>Feature sequence01 238 654 gene locus_tag LOCUS_00010 238 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1924 617 gene locus_tag LOCUS_00020 1924 617 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877006.1 protein_id gnl|my_center|LOCUS_00020 2080 1949 gene locus_tag LOCUS_00030 2080 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3139 2111 gene locus_tag LOCUS_00040 gene purE 3139 2111 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061041.1 protein_id gnl|my_center|LOCUS_00040 3264 4991 gene locus_tag LOCUS_00050 3264 4991 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877004.1 protein_id gnl|my_center|LOCUS_00050 6042 5110 gene locus_tag LOCUS_00060 6042 5110 CDS product DUF1743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877003.1 protein_id gnl|my_center|LOCUS_00060 6562 6152 gene locus_tag LOCUS_00070 gene ribH 6562 6152 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877002.1 protein_id gnl|my_center|LOCUS_00070 8068 6863 gene locus_tag LOCUS_00080 8068 6863 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061297.1 protein_id gnl|my_center|LOCUS_00080 9110 8121 gene locus_tag LOCUS_00090 9110 8121 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061040.1 protein_id gnl|my_center|LOCUS_00090 9700 9200 gene locus_tag LOCUS_00100 9700 9200 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876999.1 protein_id gnl|my_center|LOCUS_00100 10971 9712 gene locus_tag LOCUS_00110 gene hacA 10971 9712 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876998.1 protein_id gnl|my_center|LOCUS_00110 11528 11103 gene locus_tag LOCUS_00120 11528 11103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 11765 14146 gene locus_tag LOCUS_00130 11765 14146 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115891889.1 protein_id gnl|my_center|LOCUS_00130 14240 15175 gene locus_tag LOCUS_00140 gene radA 14240 15175 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876995.1 protein_id gnl|my_center|LOCUS_00140 15458 15937 gene locus_tag LOCUS_00150 15458 15937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 16062 16787 gene locus_tag LOCUS_00160 16062 16787 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876994.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00160 17233 19218 gene locus_tag LOCUS_00170 gene hdrA 17233 19218 CDS product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_00170 19468 20736 gene locus_tag LOCUS_00180 gene glyA 19468 20736 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061037.1 protein_id gnl|my_center|LOCUS_00180 20857 21555 gene locus_tag LOCUS_00190 20857 21555 CDS product dihydromethanopterin reductase (acceptor) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876991.1 protein_id gnl|my_center|LOCUS_00190 21644 22036 gene locus_tag LOCUS_00200 21644 22036 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061036.1 protein_id gnl|my_center|LOCUS_00200 22445 22077 gene locus_tag LOCUS_00210 22445 22077 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876989.1 protein_id gnl|my_center|LOCUS_00210 22685 23920 gene locus_tag LOCUS_00220 22685 23920 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061035.1 protein_id gnl|my_center|LOCUS_00220 24119 24292 gene locus_tag LOCUS_00230 24119 24292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 24456 27596 gene locus_tag LOCUS_00240 gene ileS 24456 27596 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876987.1 protein_id gnl|my_center|LOCUS_00240 27631 29811 gene locus_tag LOCUS_00250 gene purL 27631 29811 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876986.1 protein_id gnl|my_center|LOCUS_00250 29854 30414 gene locus_tag LOCUS_00260 29854 30414 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876985.1 protein_id gnl|my_center|LOCUS_00260 31329 30484 gene locus_tag LOCUS_00270 31329 30484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 31520 32533 gene locus_tag LOCUS_00280 31520 32533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876516.1 protein_id gnl|my_center|LOCUS_00280 32929 32582 gene locus_tag LOCUS_00290 32929 32582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 34183 33044 gene locus_tag LOCUS_00300 34183 33044 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876984.1 protein_id gnl|my_center|LOCUS_00300 35485 34310 gene locus_tag LOCUS_00310 35485 34310 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876983.1 protein_id gnl|my_center|LOCUS_00310 36446 35517 gene locus_tag LOCUS_00320 36446 35517 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876982.1 protein_id gnl|my_center|LOCUS_00320 36629 37123 gene locus_tag LOCUS_00330 gene msrA 36629 37123 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060839.1 protein_id gnl|my_center|LOCUS_00330 37988 37641 gene locus_tag LOCUS_00340 37988 37641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 38430 38248 gene locus_tag LOCUS_00350 38430 38248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 39481 39170 gene locus_tag LOCUS_00360 39481 39170 CDS product PDGLE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877314.1 protein_id gnl|my_center|LOCUS_00360 40119 39478 gene locus_tag LOCUS_00370 gene cbiM 40119 39478 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877315.1 protein_id gnl|my_center|LOCUS_00370 40934 40599 gene locus_tag LOCUS_00380 40934 40599 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060878.1 protein_id gnl|my_center|LOCUS_00380 41571 40903 gene locus_tag LOCUS_00390 41571 40903 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876309.1 protein_id gnl|my_center|LOCUS_00390 42292 41585 gene locus_tag LOCUS_00400 42292 41585 CDS product DUF2162 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052261160.1 protein_id gnl|my_center|LOCUS_00400 47433 42709 gene locus_tag LOCUS_00410 47433 42709 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892226.1 protein_id gnl|my_center|LOCUS_00410 48438 47965 gene locus_tag LOCUS_00420 48438 47965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875838.1 protein_id gnl|my_center|LOCUS_00420 49078 48455 gene locus_tag LOCUS_00430 49078 48455 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875839.1 