 64618 62555 gene locus_tag LOCUS_19530 64618 62555 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980092.1 protein_id gnl|my_center|LOCUS_19530 65343 64705 gene locus_tag LOCUS_19540 65343 64705 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941232.1 protein_id gnl|my_center|LOCUS_19540 >Feature sequence21 359 284 gene locus_tag LOCUS_t00200 359 284 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2199 415 gene locus_tag LOCUS_19550 gene ftsH 2199 415 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_19550 2476 2652 gene locus_tag LOCUS_19560 2476 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 3443 4639 gene locus_tag LOCUS_19570 gene hmeB 3443 4639 CDS product Hdr-like menaquinol oxidoreductase integral membrane subunit HmeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878007.1 protein_id gnl|my_center|LOCUS_19570 4984 5181 gene locus_tag LOCUS_19580 4984 5181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 7841 5424 gene locus_tag LOCUS_19590 7841 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 8438 9196 gene locus_tag LOCUS_19600 gene ttrB 8438 9196 CDS product tetrathionate reductase subunit TtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269830.1 protein_id gnl|my_center|LOCUS_19600 9215 9649 gene locus_tag LOCUS_19610 9215 9649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 10485 10712 gene locus_tag LOCUS_19620 10485 10712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 10899 12083 gene locus_tag LOCUS_19630 10899 12083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 12184 12555 gene locus_tag LOCUS_19640 12184 12555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 13083 12568 gene locus_tag LOCUS_19650 13083 12568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 13405 13124 gene locus_tag LOCUS_19660 13405 13124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 16931 13629 gene locus_tag LOCUS_19670 16931 13629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 17507 18232 gene locus_tag LOCUS_19680 17507 18232 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943737.1 protein_id gnl|my_center|LOCUS_19680 19201 18272 gene locus_tag LOCUS_19690 19201 18272 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963616.1 protein_id gnl|my_center|LOCUS_19690 19970 19185 gene locus_tag LOCUS_19700 19970 19185 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_19700 20108 21199 gene locus_tag LOCUS_19710 20108 21199 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546841.1 protein_id gnl|my_center|LOCUS_19710 22397 21552 gene locus_tag LOCUS_19720 gene thiD 22397 21552 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088646.1 protein_id gnl|my_center|LOCUS_19720 22901 22422 gene locus_tag LOCUS_19730 22901 22422 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941051.1 protein_id gnl|my_center|LOCUS_19730 24399 22945 gene locus_tag LOCUS_19740 24399 22945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 24647 24952 gene locus_tag LOCUS_19750 24647 24952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 24977 26518 gene locus_tag LOCUS_19760 gene omp50 24977 26518 CDS product outer membrane tyrosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891915.1 protein_id gnl|my_center|LOCUS_19760 26749 28782 gene locus_tag LOCUS_19770 26749 28782 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085134.1 protein_id gnl|my_center|LOCUS_19770 29869 28817 gene locus_tag LOCUS_19780 29869 28817 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337813.1 protein_id gnl|my_center|LOCUS_19780 30428 30607 gene locus_tag LOCUS_19790 30428 30607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 30588 30965 gene locus_tag LOCUS_19800 gene hisI 30588 30965 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937424.1 protein_id gnl|my_center|LOCUS_19800 30962 31834 gene locus_tag LOCUS_19810 gene hisG 30962 31834 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937425.1 protein_id gnl|my_center|LOCUS_19810 31838 32428 gene locus_tag LOCUS_19820 gene yihA 31838 32428 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943641.1 protein_id gnl|my_center|LOCUS_19820 32513 32833 gene locus_tag LOCUS_19830 32513 32833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 34779 32977 gene locus_tag LOCUS_19840 gene lepA 34779 32977 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334775.1 protein_id gnl|my_center|LOCUS_19840 34957 35922 gene locus_tag LOCUS_19850 34957 35922 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938875.1 protein_id gnl|my_center|LOCUS_19850 35991 37184 gene locus_tag LOCUS_19860 35991 37184 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_19860 37490 41542 gene locus_tag LOCUS_19870 37490 41542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 41679 42164 gene locus_tag LOCUS_19880 gene greA 41679 42164 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390637.1 protein_id gnl|my_center|LOCUS_19880 42856 42266 gene locus_tag LOCUS_19890 gene fadR 42856 42266 CDS product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229547.1 protein_id gnl|my_center|LOCUS_19890 43189 44955 gene locus_tag LOCUS_19900 43189 44955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 45046 45654 gene locus_tag LOCUS_19910 45046 45654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 45814 46143 gene locus_tag LOCUS_19920 45814 46143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 46407 47219 gene locus_tag LOCUS_19930 46407 47219 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943212.1 protein_id gnl|my_center|LOCUS_19930 47219 49021 gene locus_tag LOCUS_19940 47219 49021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 49018 50157 gene locus_tag LOCUS_19950 49018 50157 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545234.1 protein_id gnl|my_center|LOCUS_19950 50157 50987 gene locus_tag LOCUS_19960 50157 50987 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084985.1 protein_id gnl|my_center|LOCUS_19960 51003 51362 gene locus_tag LOCUS_19970 51003 51362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 51371 53011 gene locus_tag LOCUS_19980 51371 53011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 53520 53065 gene locus_tag LOCUS_19990 53520 53065 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_19990 56817 53584 gene locus_tag LOCUS_20000 56817 53584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 57158 56856 gene locus_tag LOCUS_20010 57158 56856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 57633 57211 gene locus_tag LOCUS_20020 57633 57211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 58757 57636 gene locus_tag LOCUS_20030 58757 57636 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025547.1 protein_id gnl|my_center|LOCUS_20030 59393 58920 gene locus_tag LOCUS_20040 gene tsaE 59393 58920 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048261.1 protein_id gnl|my_center|LOCUS_20040 59686 59414 gene locus_tag LOCUS_20050 59686 59414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 60641 59715 gene locus_tag LOCUS_20060 60641 59715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 60525 60734 gene locus_tag LOCUS_20070 60525 60734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 60922 62331 gene locus_tag LOCUS_20080 60922 62331 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939137.1 protein_id gnl|my_center|LOCUS_20080 62318 64192 gene locus_tag LOCUS_20090 gene mutL 62318 64192 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106411.1 protein_id gnl|my_center|LOCUS_20090 >Feature sequence22 2901 1063 gene locus_tag LOCUS_20100 2901 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 3563 5368 gene locus_tag LOCUS_20110 3563 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036215.1 protein_id gnl|my_center|LOCUS_20110 5365 6318 gene locus_tag LOCUS_20120 5365 6318 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509752.1 protein_id gnl|my_center|LOCUS_20120 6311 6769 gene locus_tag LOCUS_20130 6311 6769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 8087 7029 gene locus_tag LOCUS_20140 8087 7029 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_20140 8369 9067 gene locus_tag LOCUS_20150 8369 9067 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932340.1 protein_id gnl|my_center|LOCUS_20150 9138 9974 gene locus_tag LOCUS_20160 9138 9974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 10053 11225 gene locus_tag LOCUS_20170 10053 11225 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546841.1 protein_id gnl|my_center|LOCUS_20170 12622 11198 gene locus_tag LOCUS_20180 12622 11198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967756.1 protein_id gnl|my_center|LOCUS_20180 13270 13479 gene locus_tag LOCUS_20190 13270 13479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 13958 14770 gene locus_tag LOCUS_20200 13958 14770 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921173.1 protein_id gnl|my_center|LOCUS_20200 14727 15806 gene locus_tag LOCUS_20210 14727 15806 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185574.1 protein_id gnl|my_center|LOCUS_20210 17775 16135 gene locus_tag LOCUS_20220 17775 16135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919016.1 protein_id gnl|my_center|LOCUS_20220 18120 19652 gene locus_tag LOCUS_20230 18120 19652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 19991 23695 gene locus_tag LOCUS_20240 19991 23695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 23998 25410 gene locus_tag LOCUS_20250 23998 25410 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941505.1 protein_id gnl|my_center|LOCUS_20250 25641 27527 gene locus_tag LOCUS_20260 25641 27527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 27691 29907 gene locus_tag LOCUS_20270 27691 29907 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941801.1 protein_id gnl|my_center|LOCUS_20270 30113 30607 gene locus_tag LOCUS_20280 30113 30607 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941803.1 protein_id gnl|my_center|LOCUS_20280 31282 30806 gene locus_tag LOCUS_20290 31282 30806 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941779.1 protein_id gnl|my_center|LOCUS_20290 31421 32401 gene locus_tag LOCUS_20300 31421 32401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 32636 34012 gene locus_tag LOCUS_20310 32636 34012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 34028 35347 gene locus_tag LOCUS_20320 34028 35347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 36010 35342 gene locus_tag LOCUS_20330 36010 35342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 37481 36345 gene locus_tag LOCUS_20340 gene cydB 37481 36345 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786920.1 protein_id gnl|my_center|LOCUS_20340 39018 37483 gene locus_tag LOCUS_20350 39018 37483 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858826.1 protein_id gnl|my_center|LOCUS_20350 39254 39018 gene locus_tag LOCUS_20360 39254 39018 CDS product DUF4492 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786916.1 protein_id gnl|my_center|LOCUS_20360 40481 39432 gene locus_tag LOCUS_20370 40481 39432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 41379 40498 gene locus_tag LOCUS_20380 41379 40498 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_20380 41423 42676 gene locus_tag LOCUS_20390 41423 42676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 42853 43236 gene locus_tag LOCUS_20400 42853 43236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 43264 43584 gene locus_tag LOCUS_20410 43264 43584 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230139.1 protein_id gnl|my_center|LOCUS_20410 43581 43730 gene locus_tag LOCUS_20420 43581 43730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 43732 44628 gene locus_tag LOCUS_20430 43732 44628 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861239.1 protein_id gnl|my_center|LOCUS_20430 44653 45090 gene locus_tag LOCUS_20440 44653 45090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 46438 45092 gene locus_tag LOCUS_20450 46438 45092 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599076.1 protein_id gnl|my_center|LOCUS_20450 46602 46510 gene locus_tag LOCUS_t00210 46602 46510 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 46707 46622 gene locus_tag LOCUS_t00220 46707 46622 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 48182 46818 gene locus_tag LOCUS_20460 gene radA 48182 46818 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958217.1 protein_id gnl|my_center|LOCUS_20460 48448 48182 gene locus_tag LOCUS_20470 48448 48182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 48742 48891 gene locus_tag LOCUS_20480 48742 48891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 49517 48903 gene locus_tag LOCUS_20490 49517 48903 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869499.1 protein_id gnl|my_center|LOCUS_20490 52162 49514 gene locus_tag LOCUS_20500 52162 49514 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942226.1 protein_id gnl|my_center|LOCUS_20500 53134 52238 gene locus_tag LOCUS_20510 gene xerD 53134 52238 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390080.1 protein_id gnl|my_center|LOCUS_20510 53441 53244 gene locus_tag LOCUS_20520 gene rpsU 53441 53244 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941574.1 protein_id gnl|my_center|LOCUS_20520 54929 53532 gene locus_tag LOCUS_20530 54929 53532 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_20530 55001 55939 gene locus_tag LOCUS_20540 55001 55939 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937641.1 protein_id gnl|my_center|LOCUS_20540 56136 55942 gene locus_tag LOCUS_20550 56136 55942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 57439 56657 gene locus_tag LOCUS_20560 57439 56657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 59056 57788 gene locus_tag LOCUS_20570 gene serS 59056 57788 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545752.1 protein_id gnl|my_center|LOCUS_20570 60532 59063 gene locus_tag LOCUS_20580 60532 59063 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073207.1 protein_id gnl|my_center|LOCUS_20580 60846 61760 gene locus_tag LOCUS_20590 60846 61760 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058242.1 protein_id gnl|my_center|LOCUS_20590 >Feature sequence23 387 211 gene locus_tag LOCUS_20600 387 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 1243 512 gene locus_tag LOCUS_20610 1243 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 3234 1234 gene locus_tag LOCUS_20620 gene uvrB 3234 1234 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 protein_id gnl|my_center|LOCUS_20620 4207 3218 gene locus_tag LOCUS_20630 gene thiL 4207 3218 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_20630 6102 4309 gene locus_tag LOCUS_20640 gene ptsP 6102 4309 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942526.1 protein_id gnl|my_center|LOCUS_20640 6415 6143 gene locus_tag LOCUS_20650 6415 6143 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198013.1 protein_id gnl|my_center|LOCUS_20650 6729 6418 gene locus_tag LOCUS_20660 6729 6418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 7377 7958 gene locus_tag LOCUS_20670 7377 7958 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_20670 7968 8900 gene locus_tag LOCUS_20680 7968 8900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 8956 10386 gene locus_tag LOCUS_20690 8956 10386 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_20690 10458 10595 gene locus_tag LOCUS_20700 10458 10595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 11371 10742 gene locus_tag LOCUS_20710 11371 10742 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_20710 12147 11383 gene locus_tag LOCUS_20720 gene trpC 12147 11383 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943016.1 protein_id gnl|my_center|LOCUS_20720 13177 12137 gene locus_tag LOCUS_20730 gene trpD 13177 12137 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_20730 13993 13412 gene locus_tag LOCUS_20740 gene pabA 13993 13412 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602293.1 protein_id gnl|my_center|LOCUS_20740 15483 13999 gene locus_tag LOCUS_20750 gene trpE 15483 13999 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_20750 15946 15662 gene locus_tag LOCUS_20760 gene rpsT 15946 15662 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939182.1 protein_id gnl|my_center|LOCUS_20760 16241 17032 gene locus_tag LOCUS_20770 gene cdaA 16241 17032 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_20770 17005 17982 gene locus_tag LOCUS_20780 17005 17982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 18013 19362 gene locus_tag LOCUS_20790 gene glmM 18013 19362 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_20790 19362 20093 gene locus_tag LOCUS_20800 19362 20093 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_20800 20412 20879 gene locus_tag LOCUS_20810 20412 20879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 21533 21913 gene locus_tag LOCUS_20820 21533 21913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 21910 23229 gene locus_tag LOCUS_20830 21910 23229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 23667 24704 gene locus_tag LOCUS_20840 23667 24704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 24709 25311 gene locus_tag LOCUS_20850 24709 25311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 28309 25364 gene locus_tag LOCUS_20860 28309 25364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 28454 30139 gene locus_tag LOCUS_20870 28454 30139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 30156 31733 gene locus_tag LOCUS_20880 30156 31733 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941565.1 protein_id gnl|my_center|LOCUS_20880 32077 34359 gene locus_tag LOCUS_20890 32077 34359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 35770 34448 gene locus_tag LOCUS_20900 35770 34448 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_20900 36449 36183 gene locus_tag LOCUS_20910 36449 36183 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_20910 37516 38163 gene locus_tag LOCUS_20920 37516 38163 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_20920 38163 39500 gene locus_tag LOCUS_20930 gene trmFO 38163 39500 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943183.1 protein_id gnl|my_center|LOCUS_20930 39490 40296 gene locus_tag LOCUS_20940 39490 40296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 40660 43206 gene locus_tag LOCUS_20950 40660 43206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 44289 43219 gene locus_tag LOCUS_20960 44289 43219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 44625 45122 gene locus_tag LOCUS_20970 44625 45122 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943250.1 protein_id gnl|my_center|LOCUS_20970 47950 45401 gene locus_tag LOCUS_20980 47950 45401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 49080 47947 gene locus_tag LOCUS_20990 49080 47947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 49621 51402 gene locus_tag LOCUS_21000 gene pyk 49621 51402 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732565.1 protein_id gnl|my_center|LOCUS_21000 52230 51409 gene locus_tag LOCUS_21010 52230 51409 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_21010 52896 53321 gene locus_tag LOCUS_21020 52896 53321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 53512 55743 gene locus_tag LOCUS_21030 53512 55743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 55760 57316 gene locus_tag LOCUS_21040 55760 57316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 >Feature sequence24 253 759 gene locus_tag LOCUS_21050 253 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 1128 814 gene locus_tag LOCUS_21060 1128 814 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943430.1 protein_id gnl|my_center|LOCUS_21060 2446 1175 gene locus_tag LOCUS_21070 gene nifB 2446 1175 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933205.1 protein_id gnl|my_center|LOCUS_21070 3909 2554 gene locus_tag LOCUS_21080 3909 2554 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933204.1 protein_id gnl|my_center|LOCUS_21080 5350 3989 gene locus_tag LOCUS_21090 gene nifE 5350 3989 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787306.1 protein_id gnl|my_center|LOCUS_21090 5817 6407 gene locus_tag LOCUS_21100 5817 6407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 6560 7609 gene locus_tag LOCUS_21110 6560 7609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21110 7616 8305 gene locus_tag LOCUS_21120 7616 8305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21120 8890 8426 gene locus_tag LOCUS_21130 8890 8426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 9364 8915 gene locus_tag LOCUS_21140 9364 8915 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754241.1 protein_id gnl|my_center|LOCUS_21140 9689 9384 gene locus_tag LOCUS_21150 9689 9384 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176588.1 protein_id gnl|my_center|LOCUS_21150 11025 9847 gene locus_tag LOCUS_21160 gene nifB 11025 9847 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933205.1 protein_id gnl|my_center|LOCUS_21160 12599 11226 gene locus_tag LOCUS_21170 gene nifK 12599 11226 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933202.1 protein_id gnl|my_center|LOCUS_21170 14325 12679 gene locus_tag LOCUS_21180 gene nifD 14325 12679 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933201.1 protein_id gnl|my_center|LOCUS_21180 14716 14342 gene locus_tag LOCUS_21190 14716 14342 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933200.1 protein_id gnl|my_center|LOCUS_21190 15066 14713 gene locus_tag LOCUS_21200 15066 14713 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176592.1 protein_id gnl|my_center|LOCUS_21200 16023 15199 gene locus_tag LOCUS_21210 gene nifH 16023 15199 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176593.1 protein_id gnl|my_center|LOCUS_21210 16611 18218 gene locus_tag LOCUS_21220 16611 18218 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176720.1 protein_id gnl|my_center|LOCUS_21220 19417 18314 gene locus_tag LOCUS_21230 19417 18314 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787310.1 protein_id gnl|my_center|LOCUS_21230 19811 19431 gene locus_tag LOCUS_21240 19811 19431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 20982 19813 gene locus_tag LOCUS_21250 20982 19813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 20866 21111 gene locus_tag LOCUS_21260 20866 21111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 21905 21186 gene locus_tag LOCUS_21270 21905 21186 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811881.1 protein_id gnl|my_center|LOCUS_21270 22797 21997 gene locus_tag LOCUS_21280 22797 21997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546145.1 protein_id gnl|my_center|LOCUS_21280 24254 22974 gene locus_tag LOCUS_21290 gene amt 24254 22974 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707418.1 protein_id gnl|my_center|LOCUS_21290 24757 24419 gene locus_tag LOCUS_21300 gene glnB 24757 24419 CDS product nitrogen regulator P-II GlnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880011.1 protein_id gnl|my_center|LOCUS_21300 26171 25158 gene locus_tag LOCUS_21310 26171 25158 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791810.1 protein_id gnl|my_center|LOCUS_21310 27961 26174 gene locus_tag LOCUS_21320 27961 26174 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940448.1 protein_id gnl|my_center|LOCUS_21320 28172 28723 gene locus_tag LOCUS_21330 28172 28723 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439458.1 protein_id gnl|my_center|LOCUS_21330 29550 28765 gene locus_tag LOCUS_21340 gene rapZ 29550 28765 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942529.1 protein_id gnl|my_center|LOCUS_21340 30040 29621 gene locus_tag LOCUS_21350 30040 29621 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938921.1 protein_id gnl|my_center|LOCUS_21350 31571 30096 gene locus_tag LOCUS_21360 gene rpoN 31571 30096 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_21360 32392 31670 gene locus_tag LOCUS_21370 gene lptB 32392 31670 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047473.1 protein_id gnl|my_center|LOCUS_21370 32907 32392 gene locus_tag LOCUS_21380 gene lptA 32907 32392 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942534.1 protein_id gnl|my_center|LOCUS_21380 33230 34111 gene locus_tag LOCUS_21390 gene argB 33230 34111 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551508.1 protein_id gnl|my_center|LOCUS_21390 34123 35310 gene locus_tag LOCUS_21400 34123 35310 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_21400 35534 36541 gene locus_tag LOCUS_21410 gene argF 35534 36541 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940828.1 protein_id gnl|my_center|LOCUS_21410 36553 37755 gene locus_tag LOCUS_21420 36553 37755 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940829.1 protein_id gnl|my_center|LOCUS_21420 37814 39274 gene locus_tag LOCUS_21430 gene argH 37814 39274 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546455.1 protein_id gnl|my_center|LOCUS_21430 39277 40320 gene locus_tag LOCUS_21440 39277 40320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 40421 41608 gene locus_tag LOCUS_21450 gene lysA 40421 41608 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938936.1 protein_id gnl|my_center|LOCUS_21450 41617 42447 gene locus_tag LOCUS_21460 gene dapF 41617 42447 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939153.1 protein_id gnl|my_center|LOCUS_21460 42505 43389 gene locus_tag LOCUS_21470 gene dapA 42505 43389 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545135.1 protein_id gnl|my_center|LOCUS_21470 43504 44313 gene locus_tag LOCUS_21480 gene dapB 43504 44313 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_21480 44345 44839 gene locus_tag LOCUS_21490 gene folK 44345 44839 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762823.1 protein_id gnl|my_center|LOCUS_21490 44836 45105 gene locus_tag LOCUS_21500 44836 45105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 45102 45746 gene locus_tag LOCUS_21510 gene fsa 45102 45746 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544952.1 protein_id gnl|my_center|LOCUS_21510 45857 46393 gene locus_tag LOCUS_21520 45857 46393 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942470.1 protein_id gnl|my_center|LOCUS_21520 46418 46975 gene locus_tag LOCUS_21530 gene pgsA 46418 46975 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942469.1 protein_id gnl|my_center|LOCUS_21530 47211 48500 gene locus_tag LOCUS_21540 47211 48500 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943575.1 protein_id gnl|my_center|LOCUS_21540 48505 49251 gene locus_tag LOCUS_21550 48505 49251 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943576.1 protein_id gnl|my_center|LOCUS_21550 49529 50029 gene locus_tag LOCUS_21560 49529 50029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 50275 50361 gene locus_tag LOCUS_t00230 50275 50361 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 50677 53646 gene locus_tag LOCUS_21570 50677 53646 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058064.1 protein_id gnl|my_center|LOCUS_21570 54119 54919 gene locus_tag LOCUS_21580 54119 54919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 54916 55932 gene locus_tag LOCUS_21590 54916 55932 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035718.1 protein_id gnl|my_center|LOCUS_21590 55929 57065 gene locus_tag LOCUS_21600 55929 57065 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262887.1 protein_id gnl|my_center|LOCUS_21600 >Feature sequence25 2093 99 gene locus_tag LOCUS_21610 2093 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 2541 2101 gene locus_tag LOCUS_21620 2541 2101 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061215.1 protein_id gnl|my_center|LOCUS_21620 5333 2538 gene locus_tag LOCUS_21630 5333 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 7188 5674 gene locus_tag LOCUS_21640 7188 5674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 8916 9785 gene locus_tag LOCUS_21650 8916 9785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 12229 9995 gene locus_tag LOCUS_21660 12229 9995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 