protein_id gnl|my_center|LOCUS_00430 49588 49199 gene locus_tag LOCUS_00440 49588 49199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 52589 49659 gene locus_tag LOCUS_00450 52589 49659 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876312.1 protein_id gnl|my_center|LOCUS_00450 53695 53471 gene locus_tag LOCUS_00460 53695 53471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 54526 54128 gene locus_tag LOCUS_00470 54526 54128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 55342 54764 gene locus_tag LOCUS_00480 55342 54764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 55482 55333 gene locus_tag LOCUS_00490 55482 55333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 55949 57163 gene locus_tag LOCUS_00500 55949 57163 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876981.1 protein_id gnl|my_center|LOCUS_00500 57210 58367 gene locus_tag LOCUS_00510 57210 58367 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061033.1 protein_id gnl|my_center|LOCUS_00510 58552 58364 gene locus_tag LOCUS_00520 58552 58364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296334.1 protein_id gnl|my_center|LOCUS_00520 58884 58561 gene locus_tag LOCUS_00530 58884 58561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 59552 58938 gene locus_tag LOCUS_00540 59552 58938 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061295.1 protein_id gnl|my_center|LOCUS_00540 59961 59611 gene locus_tag LOCUS_00550 59961 59611 CDS product DsrH/TusB family sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876970.1 protein_id gnl|my_center|LOCUS_00550 60355 59984 gene locus_tag LOCUS_00560 60355 59984 CDS product DsrE/DsrF/TusD sulfur relay family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876969.1 protein_id gnl|my_center|LOCUS_00560 61578 60502 gene locus_tag LOCUS_00570 gene arsB 61578 60502 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876533.1 protein_id gnl|my_center|LOCUS_00570 62287 61631 gene locus_tag LOCUS_00580 62287 61631 CDS product DUF166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876968.1 protein_id gnl|my_center|LOCUS_00580 62743 62315 gene locus_tag LOCUS_00590 62743 62315 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_00590 63140 62766 gene locus_tag LOCUS_00600 63140 62766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 63531 63181 gene locus_tag LOCUS_00610 63531 63181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 63737 63549 gene locus_tag LOCUS_00620 63737 63549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 64735 63809 gene locus_tag LOCUS_00630 64735 63809 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875860.1 protein_id gnl|my_center|LOCUS_00630 65543 64788 gene locus_tag LOCUS_00640 gene arsM 65543 64788 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023683.1 protein_id gnl|my_center|LOCUS_00640 67128 65671 gene locus_tag LOCUS_00650 67128 65671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 67553 68914 gene locus_tag LOCUS_00660 67553 68914 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876966.1 protein_id gnl|my_center|LOCUS_00660 69613 69005 gene locus_tag LOCUS_00670 69613 69005 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876964.1 protein_id gnl|my_center|LOCUS_00670 71047 69686 gene locus_tag LOCUS_00680 gene hcp 71047 69686 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750458.1 protein_id gnl|my_center|LOCUS_00680 71249 72022 gene locus_tag LOCUS_00690 71249 72022 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876961.1 protein_id gnl|my_center|LOCUS_00690 72493 72077 gene locus_tag LOCUS_00700 72493 72077 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870251.1 protein_id gnl|my_center|LOCUS_00700 73761 72538 gene locus_tag LOCUS_00710 73761 72538 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870253.1 protein_id gnl|my_center|LOCUS_00710 73919 74683 gene locus_tag LOCUS_00720 73919 74683 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876961.1 protein_id gnl|my_center|LOCUS_00720 75462 74761 gene locus_tag LOCUS_00730 gene cobI 75462 74761 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876960.1 protein_id gnl|my_center|LOCUS_00730 75803 77527 gene locus_tag LOCUS_00740 75803 77527 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876959.1 protein_id gnl|my_center|LOCUS_00740 77806 77546 gene locus_tag LOCUS_00750 77806 77546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 78561 77986 gene locus_tag LOCUS_00760 78561 77986 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_00760 78712 78636 gene locus_tag LOCUS_t00010 78712 78636 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 78937 79761 gene locus_tag LOCUS_00770 gene hisF 78937 79761 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061292.1 protein_id gnl|my_center|LOCUS_00770 79909 80400 gene locus_tag LOCUS_00780 79909 80400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 80545 81234 gene locus_tag LOCUS_00790 80545 81234 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941438.1 protein_id gnl|my_center|LOCUS_00790 82589 81594 gene locus_tag LOCUS_00800 82589 81594 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066378.1 protein_id gnl|my_center|LOCUS_00800 83534 83734 gene locus_tag LOCUS_00810 83534 83734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 84317 83952 gene locus_tag LOCUS_00820 84317 83952 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016038.1 protein_id gnl|my_center|LOCUS_00820 86015 84507 gene locus_tag LOCUS_00830 gene katA 86015 84507 CDS product catalase KatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245322.1 protein_id gnl|my_center|LOCUS_00830 86468 86106 gene locus_tag LOCUS_00840 86468 86106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 86695 87393 gene locus_tag LOCUS_00850 86695 87393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 88182 87571 gene locus_tag LOCUS_00860 88182 87571 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485785.1 protein_id gnl|my_center|LOCUS_00860 88388 89758 gene locus_tag LOCUS_00870 88388 89758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 91086 89908 gene locus_tag LOCUS_00880 91086 89908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 92134 91130 gene locus_tag LOCUS_00890 92134 91130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 92452 92676 gene locus_tag LOCUS_00900 92452 92676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 93471 92899 gene locus_tag LOCUS_00910 93471 92899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 93616 94593 gene locus_tag LOCUS_00920 93616 94593 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876955.1 protein_id gnl|my_center|LOCUS_00920 95022 94618 gene locus_tag LOCUS_00930 95022 94618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 95126 95752 gene locus_tag LOCUS_00940 95126 95752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 96030 95773 gene locus_tag LOCUS_00950 96030 95773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 97717 96062 gene locus_tag LOCUS_00960 97717 96062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 97837 98421 gene locus_tag LOCUS_00970 97837 98421 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876952.1 protein_id gnl|my_center|LOCUS_00970 98947 98444 gene locus_tag LOCUS_00980 98947 98444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 100680 99007 gene locus_tag LOCUS_00990 100680 99007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 101419 100994 gene locus_tag LOCUS_01000 101419 100994 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876951.1 protein_id gnl|my_center|LOCUS_01000 101636 102811 gene locus_tag LOCUS_01010 101636 102811 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876950.1 protein_id gnl|my_center|LOCUS_01010 103111 104397 gene locus_tag LOCUS_01020 gene lysA 103111 104397 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_01020 104432 105367 gene locus_tag LOCUS_01030 gene dapF 104432 105367 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876947.1 protein_id gnl|my_center|LOCUS_01030 106574 105513 gene locus_tag LOCUS_01040 gene cobJ 106574 105513 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877015.1 protein_id gnl|my_center|LOCUS_01040 107211 106687 gene locus_tag LOCUS_01050 107211 106687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892718.1 protein_id gnl|my_center|LOCUS_01050 107362 108864 gene locus_tag LOCUS_01060 107362 108864 CDS product DNA-directed DNA polymerase II small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877017.1 protein_id gnl|my_center|LOCUS_01060 108975 109550 gene locus_tag LOCUS_01070 108975 109550 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892716.1 protein_id gnl|my_center|LOCUS_01070 109996 109742 gene locus_tag LOCUS_01080 109996 109742 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061044.1 protein_id gnl|my_center|LOCUS_01080 111174 110182 gene locus_tag LOCUS_01090 111174 110182 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877020.1 protein_id gnl|my_center|LOCUS_01090 111376 112026 gene locus_tag LOCUS_01100 111376 112026 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061014.1 protein_id gnl|my_center|LOCUS_01100 113033 112083 gene locus_tag LOCUS_01110 gene cbiB 113033 112083 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877021.1 protein_id gnl|my_center|LOCUS_01110 113257 113745 gene locus_tag LOCUS_01120 113257 113745 CDS product DUF2299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877022.1 protein_id gnl|my_center|LOCUS_01120 116615 114594 gene locus_tag LOCUS_01130 116615 114594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 116796 116620 gene locus_tag LOCUS_01140 116796 116620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 116929 120354 gene locus_tag LOCUS_01150 116929 120354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 121244 122392 gene locus_tag LOCUS_01160 gene cdc6-1 121244 122392 CDS product ORC1-type DNA replication protein Cdc6-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877024.1 protein_id gnl|my_center|LOCUS_01160 123532 122618 gene locus_tag LOCUS_01170 gene pyrB 123532 122618 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877025.1 protein_id gnl|my_center|LOCUS_01170 124168 125766 gene locus_tag LOCUS_01180 124168 125766 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021912.1 protein_id gnl|my_center|LOCUS_01180 125887 126876 gene locus_tag LOCUS_01190 125887 126876 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021910.1 protein_id gnl|my_center|LOCUS_01190 126873 127727 gene locus_tag LOCUS_01200 126873 127727 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021909.1 protein_id gnl|my_center|LOCUS_01200 127777 128823 gene locus_tag LOCUS_01210 127777 128823 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021908.1 protein_id gnl|my_center|LOCUS_01210 128813 129424 gene locus_tag LOCUS_01220 128813 129424 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021907.1 protein_id gnl|my_center|LOCUS_01220 130294 129566 gene locus_tag LOCUS_01230 130294 129566 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061045.1 protein_id gnl|my_center|LOCUS_01230 132645 130459 gene locus_tag LOCUS_01240 132645 130459 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877027.1 protein_id gnl|my_center|LOCUS_01240 132950 137851 gene locus_tag LOCUS_01250 132950 137851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 137879 138487 gene locus_tag LOCUS_01260 137879 138487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 138484 138864 gene locus_tag LOCUS_01270 138484 138864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 138898 139275 gene locus_tag LOCUS_01280 138898 139275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 139266 139865 gene locus_tag LOCUS_01290 139266 139865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 141069 139882 gene locus_tag LOCUS_01300 141069 139882 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877033.1 protein_id gnl|my_center|LOCUS_01300 142540 141179 gene locus_tag LOCUS_01310 142540 141179 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330372.1 protein_id gnl|my_center|LOCUS_01310 142907 142506 gene locus_tag LOCUS_01320 142907 142506 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061047.1 protein_id gnl|my_center|LOCUS_01320 143726 143160 gene locus_tag LOCUS_01330 