13188 12262 gene locus_tag LOCUS_21670 13188 12262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 15115 13229 gene locus_tag LOCUS_21680 15115 13229 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942091.1 protein_id gnl|my_center|LOCUS_21680 18363 15772 gene locus_tag LOCUS_21690 18363 15772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 19350 18382 gene locus_tag LOCUS_21700 gene trpX 19350 18382 CDS product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700783.1 protein_id gnl|my_center|LOCUS_21700 19800 20375 gene locus_tag LOCUS_21710 19800 20375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 22090 20576 gene locus_tag LOCUS_21720 22090 20576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 23354 22299 gene locus_tag LOCUS_21730 23354 22299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 24531 23722 gene locus_tag LOCUS_21740 gene epmA 24531 23722 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942397.1 protein_id gnl|my_center|LOCUS_21740 25178 24615 gene locus_tag LOCUS_21750 gene efp 25178 24615 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942396.1 protein_id gnl|my_center|LOCUS_21750 25653 25288 gene locus_tag LOCUS_21760 25653 25288 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939487.1 protein_id gnl|my_center|LOCUS_21760 26359 25736 gene locus_tag LOCUS_21770 26359 25736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 27354 26356 gene locus_tag LOCUS_21780 27354 26356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 30297 27646 gene locus_tag LOCUS_21790 gene pepN 30297 27646 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_21790 32579 30294 gene locus_tag LOCUS_21800 32579 30294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 33238 32738 gene locus_tag LOCUS_21810 33238 32738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 33503 33994 gene locus_tag LOCUS_21820 33503 33994 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037309.1 protein_id gnl|my_center|LOCUS_21820 34115 36301 gene locus_tag LOCUS_21830 34115 36301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 36689 38377 gene locus_tag LOCUS_21840 36689 38377 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940378.1 protein_id gnl|my_center|LOCUS_21840 38398 39660 gene locus_tag LOCUS_21850 38398 39660 CDS product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880611.1 protein_id gnl|my_center|LOCUS_21850 40128 41321 gene locus_tag LOCUS_21860 40128 41321 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680885.1 protein_id gnl|my_center|LOCUS_21860 41328 41639 gene locus_tag LOCUS_21870 gene yhbY 41328 41639 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004389225.1 protein_id gnl|my_center|LOCUS_21870 41718 42533 gene locus_tag LOCUS_21880 41718 42533 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665727.1 protein_id gnl|my_center|LOCUS_21880 42735 43520 gene locus_tag LOCUS_21890 gene surE 42735 43520 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545452.1 protein_id gnl|my_center|LOCUS_21890 44169 43903 gene locus_tag LOCUS_21900 44169 43903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 44288 45013 gene locus_tag LOCUS_21910 gene cmoA 44288 45013 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068374.1 protein_id gnl|my_center|LOCUS_21910 45017 45982 gene locus_tag LOCUS_21920 gene cmoB 45017 45982 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041216623.1 protein_id gnl|my_center|LOCUS_21920 47000 45966 gene locus_tag LOCUS_21930 47000 45966 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942867.1 protein_id gnl|my_center|LOCUS_21930 47296 46991 gene locus_tag LOCUS_21940 47296 46991 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942007.1 protein_id gnl|my_center|LOCUS_21940 47567 47298 gene locus_tag LOCUS_21950 47567 47298 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942006.1 protein_id gnl|my_center|LOCUS_21950 48415 47690 gene locus_tag LOCUS_21960 gene rnc 48415 47690 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354946.1 protein_id gnl|my_center|LOCUS_21960 48682 48757 gene locus_tag LOCUS_t00240 48682 48757 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 50219 49824 gene locus_tag LOCUS_21970 50219 49824 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_21970 50449 50216 gene locus_tag LOCUS_21980 50449 50216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 51348 50530 gene locus_tag LOCUS_21990 51348 50530 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932822.1 protein_id gnl|my_center|LOCUS_21990 52901 51360 gene locus_tag LOCUS_22000 52901 51360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 53457 53080 gene locus_tag LOCUS_22010 53457 53080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 54732 53929 gene locus_tag LOCUS_22020 54732 53929 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392302.1 protein_id gnl|my_center|LOCUS_22020 55477 54722 gene locus_tag LOCUS_22030 55477 54722 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545014.1 protein_id gnl|my_center|LOCUS_22030 >Feature sequence26 1393 341 gene locus_tag LOCUS_22040 gene coxFIC1 1393 341 CDS product Dot/Icm type IV secretion system effector CoxFIC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769896.1 protein_id gnl|my_center|LOCUS_22040 2860 1838 gene locus_tag LOCUS_22050 2860 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 3578 3502 gene locus_tag LOCUS_t00250 3578 3502 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4061 3669 gene locus_tag LOCUS_22060 4061 3669 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090655.1 protein_id gnl|my_center|LOCUS_22060 4498 4211 gene locus_tag LOCUS_22070 gene ihfA 4498 4211 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367042.1 protein_id gnl|my_center|LOCUS_22070 6927 4504 gene locus_tag LOCUS_22080 gene pheT 6927 4504 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_22080 7970 6954 gene locus_tag LOCUS_22090 gene pheS 7970 6954 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942166.1 protein_id gnl|my_center|LOCUS_22090 8502 8158 gene locus_tag LOCUS_22100 gene rplT 8502 8158 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942165.1 protein_id gnl|my_center|LOCUS_22100 8716 8519 gene locus_tag LOCUS_22110 gene rpmI 8716 8519 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942164.1 protein_id gnl|my_center|LOCUS_22110 9478 9011 gene locus_tag LOCUS_22120 gene infC 9478 9011 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_22120 11538 9619 gene locus_tag LOCUS_22130 gene thrS 11538 9619 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_22130 11728 11654 gene locus_tag LOCUS_t00260 11728 11654 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 13415 11835 gene locus_tag LOCUS_22140 13415 11835 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_22140 13305 13523 gene locus_tag LOCUS_22150 13305 13523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 14284 13685 gene locus_tag LOCUS_22160 gene recR 14284 13685 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_22160 14611 14291 gene locus_tag LOCUS_22170 14611 14291 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 protein_id gnl|my_center|LOCUS_22170 14567 14767 gene locus_tag LOCUS_22180 14567 14767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 16551 14770 gene locus_tag LOCUS_22190 gene dnaX 16551 14770 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_22190 16937 16850 gene locus_tag LOCUS_t00270 16937 16850 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 17477 17013 gene locus_tag LOCUS_22200 gene tadA 17477 17013 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810985.1 protein_id gnl|my_center|LOCUS_22200 18394 17477 gene locus_tag LOCUS_22210 gene trxB 18394 17477 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879051.1 protein_id gnl|my_center|LOCUS_22210 18720 21929 gene locus_tag LOCUS_22220 18720 21929 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943878.1 protein_id gnl|my_center|LOCUS_22220 21996 22484 gene locus_tag LOCUS_22230 21996 22484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 22508 22792 gene locus_tag LOCUS_22240 22508 22792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 23982 22807 gene locus_tag LOCUS_22250 23982 22807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 26456 24324 gene locus_tag LOCUS_22260 26456 24324 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939521.1 protein_id gnl|my_center|LOCUS_22260 28890 26503 gene locus_tag LOCUS_22270 28890 26503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 29669 28926 gene locus_tag LOCUS_22280 29669 28926 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941950.1 protein_id gnl|my_center|LOCUS_22280 30342 29839 gene locus_tag LOCUS_22290 30342 29839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 32713 30368 gene locus_tag LOCUS_22300 gene mrcB 32713 30368 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100154.1 protein_id gnl|my_center|LOCUS_22300 32841 34358 gene locus_tag LOCUS_22310 32841 34358 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940888.1 protein_id gnl|my_center|LOCUS_22310 34457 36097 gene locus_tag LOCUS_22320 34457 36097 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942735.1 protein_id gnl|my_center|LOCUS_22320 37265 36174 gene locus_tag LOCUS_22330 37265 36174 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941362.1 protein_id gnl|my_center|LOCUS_22330 37828 37334 gene locus_tag LOCUS_22340 37828 37334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 38957 37959 gene locus_tag LOCUS_22350 38957 37959 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942716.1 protein_id gnl|my_center|LOCUS_22350 40250 38967 gene locus_tag LOCUS_22360 40250 38967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 41781 40444 gene locus_tag LOCUS_22370 41781 40444 CDS product IPT/TIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942718.1 protein_id gnl|my_center|LOCUS_22370 42804 42178 gene locus_tag LOCUS_22380 42804 42178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 43769 43221 gene locus_tag LOCUS_22390 43769 43221 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736521.1 protein_id gnl|my_center|LOCUS_22390 44092 44541 gene locus_tag LOCUS_22400 44092 44541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 44813 47491 gene locus_tag LOCUS_22410 44813 47491 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793192.1 protein_id gnl|my_center|LOCUS_22410 47501 48157 gene locus_tag LOCUS_22420 47501 48157 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932570.1 protein_id gnl|my_center|LOCUS_22420 48301 49749 gene locus_tag LOCUS_22430 48301 49749 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121030.1 protein_id gnl|my_center|LOCUS_22430 50782 49766 gene locus_tag LOCUS_22440 50782 49766 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763737.1 protein_id gnl|my_center|LOCUS_22440 51845 50775 gene locus_tag LOCUS_22450 gene rlmN 51845 50775 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_22450 52741 51842 gene locus_tag LOCUS_22460 52741 51842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 53121 53321 gene locus_tag LOCUS_22470 53121 53321 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546429.1 protein_id gnl|my_center|LOCUS_22470 53405 55042 gene locus_tag LOCUS_22480 53405 55042 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940844.1 protein_id gnl|my_center|LOCUS_22480 55378 55178 gene locus_tag LOCUS_22490 55378 55178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 >Feature sequence27 904 482 gene locus_tag LOCUS_22500 904 482 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404325.1 protein_id gnl|my_center|LOCUS_22500 1143 901 gene locus_tag LOCUS_22510 1143 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 2688 1477 gene locus_tag LOCUS_22520 gene argJ 2688 1477 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942692.1 protein_id gnl|my_center|LOCUS_22520 5408 2868 gene locus_tag LOCUS_22530 gene secA 5408 2868 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938126.1 protein_id gnl|my_center|LOCUS_22530 5949 5488 gene locus_tag LOCUS_22540 5949 5488 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942702.1 protein_id gnl|my_center|LOCUS_22540 6588 5992 gene locus_tag LOCUS_22550 6588 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 8269 6593 gene locus_tag LOCUS_22560 gene argS 8269 6593 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403746.1 protein_id gnl|my_center|LOCUS_22560 9429 8281 gene locus_tag LOCUS_22570 gene alr 9429 8281 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_22570 9770 9426 gene locus_tag LOCUS_22580 9770 9426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 10457 10272 gene locus_tag LOCUS_22590 10457 10272 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940534.1 protein_id gnl|my_center|LOCUS_22590 10704 11063 gene locus_tag LOCUS_22600 10704 11063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 11142 11768 gene locus_tag LOCUS_22610 11142 11768 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941479.1 protein_id gnl|my_center|LOCUS_22610 11769 12740 gene locus_tag LOCUS_22620 11769 12740 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957343.1 protein_id gnl|my_center|LOCUS_22620 12743 13666 gene locus_tag LOCUS_22630 12743 13666 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088395.1 protein_id gnl|my_center|LOCUS_22630 13666 14808 gene locus_tag LOCUS_22640 13666 14808 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390877.1 protein_id gnl|my_center|LOCUS_22640 14960 15316 gene locus_tag LOCUS_22650 14960 15316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 16912 15512 gene locus_tag LOCUS_22660 gene cobB 16912 15512 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545628.1 protein_id gnl|my_center|LOCUS_22660 17257 17886 gene locus_tag LOCUS_22670 17257 17886 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393104.1 protein_id gnl|my_center|LOCUS_22670 17889 19025 gene locus_tag LOCUS_22680 17889 19025 CDS product PBS lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393103.1 protein_id gnl|my_center|LOCUS_22680 19313 19888 gene locus_tag LOCUS_22690 19313 19888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 20234 19980 gene locus_tag LOCUS_22700 20234 19980 CDS product dissimilatory sulfite reductase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393105.1 protein_id gnl|my_center|LOCUS_22700 21481 20351 gene locus_tag LOCUS_22710 gene dsrB 21481 20351 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393106.1 protein_id gnl|my_center|LOCUS_22710 22825 21545 gene locus_tag LOCUS_22720 gene dsrA 22825 21545 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937709.1 protein_id gnl|my_center|LOCUS_22720 23251 23081 gene locus_tag LOCUS_22730 23251 23081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 23522 23878 gene locus_tag LOCUS_22740 23522 23878 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942058.1 protein_id gnl|my_center|LOCUS_22740 24375 23980 gene locus_tag LOCUS_22750 24375 23980 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430159.1 protein_id gnl|my_center|LOCUS_22750 25379 24393 gene locus_tag LOCUS_22760 25379 24393 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942059.1 protein_id gnl|my_center|LOCUS_22760 25849 25439 gene locus_tag LOCUS_22770 25849 25439 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942060.1 protein_id gnl|my_center|LOCUS_22770 26237 27961 gene locus_tag LOCUS_22780 26237 27961 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940470.1 protein_id gnl|my_center|LOCUS_22780 27961 28815 gene locus_tag LOCUS_22790 27961 28815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 30577 29999 gene locus_tag LOCUS_22800 30577 29999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 30564 31769 gene locus_tag LOCUS_22810 30564 31769 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545925.1 protein_id gnl|my_center|LOCUS_22810 31878 32582 gene locus_tag LOCUS_22820 31878 32582 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074105.1 protein_id gnl|my_center|LOCUS_22820 32606 34003 gene locus_tag LOCUS_22830 32606 34003 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356901.1 protein_id gnl|my_center|LOCUS_22830 34807 34100 gene locus_tag LOCUS_22840 34807 34100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 35049 34864 gene locus_tag LOCUS_22850 35049 34864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 35170 36552 gene locus_tag LOCUS_22860 gene fliD 35170 36552 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704960.1 protein_id gnl|my_center|LOCUS_22860 39422 36642 gene locus_tag LOCUS_22870 39422 36642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 39877 40566 gene locus_tag LOCUS_22880 39877 40566 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941085.1 protein_id gnl|my_center|LOCUS_22880 40620 43103 gene locus_tag LOCUS_22890 40620 43103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 43220 45793 gene locus_tag LOCUS_22900 43220 45793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 46022 46612 gene locus_tag LOCUS_22910 46022 46612 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861377.1 protein_id gnl|my_center|LOCUS_22910 47929 47093 gene locus_tag LOCUS_22920 47929 47093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 48360 47929 gene locus_tag LOCUS_22930 48360 47929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 48768 49481 gene locus_tag LOCUS_22940 48768 49481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 50231 50521 gene locus_tag LOCUS_22950 50231 50521 CDS product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071642.1 protein_id gnl|my_center|LOCUS_22950 50509 50769 gene locus_tag LOCUS_22960 50509 50769 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071641.1 protein_id gnl|my_center|LOCUS_22960 52078 51269 gene locus_tag LOCUS_22970 52078 51269 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807710.1 protein_id gnl|my_center|LOCUS_22970 52269 52460 gene locus_tag LOCUS_22980 52269 52460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 52457 53254 gene locus_tag LOCUS_22990 52457 53254 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021804.1 protein_id gnl|my_center|LOCUS_22990 53334 54092 gene locus_tag LOCUS_23000 53334 54092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 >Feature sequence28 154 504 gene locus_tag LOCUS_23010 154 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 870 1079 gene locus_tag LOCUS_23020 870 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939510.1 protein_id gnl|my_center|LOCUS_23020 1205 2170 gene locus_tag LOCUS_23030 1205 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 3019 2447 gene locus_tag LOCUS_23040 3019 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 3659 3240 gene locus_tag LOCUS_23050 3659 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 5377 4544 gene locus_tag LOCUS_23060 5377 4544 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940762.1 protein_id gnl|my_center|LOCUS_23060 6418 5381 gene locus_tag LOCUS_23070 6418 5381 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392334.1 protein_id gnl|my_center|LOCUS_23070 7467 6421 gene locus_tag LOCUS_23080 7467 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 8122 7658 gene locus_tag LOCUS_23090 8122 7658 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940766.1 protein_id gnl|my_center|LOCUS_23090 11237 8214 gene locus_tag LOCUS_23100 11237 8214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 12705 11485 gene locus_tag LOCUS_23110 12705 11485 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939741.1 transl_except (pos:complement(11995..11997),aa:Sec) note codon on position 237 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_23110 12980 13864 gene locus_tag LOCUS_23120 12980 13864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 13882 14226 gene locus_tag LOCUS_23130 13882 14226 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258525.1 protein_id gnl|my_center|LOCUS_23130 14195 15310 gene locus_tag LOCUS_23140 14195 15310 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031587.1 protein_id gnl|my_center|LOCUS_23140 15274 16593 gene locus_tag LOCUS_23150 15274 16593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 16910 18052 gene locus_tag LOCUS_23160 16910 18052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791395.1 protein_id gnl|my_center|LOCUS_23160 18010 19650 gene locus_tag LOCUS_23170 18010 19650 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940548.1 protein_id gnl|my_center|LOCUS_23170 19768 22110 gene locus_tag LOCUS_23180 19768 22110 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940549.1 protein_id gnl|my_center|LOCUS_23180 22676 22224 gene locus_tag LOCUS_23190 22676 22224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 23313 22735 gene locus_tag LOCUS_23200 23313 22735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940532.1 protein_id gnl|my_center|LOCUS_23200 23547 23981 gene locus_tag LOCUS_23210 gene trxC 23547 23981 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 protein_id gnl|my_center|LOCUS_23210 24621 24064 gene locus_tag LOCUS_23220 24621 24064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 25805 24618 gene locus_tag LOCUS_23230 25805 24618 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_23230 26160 26387 gene locus_tag LOCUS_23240 26160 26387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 27642 26452 gene locus_tag LOCUS_23250 27642 26452 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068184.1 protein_id gnl|my_center|LOCUS_23250 29111 27957 gene locus_tag LOCUS_23260 29111 27957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 29576 29169 gene locus_tag LOCUS_23270 29576 29169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 29862 30527 gene locus_tag LOCUS_23280 29862 30527 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966848.1 protein_id gnl|my_center|LOCUS_23280 30535 31089 gene locus_tag LOCUS_23290 30535 31089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 31086 31604 gene locus_tag LOCUS_23300 31086 31604 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941913.1 protein_id gnl|my_center|LOCUS_23300 31617 31910 gene locus_tag LOCUS_23310 31617 31910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941914.1 protein_id gnl|my_center|LOCUS_23310 31922 33100 gene locus_tag LOCUS_23320 31922 33100 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941915.1 protein_id gnl|my_center|LOCUS_23320 33100 33789 gene locus_tag LOCUS_23330 33100 33789 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941916.1 protein_id gnl|my_center|LOCUS_23330 33987 35036 gene locus_tag LOCUS_23340 33987 35036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941917.1 protein_id gnl|my_center|LOCUS_23340 35060 35401 gene locus_tag LOCUS_23350 35060 35401 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810206.1 protein_id gnl|my_center|LOCUS_23350 35388 35903 gene locus_tag LOCUS_23360 35388 35903 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095369.1 protein_id gnl|my_center|LOCUS_23360 36036 37226 gene locus_tag LOCUS_23370 36036 37226 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967833.1 protein_id gnl|my_center|LOCUS_23370 37446 38306 gene locus_tag LOCUS_23380 37446 38306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 38308 41298 gene locus_tag LOCUS_23390 38308 41298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 41376 41813 gene locus_tag LOCUS_23400 41376 41813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 42015 42290 gene locus_tag LOCUS_23410 42015 42290 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957712.1 protein_id gnl|my_center|LOCUS_23410 42287 42613 gene locus_tag LOCUS_23420 42287 42613 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244108.1 protein_id gnl|my_center|LOCUS_23420 43880 42930 gene locus_tag LOCUS_23430 43880 42930 CDS product PA2778 family cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895637.1 protein_id gnl|my_center|LOCUS_23430 44310 43903 gene locus_tag LOCUS_23440 44310 43903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 45707 44502 gene locus_tag LOCUS_23450 gene dinB 45707 44502 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937382.1 protein_id gnl|my_center|LOCUS_23450 47376 45862 gene locus_tag LOCUS_23460 47376 45862 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975390.1 protein_id gnl|my_center|LOCUS_23460 47533 49077 gene locus_tag LOCUS_23470 47533 49077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 49084 49554 gene locus_tag LOCUS_23480 49084 49554 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393956.1 protein_id gnl|my_center|LOCUS_23480 50608 49790 gene locus_tag LOCUS_23490 50608 49790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 50700 51566 gene locus_tag LOCUS_23500 50700 51566 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112931.1 protein_id gnl|my_center|LOCUS_23500 51678 53498 gene locus_tag LOCUS_23510 51678 53498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 >Feature sequence29 494 2404 gene locus_tag LOCUS_23520 494 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 3465 2941 gene locus_tag LOCUS_23530 3465 2941 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868874.1 protein_id gnl|my_center|LOCUS_23530 4109 4783 gene locus_tag LOCUS_23540 4109 4783 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546873.1 protein_id gnl|my_center|LOCUS_23540 6019 4811 gene locus_tag LOCUS_23550 6019 4811 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176674.1 protein_id gnl|my_center|LOCUS_23550 6348 6025 gene locus_tag LOCUS_23560 6348 6025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 7532 6345 gene locus_tag LOCUS_23570 7532 6345 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176674.1 protein_id gnl|my_center|LOCUS_23570 8086 7529 gene locus_tag LOCUS_23580 8086 7529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 8382 8089 gene locus_tag LOCUS_23590 8382 8089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 9703 8402 gene locus_tag LOCUS_23600 gene chrA 9703 8402 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528002.1 protein_id gnl|my_center|LOCUS_23600 10720 9716 gene locus_tag LOCUS_23610 10720 9716 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176672.1 protein_id gnl|my_center|LOCUS_23610 10991 10800 gene locus_tag LOCUS_23620 10991 10800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 11581 13020 gene locus_tag LOCUS_23630 11581 13020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 12995 13645 gene locus_tag LOCUS_23640 12995 13645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 13912 14817 gene locus_tag LOCUS_23650 13912 14817 CDS product DmsE family decaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071905.1 protein_id gnl|my_center|LOCUS_23650 14831 17320 gene locus_tag LOCUS_23660 14831 17320 CDS product MtrB/PioB family decaheme-associated outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071899.1 protein_id gnl|my_center|LOCUS_23660 17634 18818 gene locus_tag LOCUS_23670 17634 18818 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870223.1 protein_id gnl|my_center|LOCUS_23670 19801 18839 gene locus_tag LOCUS_23680 19801 18839 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938071.1 protein_id gnl|my_center|LOCUS_23680 19883 20632 gene locus_tag LOCUS_23690 19883 20632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 21898 20654 gene locus_tag LOCUS_23700 21898 20654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 23121 22054 gene locus_tag LOCUS_23710 23121 22054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 23540 23118 gene locus_tag LOCUS_23720 23540 23118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 24202 23537 gene locus_tag LOCUS_23730 24202 23537 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202004.1 protein_id gnl|my_center|LOCUS_23730 25002 24406 gene locus_tag LOCUS_23740 25002 24406 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928704.1 protein_id gnl|my_center|LOCUS_23740 25556 25161 gene locus_tag LOCUS_23750 25556 25161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 27607 25709 gene locus_tag LOCUS_23760 gene pabB 27607 25709 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404430.1 protein_id gnl|my_center|LOCUS_23760 27914 28600 gene locus_tag LOCUS_23770 27914 28600 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940040.1 protein_id gnl|my_center|LOCUS_23770 30679 28664 gene locus_tag LOCUS_23780 30679 28664 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545662.1 protein_id gnl|my_center|LOCUS_23780 31179 30787 gene locus_tag LOCUS_23790 31179 30787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 32174 31329 gene locus_tag LOCUS_23800 gene ccsB 32174 31329 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941276.1 protein_id gnl|my_center|LOCUS_23800 33580 32243 gene locus_tag LOCUS_23810 33580 32243 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941275.1 protein_id gnl|my_center|LOCUS_23810 33943 34155 gene locus_tag LOCUS_23820 gene rpmB 33943 34155 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942874.1 protein_id gnl|my_center|LOCUS_23820 36422 34224 gene locus_tag LOCUS_23830 36422 34224 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_23830 38160 36439 gene locus_tag LOCUS_23840 38160 36439 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_23840 39302 38172 gene locus_tag LOCUS_23850 gene ispG 39302 38172 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629734.1 protein_id gnl|my_center|LOCUS_23850 39499 39696 gene locus_tag LOCUS_23860 39499 39696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 39693 40844 gene locus_tag LOCUS_23870 gene queA 39693 40844 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460358.1 protein_id gnl|my_center|LOCUS_23870 41541 41852 gene locus_tag LOCUS_23880 41541 41852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942705.1 protein_id gnl|my_center|LOCUS_23880 41852 42724 gene locus_tag LOCUS_23890 41852 42724 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942704.1 protein_id gnl|my_center|LOCUS_23890 42721 43659 gene locus_tag LOCUS_23900 42721 43659 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942703.1 protein_id gnl|my_center|LOCUS_23900 43967 44449 gene locus_tag LOCUS_23910 43967 44449 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939797.1 protein_id gnl|my_center|LOCUS_23910 44776 45570 gene locus_tag LOCUS_23920 gene murI 44776 45570 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_23920 45571 46233 gene locus_tag LOCUS_23930 gene lolA 45571 46233 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930946.1 protein_id gnl|my_center|LOCUS_23930 46302 48095 gene locus_tag LOCUS_23940 46302 48095 CDS product RiPP maturation radical SAM C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084777.1 protein_id gnl|my_center|LOCUS_23940 48110 48643 gene locus_tag LOCUS_23950 gene cobU 48110 48643 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938306.1 protein_id gnl|my_center|LOCUS_23950 48739 49797 gene locus_tag LOCUS_23960 gene cobD 48739 49797 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943619.1 protein_id gnl|my_center|LOCUS_23960 49816 50349 gene locus_tag LOCUS_23970 49816 50349 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250569.1 protein_id gnl|my_center|LOCUS_23970 50399 51604 gene locus_tag LOCUS_23980 gene rpsA 50399 51604 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941857.1 protein_id gnl|my_center|LOCUS_23980 51639 52220 gene locus_tag LOCUS_23990 51639 52220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 >Feature sequence30 311 934 gene locus_tag LOCUS_24000 311 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 2115 1093 gene locus_tag LOCUS_24010 2115 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 2577 2224 gene locus_tag LOCUS_24020 2577 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 2959 3612 gene locus_tag LOCUS_24030 2959 3612 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946775.1 protein_id gnl|my_center|LOCUS_24030 3615 6281 gene locus_tag LOCUS_24040 3615 6281 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 protein_id gnl|my_center|LOCUS_24040 6344 6883 gene locus_tag LOCUS_24050 6344 6883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 7039 7275 gene locus_tag LOCUS_24060 7039 7275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 7293 7946 gene locus_tag LOCUS_24070 7293 7946 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966090.1 protein_id gnl|my_center|LOCUS_24070 8090 8725 gene locus_tag LOCUS_24080 8090 8725 CDS product glycoside hydrolase family 19 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113192.1 protein_id gnl|my_center|LOCUS_24080 8858 10033 gene locus_tag LOCUS_24090 8858 10033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 10245 10895 gene locus_tag LOCUS_24100 10245 10895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 11405 11626 gene locus_tag LOCUS_24110 11405 11626 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391793.1 protein_id gnl|my_center|LOCUS_24110 11619 11840 gene locus_tag LOCUS_24120 11619 11840 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250461.1 protein_id gnl|my_center|LOCUS_24120 12362 13126 gene locus_tag LOCUS_24130 12362 13126 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453781.1 protein_id gnl|my_center|LOCUS_24130 13132 13893 gene locus_tag LOCUS_24140 13132 13893 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356704.1 protein_id gnl|my_center|LOCUS_24140 13918 15399 gene locus_tag LOCUS_24150 13918 15399 CDS product RimK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946128.1 protein_id gnl|my_center|LOCUS_24150 15393 16625 gene locus_tag LOCUS_24160 15393 16625 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444859.1 protein_id gnl|my_center|LOCUS_24160 16642 19110 gene locus_tag LOCUS_24170 16642 19110 CDS product DUF3536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393310.1 protein_id gnl|my_center|LOCUS_24170 21120 19132 gene locus_tag LOCUS_24180 21120 19132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 21755 21144 gene locus_tag LOCUS_24190 gene wrbA 21755 21144 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941470.1 protein_id gnl|my_center|LOCUS_24190 22337 21813 gene locus_tag LOCUS_24200 22337 21813 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_24200 23009 22596 gene locus_tag LOCUS_24210 23009 22596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 23822 23025 gene locus_tag LOCUS_24220 23822 23025 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940049.1 protein_id gnl|my_center|LOCUS_24220 24429 24031 gene locus_tag LOCUS_24230 gene mscL 24429 24031 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369434.1 protein_id gnl|my_center|LOCUS_24230 24827 24495 gene locus_tag LOCUS_24240 24827 24495 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255937.1 protein_id gnl|my_center|LOCUS_24240 26339 25104 gene locus_tag LOCUS_24250 gene nrfD 26339 25104 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940748.1 protein_id gnl|my_center|LOCUS_24250 27125 26355 gene locus_tag LOCUS_24260 27125 26355 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940747.1 protein_id gnl|my_center|LOCUS_24260 27595 27122 gene locus_tag LOCUS_24270 27595 27122 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940746.1 protein_id gnl|my_center|LOCUS_24270 28360 27623 gene locus_tag LOCUS_24280 28360 27623 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867364.1 protein_id gnl|my_center|LOCUS_24280 28937 28389 gene locus_tag LOCUS_24290 28937 28389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 28936 29097 gene locus_tag LOCUS_24300 28936 29097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 30101 30514 gene locus_tag LOCUS_24310 30101 30514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 30965 32074 gene locus_tag LOCUS_24320 30965 32074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 32507 32121 gene locus_tag LOCUS_24330 32507 32121 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207691809.1 protein_id gnl|my_center|LOCUS_24330 32964 32521 gene locus_tag LOCUS_24340 32964 32521 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770670.1 protein_id gnl|my_center|LOCUS_24340 33444 33199 gene locus_tag LOCUS_24350 33444 33199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 33634 33365 gene locus_tag LOCUS_24360 33634 33365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 33820 33638 gene locus_tag LOCUS_24370 33820 33638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 34347 33817 gene locus_tag LOCUS_24380 34347 33817 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_24380 34625 34344 gene locus_tag LOCUS_24390 34625 34344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24390 36103 34772 gene locus_tag LOCUS_24400 36103 34772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 37512 36133 gene locus_tag LOCUS_24410 37512 36133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 39719 37512 gene locus_tag LOCUS_24420 39719 37512 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_24420 40631 39720 gene locus_tag LOCUS_24430 40631 39720 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 protein_id gnl|my_center|LOCUS_24430 41081 40668 gene locus_tag LOCUS_24440 41081 40668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 42771 41368 gene locus_tag LOCUS_24450 42771 41368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 43288 42911 gene locus_tag LOCUS_24460 43288 42911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 43860 44585 gene locus_tag LOCUS_24470 43860 44585 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022907.1 protein_id gnl|my_center|LOCUS_24470 45238 44717 gene locus_tag LOCUS_24480 45238 44717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 46469 45240 gene locus_tag LOCUS_24490 gene nrfD 46469 45240 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320695.1 protein_id gnl|my_center|LOCUS_24490 47146 46472 gene locus_tag LOCUS_24500 47146 46472 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393407.1 protein_id gnl|my_center|LOCUS_24500 49680 47143 gene locus_tag LOCUS_24510 49680 47143 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935282.1 protein_id gnl|my_center|LOCUS_24510 49958 50338 gene locus_tag LOCUS_24520 49958 50338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938073.1 protein_id gnl|my_center|LOCUS_24520 >Feature sequence31 978 193 gene locus_tag LOCUS_24530 978 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 1634 1095 gene locus_tag LOCUS_24540 1634 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 2751 2362 gene locus_tag LOCUS_24550 2751 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 3290 3601 gene locus_tag LOCUS_24560 3290 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 4757 4353 gene locus_tag LOCUS_24570 4757 4353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 5249 4830 gene locus_tag LOCUS_24580 5249 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 5446 5246 gene locus_tag LOCUS_24590 5446 5246 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670205.1 protein_id gnl|my_center|LOCUS_24590 6051 5752 gene locus_tag LOCUS_24600 6051 5752 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259540.1 protein_id gnl|my_center|LOCUS_24600 6268 6032 gene locus_tag LOCUS_24610 6268 6032 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259539.1 protein_id gnl|my_center|LOCUS_24610 6940 6383 gene locus_tag LOCUS_24620 6940 6383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 7261 6974 gene locus_tag LOCUS_24630 7261 6974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 7348 7563 gene locus_tag LOCUS_24640 7348 7563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 7603 8388 gene locus_tag LOCUS_24650 7603 8388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 8391 9506 gene locus_tag LOCUS_24660 8391 9506 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118929.1 protein_id gnl|my_center|LOCUS_24660 10877 9810 gene locus_tag LOCUS_24670 10877 9810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 12249 10999 gene locus_tag LOCUS_24680 12249 10999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 13160 12261 gene locus_tag LOCUS_24690 13160 12261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 14620 13316 gene locus_tag LOCUS_24700 14620 13316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 14781 14617 gene locus_tag LOCUS_24710 14781 14617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 15733 14756 gene locus_tag LOCUS_24720 15733 14756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 16128 15730 gene locus_tag LOCUS_24730 16128 15730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 16669 16283 gene locus_tag LOCUS_24740 16669 16283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 17256 16678 gene locus_tag LOCUS_24750 17256 16678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 18217 17273 gene locus_tag LOCUS_24760 18217 17273 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106775453.1 protein_id gnl|my_center|LOCUS_24760 19544 18933 gene locus_tag LOCUS_24770 19544 18933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 20315 19857 gene locus_tag LOCUS_24780 20315 19857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 20500 20769 gene locus_tag LOCUS_24790 20500 20769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 21492 20920 gene locus_tag LOCUS_24800 21492 20920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 21621 22622 gene locus_tag LOCUS_24810 21621 22622 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_24810 22800 26858 gene locus_tag LOCUS_24820 22800 26858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 27277 29385 gene locus_tag LOCUS_24830 gene bamA 27277 29385 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_24830 30745 29513 gene locus_tag LOCUS_24840 30745 29513 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390206.1 protein_id gnl|my_center|LOCUS_24840 33314 30969 gene locus_tag LOCUS_24850 33314 30969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 33905 35254 gene locus_tag LOCUS_24860 33905 35254 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880416.1 protein_id gnl|my_center|LOCUS_24860 35450 36574 gene locus_tag LOCUS_24870 35450 36574 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941060.1 protein_id gnl|my_center|LOCUS_24870 36571 39774 gene locus_tag LOCUS_24880 36571 39774 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941062.1 protein_id gnl|my_center|LOCUS_24880 39809 40876 gene locus_tag LOCUS_24890 39809 40876 CDS product ABC transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176666.1 protein_id gnl|my_center|LOCUS_24890 40876 43539 gene locus_tag LOCUS_24900 40876 43539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 43577 44005 gene locus_tag LOCUS_24910 43577 44005 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941201.1 protein_id gnl|my_center|LOCUS_24910 44711 44469 gene locus_tag LOCUS_24920 44711 44469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 >Feature sequence32 152 463 gene locus_tag LOCUS_24930 gene rpsJ 152 463 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943487.1 protein_id gnl|my_center|LOCUS_24930 496 1125 gene locus_tag LOCUS_24940 gene rplC 496 1125 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943486.1 protein_id gnl|my_center|LOCUS_24940 1147 1770 gene locus_tag LOCUS_24950 gene rplD 1147 1770 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938599.1 protein_id gnl|my_center|LOCUS_24950 1767 2057 gene locus_tag LOCUS_24960 gene rplW 1767 2057 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546250.1 protein_id gnl|my_center|LOCUS_24960 2103 2927 gene locus_tag LOCUS_24970 gene rplB 2103 2927 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943483.1 protein_id gnl|my_center|LOCUS_24970 2942 3217 gene locus_tag LOCUS_24980 gene rpsS 2942 3217 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943482.1 protein_id gnl|my_center|LOCUS_24980 3251 3583 gene locus_tag LOCUS_24990 gene rplV 3251 3583 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003486710.1 protein_id gnl|my_center|LOCUS_24990 3668 4315 gene locus_tag LOCUS_25000 gene rpsC 3668 4315 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_25000 4433 4849 gene locus_tag LOCUS_25010 gene rplP 4433 4849 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943479.1 protein_id gnl|my_center|LOCUS_25010 4846 5040 gene locus_tag LOCUS_25020 gene rpmC 4846 5040 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943478.1 protein_id gnl|my_center|LOCUS_25020 5091 5357 gene locus_tag LOCUS_25030 gene rpsQ 5091 5357 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943477.1 protein_id gnl|my_center|LOCUS_25030 5452 5820 gene locus_tag LOCUS_25040 gene rplN 5452 5820 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722508.1 protein_id gnl|my_center|LOCUS_25040 5895 6230 gene locus_tag LOCUS_25050 gene rplX 5895 6230 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187422288.1 protein_id gnl|my_center|LOCUS_25050 6257 6796 gene locus_tag LOCUS_25060 gene rplE 6257 6796 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_25060 7050 7448 gene locus_tag LOCUS_25070 gene rpsH 7050 7448 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567538.1 protein_id gnl|my_center|LOCUS_25070 7539 8075 gene locus_tag LOCUS_25080 gene rplF 7539 8075 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943471.1 protein_id gnl|my_center|LOCUS_25080 8114 8479 gene locus_tag LOCUS_25090 gene rplR 8114 8479 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225816.1 protein_id gnl|my_center|LOCUS_25090 8535 9041 gene locus_tag LOCUS_25100 gene rpsE 8535 9041 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943469.1 protein_id gnl|my_center|LOCUS_25100 9130 9327 gene locus_tag LOCUS_25110 gene rpmD 9130 9327 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720933.1 protein_id gnl|my_center|LOCUS_25110 9327 9767 gene locus_tag LOCUS_25120 gene rplO 9327 9767 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943467.1 protein_id gnl|my_center|LOCUS_25120 9780 11090 gene locus_tag LOCUS_25130 gene secY 9780 11090 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_25130 11107 11874 gene locus_tag LOCUS_25140 gene map 11107 11874 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943464.1 protein_id gnl|my_center|LOCUS_25140 12037 12270 gene locus_tag LOCUS_25150 gene infA 12037 12270 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040194.1 protein_id gnl|my_center|LOCUS_25150 12427 12795 gene locus_tag LOCUS_25160 gene rpsM 12427 12795 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943462.1 protein_id gnl|my_center|LOCUS_25160 12840 13229 gene locus_tag LOCUS_25170 gene rpsK 12840 13229 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810114.1 protein_id gnl|my_center|LOCUS_25170 13432 13920 gene locus_tag LOCUS_25180 gene rpsD 13432 13920 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943460.1 protein_id gnl|my_center|LOCUS_25180 13971 15032 gene locus_tag LOCUS_25190 13971 15032 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_25190 15045 15431 gene locus_tag LOCUS_25200 15045 15431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 15729 15941 gene locus_tag LOCUS_25210 15729 15941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 16254 16454 gene locus_tag LOCUS_25220 gene cspC 16254 16454 CDS product cold shock protein CspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001990088.1 protein_id gnl|my_center|LOCUS_25220 17826 16528 gene locus_tag LOCUS_25230 17826 16528 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942374.1 protein_id gnl|my_center|LOCUS_25230 18603 17857 gene locus_tag LOCUS_25240 18603 17857 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942375.1 protein_id gnl|my_center|LOCUS_25240 19360 18596 gene locus_tag LOCUS_25250 19360 18596 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142277.1 protein_id gnl|my_center|LOCUS_25250 20447 19383 gene locus_tag LOCUS_25260 20447 19383 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942377.1 protein_id gnl|my_center|LOCUS_25260 21337 20447 gene locus_tag LOCUS_25270 21337 20447 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942378.1 protein_id gnl|my_center|LOCUS_25270 22645 21446 gene locus_tag LOCUS_25280 22645 21446 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942379.1 protein_id gnl|my_center|LOCUS_25280 23147 22716 gene locus_tag LOCUS_25290 23147 22716 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942381.1 protein_id gnl|my_center|LOCUS_25290 24513 23212 gene locus_tag LOCUS_25300 24513 23212 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942382.1 protein_id gnl|my_center|LOCUS_25300 25119 24541 gene locus_tag LOCUS_25310 25119 24541 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942383.1 protein_id gnl|my_center|LOCUS_25310 26930 25116 gene locus_tag LOCUS_25320 gene iorA 26930 25116 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942384.1 protein_id gnl|my_center|LOCUS_25320 27312 29612 gene locus_tag LOCUS_25330 27312 29612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 29609 33037 gene locus_tag LOCUS_25340 29609 33037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 33227 33868 gene locus_tag LOCUS_25350 gene thiF 33227 33868 CDS product sulfur carrier protein ThiS adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966206.1 protein_id gnl|my_center|LOCUS_25350 33906 34307 gene locus_tag LOCUS_25360 33906 34307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 34461 34661 gene locus_tag LOCUS_25370 34461 34661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 34663 35430 gene locus_tag LOCUS_25380 34663 35430 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945667.1 protein_id gnl|my_center|LOCUS_25380 35447 36592 gene locus_tag LOCUS_25390 gene thiH 35447 36592 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962602.1 protein_id gnl|my_center|LOCUS_25390 36612 37907 gene locus_tag LOCUS_25400 36612 37907 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791443.1 protein_id gnl|my_center|LOCUS_25400 38041 38754 gene locus_tag LOCUS_25410 38041 38754 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_25410 38918 40138 gene locus_tag LOCUS_25420 38918 40138 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021679.1 protein_id gnl|my_center|LOCUS_25420 40131 41354 gene locus_tag LOCUS_25430 40131 41354 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261735.1 protein_id gnl|my_center|LOCUS_25430 41354 42049 gene locus_tag LOCUS_25440 41354 42049 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482754.1 protein_id gnl|my_center|LOCUS_25440 42033 42995 gene locus_tag LOCUS_25450 42033 42995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 43810 43100 gene locus_tag LOCUS_25460 43810 43100 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_25460 44811 43807 gene locus_tag LOCUS_25470 44811 43807 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615838.1 protein_id gnl|my_center|LOCUS_25470 >Feature sequence33 314 2851 gene locus_tag LOCUS_25480 314 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 3044 4030 gene locus_tag LOCUS_25490 3044 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 4055 5488 gene locus_tag LOCUS_25500 4055 5488 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022613.1 protein_id gnl|my_center|LOCUS_25500 5509 5877 gene locus_tag LOCUS_25510 5509 5877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 7135 6104 gene locus_tag LOCUS_25520 7135 6104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 7459 8604 gene locus_tag LOCUS_25530 7459 8604 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545883.1 protein_id gnl|my_center|LOCUS_25530 8772 9227 gene locus_tag LOCUS_25540 8772 9227 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941021.1 protein_id gnl|my_center|LOCUS_25540 9235 11277 gene locus_tag LOCUS_25550 9235 11277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 12113 11355 gene locus_tag LOCUS_25560 12113 11355 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545091.1 protein_id gnl|my_center|LOCUS_25560 13066 12110 gene locus_tag LOCUS_25570 13066 12110 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810478.1 protein_id gnl|my_center|LOCUS_25570 14667 13063 gene locus_tag LOCUS_25580 14667 13063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 15248 14718 gene locus_tag LOCUS_25590 15248 14718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 15407 15772 gene locus_tag LOCUS_25600 15407 15772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 17645 15810 gene locus_tag LOCUS_25610 17645 15810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 18283 19434 gene locus_tag LOCUS_25620 18283 19434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 19851 19501 gene locus_tag LOCUS_25630 19851 19501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 20007 23030 gene locus_tag LOCUS_25640 20007 23030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 25645 23090 gene locus_tag LOCUS_25650 gene hrpB 25645 23090 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405451.1 protein_id gnl|my_center|LOCUS_25650 27006 25654 gene locus_tag LOCUS_25660 27006 25654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 27535 29358 gene locus_tag LOCUS_25670 27535 29358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 29558 29406 gene locus_tag LOCUS_25680 29558 29406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 29683 30288 gene locus_tag LOCUS_25690 29683 30288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 30355 30837 gene locus_tag LOCUS_25700 30355 30837 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940509.1 protein_id gnl|my_center|LOCUS_25700 31158 31640 gene locus_tag LOCUS_25710 31158 31640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 31705 32154 gene locus_tag LOCUS_25720 31705 32154 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_25720 32269 32661 gene locus_tag LOCUS_25730 32269 32661 CDS product HIRAN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940728.1 protein_id gnl|my_center|LOCUS_25730 32802 33776 gene locus_tag LOCUS_25740 32802 33776 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940727.1 protein_id gnl|my_center|LOCUS_25740 34020 34178 gene locus_tag LOCUS_25750 34020 34178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 35109 36629 gene locus_tag LOCUS_25760 35109 36629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 36643 37347 gene locus_tag LOCUS_25770 gene cas5c 36643 37347 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205009051.1 protein_id gnl|my_center|LOCUS_25770 37344 39371 gene locus_tag LOCUS_25780 37344 39371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 39390 40250 gene locus_tag LOCUS_25790 gene cas7c 39390 40250 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922510.1 protein_id gnl|my_center|LOCUS_25790 40289 40975 gene locus_tag LOCUS_25800 40289 40975 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_25800 40990 41832 gene locus_tag LOCUS_25810 40990 41832 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_25810 41986 42987 gene locus_tag LOCUS_25820 gene rhuM 41986 42987 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_25820 43401 43012 gene locus_tag LOCUS_25830 43401 43012 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403014.1 protein_id gnl|my_center|LOCUS_25830 43651 43388 gene locus_tag LOCUS_25840 43651 43388 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965479.1 protein_id gnl|my_center|LOCUS_25840 43736 44377 gene locus_tag LOCUS_25850 gene cas4 43736 44377 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932803.1 protein_id gnl|my_center|LOCUS_25850 44374 45405 gene locus_tag LOCUS_25860 gene cas1c 44374 45405 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_25860 45411 45701 gene locus_tag LOCUS_25870 gene cas2 45411 45701 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787408.1 protein_id gnl|my_center|LOCUS_25870 45886 >46307 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgccccctgcacgggggcgtggattgaaac >Feature sequence34 430 1986 gene locus_tag LOCUS_25880 430 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 2915 2019 gene locus_tag LOCUS_25890 2915 2019 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942133.1 protein_id gnl|my_center|LOCUS_25890 2823 