143726 143160 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877036.1 protein_id gnl|my_center|LOCUS_01330 143854 144609 gene locus_tag LOCUS_01340 143854 144609 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892471.1 protein_id gnl|my_center|LOCUS_01340 146277 144655 gene locus_tag LOCUS_01350 146277 144655 CDS product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877037.1 protein_id gnl|my_center|LOCUS_01350 146679 150062 gene locus_tag LOCUS_01360 146679 150062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 150217 151287 gene locus_tag LOCUS_01370 150217 151287 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061048.1 protein_id gnl|my_center|LOCUS_01370 151291 152010 gene locus_tag LOCUS_01380 151291 152010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877039.1 protein_id gnl|my_center|LOCUS_01380 152139 152696 gene locus_tag LOCUS_01390 152139 152696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 152711 152920 gene locus_tag LOCUS_01400 152711 152920 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066331.1 protein_id gnl|my_center|LOCUS_01400 153780 152944 gene locus_tag LOCUS_01410 153780 152944 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546705.1 protein_id gnl|my_center|LOCUS_01410 154748 153825 gene locus_tag LOCUS_01420 gene ilvE 154748 153825 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061049.1 protein_id gnl|my_center|LOCUS_01420 154948 155021 gene locus_tag LOCUS_t00020 154948 155021 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 155989 155210 gene locus_tag LOCUS_01430 155989 155210 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061050.1 protein_id gnl|my_center|LOCUS_01430 156171 156947 gene locus_tag LOCUS_01440 gene surE 156171 156947 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878442.1 protein_id gnl|my_center|LOCUS_01440 157975 156980 gene locus_tag LOCUS_01450 157975 156980 CDS product methanogenesis marker 12 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061052.1 protein_id gnl|my_center|LOCUS_01450 159050 158064 gene locus_tag LOCUS_01460 gene ilvC 159050 158064 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061053.1 protein_id gnl|my_center|LOCUS_01460 159769 159269 gene locus_tag LOCUS_01470 gene ilvN 159769 159269 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061054.1 protein_id gnl|my_center|LOCUS_01470 161510 159771 gene locus_tag LOCUS_01480 161510 159771 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061055.1 protein_id gnl|my_center|LOCUS_01480 161715 163025 gene locus_tag LOCUS_01490 gene purD 161715 163025 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061056.1 protein_id gnl|my_center|LOCUS_01490 163107 163610 gene locus_tag LOCUS_01500 163107 163610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 163717 164619 gene locus_tag LOCUS_01510 gene argF 163717 164619 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877056.1 protein_id gnl|my_center|LOCUS_01510 166099 164666 gene locus_tag LOCUS_01520 166099 164666 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061146.1 protein_id gnl|my_center|LOCUS_01520 166372 166100 gene locus_tag LOCUS_01530 166372 166100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 167305 167853 gene locus_tag LOCUS_01540 167305 167853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 169617 167932 gene locus_tag LOCUS_01550 gene argS 169617 167932 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877057.1 protein_id gnl|my_center|LOCUS_01550 170193 169795 gene locus_tag LOCUS_01560 170193 169795 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877058.1 protein_id gnl|my_center|LOCUS_01560 171894 170239 gene locus_tag LOCUS_01570 gene ilvD 171894 170239 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061057.1 protein_id gnl|my_center|LOCUS_01570 172312 173553 gene locus_tag LOCUS_01580 172312 173553 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404404.1 protein_id gnl|my_center|LOCUS_01580 173775 175607 gene locus_tag LOCUS_01590 173775 175607 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877065.1 protein_id gnl|my_center|LOCUS_01590 175767 176540 gene locus_tag LOCUS_01600 175767 176540 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898851.1 protein_id gnl|my_center|LOCUS_01600 176540 176860 gene locus_tag LOCUS_01610 176540 176860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877067.1 protein_id gnl|my_center|LOCUS_01610 178111 176993 gene locus_tag LOCUS_01620 178111 176993 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061302.1 protein_id gnl|my_center|LOCUS_01620 178721 178296 gene locus_tag LOCUS_01630 178721 178296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 178985 179545 gene locus_tag LOCUS_01640 178985 179545 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_01640 179554 180459 gene locus_tag LOCUS_01650 179554 180459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 180640 181986 gene locus_tag LOCUS_01660 gene cfbB 180640 181986 CDS product Ni-sirohydrochlorin a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877070.1 protein_id gnl|my_center|LOCUS_01660 182014 183084 gene locus_tag LOCUS_01670 182014 183084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877072.1 protein_id gnl|my_center|LOCUS_01670 183980 183195 gene locus_tag LOCUS_01680 183980 183195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 184289 185119 gene locus_tag LOCUS_01690 184289 185119 CDS product F420-dependent methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877074.1 protein_id gnl|my_center|LOCUS_01690 185492 186040 gene locus_tag LOCUS_01700 185492 186040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 186236 186685 gene locus_tag LOCUS_01710 186236 186685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 186789 187334 gene locus_tag LOCUS_01720 186789 187334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 187373 189301 gene locus_tag LOCUS_01730 187373 189301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 189669 190136 gene locus_tag LOCUS_01740 189669 190136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 190325 191533 gene locus_tag LOCUS_01750 190325 191533 