3035 gene locus_tag LOCUS_25900 2823 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 3112 3198 gene locus_tag LOCUS_t00280 3112 3198 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3499 3906 gene locus_tag LOCUS_25910 3499 3906 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941070.1 protein_id gnl|my_center|LOCUS_25910 4195 4872 gene locus_tag LOCUS_25920 4195 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 5200 6897 gene locus_tag LOCUS_25930 5200 6897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 7042 7932 gene locus_tag LOCUS_25940 7042 7932 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942309.1 protein_id gnl|my_center|LOCUS_25940 8066 9184 gene locus_tag LOCUS_25950 gene hflK 8066 9184 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_25950 9196 10128 gene locus_tag LOCUS_25960 gene hflC 9196 10128 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678885.1 protein_id gnl|my_center|LOCUS_25960 10788 10132 gene locus_tag LOCUS_25970 10788 10132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 11474 10785 gene locus_tag LOCUS_25980 gene thiE 11474 10785 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436488.1 protein_id gnl|my_center|LOCUS_25980 11820 13127 gene locus_tag LOCUS_25990 11820 13127 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326127.1 protein_id gnl|my_center|LOCUS_25990 13755 13339 gene locus_tag LOCUS_26000 13755 13339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 13708 14217 gene locus_tag LOCUS_26010 13708 14217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 14448 14242 gene locus_tag LOCUS_26020 14448 14242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 14604 15908 gene locus_tag LOCUS_26030 14604 15908 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940793.1 protein_id gnl|my_center|LOCUS_26030 16769 15987 gene locus_tag LOCUS_26040 16769 15987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 17096 17647 gene locus_tag LOCUS_26050 gene grpE 17096 17647 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706782.1 protein_id gnl|my_center|LOCUS_26050 17703 19640 gene locus_tag LOCUS_26060 gene dnaK 17703 19640 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_26060 19780 20745 gene locus_tag LOCUS_26070 gene trpS 19780 20745 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858719.1 protein_id gnl|my_center|LOCUS_26070 21445 22461 gene locus_tag LOCUS_26080 21445 22461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 22618 23799 gene locus_tag LOCUS_26090 22618 23799 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009918143.1 protein_id gnl|my_center|LOCUS_26090 24167 26758 gene locus_tag LOCUS_26100 gene clpB 24167 26758 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941319.1 protein_id gnl|my_center|LOCUS_26100 26774 27295 gene locus_tag LOCUS_26110 26774 27295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 28658 27429 gene locus_tag LOCUS_26120 28658 27429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 28931 28734 gene locus_tag LOCUS_26130 28931 28734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 28887 29921 gene locus_tag LOCUS_26140 28887 29921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 29921 30541 gene locus_tag LOCUS_26150 29921 30541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 30746 30982 gene locus_tag LOCUS_26160 30746 30982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 31106 31348 gene locus_tag LOCUS_26170 31106 31348 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939842.1 protein_id gnl|my_center|LOCUS_26170 31358 33559 gene locus_tag LOCUS_26180 gene feoB 31358 33559 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939841.1 protein_id gnl|my_center|LOCUS_26180 35312 33627 gene locus_tag LOCUS_26190 gene ettA 35312 33627 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_26190 37272 35620 gene locus_tag LOCUS_26200 37272 35620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 38599 37289 gene locus_tag LOCUS_26210 38599 37289 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202873.1 protein_id gnl|my_center|LOCUS_26210 38489 38710 gene locus_tag LOCUS_26220 38489 38710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 38843 39004 gene locus_tag LOCUS_26230 38843 39004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 39244 40902 gene locus_tag LOCUS_26240 gene sbtM 39244 40902 CDS product thio(seleno)oxazole modification radical SAM maturase SbtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045007.1 protein_id gnl|my_center|LOCUS_26240 43626 40906 gene locus_tag LOCUS_26250 43626 40906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 44667 43657 gene locus_tag LOCUS_26260 44667 43657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 >Feature sequence35 1026 169 gene locus_tag LOCUS_26270 1026 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 1333 1169 gene locus_tag LOCUS_26280 1333 1169 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092374840.1 protein_id gnl|my_center|LOCUS_26280 2439 1342 gene locus_tag LOCUS_26290 2439 1342 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331459.1 protein_id gnl|my_center|LOCUS_26290 2820 2476 gene locus_tag LOCUS_26300 2820 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 2960 3307 gene locus_tag LOCUS_26310 2960 3307 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943583.1 protein_id gnl|my_center|LOCUS_26310 3346 4434 gene locus_tag LOCUS_26320 gene arsB 3346 4434 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826560.1 protein_id gnl|my_center|LOCUS_26320 4431 5225 gene locus_tag LOCUS_26330 4431 5225 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289730.1 protein_id gnl|my_center|LOCUS_26330 5303 5764 gene locus_tag LOCUS_26340 5303 5764 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933002.1 protein_id gnl|my_center|LOCUS_26340 5761 6891 gene locus_tag LOCUS_26350 5761 6891 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545564.1 protein_id gnl|my_center|LOCUS_26350 7760 6957 gene locus_tag LOCUS_26360 7760 6957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 7990 7808 gene locus_tag LOCUS_26370 7990 7808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 8261 7938 gene locus_tag LOCUS_26380 8261 7938 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 protein_id gnl|my_center|LOCUS_26380 8512 8252 gene locus_tag LOCUS_26390 8512 8252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 8997 9302 gene locus_tag LOCUS_26400 8997 9302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 9315 9842 gene locus_tag LOCUS_26410 9315 9842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 9876 10337 gene locus_tag LOCUS_26420 9876 10337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 10609 10521 gene locus_tag LOCUS_t00290 10609 10521 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11425 12513 gene locus_tag LOCUS_26430 11425 12513 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942347.1 protein_id gnl|my_center|LOCUS_26430 12712 13953 gene locus_tag LOCUS_26440 12712 13953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 14822 13968 gene locus_tag LOCUS_26450 14822 13968 CDS product UbiA-like polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205587.1 protein_id gnl|my_center|LOCUS_26450 15378 14815 gene locus_tag LOCUS_26460 15378 14815 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868085.1 protein_id gnl|my_center|LOCUS_26460 16082 15375 gene locus_tag LOCUS_26470 16082 15375 CDS product ubiquinone/menaquinone biosynthesis methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940432.1 protein_id gnl|my_center|LOCUS_26470 17050 16223 gene locus_tag LOCUS_26480 17050 16223 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942660.1 protein_id gnl|my_center|LOCUS_26480 18239 17064 gene locus_tag LOCUS_26490 18239 17064 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940160.1 protein_id gnl|my_center|LOCUS_26490 19303 18248 gene locus_tag LOCUS_26500 gene mqnC 19303 18248 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940023.1 protein_id gnl|my_center|LOCUS_26500 20577 19477 gene locus_tag LOCUS_26510 gene mqnE 20577 19477 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393346.1 protein_id gnl|my_center|LOCUS_26510 21294 20593 gene locus_tag LOCUS_26520 21294 20593 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258572.1 protein_id gnl|my_center|LOCUS_26520 21513 23141 gene locus_tag LOCUS_26530 21513 23141 CDS product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091675.1 protein_id gnl|my_center|LOCUS_26530 23463 24614 gene locus_tag LOCUS_26540 gene arnB 23463 24614 CDS product UDP-4-amino-4-deoxy-L-arabinose aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112882.1 protein_id gnl|my_center|LOCUS_26540 24611 25684 gene locus_tag LOCUS_26550 gene arnC 24611 25684 CDS product undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704926.1 protein_id gnl|my_center|LOCUS_26550 25707 27692 gene locus_tag LOCUS_26560 gene arnA 25707 27692 CDS product bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704925.1 protein_id gnl|my_center|LOCUS_26560 27689 28594 gene locus_tag LOCUS_26570 gene arnD 27689 28594 CDS product 4-deoxy-4-formamido-L-arabinose-phosphoundecaprenol deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267893.1 protein_id gnl|my_center|LOCUS_26570 28596 30308 gene locus_tag LOCUS_26580 28596 30308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 30320 32011 gene locus_tag LOCUS_26590 gene arnT 30320 32011 CDS product lipid IV(A) 4-amino-4-deoxy-L-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703729.1 protein_id gnl|my_center|LOCUS_26590 32054 32425 gene locus_tag LOCUS_26600 32054 32425 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192320.1 protein_id gnl|my_center|LOCUS_26600 32443 33120 gene locus_tag LOCUS_26610 32443 33120 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083233.1 protein_id gnl|my_center|LOCUS_26610 33117 34517 gene locus_tag LOCUS_26620 33117 34517 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 protein_id gnl|my_center|LOCUS_26620 35485 34541 gene locus_tag LOCUS_26630 35485 34541 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377275.1 protein_id gnl|my_center|LOCUS_26630 35783 35634 gene locus_tag LOCUS_26640 35783 35634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 37989 35731 gene locus_tag LOCUS_26650 37989 35731 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942516.1 protein_id gnl|my_center|LOCUS_26650 38939 38283 gene locus_tag LOCUS_26660 38939 38283 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030700.1 protein_id gnl|my_center|LOCUS_26660 40964 39093 gene locus_tag LOCUS_26670 40964 39093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 41194 42330 gene locus_tag LOCUS_26680 41194 42330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 42451 42858 gene locus_tag LOCUS_26690 42451 42858 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_26690 43359 43207 gene locus_tag LOCUS_26700 43359 43207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 43580 43356 gene locus_tag LOCUS_26710 43580 43356 CDS product addiction module protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986787.1 protein_id gnl|my_center|LOCUS_26710 >Feature sequence36 2184 1135 gene locus_tag LOCUS_26720 2184 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 2705 2307 gene locus_tag LOCUS_26730 2705 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 3163 5838 gene locus_tag LOCUS_26740 3163 5838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 5927 6940 gene locus_tag LOCUS_26750 5927 6940 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064836.1 protein_id gnl|my_center|LOCUS_26750 7170 7694 gene locus_tag LOCUS_26760 7170 7694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 7764 7952 gene locus_tag LOCUS_26770 7764 7952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 16534 7928 gene locus_tag LOCUS_26780 16534 7928 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994041.1 protein_id gnl|my_center|LOCUS_26780 17535 16987 gene locus_tag LOCUS_26790 17535 16987 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964078.1 protein_id gnl|my_center|LOCUS_26790 18003 20690 gene locus_tag LOCUS_26800 18003 20690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 21774 20908 gene locus_tag LOCUS_26810 21774 20908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 21988 23361 gene locus_tag LOCUS_26820 21988 23361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 23405 24286 gene locus_tag LOCUS_26830 23405 24286 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073870.1 protein_id gnl|my_center|LOCUS_26830 24933 24313 gene locus_tag LOCUS_26840 24933 24313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 26514 25030 gene locus_tag LOCUS_26850 26514 25030 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891943.1 protein_id gnl|my_center|LOCUS_26850 27760 26723 gene locus_tag LOCUS_26860 27760 26723 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403121.1 protein_id gnl|my_center|LOCUS_26860 28506 27757 gene locus_tag LOCUS_26870 28506 27757 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403122.1 protein_id gnl|my_center|LOCUS_26870 29663 28509 gene locus_tag LOCUS_26880 29663 28509 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403123.1 protein_id gnl|my_center|LOCUS_26880 30091 32727 gene locus_tag LOCUS_26890 30091 32727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 34560 32734 gene locus_tag LOCUS_26900 34560 32734 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257959.1 protein_id gnl|my_center|LOCUS_26900 36333 34567 gene locus_tag LOCUS_26910 36333 34567 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583044.1 protein_id gnl|my_center|LOCUS_26910 37459 36350 gene locus_tag LOCUS_26920 37459 36350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 39291 37576 gene locus_tag LOCUS_26930 39291 37576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 <40025 39308 gene locus_tag LOCUS_26940 <40025 39308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941598.1:rhodanese-like domain-containing protein >Feature sequence37 784 287 gene locus_tag LOCUS_26950 784 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 723 989 gene locus_tag LOCUS_26960 723 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 1598 1110 gene locus_tag LOCUS_26970 1598 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 3795 2563 gene locus_tag LOCUS_26980 3795 2563 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927132.1 protein_id gnl|my_center|LOCUS_26980 4555 6552 gene locus_tag LOCUS_26990 4555 6552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 7845 6874 gene locus_tag LOCUS_27000 gene dmeF 7845 6874 CDS product CDF family Co(II)/Ni(II) efflux transporter DmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477256.1 protein_id gnl|my_center|LOCUS_27000 9059 7863 gene locus_tag LOCUS_27010 9059 7863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 11493 9190 gene locus_tag LOCUS_27020 gene feoB 11493 9190 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939841.1 protein_id gnl|my_center|LOCUS_27020 11830 11516 gene locus_tag LOCUS_27030 11830 11516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 12491 12078 gene locus_tag LOCUS_27040 12491 12078 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072119.1 protein_id gnl|my_center|LOCUS_27040 13172 12723 gene locus_tag LOCUS_27050 13172 12723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 14139 13231 gene locus_tag LOCUS_27060 14139 13231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 14394 14158 gene locus_tag LOCUS_27070 14394 14158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 14954 14556 gene locus_tag LOCUS_27080 14954 14556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27080 15000 15194 gene locus_tag LOCUS_27090 15000 15194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 15611 15408 gene locus_tag LOCUS_27100 15611 15408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 17253 15649 gene locus_tag LOCUS_27110 gene pckA 17253 15649 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393393.1 protein_id gnl|my_center|LOCUS_27110 18011 17430 gene locus_tag LOCUS_27120 18011 17430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 18714 18289 gene locus_tag LOCUS_27130 gene merR 18714 18289 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429838.1 protein_id gnl|my_center|LOCUS_27130 19121 18711 gene locus_tag LOCUS_27140 19121 18711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 19497 19306 gene locus_tag LOCUS_27150 19497 19306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 19787 21004 gene locus_tag LOCUS_27160 19787 21004 CDS product 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791484.1 protein_id gnl|my_center|LOCUS_27160 21471 21052 gene locus_tag LOCUS_27170 21471 21052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 23904 21565 gene locus_tag LOCUS_27180 23904 21565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 24675 24133 gene locus_tag LOCUS_27190 24675 24133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 26044 24827 gene locus_tag LOCUS_27200 26044 24827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 26234 26536 gene locus_tag LOCUS_27210 26234 26536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 26580 26936 gene locus_tag LOCUS_27220 26580 26936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 28200 27049 gene locus_tag LOCUS_27230 28200 27049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 28420 29472 gene locus_tag LOCUS_27240 28420 29472 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937763.1 protein_id gnl|my_center|LOCUS_27240 29609 30868 gene locus_tag LOCUS_27250 29609 30868 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082942.1 protein_id gnl|my_center|LOCUS_27250 30865 32145 gene locus_tag LOCUS_27260 30865 32145 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258382.1 protein_id gnl|my_center|LOCUS_27260 33027 32257 gene locus_tag LOCUS_27270 gene trpA 33027 32257 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546593.1 protein_id gnl|my_center|LOCUS_27270 34255 33017 gene locus_tag LOCUS_27280 gene trpB 34255 33017 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687637.1 protein_id gnl|my_center|LOCUS_27280 34629 35204 gene locus_tag LOCUS_27290 34629 35204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 35269 36063 gene locus_tag LOCUS_27300 35269 36063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 36151 36558 gene locus_tag LOCUS_27310 36151 36558 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948605.1 protein_id gnl|my_center|LOCUS_27310 36561 36923 gene locus_tag LOCUS_27320 36561 36923 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258722.1 protein_id gnl|my_center|LOCUS_27320 >Feature sequence38 489 701 gene locus_tag LOCUS_27330 489 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 1202 804 gene locus_tag LOCUS_27340 1202 804 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876264.1 protein_id gnl|my_center|LOCUS_27340 1438 1199 gene locus_tag LOCUS_27350 1438 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 2398 1682 gene locus_tag LOCUS_27360 2398 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 2962 2414 gene locus_tag LOCUS_27370 2962 2414 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943181.1 protein_id gnl|my_center|LOCUS_27370 3854 3102 gene locus_tag LOCUS_27380 gene fabL 3854 3102 CDS product enoyl-[acyl-carrier-protein] reductase FabL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223262.1 protein_id gnl|my_center|LOCUS_27380 3989 4498 gene locus_tag LOCUS_27390 3989 4498 CDS product DUF3124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139455833.1 protein_id gnl|my_center|LOCUS_27390 5386 4541 gene locus_tag LOCUS_27400 gene htpX 5386 4541 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545548.1 protein_id gnl|my_center|LOCUS_27400 6471 5536 gene locus_tag LOCUS_27410 6471 5536 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294642.1 protein_id gnl|my_center|LOCUS_27410 8807 6888 gene locus_tag LOCUS_27420 8807 6888 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943084.1 protein_id gnl|my_center|LOCUS_27420 9202 9759 gene locus_tag LOCUS_27430 9202 9759 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546721.1 protein_id gnl|my_center|LOCUS_27430 9821 10810 gene locus_tag LOCUS_27440 gene fliM 9821 10810 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938209.1 protein_id gnl|my_center|LOCUS_27440 10949 11374 gene locus_tag LOCUS_27450 gene fliN 10949 11374 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937357.1 protein_id gnl|my_center|LOCUS_27450 11515 11934 gene locus_tag LOCUS_27460 11515 11934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 11931 12680 gene locus_tag LOCUS_27470 gene fliP 11931 12680 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_27470 12683 12952 gene locus_tag LOCUS_27480 gene fliQ 12683 12952 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220888.1 protein_id gnl|my_center|LOCUS_27480 12966 13757 gene locus_tag LOCUS_27490 gene fliR 12966 13757 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941094.1 protein_id gnl|my_center|LOCUS_27490 13761 14831 gene locus_tag LOCUS_27500 gene flhB 13761 14831 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_27500 14863 16971 gene locus_tag LOCUS_27510 gene flhA 14863 16971 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943681.1 protein_id gnl|my_center|LOCUS_27510 17010 18158 gene locus_tag LOCUS_27520 gene flhF 17010 18158 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965445.1 protein_id gnl|my_center|LOCUS_27520 18173 19057 gene locus_tag LOCUS_27530 18173 19057 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943679.1 protein_id gnl|my_center|LOCUS_27530 19134 19919 gene locus_tag LOCUS_27540 gene whiG 19134 19919 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667112.1 protein_id gnl|my_center|LOCUS_27540 20112 20477 gene locus_tag LOCUS_27550 20112 20477 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940486.1 protein_id gnl|my_center|LOCUS_27550 20561 21523 gene locus_tag LOCUS_27560 20561 21523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 21743 22969 gene locus_tag LOCUS_27570 21743 22969 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211292884.1 protein_id gnl|my_center|LOCUS_27570 23298 23636 gene locus_tag LOCUS_27580 23298 23636 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_27580 23638 26166 gene locus_tag LOCUS_27590 gene glnD 23638 26166 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_27590 26472 28610 gene locus_tag LOCUS_27600 26472 28610 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_27600 28799 29641 gene locus_tag LOCUS_27610 28799 29641 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938290.1 protein_id gnl|my_center|LOCUS_27610 30123 29632 gene locus_tag LOCUS_27620 30123 29632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 30532 30233 gene locus_tag LOCUS_27630 30532 30233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 30912 31478 gene locus_tag LOCUS_27640 30912 31478 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939849.1 protein_id gnl|my_center|LOCUS_27640 32095 31916 gene locus_tag LOCUS_27650 32095 31916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 32063 33817 gene locus_tag LOCUS_27660 32063 33817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 34743 33949 gene locus_tag LOCUS_27670 gene cbiR 34743 33949 CDS product cobamide remodeling phosphodiesterase CbiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932624.1 protein_id gnl|my_center|LOCUS_27670 35530 34730 gene locus_tag LOCUS_27680 35530 34730 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_27680 36096 35635 gene locus_tag LOCUS_27690 gene dut 36096 35635 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083581.1 protein_id gnl|my_center|LOCUS_27690 >Feature sequence39 373 1350 gene locus_tag LOCUS_27700 373 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 1371 1688 gene locus_tag LOCUS_27710 1371 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 2046 2333 gene locus_tag LOCUS_27720 2046 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 2936 4495 gene locus_tag LOCUS_27730 gene rny 2936 4495 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941798.1 protein_id gnl|my_center|LOCUS_27730 4612 5829 gene locus_tag LOCUS_27740 gene tyrS 4612 5829 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941800.1 protein_id gnl|my_center|LOCUS_27740 6289 8073 gene locus_tag LOCUS_27750 6289 8073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 8212 9642 gene locus_tag LOCUS_27760 8212 9642 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943835.1 protein_id gnl|my_center|LOCUS_27760 10037 10675 gene locus_tag LOCUS_27770 10037 10675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 10733 11449 gene locus_tag LOCUS_27780 10733 11449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 11574 12392 gene locus_tag LOCUS_27790 11574 12392 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920502.1 protein_id gnl|my_center|LOCUS_27790 13220 12438 gene locus_tag LOCUS_27800 13220 12438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 15508 13382 gene locus_tag LOCUS_27810 15508 13382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 17766 15544 gene locus_tag LOCUS_27820 17766 15544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 19987 18275 gene locus_tag LOCUS_27830 19987 18275 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943843.1 protein_id gnl|my_center|LOCUS_27830 21033 19984 gene locus_tag LOCUS_27840 21033 19984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 22132 21038 gene locus_tag LOCUS_27850 22132 21038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 24434 22353 gene locus_tag LOCUS_27860 24434 22353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 25612 24452 gene locus_tag LOCUS_27870 25612 24452 CDS product SBBP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943839.1 protein_id gnl|my_center|LOCUS_27870 26315 27133 gene locus_tag LOCUS_27880 26315 27133 CDS product cytochrome C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136516188.1 protein_id gnl|my_center|LOCUS_27880 27293 29446 gene locus_tag LOCUS_27890 27293 29446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 29450 31522 gene locus_tag LOCUS_27900 29450 31522 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172931.1 protein_id gnl|my_center|LOCUS_27900 32004 32807 gene locus_tag LOCUS_27910 32004 32807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 32867 35305 gene locus_tag LOCUS_27920 32867 35305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 >Feature sequence40 881 372 gene locus_tag LOCUS_27930 881 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 1063 2010 gene locus_tag LOCUS_27940 1063 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 2345 3184 gene locus_tag LOCUS_27950 2345 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 3184 3984 gene locus_tag LOCUS_27960 3184 3984 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583927.1 protein_id gnl|my_center|LOCUS_27960 3981 4634 gene locus_tag LOCUS_27970 3981 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 4631 5482 gene locus_tag LOCUS_27980 4631 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 5667 6257 gene locus_tag LOCUS_27990 5667 6257 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943032.1 protein_id gnl|my_center|LOCUS_27990 6320 7342 gene locus_tag LOCUS_28000 6320 7342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 8255 7674 gene locus_tag LOCUS_28010 8255 7674 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943415.1 protein_id gnl|my_center|LOCUS_28010 8472 8672 gene locus_tag LOCUS_28020 8472 8672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 8913 9053 gene locus_tag LOCUS_28030 8913 9053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 9412 9176 gene locus_tag LOCUS_28040 9412 9176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 11331 9754 gene locus_tag LOCUS_28050 11331 9754 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294598.1 protein_id gnl|my_center|LOCUS_28050 13295 11418 gene locus_tag LOCUS_28060 13295 11418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 13467 14531 gene locus_tag LOCUS_28070 gene corA 13467 14531 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942048.1 protein_id gnl|my_center|LOCUS_28070 14557 16650 gene locus_tag LOCUS_28080 gene pta 14557 16650 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940288.1 protein_id gnl|my_center|LOCUS_28080 16653 17879 gene locus_tag LOCUS_28090 16653 17879 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030238.1 protein_id gnl|my_center|LOCUS_28090 17928 19394 gene locus_tag LOCUS_28100 gene zwf 17928 19394 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072454.1 protein_id gnl|my_center|LOCUS_28100 19404 20126 gene locus_tag LOCUS_28110 gene pgl 19404 20126 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072453.1 protein_id gnl|my_center|LOCUS_28110 20143 21996 gene locus_tag LOCUS_28120 gene edd 20143 21996 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050129919.1 protein_id gnl|my_center|LOCUS_28120 22212 22856 gene locus_tag LOCUS_28130 22212 22856 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163029.1 protein_id gnl|my_center|LOCUS_28130 23042 23662 gene locus_tag LOCUS_28140 gene yedF 23042 23662 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391672.1 protein_id gnl|my_center|LOCUS_28140 23672 24838 gene locus_tag LOCUS_28150 23672 24838 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942513.1 protein_id gnl|my_center|LOCUS_28150 24846 25121 gene locus_tag LOCUS_28160 24846 25121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 25687 26682 gene locus_tag LOCUS_28170 25687 26682 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105527.1 protein_id gnl|my_center|LOCUS_28170 27225 30080 gene locus_tag LOCUS_28180 27225 30080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 32072 30441 gene locus_tag LOCUS_28190 gene gpmI 32072 30441 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_28190 34123 32144 gene locus_tag LOCUS_28200 gene glgX 34123 32144 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021995.1 protein_id gnl|my_center|LOCUS_28200 34497 36149 gene locus_tag LOCUS_28210 gene pgm 34497 36149 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705434.1 protein_id gnl|my_center|LOCUS_28210 >Feature sequence41 1596 358 gene locus_tag LOCUS_28220 1596 358 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926104.1 protein_id gnl|my_center|LOCUS_28220 1513 1818 gene locus_tag LOCUS_28230 1513 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 2564 1980 gene locus_tag LOCUS_28240 2564 1980 CDS product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626398.1 protein_id gnl|my_center|LOCUS_28240 4381 2687 gene locus_tag LOCUS_28250 4381 2687 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986802.1 protein_id gnl|my_center|LOCUS_28250 6920 4374 gene locus_tag LOCUS_28260 6920 4374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 7172 7636 gene locus_tag LOCUS_28270 7172 7636 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382916.1 protein_id gnl|my_center|LOCUS_28270 7633 9813 gene locus_tag LOCUS_28280 7633 9813 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940876.1 protein_id gnl|my_center|LOCUS_28280 9823 10635 gene locus_tag LOCUS_28290 9823 10635 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940877.1 protein_id gnl|my_center|LOCUS_28290 10592 11188 gene locus_tag LOCUS_28300 10592 11188 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940878.1 protein_id gnl|my_center|LOCUS_28300 12245 11211 gene locus_tag LOCUS_28310 12245 11211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 12652 12873 gene locus_tag LOCUS_28320 12652 12873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 14383 12980 gene locus_tag LOCUS_28330 14383 12980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 14699 16084 gene locus_tag LOCUS_28340 14699 16084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 16945 16130 gene locus_tag LOCUS_28350 16945 16130 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937704.1 protein_id gnl|my_center|LOCUS_28350 18447 16942 gene locus_tag LOCUS_28360 18447 16942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 18809 20464 gene locus_tag LOCUS_28370 18809 20464 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938914.1 protein_id gnl|my_center|LOCUS_28370 20498 20692 gene locus_tag LOCUS_28380 20498 20692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 20756 21583 gene locus_tag LOCUS_28390 gene kdsA 20756 21583 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_28390 21684 22334 gene locus_tag LOCUS_28400 21684 22334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 22331 22894 gene locus_tag LOCUS_28410 22331 22894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 23927 23127 gene locus_tag LOCUS_28420 23927 23127 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545351.1 protein_id gnl|my_center|LOCUS_28420 24708 23935 gene locus_tag LOCUS_28430 24708 23935 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883529.1 protein_id gnl|my_center|LOCUS_28430 24843 25583 gene locus_tag LOCUS_28440 gene pyrF 24843 25583 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083509.1 protein_id gnl|my_center|LOCUS_28440 25745 26962 gene locus_tag LOCUS_28450 25745 26962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943169.1 protein_id gnl|my_center|LOCUS_28450 27247 27669 gene locus_tag LOCUS_28460 27247 27669 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943168.1 protein_id gnl|my_center|LOCUS_28460 27685 29409 gene locus_tag LOCUS_28470 27685 29409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 30146 29469 gene locus_tag LOCUS_28480 30146 29469 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542407.1 protein_id gnl|my_center|LOCUS_28480 30345 31697 gene locus_tag LOCUS_28490 30345 31697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 31844 31680 gene locus_tag LOCUS_28500 31844 31680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 32220 31849 gene locus_tag LOCUS_28510 32220 31849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 32423 32217 gene locus_tag LOCUS_28520 32423 32217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 33505 32516 gene locus_tag LOCUS_28530 33505 32516 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941622.1 protein_id gnl|my_center|LOCUS_28530 35100 33571 gene locus_tag LOCUS_28540 35100 33571 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994768.1 protein_id gnl|my_center|LOCUS_28540 35279 35097 gene locus_tag LOCUS_28550 35279 35097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 36047 35529 gene locus_tag LOCUS_28560 36047 35529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 >Feature sequence42 658 239 gene locus_tag LOCUS_28570 658 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 2739 913 gene locus_tag LOCUS_28580 2739 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 5054 4527 gene locus_tag LOCUS_28590 5054 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 5353 5054 gene locus_tag LOCUS_28600 5353 5054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 5578 5357 gene locus_tag LOCUS_28610 5578 5357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 6630 5701 gene locus_tag LOCUS_28620 6630 5701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 8027 6729 gene locus_tag LOCUS_28630 8027 6729 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938819.1 protein_id gnl|my_center|LOCUS_28630 8215 8139 gene locus_tag LOCUS_t00300 8215 8139 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 10008 8362 gene locus_tag LOCUS_28640 gene groL 10008 8362 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_28640 10407 10117 gene locus_tag LOCUS_28650 gene groES 10407 10117 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918572.1 protein_id gnl|my_center|LOCUS_28650 11731 10664 gene locus_tag LOCUS_28660 11731 10664 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_28660 11948 13123 gene locus_tag LOCUS_28670 11948 13123 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813006.1 protein_id gnl|my_center|LOCUS_28670 13589 13167 gene locus_tag LOCUS_28680 gene arfB 13589 13167 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919096.1 protein_id gnl|my_center|LOCUS_28680 13658 13882 gene locus_tag LOCUS_28690 13658 13882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 13960 14877 gene locus_tag LOCUS_28700 gene speB 13960 14877 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393315.1 protein_id gnl|my_center|LOCUS_28700 14867 16783 gene locus_tag LOCUS_28710 gene speA 14867 16783 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144058.1 protein_id gnl|my_center|LOCUS_28710 16880 18058 gene locus_tag LOCUS_28720 16880 18058 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937725.1 protein_id gnl|my_center|LOCUS_28720 18037 19194 gene locus_tag LOCUS_28730 gene nspC 18037 19194 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943174.1 protein_id gnl|my_center|LOCUS_28730 19386 22763 gene locus_tag LOCUS_28740 gene hsdR 19386 22763 CDS product type I restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122926.1 protein_id gnl|my_center|LOCUS_28740 22782 24254 gene locus_tag LOCUS_28750 22782 24254 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122925.1 protein_id gnl|my_center|LOCUS_28750 24358 25458 gene locus_tag LOCUS_28760 24358 25458 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022383.1 protein_id gnl|my_center|LOCUS_28760 25455 27083 gene locus_tag LOCUS_28770 gene hsdS 25455 27083 CDS product type I restriction-modification system specificity subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014003.1 protein_id gnl|my_center|LOCUS_28770 27068 27514 gene locus_tag LOCUS_28780 27068 27514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 27899 27483 gene locus_tag LOCUS_28790 gene nikR 27899 27483 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943609.1 protein_id gnl|my_center|LOCUS_28790 28244 29290 gene locus_tag LOCUS_28800 28244 29290 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941934.1 protein_id gnl|my_center|LOCUS_28800 29287 30099 gene locus_tag LOCUS_28810 gene cbiQ 29287 30099 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941935.1 protein_id gnl|my_center|LOCUS_28810 30096 30851 gene locus_tag LOCUS_28820 30096 30851 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941936.1 protein_id gnl|my_center|LOCUS_28820 30934 32214 gene locus_tag LOCUS_28830 30934 32214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 33142 32222 gene locus_tag LOCUS_28840 33142 32222 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713630.1 protein_id gnl|my_center|LOCUS_28840 35784 33157 gene locus_tag LOCUS_28850 gene ndvB 35784 33157 CDS product glycosyltransferase NdvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115817.1 protein_id gnl|my_center|LOCUS_28850 >Feature sequence43 400 732 gene locus_tag LOCUS_28860 400 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 735 1406 gene locus_tag LOCUS_28870 735 1406 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939611.1 protein_id gnl|my_center|LOCUS_28870 1624 2646 gene locus_tag LOCUS_28880 1624 2646 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173870.1 protein_id gnl|my_center|LOCUS_28880 3254 2970 gene locus_tag LOCUS_28890 3254 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 3270 3518 gene locus_tag LOCUS_28900 3270 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 3575 4624 gene locus_tag LOCUS_28910 3575 4624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 5741 4650 gene locus_tag LOCUS_28920 5741 4650 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393048.1 protein_id gnl|my_center|LOCUS_28920 7928 5847 gene locus_tag LOCUS_28930 7928 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 8138 9187 gene locus_tag LOCUS_28940 8138 9187 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933549.1 protein_id gnl|my_center|LOCUS_28940 9180 10079 gene locus_tag LOCUS_28950 9180 10079 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986803.1 protein_id gnl|my_center|LOCUS_28950 10087 10875 gene locus_tag LOCUS_28960 10087 10875 CDS product NADH ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933551.1 protein_id gnl|my_center|LOCUS_28960 10909 12183 gene locus_tag LOCUS_28970 10909 12183 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933552.1 protein_id gnl|my_center|LOCUS_28970 12423 12172 gene locus_tag LOCUS_28980 12423 12172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 13023 12433 gene locus_tag LOCUS_28990 13023 12433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 13317 13601 gene locus_tag LOCUS_29000 13317 13601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 13601 14371 gene locus_tag LOCUS_29010 13601 14371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 14774 14454 gene locus_tag LOCUS_29020 14774 14454 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940042.1 protein_id gnl|my_center|LOCUS_29020 16378 15026 gene locus_tag LOCUS_29030 16378 15026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 17133 16501 gene locus_tag LOCUS_29040 17133 16501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942125.1 protein_id gnl|my_center|LOCUS_29040 18020 17136 gene locus_tag LOCUS_29050 18020 17136 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942124.1 protein_id gnl|my_center|LOCUS_29050 18575 18021 gene locus_tag LOCUS_29060 18575 18021 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942123.1 protein_id gnl|my_center|LOCUS_29060 19684 18803 gene locus_tag LOCUS_29070 19684 18803 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667127.1 protein_id gnl|my_center|LOCUS_29070 19794 21011 gene locus_tag LOCUS_29080 19794 21011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 21309 21016 gene locus_tag LOCUS_29090 21309 21016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 22647 21403 gene locus_tag LOCUS_29100 22647 21403 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938299.1 protein_id gnl|my_center|LOCUS_29100 23241 22657 gene locus_tag LOCUS_29110 23241 22657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 23953 23327 gene locus_tag LOCUS_29120 23953 23327 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840898.1 protein_id gnl|my_center|LOCUS_29120 24163 24963 gene locus_tag LOCUS_29130 gene lgt 24163 24963 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545160.1 protein_id gnl|my_center|LOCUS_29130 24971 27631 gene locus_tag LOCUS_29140 24971 27631 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938723.1 protein_id gnl|my_center|LOCUS_29140 27665 28321 gene locus_tag LOCUS_29150 gene rpe 27665 28321 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_29150 30424 28364 gene locus_tag LOCUS_29160 30424 28364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 30987 30439 gene locus_tag LOCUS_29170 30987 30439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 31847 31080 gene locus_tag LOCUS_29180 31847 31080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 32609 31938 gene locus_tag LOCUS_29190 32609 31938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 33085 33585 gene locus_tag LOCUS_29200 33085 33585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 35342 33651 gene locus_tag LOCUS_29210 35342 33651 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942046.1 protein_id gnl|my_center|LOCUS_29210 35899 35354 gene locus_tag LOCUS_29220 35899 35354 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942047.1 protein_id gnl|my_center|LOCUS_29220 >Feature sequence44 949 1725 gene locus_tag LOCUS_29230 gene modA 949 1725 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943593.1 protein_id gnl|my_center|LOCUS_29230 1940 2629 gene locus_tag LOCUS_29240 gene modB 1940 2629 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943592.1 protein_id gnl|my_center|LOCUS_29240 2626 3681 gene locus_tag LOCUS_29250 gene modC 2626 3681 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943591.1 protein_id gnl|my_center|LOCUS_29250 4286 3831 gene locus_tag LOCUS_29260 4286 3831 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707093.1 protein_id gnl|my_center|LOCUS_29260 5467 4286 gene locus_tag LOCUS_29270 gene larC 5467 4286 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393989.1 protein_id gnl|my_center|LOCUS_29270 6575 5625 gene locus_tag LOCUS_29280 gene fmt 6575 5625 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_29280 7092 6559 gene locus_tag LOCUS_29290 gene def 7092 6559 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940805.1 protein_id gnl|my_center|LOCUS_29290 7939 7490 gene locus_tag LOCUS_29300 7939 7490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 10429 7997 gene locus_tag LOCUS_29310 gene priA 10429 7997 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101474.1 protein_id gnl|my_center|LOCUS_29310 11526 10657 gene locus_tag LOCUS_29320 gene galU 11526 10657 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892053.1 protein_id gnl|my_center|LOCUS_29320 11686 12738 gene locus_tag LOCUS_29330 11686 12738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 13175 12819 gene locus_tag LOCUS_29340 13175 12819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943567.1 protein_id gnl|my_center|LOCUS_29340 14162 13203 gene locus_tag LOCUS_29350 gene extKL 14162 13203 CDS product multiheme c-type cytochrome ExtKL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943568.1 protein_id gnl|my_center|LOCUS_29350 14726 14802 gene locus_tag LOCUS_t00310 14726 14802 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 17871 14908 gene locus_tag LOCUS_29360 17871 14908 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942996.1 protein_id gnl|my_center|LOCUS_29360 19786 17903 gene locus_tag LOCUS_29370 gene treZ 19786 17903 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942994.1 protein_id gnl|my_center|LOCUS_29370 20841 19783 gene locus_tag LOCUS_29380 20841 19783 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545596.1 protein_id gnl|my_center|LOCUS_29380 22092 20854 gene locus_tag LOCUS_29390 22092 20854 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869050.1 protein_id gnl|my_center|LOCUS_29390 22736 22089 gene locus_tag LOCUS_29400 22736 22089 CDS product DUF5752 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869051.1 protein_id gnl|my_center|LOCUS_29400 23581 23372 gene locus_tag LOCUS_29410 23581 23372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 24582 24157 gene locus_tag LOCUS_29420 24582 24157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 25227 25499 gene locus_tag LOCUS_29430 25227 25499 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943754.1 protein_id gnl|my_center|LOCUS_29430 25645 26286 gene locus_tag LOCUS_29440 25645 26286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 26532 26365 gene locus_tag LOCUS_29450 26532 26365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 27132 27350 gene locus_tag LOCUS_29460 27132 27350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 27439 27801 gene locus_tag LOCUS_29470 27439 27801 CDS product DUF2628 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056603.1 protein_id gnl|my_center|LOCUS_29470 28410 28114 gene locus_tag LOCUS_29480 28410 28114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 28593 28432 gene locus_tag LOCUS_29490 28593 28432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 28714 31590 gene locus_tag LOCUS_29500 28714 31590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 32604 31660 gene locus_tag LOCUS_29510 32604 31660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 33917 32808 gene locus_tag LOCUS_29520 33917 32808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 35431 34316 gene locus_tag LOCUS_29530 35431 34316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 35771 35586 gene locus_tag LOCUS_29540 35771 35586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 >Feature sequence45 2046 148 gene locus_tag LOCUS_29550 gene asnB 2046 148 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061273.1 protein_id gnl|my_center|LOCUS_29550 2527 2171 gene locus_tag LOCUS_29560 2527 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 2914 2618 gene locus_tag LOCUS_29570 2914 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29570 3800 3123 gene locus_tag LOCUS_29580 3800 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 4802 4242 gene locus_tag LOCUS_29590 4802 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 6792 5356 gene locus_tag LOCUS_29600 6792 5356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 6870 7028 gene locus_tag LOCUS_29610 6870 7028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 7371 7000 gene locus_tag LOCUS_29620 7371 7000 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_29620 8745 7438 gene locus_tag LOCUS_29630 8745 7438 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389965.1 protein_id gnl|my_center|LOCUS_29630 9762 8755 gene locus_tag LOCUS_29640 9762 8755 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_29640 10821 9793 gene locus_tag LOCUS_29650 10821 9793 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937626.1 protein_id gnl|my_center|LOCUS_29650 12104 10821 gene locus_tag LOCUS_29660 gene tviB 12104 10821 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208043.1 protein_id gnl|my_center|LOCUS_29660 13108 12152 gene locus_tag LOCUS_29670 13108 12152 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_29670 15043 13400 gene locus_tag LOCUS_29680 15043 13400 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937340.1 protein_id gnl|my_center|LOCUS_29680 15208 16095 gene locus_tag LOCUS_29690 15208 16095 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193057.1 protein_id gnl|my_center|LOCUS_29690 16156 17073 gene locus_tag LOCUS_29700 16156 17073 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_29700 17081 19267 gene locus_tag LOCUS_29710 17081 19267 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_29710 19601 20185 gene locus_tag LOCUS_29720 19601 20185 CDS product RsbRD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810499.1 protein_id gnl|my_center|LOCUS_29720 20309 21304 gene locus_tag LOCUS_29730 gene dsrM 20309 21304 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938586.1 protein_id gnl|my_center|LOCUS_29730 21397 22935 gene locus_tag LOCUS_29740 21397 22935 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393112.1 protein_id gnl|my_center|LOCUS_29740 22939 23334 gene locus_tag LOCUS_29750 gene dsrJ 22939 23334 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938584.1 protein_id gnl|my_center|LOCUS_29750 23334 24182 gene locus_tag LOCUS_29760 23334 24182 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393110.1 protein_id gnl|my_center|LOCUS_29760 24194 25375 gene locus_tag LOCUS_29770 gene nrfD 24194 25375 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541886.1 protein_id gnl|my_center|LOCUS_29770 25569 25799 gene locus_tag LOCUS_29780 25569 25799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 25851 26006 gene locus_tag LOCUS_29790 25851 26006 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933679.1 protein_id gnl|my_center|LOCUS_29790 26285 28612 gene locus_tag LOCUS_29800 26285 28612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 29923 28640 gene locus_tag LOCUS_29810 29923 28640 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629647.1 protein_id gnl|my_center|LOCUS_29810 30436 29990 gene locus_tag LOCUS_29820 gene umuD 30436 29990 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219995814.1 protein_id gnl|my_center|LOCUS_29820 30592 32019 gene locus_tag LOCUS_29830 30592 32019 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011342568.1 protein_id gnl|my_center|LOCUS_29830 32361 32023 gene locus_tag LOCUS_29840 32361 32023 CDS product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461033.1 protein_id gnl|my_center|LOCUS_29840 32597 32673 gene locus_tag LOCUS_t00320 32597 32673 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 33781 32702 gene locus_tag LOCUS_29850 33781 32702 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007697.1 protein_id gnl|my_center|LOCUS_29850 >Feature sequence46 241 1140 gene locus_tag LOCUS_29860 241 1140 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_29860 1207 2220 gene locus_tag LOCUS_29870 1207 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 2217 2762 gene locus_tag LOCUS_29880 2217 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 3823 2849 gene locus_tag LOCUS_29890 3823 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 6759 3826 gene locus_tag LOCUS_29900 6759 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 7688 6756 gene locus_tag LOCUS_29910 7688 6756 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_29910 8578 7952 gene locus_tag LOCUS_29920 8578 7952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 9690 8908 gene locus_tag LOCUS_29930 9690 8908 CDS product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838970.1 protein_id gnl|my_center|LOCUS_29930 10525 9731 gene locus_tag LOCUS_29940 10525 9731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 11139 10819 gene locus_tag LOCUS_29950 11139 10819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 12294 11149 gene locus_tag LOCUS_29960 12294 11149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 12490 13458 gene locus_tag LOCUS_29970 12490 13458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 14755 13505 gene locus_tag LOCUS_29980 14755 13505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 15736 15380 gene locus_tag LOCUS_29990 15736 15380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 16262 15867 gene locus_tag LOCUS_30000 16262 15867 CDS product class II SORL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081116.1 protein_id gnl|my_center|LOCUS_30000 16662 16408 gene locus_tag LOCUS_30010 16662 16408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 16981 17151 gene locus_tag LOCUS_30020 16981 17151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 17212 17724 gene locus_tag LOCUS_30030 17212 17724 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703592.1 protein_id gnl|my_center|LOCUS_30030 18339 17887 gene locus_tag LOCUS_30040 18339 17887 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939462.1 protein_id gnl|my_center|LOCUS_30040 18820 23352 gene locus_tag LOCUS_30050 18820 23352 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944060.1 protein_id gnl|my_center|LOCUS_30050 23483 24496 gene locus_tag LOCUS_30060 gene amrS 23483 24496 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546747.1 protein_id gnl|my_center|LOCUS_30060 24545 24805 gene locus_tag LOCUS_30070 24545 24805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 24831 25238 gene locus_tag LOCUS_30080 24831 25238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 25563 25258 gene locus_tag LOCUS_30090 25563 25258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 25795 25583 gene locus_tag LOCUS_30100 25795 25583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 26191 27372 gene locus_tag LOCUS_30110 26191 27372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 28203 27655 gene locus_tag LOCUS_30120 28203 27655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 28456 29742 gene locus_tag LOCUS_30130 28456 29742 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938271.1 protein_id gnl|my_center|LOCUS_30130 29824 32154 gene locus_tag LOCUS_30140 29824 32154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 32811 32245 gene locus_tag LOCUS_30150 32811 32245 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_30150 33592 33095 gene locus_tag LOCUS_30160 33592 33095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 >Feature sequence47 448 648 gene locus_tag LOCUS_30170 448 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 1596 595 gene locus_tag LOCUS_30180 gene dusB 1596 595 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_30180 1706 3652 gene locus_tag LOCUS_30190 1706 3652 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582597.1 protein_id gnl|my_center|LOCUS_30190 4435 3839 gene locus_tag LOCUS_30200 4435 3839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 6950 4464 gene locus_tag