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853125.1 protein_id gnl|my_center|LOCUS_01750 191715 191903 gene locus_tag LOCUS_01760 191715 191903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 191903 192262 gene locus_tag LOCUS_01770 191903 192262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 192697 193152 gene locus_tag LOCUS_01780 192697 193152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 193739 193179 gene locus_tag LOCUS_01790 gene hisB 193739 193179 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061060.1 protein_id gnl|my_center|LOCUS_01790 193947 193720 gene locus_tag LOCUS_01800 193947 193720 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061061.1 protein_id gnl|my_center|LOCUS_01800 194691 193987 gene locus_tag LOCUS_01810 194691 193987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 196282 194735 gene locus_tag LOCUS_01820 196282 194735 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870892.1 protein_id gnl|my_center|LOCUS_01820 196661 197170 gene locus_tag LOCUS_01830 196661 197170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 197788 197213 gene locus_tag LOCUS_01840 197788 197213 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879016.1 protein_id gnl|my_center|LOCUS_01840 198276 197902 gene locus_tag LOCUS_01850 198276 197902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 199657 198437 gene locus_tag LOCUS_01860 199657 198437 CDS product bifunctional 5,6,7,8-tetrahydromethanopterin hydro-lyase/3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877084.1 protein_id gnl|my_center|LOCUS_01860 201393 199837 gene locus_tag LOCUS_01870 201393 199837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 202130 201582 gene locus_tag LOCUS_01880 202130 201582 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930819.1 protein_id gnl|my_center|LOCUS_01880 203572 202280 gene locus_tag LOCUS_01890 203572 202280 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877086.1 protein_id gnl|my_center|LOCUS_01890 203850 205133 gene locus_tag LOCUS_01900 203850 205133 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022546.1 protein_id gnl|my_center|LOCUS_01900 207098 207313 gene locus_tag LOCUS_01910 207098 207313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 207811 208017 gene locus_tag LOCUS_01920 207811 208017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 208055 208177 gene locus_tag LOCUS_01930 208055 208177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 208195 208326 gene locus_tag LOCUS_01940 208195 208326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 208340 208660 gene locus_tag LOCUS_01950 208340 208660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 208791 208961 gene locus_tag LOCUS_01960 208791 208961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 209191 211449 gene locus_tag LOCUS_01970 209191 211449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 211639 211914 gene locus_tag LOCUS_01980 211639 211914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 213787 211865 gene locus_tag LOCUS_01990 213787 211865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 214060 213902 gene locus_tag LOCUS_02000 214060 213902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 214290 214601 gene locus_tag LOCUS_02010 214290 214601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 214867 215895 gene locus_tag LOCUS_02020 214867 215895 CDS product DUF1786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892670.1 protein_id gnl|my_center|LOCUS_02020 215907 216554 gene locus_tag LOCUS_02030 215907 216554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 216696 217139 gene locus_tag LOCUS_02040 216696 217139 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023986.1 protein_id gnl|my_center|LOCUS_02040 217226 218041 gene locus_tag LOCUS_02050 217226 218041 CDS product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877090.1 protein_id gnl|my_center|LOCUS_02050 218157 219674 gene locus_tag LOCUS_02060 218157 219674 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877091.1 protein_id gnl|my_center|LOCUS_02060 219725 220477 gene locus_tag LOCUS_02070 219725 220477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 220523 221293 gene locus_tag LOCUS_02080 220523 221293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 221899 222171 gene locus_tag LOCUS_02090 gene albA 221899 222171 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061063.1 protein_id gnl|my_center|LOCUS_02090 223682 222441 gene locus_tag LOCUS_02100 223682 222441 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061304.1 protein_id gnl|my_center|LOCUS_02100 224807 223731 gene locus_tag LOCUS_02110 224807 223731 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877096.1 protein_id gnl|my_center|LOCUS_02110 226017 224920 gene locus_tag LOCUS_02120 226017 224920 CDS product DrrA-related ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877097.1 protein_id gnl|my_center|LOCUS_02120 226529 226014 gene locus_tag LOCUS_02130 226529 226014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 226718 227443 gene locus_tag LOCUS_02140 226718 227443 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877099.1 protein_id gnl|my_center|LOCUS_02140 227535 228638 gene locus_tag LOCUS_02150 227535 228638 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877428.1 protein_id gnl|my_center|LOCUS_02150 228650 229240 gene locus_tag LOCUS_02160 228650 229240 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485785.1 protein_id gnl|my_center|LOCUS_02160 230045 229251 gene locus_tag LOCUS_02170 gene alsD 230045 229251 CDS product alpha-acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215019.1 protein_id gnl|my_center|LOCUS_02170 230240 230103 gene locus_tag LOCUS_02180 230240 230103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 230322 230975 gene locus_tag LOCUS_02190 230322 230975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 231803 231015 gene locus_tag LOCUS_02200 231803 231015 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877103.1 protein_id gnl|my_center|LOCUS_02200 232330 232776 gene locus_tag LOCUS_02210 232330 232776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 233033 232818 gene locus_tag LOCUS_02220 233033 232818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02220 232970 233137 gene locus_tag LOCUS_02230 232970 233137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 233509 233198 gene locus_tag LOCUS_02240 233509 233198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02240 233734 233570 gene locus_tag LOCUS_02250 233734 233570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 234771 233779 gene locus_tag LOCUS_02260 gene ala 234771 233779 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061064.1 protein_id gnl|my_center|LOCUS_02260 235234 234887 gene locus_tag LOCUS_02270 235234 234887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 235528 235247 gene locus_tag LOCUS_02280 235528 235247 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061051.1 protein_id gnl|my_center|LOCUS_02280 236459 235650 gene locus_tag LOCUS_02290 236459 235650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877047.1 protein_id gnl|my_center|LOCUS_02290 236788 236456 gene locus_tag LOCUS_02300 236788 236456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877046.1 protein_id gnl|my_center|LOCUS_02300 237085 237855 gene locus_tag LOCUS_02310 237085 237855 CDS product heparan-alpha-glucosaminide N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065998.1 protein_id gnl|my_center|LOCUS_02310 238563 237859 gene locus_tag LOCUS_02320 238563 237859 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946775.1 protein_id gnl|my_center|LOCUS_02320 238644 239297 gene locus_tag LOCUS_02330 238644 239297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 239432 240805 gene locus_tag LOCUS_02340 gene gatA 239432 240805 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061065.1 protein_id gnl|my_center|LOCUS_02340 240858 242357 gene locus_tag LOCUS_02350 240858 242357 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061066.1 protein_id gnl|my_center|LOCUS_02350 243255 242572 gene locus_tag LOCUS_02360 gene ribB 243255 242572 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877109.1 protein_id gnl|my_center|LOCUS_02360 243752 243372 gene locus_tag LOCUS_02370 243752 243372 CDS product DUF120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877110.1 protein_id gnl|my_center|LOCUS_02370 245423 243828 gene locus_tag LOCUS_02380 gene sepS 245423 243828 CDS product O-phosphoserine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877111.1 protein_id gnl|my_center|LOCUS_02380 245596 247245 gene locus_tag LOCUS_02390 245596 247245 CDS product fumarate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061070.1 protein_id gnl|my_center|LOCUS_02390 247346 247888 gene locus_tag LOCUS_02400 247346 247888 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145144.1 protein_id gnl|my_center|LOCUS_02400 248988 247936 gene locus_tag LOCUS_02410 gene rsgA 248988 247936 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459864.1 protein_id gnl|my_center|LOCUS_02410 250457 249189 gene locus_tag LOCUS_02420 250457 249189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 250868 250795 gene locus_tag LOCUS_t00030 250868 250795 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 251642 251010 gene locus_tag LOCUS_02430 251642 251010 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932444.1 protein_id gnl|my_center|LOCUS_02430 252145 251723 gene locus_tag LOCUS_02440 252145 251723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 253546 252185 gene locus_tag LOCUS_02450 253546 252185 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061078.1 protein_id gnl|my_center|LOCUS_02450 254190 253597 gene locus_tag LOCUS_02460 gene hisH 254190 253597 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877134.1 protein_id gnl|my_center|LOCUS_02460 255279 254221 gene locus_tag LOCUS_02470 255279 254221 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877133.1 protein_id gnl|my_center|LOCUS_02470 256442 255363 gene locus_tag LOCUS_02480 gene cfbD 256442 255363 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877132.1 protein_id gnl|my_center|LOCUS_02480 256687 257418 gene locus_tag LOCUS_02490 256687 257418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876163.1 protein_id gnl|my_center|LOCUS_02490 257433 258158 gene locus_tag LOCUS_02500 gene sfsA 257433 258158 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877131.1 protein_id gnl|my_center|LOCUS_02500 259171 258155 gene locus_tag LOCUS_02510 gene mthK 259171 258155 CDS product calcium-gated potassium channel MthK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877130.1 protein_id gnl|my_center|LOCUS_02510 259571 259209 gene locus_tag LOCUS_02520 259571 259209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 259992 259648 gene locus_tag LOCUS_02530 259992 259648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 260566 260189 gene locus_tag LOCUS_02540 260566 260189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 260962 260726 gene locus_tag LOCUS_02550 260962 260726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 261726 260995 gene locus_tag LOCUS_02560 261726 260995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 262775 261747 gene locus_tag LOCUS_02570 262775 261747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 265594 262835 gene locus_tag LOCUS_02580 265594 262835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 265926 267470 gene locus_tag LOCUS_02590 265926 267470 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225752.1 protein_id gnl|my_center|LOCUS_02590 268273 269265 gene locus_tag LOCUS_02600 268273 269265 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060981.1 protein_id gnl|my_center|LOCUS_02600 269270 269701 gene locus_tag LOCUS_02610 269270 269701 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060980.1 protein_id gnl|my_center|LOCUS_02610 269857 270312 gene locus_tag LOCUS_02620 269857 270312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 270457 270639 gene locus_tag LOCUS_02630 270457 270639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 273554 270792 gene locus_tag LOCUS_02640 273554 270792 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061075.1 