LOCUS_30210 gene leuS 6950 4464 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942849.1 protein_id gnl|my_center|LOCUS_30210 8258 6999 gene locus_tag LOCUS_30220 gene dnaB 8258 6999 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941663.1 protein_id gnl|my_center|LOCUS_30220 8951 8496 gene locus_tag LOCUS_30230 gene rplI 8951 8496 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938257.1 protein_id gnl|my_center|LOCUS_30230 9587 9000 gene locus_tag LOCUS_30240 9587 9000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 10180 9947 gene locus_tag LOCUS_30250 10180 9947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 10572 10198 gene locus_tag LOCUS_30260 gene rpsF 10572 10198 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941326.1 protein_id gnl|my_center|LOCUS_30260 10729 10878 gene locus_tag LOCUS_30270 10729 10878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 11139 10834 gene locus_tag LOCUS_30280 11139 10834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 11596 11405 gene locus_tag LOCUS_30290 11596 11405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 12212 11649 gene locus_tag LOCUS_30300 12212 11649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 12464 13252 gene locus_tag LOCUS_30310 12464 13252 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942088.1 protein_id gnl|my_center|LOCUS_30310 13673 13296 gene locus_tag LOCUS_30320 13673 13296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 14225 15232 gene locus_tag LOCUS_30330 14225 15232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 16158 15304 gene locus_tag LOCUS_30340 16158 15304 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869527.1 protein_id gnl|my_center|LOCUS_30340 17226 16201 gene locus_tag LOCUS_30350 17226 16201 CDS product YhdH/YhfP family quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016968.1 protein_id gnl|my_center|LOCUS_30350 17820 18338 gene locus_tag LOCUS_30360 17820 18338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 18363 19334 gene locus_tag LOCUS_30370 18363 19334 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_30370 19322 20458 gene locus_tag LOCUS_30380 gene lpxB 19322 20458 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_30380 20549 20959 gene locus_tag LOCUS_30390 20549 20959 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941941.1 protein_id gnl|my_center|LOCUS_30390 22125 21031 gene locus_tag LOCUS_30400 gene mutY 22125 21031 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629788.1 protein_id gnl|my_center|LOCUS_30400 22863 22132 gene locus_tag LOCUS_30410 22863 22132 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942121.1 protein_id gnl|my_center|LOCUS_30410 23946 22864 gene locus_tag LOCUS_30420 gene leuB 23946 22864 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704821.1 protein_id gnl|my_center|LOCUS_30420 24741 24112 gene locus_tag LOCUS_30430 24741 24112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256711.1 protein_id gnl|my_center|LOCUS_30430 26003 24738 gene locus_tag LOCUS_30440 26003 24738 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256710.1 protein_id gnl|my_center|LOCUS_30440 26300 28138 gene locus_tag LOCUS_30450 gene uvrC 26300 28138 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_30450 28271 29113 gene locus_tag LOCUS_30460 gene nifU 28271 29113 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937968.1 protein_id gnl|my_center|LOCUS_30460 29110 30291 gene locus_tag LOCUS_30470 gene nifS 29110 30291 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942654.1 protein_id gnl|my_center|LOCUS_30470 30419 31372 gene locus_tag LOCUS_30480 30419 31372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 31623 33386 gene locus_tag LOCUS_30490 31623 33386 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546634.1 protein_id gnl|my_center|LOCUS_30490 >Feature sequence48 1729 191 gene locus_tag LOCUS_30500 1729 191 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_30500 2157 1972 gene locus_tag LOCUS_30510 2157 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 4483 2483 gene locus_tag LOCUS_30520 4483 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 9255 4747 gene locus_tag LOCUS_30530 9255 4747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 9678 10370 gene locus_tag LOCUS_30540 9678 10370 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_30540 10410 10961 gene locus_tag LOCUS_30550 10410 10961 CDS product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946938.1 protein_id gnl|my_center|LOCUS_30550 10958 11236 gene locus_tag LOCUS_30560 10958 11236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 11316 11735 gene locus_tag LOCUS_30570 11316 11735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 13267 11768 gene locus_tag LOCUS_30580 gene purF 13267 11768 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091383.1 protein_id gnl|my_center|LOCUS_30580 13755 13321 gene locus_tag LOCUS_30590 13755 13321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 14152 13922 gene locus_tag LOCUS_30600 14152 13922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 17368 14243 gene locus_tag LOCUS_30610 17368 14243 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_30610 18471 17383 gene locus_tag LOCUS_30620 18471 17383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 18851 20992 gene locus_tag LOCUS_30630 18851 20992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 23616 21190 gene locus_tag LOCUS_30640 23616 21190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 25304 23706 gene locus_tag LOCUS_30650 25304 23706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 25490 28681 gene locus_tag LOCUS_30660 gene recC 25490 28681 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942180.1 protein_id gnl|my_center|LOCUS_30660 28674 32258 gene locus_tag LOCUS_30670 28674 32258 CDS product DUF748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941340.1 protein_id gnl|my_center|LOCUS_30670 32455 33291 gene locus_tag LOCUS_30680 32455 33291 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965435.1 protein_id gnl|my_center|LOCUS_30680 >Feature sequence49 169 870 gene locus_tag LOCUS_30690 169 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091213.1 protein_id gnl|my_center|LOCUS_30690 1183 1986 gene locus_tag LOCUS_30700 1183 1986 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085387.1 protein_id gnl|my_center|LOCUS_30700 2422 3219 gene locus_tag LOCUS_30710 2422 3219 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940564.1 protein_id gnl|my_center|LOCUS_30710 3741 3427 gene locus_tag LOCUS_30720 3741 3427 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650217.1 protein_id gnl|my_center|LOCUS_30720 4676 4275 gene locus_tag LOCUS_30730 4676 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 4988 4773 gene locus_tag LOCUS_30740 4988 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 6026 4992 gene locus_tag LOCUS_30750 6026 4992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 6492 6031 gene locus_tag LOCUS_30760 6492 6031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 7658 7582 gene locus_tag LOCUS_t00330 7658 7582 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7864 8403 gene locus_tag LOCUS_30770 7864 8403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 8312 8587 gene locus_tag LOCUS_30780 8312 8587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 10896 8629 gene locus_tag LOCUS_30790 10896 8629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 11315 11827 gene locus_tag LOCUS_30800 11315 11827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 11864 12274 gene locus_tag LOCUS_30810 11864 12274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 12310 12663 gene locus_tag LOCUS_30820 12310 12663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 12690 12872 gene locus_tag LOCUS_30830 12690 12872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545090.1 protein_id gnl|my_center|LOCUS_30830 15206 12894 gene locus_tag LOCUS_30840 15206 12894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 16029 15217 gene locus_tag LOCUS_30850 16029 15217 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731550.1 protein_id gnl|my_center|LOCUS_30850 16820 18061 gene locus_tag LOCUS_30860 gene dnaA 16820 18061 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428017.1 protein_id gnl|my_center|LOCUS_30860 19581 18205 gene locus_tag LOCUS_30870 gene hemG 19581 18205 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545161.1 protein_id gnl|my_center|LOCUS_30870 19840 19598 gene locus_tag LOCUS_30880 19840 19598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 19806 20321 gene locus_tag LOCUS_30890 19806 20321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 20901 20359 gene locus_tag LOCUS_30900 gene cobO 20901 20359 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531120.1 protein_id gnl|my_center|LOCUS_30900 22706 20904 gene locus_tag LOCUS_30910 22706 20904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 23592 22696 gene locus_tag LOCUS_30920 23592 22696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 24041 23733 gene locus_tag LOCUS_30930 24041 23733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 24373 24164 gene locus_tag LOCUS_30940 24373 24164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 24702 24421 gene locus_tag LOCUS_30950 24702 24421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939234.1 protein_id gnl|my_center|LOCUS_30950 25276 26661 gene locus_tag LOCUS_30960 25276 26661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 26922 26605 gene locus_tag LOCUS_30970 26922 26605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 27115 26948 gene locus_tag LOCUS_30980 27115 26948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 27044 28279 gene locus_tag LOCUS_30990 gene purF 27044 28279 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937472.1 protein_id gnl|my_center|LOCUS_30990 28298 29275 gene locus_tag LOCUS_31000 28298 29275 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544949.1 protein_id gnl|my_center|LOCUS_31000 29577 30137 gene locus_tag LOCUS_31010 29577 30137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 30342 30764 gene locus_tag LOCUS_31020 30342 30764 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392707.1 protein_id gnl|my_center|LOCUS_31020 30761 31429 gene locus_tag LOCUS_31030 30761 31429 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392706.1 protein_id gnl|my_center|LOCUS_31030 >Feature sequence50 351 920 gene locus_tag LOCUS_31040 gene kdpC 351 920 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943119.1 protein_id gnl|my_center|LOCUS_31040 917 3598 gene locus_tag LOCUS_31050 917 3598 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943120.1 protein_id gnl|my_center|LOCUS_31050 3598 4293 gene locus_tag LOCUS_31060 3598 4293 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943121.1 protein_id gnl|my_center|LOCUS_31060 5736 4309 gene locus_tag LOCUS_31070 5736 4309 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791433.1 protein_id gnl|my_center|LOCUS_31070 7459 5726 gene locus_tag LOCUS_31080 7459 5726 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_31080 8640 7456 gene locus_tag LOCUS_31090 gene ftsZ 8640 7456 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939769.1 protein_id gnl|my_center|LOCUS_31090 9960 8728 gene locus_tag LOCUS_31100 gene ftsA 9960 8728 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_31100 10817 9969 gene locus_tag LOCUS_31110 10817 9969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 11779 10814 gene locus_tag LOCUS_31120 gene murB 11779 10814 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232182.1 protein_id gnl|my_center|LOCUS_31120 13201 11828 gene locus_tag LOCUS_31130 gene murC 13201 11828 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_31130 14338 13259 gene locus_tag LOCUS_31140 gene murG 14338 13259 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_31140 14582 14376 gene locus_tag LOCUS_31150 14582 14376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 16053 14671 gene locus_tag LOCUS_31160 gene murD 16053 14671 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_31160 17140 16061 gene locus_tag LOCUS_31170 gene mraY 17140 16061 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_31170 18649 17153 gene locus_tag LOCUS_31180 18649 17153 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943698.1 protein_id gnl|my_center|LOCUS_31180 20259 18667 gene locus_tag LOCUS_31190 20259 18667 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943699.1 protein_id gnl|my_center|LOCUS_31190 22278 20263 gene locus_tag LOCUS_31200 22278 20263 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_31200 22646 22275 gene locus_tag LOCUS_31210 22646 22275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 23536 22646 gene locus_tag LOCUS_31220 gene rsmH 23536 22646 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943702.1 protein_id gnl|my_center|LOCUS_31220 24036 23545 gene locus_tag LOCUS_31230 gene mraZ 24036 23545 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625480.1 protein_id gnl|my_center|LOCUS_31230 24962 24285 gene locus_tag LOCUS_31240 24962 24285 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938821.1 protein_id gnl|my_center|LOCUS_31240 27312 25204 gene locus_tag LOCUS_31250 27312 25204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 28742 27309 gene locus_tag LOCUS_31260 gene selA 28742 27309 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940143.1 protein_id gnl|my_center|LOCUS_31260 29478 29095 gene locus_tag LOCUS_31270 29478 29095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 29826 30029 gene locus_tag LOCUS_31280 29826 30029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 30035 30199 gene locus_tag LOCUS_31290 30035 30199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 30498 30361 gene locus_tag LOCUS_31300 30498 30361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 30650 30465 gene locus_tag LOCUS_31310 30650 30465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 30793 31355 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccacgcccccgtgcagggggcgac >Feature sequence51 1120 377 gene locus_tag LOCUS_31320 1120 377 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315093.1 protein_id gnl|my_center|LOCUS_31320 1490 2662 gene locus_tag LOCUS_31330 1490 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 2931 3344 gene locus_tag LOCUS_31340 2931 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 4341 3628 gene locus_tag LOCUS_31350 4341 3628 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942449.1 protein_id gnl|my_center|LOCUS_31350 4842 4381 gene locus_tag LOCUS_31360 gene ybeY 4842 4381 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880869.1 protein_id gnl|my_center|LOCUS_31360 5830 4820 gene locus_tag LOCUS_31370 5830 4820 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792172.1 protein_id gnl|my_center|LOCUS_31370 6702 5839 gene locus_tag LOCUS_31380 6702 5839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 8172 6868 gene locus_tag LOCUS_31390 8172 6868 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460927.1 protein_id gnl|my_center|LOCUS_31390 9052 8180 gene locus_tag LOCUS_31400 gene prfB 9052 8180 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 protein_id gnl|my_center|LOCUS_31400 10501 9410 gene locus_tag LOCUS_31410 10501 9410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 12672 10498 gene locus_tag LOCUS_31420 12672 10498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 14844 12697 gene locus_tag LOCUS_31430 14844 12697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 16797 15256 gene locus_tag LOCUS_31440 gene lnt 16797 15256 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_31440 17724 16873 gene locus_tag LOCUS_31450 17724 16873 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942919.1 protein_id gnl|my_center|LOCUS_31450 18080 19486 gene locus_tag LOCUS_31460 18080 19486 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939501.1 protein_id gnl|my_center|LOCUS_31460 19689 21938 gene locus_tag LOCUS_31470 19689 21938 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939500.1 protein_id gnl|my_center|LOCUS_31470 22121 21945 gene locus_tag LOCUS_31480 22121 21945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 22120 22770 gene locus_tag LOCUS_31490 22120 22770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939499.1 protein_id gnl|my_center|LOCUS_31490 22813 23778 gene locus_tag LOCUS_31500 22813 23778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 23779 24654 gene locus_tag LOCUS_31510 23779 24654 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099029.1 protein_id gnl|my_center|LOCUS_31510 25880 24621 gene locus_tag LOCUS_31520 25880 24621 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931796.1 protein_id gnl|my_center|LOCUS_31520 26065 27075 gene locus_tag LOCUS_31530 gene fbp 26065 27075 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939127.1 protein_id gnl|my_center|LOCUS_31530 29163 27154 gene locus_tag LOCUS_31540 29163 27154 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941958.1 protein_id gnl|my_center|LOCUS_31540 31021 29336 gene locus_tag LOCUS_31550 31021 29336 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943977.1 protein_id gnl|my_center|LOCUS_31550 >Feature sequence52 278 84 gene locus_tag LOCUS_31560 278 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 174 1001 gene locus_tag LOCUS_31570 gene rsmI 174 1001 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941314.1 protein_id gnl|my_center|LOCUS_31570 1114 1788 gene locus_tag LOCUS_31580 1114 1788 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939535.1 protein_id gnl|my_center|LOCUS_31580 1851 2600 gene locus_tag LOCUS_31590 1851 2600 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_31590 2601 3107 gene locus_tag LOCUS_31600 gene ruvC 2601 3107 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196340.1 protein_id gnl|my_center|LOCUS_31600 3107 3715 gene locus_tag LOCUS_31610 gene ruvA 3107 3715 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707372.1 protein_id gnl|my_center|LOCUS_31610 3712 4776 gene locus_tag LOCUS_31620 gene ruvB 3712 4776 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_31620 4916 5749 gene locus_tag LOCUS_31630 gene panB 4916 5749 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_31630 5787 6386 gene locus_tag LOCUS_31640 5787 6386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 6383 7228 gene locus_tag LOCUS_31650 6383 7228 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393766.1 protein_id gnl|my_center|LOCUS_31650 7228 7818 gene locus_tag LOCUS_31660 7228 7818 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393765.1 protein_id gnl|my_center|LOCUS_31660 9233 7827 gene locus_tag LOCUS_31670 9233 7827 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_31670 10639 9359 gene locus_tag LOCUS_31680 10639 9359 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942417.1 protein_id gnl|my_center|LOCUS_31680 11549 10662 gene locus_tag LOCUS_31690 gene ftsX 11549 10662 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942418.1 protein_id gnl|my_center|LOCUS_31690 12290 11586 gene locus_tag LOCUS_31700 gene ftsE 12290 11586 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768285.1 protein_id gnl|my_center|LOCUS_31700 12590 13609 gene locus_tag LOCUS_31710 12590 13609 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924797.1 protein_id gnl|my_center|LOCUS_31710 13584 15704 gene locus_tag LOCUS_31720 13584 15704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 15812 17233 gene locus_tag LOCUS_31730 15812 17233 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842237.1 protein_id gnl|my_center|LOCUS_31730 17505 17891 gene locus_tag LOCUS_31740 17505 17891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 17894 18334 gene locus_tag LOCUS_31750 gene flgC 17894 18334 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941076.1 protein_id gnl|my_center|LOCUS_31750 18396 18698 gene locus_tag LOCUS_31760 18396 18698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 18878 20479 gene locus_tag LOCUS_31770 gene fliF 18878 20479 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941078.1 protein_id gnl|my_center|LOCUS_31770 20481 21512 gene locus_tag LOCUS_31780 gene fliG 20481 21512 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937619.1 protein_id gnl|my_center|LOCUS_31780 21505 22227 gene locus_tag LOCUS_31790 21505 22227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 22229 23536 gene locus_tag LOCUS_31800 gene fliI 22229 23536 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 protein_id gnl|my_center|LOCUS_31800 23542 23988 gene locus_tag LOCUS_31810 23542 23988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 23997 24482 gene locus_tag LOCUS_31820 23997 24482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 24851 26650 gene locus_tag LOCUS_31830 24851 26650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 26677 27345 gene locus_tag LOCUS_31840 gene flgD 26677 27345 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946950.1 protein_id gnl|my_center|LOCUS_31840 27521 29962 gene locus_tag LOCUS_31850 27521 29962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 >Feature sequence53 7238 1887 gene locus_tag LOCUS_31860 7238 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 8392 7328 gene locus_tag LOCUS_31870 8392 7328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 9048 8554 gene locus_tag LOCUS_31880 9048 8554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 10139 11158 gene locus_tag LOCUS_31890 10139 11158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 11891 11538 gene locus_tag LOCUS_31900 11891 11538 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617906.1 protein_id gnl|my_center|LOCUS_31900 12151 11885 gene locus_tag LOCUS_31910 12151 11885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 13508 12309 gene locus_tag LOCUS_31920 13508 12309 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958509.1 protein_id gnl|my_center|LOCUS_31920 13642 13851 gene locus_tag LOCUS_31930 13642 13851 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878572.1 protein_id gnl|my_center|LOCUS_31930 14684 14094 gene locus_tag LOCUS_31940 14684 14094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 15713 14829 gene locus_tag LOCUS_31950 15713 14829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 16129 15875 gene locus_tag LOCUS_31960 16129 15875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 16349 16122 gene locus_tag LOCUS_31970 16349 16122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 16681 17640 gene locus_tag LOCUS_31980 16681 17640 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948817.1 protein_id gnl|my_center|LOCUS_31980 17654 18112 gene locus_tag LOCUS_31990 17654 18112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 18137 19126 gene locus_tag LOCUS_32000 18137 19126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 19246 19623 gene locus_tag LOCUS_32010 gene crcB 19246 19623 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405171.1 protein_id gnl|my_center|LOCUS_32010 19635 20921 gene locus_tag LOCUS_32020 19635 20921 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258332.1 protein_id gnl|my_center|LOCUS_32020 22235 21063 gene locus_tag LOCUS_32030 22235 21063 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742961.1 protein_id gnl|my_center|LOCUS_32030 22433 22732 gene locus_tag LOCUS_32040 22433 22732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 24167 22899 gene locus_tag LOCUS_32050 gene aroA 24167 22899 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072383.1 protein_id gnl|my_center|LOCUS_32050 25011 24193 gene locus_tag LOCUS_32060 25011 24193 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892481.1 protein_id gnl|my_center|LOCUS_32060 25714 25001 gene locus_tag LOCUS_32070 gene aroD 25714 25001 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083186615.1 protein_id gnl|my_center|LOCUS_32070 27025 27270 gene locus_tag LOCUS_32080 27025 27270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 27612 27361 gene locus_tag LOCUS_32090 27612 27361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 27685 29064 gene locus_tag LOCUS_32100 27685 29064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 >Feature sequence54 209 682 gene locus_tag LOCUS_32110 209 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 933 2780 gene locus_tag LOCUS_32120 933 2780 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546388.1 protein_id gnl|my_center|LOCUS_32120 2879 2782 gene locus_tag LOCUS_t00340 2879 2782 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 3102 3458 gene locus_tag LOCUS_32130 3102 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 3895 4248 gene locus_tag LOCUS_32140 3895 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 4245 6137 gene locus_tag LOCUS_32150 4245 6137 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250548.1 protein_id gnl|my_center|LOCUS_32150 6140 6358 gene locus_tag LOCUS_32160 6140 6358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 6360 6947 gene locus_tag LOCUS_32170 6360 6947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 6981 7856 gene locus_tag LOCUS_32180 6981 7856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 7853 8173 gene locus_tag LOCUS_32190 7853 8173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 8244 9851 gene locus_tag LOCUS_32200 8244 9851 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887345.1 protein_id gnl|my_center|LOCUS_32200 9893 11221 gene locus_tag LOCUS_32210 9893 11221 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_32210 11218 11829 gene locus_tag LOCUS_32220 11218 11829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 12473 12003 gene locus_tag LOCUS_32230 12473 12003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 13462 12470 gene locus_tag LOCUS_32240 13462 12470 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327978.1 protein_id gnl|my_center|LOCUS_32240 14451 13471 gene locus_tag LOCUS_32250 14451 13471 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103113.1 protein_id gnl|my_center|LOCUS_32250 15719 14490 gene locus_tag LOCUS_32260 gene ablA 15719 14490 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_32260 16246 16031 gene locus_tag LOCUS_32270 16246 16031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 16439 18742 gene locus_tag LOCUS_32280 16439 18742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 18750 19385 gene locus_tag LOCUS_32290 18750 19385 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545227.1 protein_id gnl|my_center|LOCUS_32290 19889 19431 gene locus_tag LOCUS_32300 19889 19431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 20318 19908 gene locus_tag LOCUS_32310 20318 19908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941821.1 protein_id gnl|my_center|LOCUS_32310 20509 21663 gene locus_tag LOCUS_32320 20509 21663 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206889.1 protein_id gnl|my_center|LOCUS_32320 21753 22694 gene locus_tag LOCUS_32330 21753 22694 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020817.1 protein_id gnl|my_center|LOCUS_32330 23332 22742 gene locus_tag LOCUS_32340 23332 22742 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880618.1 protein_id gnl|my_center|LOCUS_32340 24914 23316 gene locus_tag LOCUS_32350 24914 23316 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256102.1 protein_id gnl|my_center|LOCUS_32350 26140 24932 gene locus_tag LOCUS_32360 26140 24932 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869039.1 protein_id gnl|my_center|LOCUS_32360 26679 27341 gene locus_tag LOCUS_32370 26679 27341 CDS product DUF2202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870259.1 protein_id gnl|my_center|LOCUS_32370 >Feature sequence55 330 587 gene locus_tag LOCUS_32380 330 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 616 861 gene locus_tag LOCUS_32390 616 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 984 1217 gene locus_tag LOCUS_32400 984 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 1214 1525 gene