protein_id gnl|my_center|LOCUS_02640 273701 275080 gene locus_tag LOCUS_02650 273701 275080 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250508.1 protein_id gnl|my_center|LOCUS_02650 275101 275418 gene locus_tag LOCUS_02660 275101 275418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 275445 275858 gene locus_tag LOCUS_02670 275445 275858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 276291 275860 gene locus_tag LOCUS_02680 276291 275860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 277507 276320 gene locus_tag LOCUS_02690 277507 276320 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061074.1 protein_id gnl|my_center|LOCUS_02690 279483 277675 gene locus_tag LOCUS_02700 279483 277675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 279763 280380 gene locus_tag LOCUS_02710 279763 280380 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877124.1 protein_id gnl|my_center|LOCUS_02710 280771 280397 gene locus_tag LOCUS_02720 280771 280397 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875991.1 protein_id gnl|my_center|LOCUS_02720 281386 280790 gene locus_tag LOCUS_02730 281386 280790 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061290.1 protein_id gnl|my_center|LOCUS_02730 281716 281420 gene locus_tag LOCUS_02740 281716 281420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 282041 281730 gene locus_tag LOCUS_02750 282041 281730 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989541.1 protein_id gnl|my_center|LOCUS_02750 282181 282654 gene locus_tag LOCUS_02760 282181 282654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 282651 283373 gene locus_tag LOCUS_02770 282651 283373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 284202 283366 gene locus_tag LOCUS_02780 gene rsmA 284202 283366 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876939.1 protein_id gnl|my_center|LOCUS_02780 284859 284281 gene locus_tag LOCUS_02790 284859 284281 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876938.1 protein_id gnl|my_center|LOCUS_02790 285295 284966 gene locus_tag LOCUS_02800 285295 284966 CDS product DNA-directed RNA polymerase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061025.1 protein_id gnl|my_center|LOCUS_02800 285591 285301 gene locus_tag LOCUS_02810 285591 285301 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876936.1 protein_id gnl|my_center|LOCUS_02810 287275 286049 gene locus_tag LOCUS_02820 287275 286049 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876935.1 protein_id gnl|my_center|LOCUS_02820 288699 287368 gene locus_tag LOCUS_02830 288699 287368 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876934.1 protein_id gnl|my_center|LOCUS_02830 288916 289482 gene locus_tag LOCUS_02840 gene hpt 288916 289482 CDS product hypoxanthine/guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061024.1 protein_id gnl|my_center|LOCUS_02840 289505 290497 gene locus_tag LOCUS_02850 gene dph2 289505 290497 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876932.1 protein_id gnl|my_center|LOCUS_02850 290613 291182 gene locus_tag LOCUS_02860 290613 291182 CDS product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876931.1 protein_id gnl|my_center|LOCUS_02860 291186 291449 gene locus_tag LOCUS_02870 291186 291449 CDS product DNA-directed RNA polymerase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876930.1 protein_id gnl|my_center|LOCUS_02870 291504 292100 gene locus_tag LOCUS_02880 291504 292100 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061023.1 protein_id gnl|my_center|LOCUS_02880 292141 292563 gene locus_tag LOCUS_02890 292141 292563 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251234.1 protein_id gnl|my_center|LOCUS_02890 292752 293066 gene locus_tag LOCUS_02900 292752 293066 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061022.1 protein_id gnl|my_center|LOCUS_02900 293108 293653 gene locus_tag LOCUS_02910 293108 293653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 293694 294428 gene locus_tag LOCUS_02920 gene pcn 293694 294428 CDS product proliferating cell nuclear antigen (pcna) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876925.1 protein_id gnl|my_center|LOCUS_02920 294498 295313 gene locus_tag LOCUS_02930 294498 295313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061021.1 protein_id gnl|my_center|LOCUS_02930 295542 295820 gene locus_tag LOCUS_02940 295542 295820 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876923.1 protein_id gnl|my_center|LOCUS_02940 295830 296015 gene locus_tag LOCUS_02950 295830 296015 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876922.1 protein_id gnl|my_center|LOCUS_02950 296055 296834 gene locus_tag LOCUS_02960 296055 296834 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061020.1 protein_id gnl|my_center|LOCUS_02960 296870 297049 gene locus_tag LOCUS_02970 296870 297049 CDS product RNA-protein complex protein Nop10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876920.1 protein_id gnl|my_center|LOCUS_02970 297049 297816 gene locus_tag LOCUS_02980 297049 297816 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878032.1 protein_id gnl|my_center|LOCUS_02980 297870 299072 gene locus_tag LOCUS_02990 297870 299072 CDS product TIGR00375 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876918.1 protein_id gnl|my_center|LOCUS_02990 299083 299934 gene locus_tag LOCUS_03000 299083 299934 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877416.1 protein_id gnl|my_center|LOCUS_03000 299953 301098 gene locus_tag LOCUS_03010 299953 301098 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061331.1 protein_id gnl|my_center|LOCUS_03010 301115 301381 gene locus_tag LOCUS_03020 301115 301381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 301659 301584 gene locus_tag LOCUS_t00040 301659 301584 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 301965 301891 gene locus_tag LOCUS_t00050 301965 301891 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 302791 302072 gene locus_tag LOCUS_03030 302791 302072 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876917.1 protein_id gnl|my_center|LOCUS_03030 303259 302816 gene