locus_tag LOCUS_32410 1214 1525 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020159.1 protein_id gnl|my_center|LOCUS_32410 1522 1881 gene locus_tag LOCUS_32420 1522 1881 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546363.1 protein_id gnl|my_center|LOCUS_32420 2348 3130 gene locus_tag LOCUS_32430 gene rfbA 2348 3130 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721498.1 protein_id gnl|my_center|LOCUS_32430 3141 4073 gene locus_tag LOCUS_32440 3141 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 4096 5445 gene locus_tag LOCUS_32450 4096 5445 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122761.1 protein_id gnl|my_center|LOCUS_32450 5442 6035 gene locus_tag LOCUS_32460 5442 6035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 6110 7009 gene locus_tag LOCUS_32470 6110 7009 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403764.1 protein_id gnl|my_center|LOCUS_32470 7019 7966 gene locus_tag LOCUS_32480 7019 7966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 7963 9126 gene locus_tag LOCUS_32490 7963 9126 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936352.1 protein_id gnl|my_center|LOCUS_32490 9123 10283 gene locus_tag LOCUS_32500 9123 10283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 10671 11159 gene locus_tag LOCUS_32510 10671 11159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 11498 11349 gene locus_tag LOCUS_32520 11498 11349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 11651 12418 gene locus_tag LOCUS_32530 11651 12418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 12420 13520 gene locus_tag LOCUS_32540 12420 13520 CDS product DUF1972 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172642.1 protein_id gnl|my_center|LOCUS_32540 14918 13494 gene locus_tag LOCUS_32550 14918 13494 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020109.1 protein_id gnl|my_center|LOCUS_32550 15751 15443 gene locus_tag LOCUS_32560 15751 15443 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546363.1 protein_id gnl|my_center|LOCUS_32560 16034 15744 gene locus_tag LOCUS_32570 16034 15744 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546611.1 protein_id gnl|my_center|LOCUS_32570 16309 16091 gene locus_tag LOCUS_32580 16309 16091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 16704 16306 gene locus_tag LOCUS_32590 16704 16306 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402858.1 protein_id gnl|my_center|LOCUS_32590 18136 16976 gene locus_tag LOCUS_32600 18136 16976 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_32600 18590 20122 gene locus_tag LOCUS_32610 18590 20122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 20147 21553 gene locus_tag LOCUS_32620 20147 21553 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_32620 21772 22086 gene locus_tag LOCUS_32630 21772 22086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 22083 23300 gene locus_tag LOCUS_32640 22083 23300 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929595.1 protein_id gnl|my_center|LOCUS_32640 25575 23362 gene locus_tag LOCUS_32650 25575 23362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 27619 25922 gene locus_tag LOCUS_32660 27619 25922 CDS product bifunctional sulfate adenylyltransferase/adenylylsulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722319.1 protein_id gnl|my_center|LOCUS_32660 >Feature sequence56 1121 87 gene locus_tag LOCUS_32670 1121 87 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922567.1 protein_id gnl|my_center|LOCUS_32670 1931 1128 gene locus_tag LOCUS_32680 1931 1128 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121724.1 protein_id gnl|my_center|LOCUS_32680 2435 1971 gene locus_tag LOCUS_32690 2435 1971 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922123.1 protein_id gnl|my_center|LOCUS_32690 3156 2416 gene locus_tag LOCUS_32700 gene fabG 3156 2416 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_32700 4565 3159 gene locus_tag LOCUS_32710 4565 3159 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921402.1 protein_id gnl|my_center|LOCUS_32710 6076 4685 gene locus_tag LOCUS_32720 6076 4685 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118443.1 protein_id gnl|my_center|LOCUS_32720 6337 6086 gene locus_tag LOCUS_32730 6337 6086 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921431.1 protein_id gnl|my_center|LOCUS_32730 7632 6385 gene locus_tag LOCUS_32740 7632 6385 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325817.1 protein_id gnl|my_center|LOCUS_32740 9770 7854 gene locus_tag LOCUS_32750 9770 7854 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946701.1 protein_id gnl|my_center|LOCUS_32750 10828 9812 gene locus_tag LOCUS_32760 10828 9812 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113413.1 protein_id gnl|my_center|LOCUS_32760 11754 10825 gene locus_tag LOCUS_32770 11754 10825 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433078.1 protein_id gnl|my_center|LOCUS_32770 13085 11805 gene locus_tag LOCUS_32780 13085 11805 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532721.1 protein_id gnl|my_center|LOCUS_32780 13884 13129 gene locus_tag LOCUS_32790 13884 13129 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356900.1 protein_id gnl|my_center|LOCUS_32790 16028 13926 gene locus_tag LOCUS_32800 16028 13926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 17000 16029 gene locus_tag LOCUS_32810 17000 16029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 18106 16997 gene locus_tag LOCUS_32820 18106 16997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 18685 19041 gene locus_tag LOCUS_32830 18685 19041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 19652 19053 gene locus_tag LOCUS_32840 19652 19053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 20826 19675 gene locus_tag LOCUS_32850 20826 19675 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808458.1 protein_id gnl|my_center|LOCUS_32850 22043 20823 gene locus_tag LOCUS_32860 22043 20823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 22841 22140 gene locus_tag LOCUS_32870 22841 22140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 23925 22834 gene locus_tag LOCUS_32880 23925 22834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 25695 23929 gene locus_tag LOCUS_32890 25695 23929 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698821.1 protein_id gnl|my_center|LOCUS_32890 27473 25800 gene locus_tag LOCUS_32900 27473 25800 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020110.1 protein_id gnl|my_center|LOCUS_32900 >Feature sequence57 956 399 gene locus_tag LOCUS_32910 956 399 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933341.1 protein_id gnl|my_center|LOCUS_32910 1157 2554 gene locus_tag LOCUS_32920 gene asnS 1157 2554 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058304.1 protein_id gnl|my_center|LOCUS_32920 2587 3294 gene locus_tag LOCUS_32930 2587 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 3291 4268 gene locus_tag LOCUS_32940 3291 4268 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966723.1 protein_id gnl|my_center|LOCUS_32940 4256 5170 gene locus_tag LOCUS_32950 4256 5170 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840062.1 protein_id gnl|my_center|LOCUS_32950 5895 5173 gene locus_tag LOCUS_32960 5895 5173 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792492.1 protein_id gnl|my_center|LOCUS_32960 6217 6867 gene locus_tag LOCUS_32970 6217 6867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 7534 8073 gene locus_tag LOCUS_32980 7534 8073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 9399 8083 gene locus_tag LOCUS_32990 9399 8083 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715488.1 protein_id gnl|my_center|LOCUS_32990 10313 9426 gene locus_tag LOCUS_33000 10313 9426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 11143 10319 gene locus_tag LOCUS_33010 11143 10319 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986648.1 protein_id gnl|my_center|LOCUS_33010 12090 11197 gene locus_tag LOCUS_33020 12090 11197 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986648.1 protein_id gnl|my_center|LOCUS_33020 13327 12053 gene locus_tag LOCUS_33030 13327 12053 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879290.1 protein_id gnl|my_center|LOCUS_33030 14056 13406 gene locus_tag LOCUS_33040 14056 13406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 14904 14068 gene locus_tag LOCUS_33050 14904 14068 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938969.1 protein_id gnl|my_center|LOCUS_33050 16514 15102 gene locus_tag LOCUS_33060 16514 15102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 18891 16516 gene locus_tag LOCUS_33070 18891 16516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 19798 21876 gene locus_tag LOCUS_33080 19798 21876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 22068 21877 gene locus_tag LOCUS_33090 22068 21877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 22197 22631 gene locus_tag LOCUS_33100 22197 22631 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670476.1 protein_id gnl|my_center|LOCUS_33100 <26460 22804 gene locus_tag LOCUS_33110 <26460 22804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251214.1:transglutaminase-like domain-containing protein >Feature sequence58 149 1069 gene locus_tag LOCUS_33120 149 1069 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941492.1 protein_id gnl|my_center|LOCUS_33120 1188 1547 gene locus_tag LOCUS_33130 1188 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 1620 2294 gene locus_tag LOCUS_33140 1620 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 3406 2408 gene locus_tag LOCUS_33150 3406 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 4167 3406 gene locus_tag LOCUS_33160 4167 3406 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256708.1 protein_id gnl|my_center|LOCUS_33160 4849 4157 gene locus_tag LOCUS_33170 4849 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 5501 5352 gene locus_tag LOCUS_33180 5501 5352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 6006 5545 gene locus_tag LOCUS_33190 6006 5545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 6323 6141 gene locus_tag LOCUS_33200 6323 6141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 6543 6358 gene locus_tag LOCUS_33210 6543 6358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 7229 6642 gene locus_tag LOCUS_33220 7229 6642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941488.1 protein_id gnl|my_center|LOCUS_33220 8886 7324 gene locus_tag LOCUS_33230 8886 7324 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946245.1 protein_id gnl|my_center|LOCUS_33230 9090 10358 gene locus_tag LOCUS_33240 9090 10358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 10395 10973 gene locus_tag LOCUS_33250 10395 10973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 11059 11517 gene locus_tag LOCUS_33260 11059 11517 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020586.1 protein_id gnl|my_center|LOCUS_33260 11830 12294 gene locus_tag LOCUS_33270 gene nrfH 11830 12294 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943776.1 protein_id gnl|my_center|LOCUS_33270 12325 13806 gene locus_tag LOCUS_33280 12325 13806 CDS product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943775.1 protein_id gnl|my_center|LOCUS_33280 14201 14395 gene locus_tag LOCUS_33290 14201 14395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 15305 15865 gene locus_tag LOCUS_33300 15305 15865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 16501 17817 gene locus_tag LOCUS_33310 16501 17817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 18047 18820 gene locus_tag LOCUS_33320 18047 18820 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444002.1 protein_id gnl|my_center|LOCUS_33320 19226 19546 gene locus_tag LOCUS_33330 19226 19546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 22243 19577 gene locus_tag LOCUS_33340 22243 19577 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225782.1 protein_id gnl|my_center|LOCUS_33340 22716 25040 gene locus_tag LOCUS_33350 gene lon 22716 25040 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_33350 >Feature sequence59 451 897 gene locus_tag LOCUS_33360 451 897 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970037.1 protein_id gnl|my_center|LOCUS_33360 920 1261 gene locus_tag LOCUS_33370 920 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 1428 1967 gene locus_tag LOCUS_33380 1428 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 2556 2909 gene locus_tag LOCUS_33390 2556 2909 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533874.1 protein_id gnl|my_center|LOCUS_33390 3000 3644 gene locus_tag LOCUS_33400 3000 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 4223 5785 gene locus_tag LOCUS_33410 4223 5785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 5887 7134 gene locus_tag LOCUS_33420 5887 7134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 7141 7656 gene locus_tag LOCUS_33430 7141 7656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 7906 10878 gene locus_tag LOCUS_33440 7906 10878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 11043 14129 gene locus_tag LOCUS_33450 11043 14129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294648.1 protein_id gnl|my_center|LOCUS_33450 14639 14436 gene locus_tag LOCUS_33460 14639 14436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 15039 16415 gene locus_tag LOCUS_33470 15039 16415 CDS product peptidoglycan O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881300.1 protein_id gnl|my_center|LOCUS_33470 16427 17965 gene locus_tag LOCUS_33480 16427 17965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 19592 18072 gene locus_tag LOCUS_33490 19592 18072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 20329 19655 gene locus_tag LOCUS_33500 20329 19655 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_33500 21501 20416 gene locus_tag LOCUS_33510 21501 20416 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_33510 22475 23707 gene locus_tag LOCUS_33520 22475 23707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 23744 24277 gene locus_tag LOCUS_33530 23744 24277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 >Feature sequence60 3684 1897 gene locus_tag LOCUS_33540 gene kdpA 3684 1897 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943117.1 protein_id gnl|my_center|LOCUS_33540 6932 4143 gene locus_tag LOCUS_33550 6932 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 9743 6996 gene locus_tag LOCUS_33560 9743 6996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 10232 13918 gene locus_tag LOCUS_33570 10232 13918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 13919 14587 gene locus_tag LOCUS_33580 13919 14587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 15667 14738 gene locus_tag LOCUS_33590 15667 14738 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932553.1 protein_id gnl|my_center|LOCUS_33590 15835 15996 gene locus_tag LOCUS_33600 15835 15996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 15996 16424 gene locus_tag LOCUS_33610 gene aprB 15996 16424 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938146.1 protein_id gnl|my_center|LOCUS_33610 16480 18495 gene locus_tag LOCUS_33620 gene aprA 16480 18495 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938147.1 protein_id gnl|my_center|LOCUS_33620 18794 20050 gene locus_tag LOCUS_33630 18794 20050 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932547.1 protein_id gnl|my_center|LOCUS_33630 20062 22326 gene locus_tag LOCUS_33640 20062 22326 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938149.1 protein_id gnl|my_center|LOCUS_33640 22467 23654 gene locus_tag LOCUS_33650 gene qmoC 22467 23654 CDS product quinone-interacting membrane-bound oxidoreductase complex subunit QmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938150.1 protein_id gnl|my_center|LOCUS_33650 23900 23975 gene locus_tag LOCUS_t00350 23900 23975 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 24048 24132 gene locus_tag LOCUS_t00360 24048 24132 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 24200 24275 gene locus_tag LOCUS_t00370 24200 24275 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 24349 24424 gene locus_tag LOCUS_t00380 24349 24424 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence61 2906 1077 gene locus_tag LOCUS_33660 2906 1077 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390914.1 protein_id gnl|my_center|LOCUS_33660 4603 2993 gene locus_tag LOCUS_33670 4603 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 4871 6154 gene locus_tag LOCUS_33680 4871 6154 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942548.1 protein_id gnl|my_center|LOCUS_33680 6263 6778 gene locus_tag LOCUS_33690 6263 6778 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942547.1 protein_id gnl|my_center|LOCUS_33690 7255 7971 gene locus_tag LOCUS_33700 7255 7971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 7989 8597 gene locus_tag LOCUS_33710 7989 8597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 8812 10158 gene locus_tag LOCUS_33720 gene rlmD 8812 10158 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694340.1 protein_id gnl|my_center|LOCUS_33720 11522 10353 gene locus_tag LOCUS_33730 11522 10353 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393460.1 protein_id gnl|my_center|LOCUS_33730 12028 11519 gene locus_tag LOCUS_33740 12028 11519 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941194.1 protein_id gnl|my_center|LOCUS_33740 13004 12000 gene locus_tag LOCUS_33750 13004 12000 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258797.1 protein_id gnl|my_center|LOCUS_33750 13216 13602 gene locus_tag LOCUS_33760 13216 13602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 13804 15192 gene locus_tag LOCUS_33770 13804 15192 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946753.1 protein_id gnl|my_center|LOCUS_33770 15213 16736 gene locus_tag LOCUS_33780 15213 16736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 16810 18342 gene locus_tag LOCUS_33790 16810 18342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 18339 21647 gene locus_tag LOCUS_33800 18339 21647 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946755.1 protein_id gnl|my_center|LOCUS_33800 21644 22174 gene locus_tag LOCUS_33810 21644 22174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 22333 22971 gene locus_tag LOCUS_33820 22333 22971 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404330.1 protein_id gnl|my_center|LOCUS_33820 23057 23524 gene locus_tag LOCUS_33830 23057 23524 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388985.1 protein_id gnl|my_center|LOCUS_33830 23606 23959 gene locus_tag LOCUS_33840 23606 23959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 >Feature sequence62 372 1109 gene locus_tag LOCUS_33850 372 1109 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766271.1 protein_id gnl|my_center|LOCUS_33850 1129 1638 gene locus_tag LOCUS_33860 1129 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 3356 1659 gene locus_tag LOCUS_33870 3356 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 3817 4908 gene locus_tag LOCUS_33880 3817 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 6270 5026 gene locus_tag LOCUS_33890 6270 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 7109 9319 gene locus_tag LOCUS_33900 7109 9319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 9381 11090 gene locus_tag LOCUS_33910 9381 11090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 11978 11127 gene locus_tag LOCUS_33920 11978 11127 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_33920 12824 11982 gene locus_tag LOCUS_33930 12824 11982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 13107 14507 gene locus_tag LOCUS_33940 13107 14507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 15636 14935 gene locus_tag LOCUS_33950 15636 14935 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943589.1 protein_id gnl|my_center|LOCUS_33950 16025 15642 gene locus_tag LOCUS_33960 16025 15642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 17742 16459 gene locus_tag LOCUS_33970 17742 16459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 18688 17975 gene locus_tag LOCUS_33980 18688 17975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 19994 18750 gene locus_tag LOCUS_33990 19994 18750 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039709.1 protein_id gnl|my_center|LOCUS_33990 20691 19987 gene locus_tag LOCUS_34000 20691 19987 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190866.1 protein_id gnl|my_center|LOCUS_34000 21986 21039 gene locus_tag LOCUS_34010 21986 21039 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545025.1 protein_id gnl|my_center|LOCUS_34010 22466 21987 gene locus_tag LOCUS_34020 22466 21987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 23064 22636 gene locus_tag LOCUS_34030 23064 22636 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938935.1 protein_id gnl|my_center|LOCUS_34030 23304 23074 gene locus_tag LOCUS_34040 23304 23074 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023834.1 protein_id gnl|my_center|LOCUS_34040 >Feature sequence63 224 577 gene locus_tag LOCUS_34050 224 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 984 799 gene locus_tag LOCUS_34060 984 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 1132 1533 gene locus_tag LOCUS_34070 1132 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 1676 3025 gene locus_tag LOCUS_34080 gene rimO 1676 3025 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_34080 3367 3086 gene locus_tag LOCUS_34090 3367 3086 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_34090 4325 3609 gene locus_tag LOCUS_34100 4325 3609 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_34100 4790 4356 gene locus_tag LOCUS_34110 4790 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 6696 4915 gene locus_tag LOCUS_34120 6696 4915 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695320.1 protein_id gnl|my_center|LOCUS_34120 6944 6696 gene locus_tag LOCUS_34130 6944 6696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 7011 7757 gene locus_tag LOCUS_34140 7011 7757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 8190 7795 gene locus_tag LOCUS_34150 8190 7795 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545896.1 protein_id gnl|my_center|LOCUS_34150 8369 9007 gene locus_tag LOCUS_34160 8369 9007 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545344.1 protein_id gnl|my_center|LOCUS_34160 9013 9699 gene locus_tag LOCUS_34170 9013 9699 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 protein_id gnl|my_center|LOCUS_34170 9812 10621 gene locus_tag LOCUS_34180 gene ccsB 9812 10621 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_34180 10611 11897 gene locus_tag LOCUS_34190 gene hemA 10611 11897 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938754.1 protein_id gnl|my_center|LOCUS_34190 12226 12585 gene locus_tag LOCUS_34200 gene rnpA 12226 12585 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070422.1 protein_id gnl|my_center|LOCUS_34200 12634 12846 gene locus_tag LOCUS_34210 gene yidD 12634 12846 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016065.1 protein_id gnl|my_center|LOCUS_34210 12859 14517 gene locus_tag LOCUS_34220 gene yidC 12859 14517 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944075.1 protein_id gnl|my_center|LOCUS_34220 14585 15490 gene locus_tag LOCUS_34230 14585 15490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 15543 16955 gene locus_tag LOCUS_34240 gene mnmE 15543 16955 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944074.1 protein_id gnl|my_center|LOCUS_34240 16959 18503 gene locus_tag LOCUS_34250 16959 18503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 18709 18548 gene locus_tag LOCUS_34260 18709 18548 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081114.1 protein_id gnl|my_center|LOCUS_34260 18838 19362 gene locus_tag LOCUS_34270 gene hpt 18838 19362 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_34270 19417 20781 gene locus_tag LOCUS_34280 gene bioA 19417 20781 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048655595.1 protein_id gnl|my_center|LOCUS_34280 20781 21725 gene locus_tag LOCUS_34290 20781 21725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 21807 21883 gene locus_tag LOCUS_t00390 21807 21883 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 22991 21924 gene locus_tag LOCUS_34300 22991 21924 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007697.1 protein_id gnl|my_center|LOCUS_34300 >Feature sequence64 175 627 gene locus_tag LOCUS_34310 175 627 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083256.1 protein_id gnl|my_center|LOCUS_34310 1352 636 gene locus_tag LOCUS_34320 1352 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 2302 1478 gene locus_tag LOCUS_34330 2302 1478 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942280.1 protein_id gnl|my_center|LOCUS_34330 3011 2295 gene locus_tag LOCUS_34340 3011 2295 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937454.1 protein_id gnl|my_center|LOCUS_34340 5596 3008 gene locus_tag LOCUS_34350 gene secDF 5596 3008 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531306.1 protein_id gnl|my_center|LOCUS_34350 5954 6337 gene locus_tag LOCUS_34360 gene rsfS 5954 6337 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775847.1 protein_id gnl|my_center|LOCUS_34360 6395 7780 gene locus_tag LOCUS_34370 gene thrC 6395 7780 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942338.1 protein_id gnl|my_center|LOCUS_34370 8052 8390 gene locus_tag LOCUS_34380 8052 8390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 9806 8463 gene locus_tag LOCUS_34390 gene xseA 9806 8463 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_34390 10224 10901 gene locus_tag LOCUS_34400 10224 10901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 10907 11755 gene locus_tag LOCUS_34410 gene panC 10907 11755 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942350.1 protein_id gnl|my_center|LOCUS_34410 11778 12176 gene locus_tag LOCUS_34420 11778 12176 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810617.1 protein_id gnl|my_center|LOCUS_34420 12178 12843 gene locus_tag LOCUS_34430 gene mqnB 12178 12843 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136796951.1 protein_id gnl|my_center|LOCUS_34430 12901 13734 gene locus_tag LOCUS_34440 12901 13734 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941121.1 protein_id gnl|my_center|LOCUS_34440 14078 15778 gene locus_tag LOCUS_34450 gene ilvB 14078 15778 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545836.1 protein_id gnl|my_center|LOCUS_34450 15814 16299 gene locus_tag LOCUS_34460 gene ilvN 15814 16299 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942555.1 protein_id gnl|my_center|LOCUS_34460 16446 17090 gene locus_tag LOCUS_34470 16446 17090 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942553.1 protein_id gnl|my_center|LOCUS_34470 17133 18686 gene locus_tag LOCUS_34480 17133 18686 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_34480 18690 19718 gene locus_tag LOCUS_34490 18690 19718 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545714.1 protein_id gnl|my_center|LOCUS_34490 19786 20367 gene locus_tag LOCUS_34500 gene rsmD 19786 20367 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941900.1 protein_id gnl|my_center|LOCUS_34500 20360 20884 gene locus_tag LOCUS_34510 gene coaD 20360 20884 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938824.1 protein_id gnl|my_center|LOCUS_34510 21102 21560 gene locus_tag LOCUS_34520 21102 21560 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942294.1 protein_id gnl|my_center|LOCUS_34520 21576 22406 gene locus_tag LOCUS_34530 21576 22406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 >Feature sequence65 1691 249 gene locus_tag LOCUS_34540 1691 249 CDS product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943871.1 protein_id gnl|my_center|LOCUS_34540 3214 1748 gene locus_tag LOCUS_34550 3214 1748 CDS product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943871.1 protein_id gnl|my_center|LOCUS_34550 3691 3470 gene locus_tag LOCUS_34560 3691 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 3981 3748 gene locus_tag LOCUS_34570 3981 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 4505 6358 gene locus_tag LOCUS_34580 gene ftsH 4505 6358 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545429.1 protein_id gnl|my_center|LOCUS_34580 7699 6359 gene locus_tag LOCUS_34590 7699 6359 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_34590 9303 7696 gene locus_tag LOCUS_34600 9303 7696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 10455 9757 gene locus_tag LOCUS_34610 10455 9757 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545638.1 protein_id gnl|my_center|LOCUS_34610 10816 10436 gene locus_tag LOCUS_34620 gene queD 10816 10436 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546681.1 protein_id gnl|my_center|LOCUS_34620 10995 12353 gene locus_tag LOCUS_34630 10995 12353 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545699.1 protein_id gnl|my_center|LOCUS_34630 12359 13087 gene locus_tag LOCUS_34640 12359 13087 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356457.1 protein_id gnl|my_center|LOCUS_34640 13278 13096 gene locus_tag LOCUS_34650 13278 13096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 14107 13442 gene locus_tag LOCUS_34660 14107 13442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 14861 14094 gene locus_tag LOCUS_34670 14861 14094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 15984 14899 gene locus_tag LOCUS_34680 gene lptG 15984 14899 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870030.1 protein_id gnl|my_center|LOCUS_34680 17168 15981 gene locus_tag LOCUS_34690 17168 15981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 17401 18936 gene locus_tag LOCUS_34700 17401 18936 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461578.1 protein_id gnl|my_center|LOCUS_34700 21082 18977 gene locus_tag LOCUS_34710 21082 18977 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400611.1 protein_id gnl|my_center|LOCUS_34710 21297 22496 gene locus_tag LOCUS_34720 21297 22496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 >Feature sequence66 1255 953 gene locus_tag LOCUS_34730 1255 953 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545871.1 protein_id gnl|my_center|LOCUS_34730 2309 1554 gene locus_tag LOCUS_34740 gene recO 2309 1554 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047994.1 protein_id gnl|my_center|LOCUS_34740 3370 2309 gene locus_tag LOCUS_34750 3370 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 4455 3451 gene locus_tag LOCUS_34760 4455 3451 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546060.1 protein_id gnl|my_center|LOCUS_34760 8005 4577 gene locus_tag LOCUS_34770 gene mfd 8005 4577 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940695.1 protein_id gnl|my_center|LOCUS_34770 11001 8311 gene locus_tag LOCUS_34780 gene bamA 11001 8311 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_34780 11988 11266 gene locus_tag LOCUS_34790 11988 11266 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_34790 13225 11996 gene locus_tag LOCUS_34800 13225 11996 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_34800 14705 13230 gene locus_tag LOCUS_34810 gene lysS 14705 13230 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791906.1 protein_id gnl|my_center|LOCUS_34810 15929 14808 gene locus_tag LOCUS_34820 15929 14808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392352.1 protein_id gnl|my_center|LOCUS_34820 16101 16186 gene locus_tag LOCUS_t00400 16101 16186 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16310 17644 gene locus_tag LOCUS_34830 gene tig 16310 17644 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942437.1 protein_id gnl|my_center|LOCUS_34830 17641 18243 gene locus_tag LOCUS_34840 gene clpP 17641 18243 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036184.1 protein_id gnl|my_center|LOCUS_34840 18246 19511 gene locus_tag LOCUS_34850 gene clpX 18246 19511 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_34850 19552 21966 gene locus_tag LOCUS_34860 gene lon 19552 21966 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942434.1 protein_id gnl|my_center|LOCUS_34860 22088 22163 gene locus_tag LOCUS_t00410 22088 22163 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 22172 22248 gene locus_tag LOCUS_t00420 22172 22248 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence67 45 629 gene locus_tag LOCUS_34870 45 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 631 1524 gene locus_tag LOCUS_34880 631 1524 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259370.1 protein_id gnl|my_center|LOCUS_34880 1720 3345 gene locus_tag LOCUS_34890 1720 3345 CDS product fatty acid CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259368.1 protein_id gnl|my_center|LOCUS_34890 3346 4347 gene locus_tag LOCUS_34900 3346 4347 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218938748.1 protein_id gnl|my_center|LOCUS_34900 6714 4444 gene locus_tag LOCUS_34910 6714 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 7000 7311 gene locus_tag LOCUS_34920 7000 7311 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_34920 7374 7640 gene locus_tag LOCUS_34930 7374 7640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 7631 7909 gene locus_tag LOCUS_34940 7631 7909 CDS product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967243.1 protein_id gnl|my_center|LOCUS_34940 8041 8331 gene locus_tag LOCUS_34950 8041 8331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 8862 8620 gene locus_tag LOCUS_34960 8862 8620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 10101 9013 gene locus_tag LOCUS_34970 10101 9013 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869354.1 protein_id gnl|my_center|LOCUS_34970 13662 10291 gene locus_tag LOCUS_34980 13662 10291 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414323.1 protein_id gnl|my_center|LOCUS_34980 14189 17854 gene locus_tag LOCUS_34990 14189 17854 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941924.1 protein_id gnl|my_center|LOCUS_34990 19755 17980 gene locus_tag LOCUS_35000 19755 17980 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933466.1 protein_id gnl|my_center|LOCUS_35000 20174 19923 gene locus_tag LOCUS_35010 20174 19923 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_35010 <21635 20407 gene locus_tag LOCUS_35020 <21635 20407 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546484.1:cation/acetate symporter ActP >Feature sequence68 174 326 gene locus_tag LOCUS_35030 gene rpmG 174 326 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943500.1 protein_id gnl|my_center|LOCUS_35030 333 408 gene locus_tag LOCUS_t00430 333 408 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 490 756 gene locus_tag LOCUS_35040 490 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 800 1330 gene locus_tag LOCUS_35050 gene nusG 800 1330 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943498.1 protein_id gnl|my_center|LOCUS_35050 1401 1826 gene locus_tag LOCUS_35060 gene rplK 1401 1826 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_35060 1849 2559 gene locus_tag LOCUS_35070 gene rplA 1849 2559 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943496.1 protein_id gnl|my_center|LOCUS_35070 2917 3444 gene locus_tag LOCUS_35080 gene rplJ 2917 3444 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806888.1 protein_id gnl|my_center|LOCUS_35080 3485 3862 gene locus_tag LOCUS_35090 gene rplL 3485 3862 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940187.1 protein_id gnl|my_center|LOCUS_35090 4072 8157 gene locus_tag LOCUS_35100 gene rpoB 4072 8157 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943493.1 protein_id gnl|my_center|LOCUS_35100 8269 12330 gene locus_tag LOCUS_35110 gene rpoC 8269 12330 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_35110 12485 12856 gene locus_tag LOCUS_35120 gene rpsL 12485 12856 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938593.1 protein_id gnl|my_center|LOCUS_35120 12894 13367 gene locus_tag LOCUS_35130 gene rpsG 12894 13367 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306266.1 protein_id gnl|my_center|LOCUS_35130 13582 15519 gene locus_tag LOCUS_35140 gene fusA 13582 15519 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_35140 15547 16737 gene locus_tag LOCUS_35150 gene tuf 15547 16737 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943488.1 protein_id gnl|my_center|LOCUS_35150 >Feature sequence69 369 1340 gene locus_tag LOCUS_35160 369 1340 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_35160 1601 5146 gene locus_tag LOCUS_35170 gene nifJ 1601 5146 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940774.1 protein_id gnl|my_center|LOCUS_35170 7418 5304 gene locus_tag LOCUS_35180 7418 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 7815 7423 gene locus_tag LOCUS_35190 7815 7423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 8396 7833 gene locus_tag LOCUS_35200 8396 7833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 9307 8474 gene locus_tag LOCUS_35210 9307 8474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 9889 9320 gene locus_tag LOCUS_35220 9889 9320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 10629 9901 gene locus_tag LOCUS_35230 10629 9901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 11278 10682 gene locus_tag LOCUS_35240 11278 10682 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943840.1 protein_id gnl|my_center|LOCUS_35240 12645 11275 gene locus_tag LOCUS_35250 12645 11275 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943836.1 protein_id gnl|my_center|LOCUS_35250 13390 12656 gene locus_tag LOCUS_35260 13390 12656 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941330.1 protein_id gnl|my_center|LOCUS_35260 13648 14622 gene locus_tag LOCUS_35270 13648 14622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 15674 14685 gene locus_tag LOCUS_35280 15674 14685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 >Feature sequence70 853 140 gene locus_tag LOCUS_35290 853 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 1650 850 gene locus_tag LOCUS_35300 gene bioC 1650 850 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608924.1 protein_id gnl|my_center|LOCUS_35300 2315 1650 gene locus_tag LOCUS_35310 2315 1650 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661279.1 protein_id gnl|my_center|LOCUS_35310 3532 2327 gene locus_tag LOCUS_35320 3532 2327 CDS product XrtA-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044863.1 protein_id gnl|my_center|LOCUS_35320 4443 3619 gene locus_tag LOCUS_35330 4443 3619 CDS product XrtA-associated tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942627.1 protein_id gnl|my_center|LOCUS_35330 6123 4561 gene locus_tag LOCUS_35340 6123 4561 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942628.1 protein_id gnl|my_center|LOCUS_35340 7466 6312 gene locus_tag LOCUS_35350 7466 6312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 8041 7463 gene locus_tag LOCUS_35360 8041 7463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 10504 8156 gene locus_tag LOCUS_35370 10504 8156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 10727 12160 gene locus_tag LOCUS_35380 gene qseE 10727 12160 CDS product two component system sensor histidine kinase QseE/GlrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309666.1 protein_id gnl|my_center|LOCUS_35380 12157 12714 gene locus_tag LOCUS_35390 12157 12714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 12704 14068 gene locus_tag LOCUS_35400 gene glrR 12704 14068 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172694.1 protein_id gnl|my_center|LOCUS_35400 >Feature sequence71 1106 534 gene locus_tag LOCUS_35410 1106 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 2128 1103 gene locus_tag LOCUS_35420 gene pdxA 2128 1103 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919557.1 protein_id gnl|my_center|LOCUS_35420 2541 2173 gene locus_tag LOCUS_35430 2541 2173 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_35430 3163 2555 gene locus_tag LOCUS_35440 3163 2555 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941310.1 protein_id gnl|my_center|LOCUS_35440 3537 3190 gene locus_tag LOCUS_35450 gene rplS 3537 3190 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002436293.1 protein_id gnl|my_center|LOCUS_35450 4157 3606 gene locus_tag LOCUS_35460 4157 3606 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813203.1 protein_id gnl|my_center|LOCUS_35460 4948 4208 gene locus_tag LOCUS_35470 gene trmD 4948 4208 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941307.1 protein_id gnl|my_center|LOCUS_35470 5412 4948 gene locus_tag LOCUS_35480 gene rimM 5412 4948 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858943.1 protein_id gnl|my_center|LOCUS_35480 5719 5489 gene locus_tag LOCUS_35490 5719 5489 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_35490 5992 5750 gene locus_tag LOCUS_35500 gene rpsP 5992 5750 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699989.1 protein_id gnl|my_center|LOCUS_35500 7465 6101 gene locus_tag LOCUS_35510 gene ffh 7465 6101 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941303.1 protein_id gnl|my_center|LOCUS_35510 8563 7601 gene locus_tag LOCUS_35520 gene fabD 8563 7601 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938545.1 protein_id gnl|my_center|LOCUS_35520 9109 8615 gene locus_tag LOCUS_35530 gene lspA 9109 8615 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004863699.1 protein_id gnl|my_center|LOCUS_35530 11928 9127 gene locus_tag LOCUS_35540 gene ileS 11928 9127 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943758.1 protein_id gnl|my_center|LOCUS_35540 12330 13091 gene locus_tag LOCUS_35550 12330 13091 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418348.1 protein_id gnl|my_center|LOCUS_35550 >Feature sequence72 748 1527 gene locus_tag LOCUS_35560 748 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 1603 2712 gene locus_tag LOCUS_35570 gene carA 1603 2712 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_35570 2959 6174 gene locus_tag LOCUS_35580 gene carB 2959 6174 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941931.1 protein_id gnl|my_center|LOCUS_35580 6369 8273 gene locus_tag LOCUS_35590 gene ftsH 6369 8273 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938574.1 protein_id gnl|my_center|LOCUS_35590 8299 9153 gene locus_tag LOCUS_35600 gene folP 8299 9153 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545277.1 protein_id gnl|my_center|LOCUS_35600 9179 11122 gene locus_tag LOCUS_35610 9179 11122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 11243 11494 gene locus_tag LOCUS_35620 11243 11494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 12838 11498 gene locus_tag LOCUS_35630 12838 11498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 >Feature sequence73 2496 1597 gene locus_tag LOCUS_35640 gene era 2496 1597 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360270.1 protein_id gnl|my_center|LOCUS_35640 2846 4846 gene locus_tag LOCUS_35650 2846 4846 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056499.1 protein_id gnl|my_center|LOCUS_35650 5134 4910 gene locus_tag LOCUS_35660 5134 4910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_35660 5387 5124 gene locus_tag LOCUS_35670 5387 5124 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589156.1 protein_id gnl|my_center|LOCUS_35670 6994 5861 gene locus_tag LOCUS_35680 6994 5861 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_35680 7528 8511 gene locus_tag LOCUS_35690 7528 8511 CDS product DUF4268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403858.1 protein_id gnl|my_center|LOCUS_35690 8570 9034 gene locus_tag LOCUS_35700 8570 9034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 9466 9687 gene locus_tag LOCUS_35710 9466 9687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 9728 9934 gene locus_tag LOCUS_35720 9728 9934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 9931 10239 gene locus_tag LOCUS_35730 9931 10239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 10444 11229 gene locus_tag LOCUS_35740 10444 11229 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092159.1 protein_id gnl|my_center|LOCUS_35740 11430 11969 gene locus_tag LOCUS_35750 11430 11969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35750 11869 12183 gene locus_tag LOCUS_35760 11869 12183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35760 12625 12455 gene locus_tag LOCUS_35770 12625 12455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 >Feature sequence74 1375 431 gene locus_tag LOCUS_35780 1375 431 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545320.1 protein_id gnl|my_center|LOCUS_35780 3162 1390 gene locus_tag LOCUS_35790 3162 1390 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546477.1 protein_id gnl|my_center|LOCUS_35790 3711 3163 gene locus_tag LOCUS_35800 gene thpR 3711 3163 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391396.1 protein_id gnl|my_center|LOCUS_35800 3938 3765 gene locus_tag LOCUS_35810 3938 3765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 4568 4981 gene locus_tag LOCUS_35820 4568 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942792.1 protein_id gnl|my_center|LOCUS_35820 5220 5663 gene locus_tag LOCUS_35830 5220 5663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 5922 6341 gene locus_tag LOCUS_35840 5922 6341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 6666 7994 gene locus_tag LOCUS_35850 6666 7994 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113317.1 protein_id gnl|my_center|LOCUS_35850 7984 9417 gene locus_tag LOCUS_35860 7984 9417 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942781.1 protein_id gnl|my_center|LOCUS_35860 9428 12517 gene locus_tag LOCUS_35870 9428 12517 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941497.1 protein_id gnl|my_center|LOCUS_35870 >Feature sequence75 899 369 gene locus_tag LOCUS_35880 899 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 3229 896 gene locus_tag LOCUS_35890 3229 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 4190 3243 gene locus_tag LOCUS_35900 4190 3243 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939207.1 protein_id gnl|my_center|LOCUS_35900 6095 4497 gene locus_tag LOCUS_35910 6095 4497 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460064.1 protein_id gnl|my_center|LOCUS_35910 9133 6575 gene locus_tag LOCUS_35920 9133 6575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 >Feature sequence76 1884 895 gene locus_tag LOCUS_35930 1884 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 3340 2399 gene locus_tag LOCUS_35940 3340 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 4824 3436 gene locus_tag LOCUS_35950 4824 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 5541 5281 gene locus_tag LOCUS_35960 5541 5281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 5634 5909 gene locus_tag LOCUS_35970 5634 5909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 7116 6247 gene locus_tag LOCUS_35980 7116 6247 CDS product DUF4824 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114161.1 protein_id gnl|my_center|LOCUS_35980 8189 7113 gene locus_tag LOCUS_35990 8189 7113 CDS product DUF2157 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114162.1 protein_id gnl|my_center|LOCUS_35990 8361 8167 gene locus_tag LOCUS_36000 8361 8167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 8683 8309 gene locus_tag LOCUS_36010 8683 8309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 9137 8841 gene locus_tag LOCUS_36020 9137 8841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 9627 9319 gene locus_tag LOCUS_36030 9627 9319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 >Feature sequence77 1112 711 gene locus_tag LOCUS_36040 1112 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 1269 1487 gene locus_tag LOCUS_36050 1269 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 1895 1560 gene locus_tag LOCUS_36060 1895 1560 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_36060 2166 1876 gene locus_tag LOCUS_36070 2166 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 3961 2549 gene locus_tag LOCUS_36080 3961 2549 CDS product DUF3999 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765555.1 protein_id gnl|my_center|LOCUS_36080 6669 3958 gene locus_tag LOCUS_36090 6669 3958 CDS product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105345.1 protein_id gnl|my_center|LOCUS_36090 8520 6859 gene locus_tag LOCUS_36100 8520 6859 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920935.1 protein_id gnl|my_center|LOCUS_36100 9095 8649 gene locus_tag LOCUS_36110 9095 8649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 >Feature sequence78 2512 2730 gene locus_tag LOCUS_36120 2512 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 3126 2617 gene locus_tag LOCUS_36130 3126 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 5086 3305 gene locus_tag LOCUS_36140 5086 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 6328 5348 gene locus_tag LOCUS_36150 6328 5348 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943443.1 protein_id gnl|my_center|LOCUS_36150 6850 7320 gene locus_tag LOCUS_36160 6850 7320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 7515 8075 gene locus_tag LOCUS_36170 7515 8075 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403898.1 protein_id gnl|my_center|LOCUS_36170 >Feature sequence79 331 528 gene locus_tag LOCUS_36180 331 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 719 644 gene locus_tag LOCUS_t00440 719 644 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1118 1756 gene locus_tag LOCUS_36190 1118 1756 CDS product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419826.1 protein_id gnl|my_center|LOCUS_36190 1807 2445 gene locus_tag LOCUS_36200 gene coaE 1807 2445 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516190.1 protein_id gnl|my_center|LOCUS_36200 2753 2520 gene locus_tag LOCUS_36210 2753 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 2850 4106 gene locus_tag LOCUS_36220 gene rho 2850 4106 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_36220 4258 4467 gene locus_tag LOCUS_36230 gene rpmE 4258 4467 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943728.1 protein_id gnl|my_center|LOCUS_36230 4489 5556 gene locus_tag LOCUS_36240 gene prfA 4489 5556 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943725.1 protein_id gnl|my_center|LOCUS_36240 5689 6543 gene locus_tag LOCUS_36250 gene prmC 5689 6543 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640077.1 protein_id gnl|my_center|LOCUS_36250 6543 7802 gene locus_tag LOCUS_36260 gene murA 6543 7802 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546097.1 protein_id gnl|my_center|LOCUS_36260 >Feature sequence80 188 2428 gene locus_tag LOCUS_36270 188 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 2774 3145 gene locus_tag LOCUS_36280 2774 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 3178 3534 gene locus_tag LOCUS_36290 3178 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 3691 4293 gene locus_tag LOCUS_36300 3691 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 >Feature sequence81 1522 1893 gene locus_tag LOCUS_36310 1522 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 1984 2208 gene locus_tag LOCUS_36320 1984 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 2249 2911 gene locus_tag LOCUS_36330 2249 2911 CDS product sulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400525.1 protein_id gnl|my_center|LOCUS_36330 3804 3178 gene locus_tag LOCUS_36340 3804 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 4512 5705 gene locus_tag LOCUS_36350 gene nrfD 4512 5705 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810041.1 protein_id gnl|my_center|LOCUS_36350 >Feature sequence82 1924 4497 gene locus_tag LOCUS_36360 1924 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 4657 4508 gene locus_tag LOCUS_36370 4657 4508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 5132 5368 gene locus_tag LOCUS_36380 5132 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 5365 5670 gene locus_tag LOCUS_36390 5365 5670 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_36390 >Feature sequence83 264 962 gene locus_tag LOCUS_36400 264 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 1008 3467 gene locus_tag LOCUS_36410 1008 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 3547 4311 gene locus_tag LOCUS_36420 gene prpC 3547 4311 CDS product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 protein_id gnl|my_center|LOCUS_36420 <4935 4375 gene locus_tag LOCUS_36430 <4935 4375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393661.1:molybdenum cofactor guanylyltransferase >Feature sequence84 >Feature sequence85 237 2843 gene locus_tag LOCUS_36440 237 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 >Feature sequence86 <1 597 gene locus_tag LOCUS_36450 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941949.1:methyl-accepting chemotaxis protein 722 1204 gene locus_tag LOCUS_36460 722 1204 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941803.1 protein_id gnl|my_center|LOCUS_36460 >Feature sequence87 201 362 gene locus_tag LOCUS_36470 201 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 359 2458 gene locus_tag LOCUS_36480 359 2458 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082901051.1 protein_id gnl|my_center|LOCUS_36480 2462 3772 gene locus_tag LOCUS_36490 2462 3772 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268198.1 protein_id gnl|my_center|LOCUS_36490 >Feature sequence88 92 307 gene locus_tag LOCUS_36500 92 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 436 2220 gene locus_tag LOCUS_36510 436 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 3406 2537 gene locus_tag LOCUS_36520 3406 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 3664 3476 gene locus_tag LOCUS_36530 3664 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 >Feature sequence89 506 2962 gene locus_tag LOCUS_36540 506 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 3197 2991 gene locus_tag LOCUS_36550 3197 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 >Feature sequence90 1897 1709 gene locus_tag LOCUS_36560 1897 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 >Feature sequence91 336 61 gene locus_tag LOCUS_36570 336 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 611 976 gene locus_tag LOCUS_36580 611 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 1454 1332 gene locus_tag LOCUS_36590 1454 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 1799 1557 gene locus_tag LOCUS_36600 1799 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 1819 1941 gene locus_tag LOCUS_36610 1819 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 >Feature sequence92 <1 1236 gene locus_tag LOCUS_36620 <1 1236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024696519.1:calcium-binding protein 1403 2431 gene locus_tag LOCUS_36630 1403 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 >Feature sequence93 <1 678 gene locus_tag LOCUS_36640 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390978.1:GGDEF domain-containing protein <2524 1000 gene locus_tag LOCUS_36650 <2524 1000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035719.1:type I restriction-modification system subunit M >Feature sequence94 578 285 gene locus_tag LOCUS_36660 578 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 1486 563 gene locus_tag LOCUS_36670 1486 563 CDS product HPr kinase/phosphatase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388576.1 protein_id gnl|my_center|LOCUS_36670 2354 1581 gene locus_tag LOCUS_36680 gene hisF 2354 1581 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_36680 >Feature sequence95 1 429 gene locus_tag LOCUS_36690 1 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 524 1012 gene locus_tag LOCUS_36700 524 1012 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941803.1 protein_id gnl|my_center|LOCUS_36700 >Feature sequence96 <1 985 gene locus_tag LOCUS_36710 <1 985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_065621648.1:acyltransferase family protein 1700 1978 gene locus_tag LOCUS_36720 1700 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 >Feature sequence97