locus_tag LOCUS_03040 303259 302816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 303608 304831 gene locus_tag LOCUS_03050 gene frhA 303608 304831 CDS product coenzyme F420 hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061018.1 protein_id gnl|my_center|LOCUS_03050 304843 305313 gene locus_tag LOCUS_03060 gene frhD 304843 305313 CDS product coenzyme F420-reducing hydrogenase, FrhD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876914.1 protein_id gnl|my_center|LOCUS_03060 305318 306127 gene locus_tag LOCUS_03070 gene frhG 305318 306127 CDS product coenzyme F420 hydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876913.1 protein_id gnl|my_center|LOCUS_03070 306139 307023 gene locus_tag LOCUS_03080 gene frhB 306139 307023 CDS product coenzyme F420 hydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876912.1 protein_id gnl|my_center|LOCUS_03080 307121 307504 gene locus_tag LOCUS_03090 307121 307504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 307557 308378 gene locus_tag LOCUS_03100 307557 308378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 309294 308389 gene locus_tag LOCUS_03110 gene map 309294 308389 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061017.1 protein_id gnl|my_center|LOCUS_03110 309670 309813 gene locus_tag LOCUS_03120 309670 309813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 310038 310469 gene locus_tag LOCUS_03130 310038 310469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876910.1 protein_id gnl|my_center|LOCUS_03130 310473 311021 gene locus_tag LOCUS_03140 310473 311021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876909.1 protein_id gnl|my_center|LOCUS_03140 311231 311306 gene locus_tag LOCUS_t00060 311231 311306 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 312033 313808 gene locus_tag LOCUS_03150 312033 313808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 315778 314636 gene locus_tag LOCUS_03160 gene dnaJ 315778 314636 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876908.1 protein_id gnl|my_center|LOCUS_03160 317783 315909 gene locus_tag LOCUS_03170 gene dnaK 317783 315909 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430934.1 protein_id gnl|my_center|LOCUS_03170 318381 317866 gene locus_tag LOCUS_03180 318381 317866 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876906.1 protein_id gnl|my_center|LOCUS_03180 318537 318983 gene locus_tag LOCUS_03190 318537 318983 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876905.1 protein_id gnl|my_center|LOCUS_03190 321301 318995 gene locus_tag LOCUS_03200 gene hypF 321301 318995 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496588.1 protein_id gnl|my_center|LOCUS_03200 321422 322186 gene locus_tag LOCUS_03210 gene larB 321422 322186 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061016.1 protein_id gnl|my_center|LOCUS_03210 322222 323193 gene locus_tag LOCUS_03220 322222 323193 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020124.1 protein_id gnl|my_center|LOCUS_03220 323254 323757 gene locus_tag LOCUS_03230 323254 323757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 323773 324519 gene locus_tag LOCUS_03240 323773 324519 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496487.1 protein_id gnl|my_center|LOCUS_03240 324576 325325 gene locus_tag LOCUS_03250 324576 325325 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 protein_id gnl|my_center|LOCUS_03250 325364 325882 gene locus_tag LOCUS_03260 325364 325882 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583273.1 protein_id gnl|my_center|LOCUS_03260 326587 325886 gene locus_tag LOCUS_03270 326587 325886 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879896.1 protein_id gnl|my_center|LOCUS_03270 327062 326604 gene locus_tag LOCUS_03280 327062 326604 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020435.1 protein_id gnl|my_center|LOCUS_03280 327531 327085 gene locus_tag LOCUS_03290 327531 327085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03290 328361 327780 gene locus_tag LOCUS_03300 328361 327780 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879640.1 protein_id gnl|my_center|LOCUS_03300 329208 328525 gene locus_tag LOCUS_03310 329208 328525 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009127818.1 protein_id gnl|my_center|LOCUS_03310 330200 329232 gene locus_tag LOCUS_03320 330200 329232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 332056 330254 gene locus_tag LOCUS_03330 gene polB1 332056 330254 CDS product DNA polymerase PolB subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876832.1 protein_id gnl|my_center|LOCUS_03330 332288 332896 gene locus_tag LOCUS_03340 332288 332896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 333095 334207 gene locus_tag LOCUS_03350 333095 334207 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876334.1 protein_id gnl|my_center|LOCUS_03350 334231 334932 gene locus_tag LOCUS_03360 334231 334932 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876335.1 protein_id gnl|my_center|LOCUS_03360 335118 335381 gene locus_tag LOCUS_03370 335118 335381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 335374 335985 gene locus_tag LOCUS_03380 335374 335985 CDS product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031387.1 protein_id gnl|my_center|LOCUS_03380 336003 336338 gene locus_tag LOCUS_03390 336003 336338 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061051.1 protein_id gnl|my_center|LOCUS_03390 336895 337947 gene locus_tag LOCUS_03400 336895 337947 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876334.1 protein_id gnl|my_center|LOCUS_03400 337940 338608 gene locus_tag LOCUS_03410 337940 338608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 339316 338804 gene locus_tag LOCUS_03420 339316 338804 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978052.1 protein_id gnl|my_center|LOCUS_03420 340325 339285 gene locus_tag LOCUS_03430 340325 339285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 341008 340349 gene locus_tag LOCUS_03440 341008 340349 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221202124.1 protein_id gnl|my_center|LOCUS_03440 341327 342070 gene locus_tag LOCUS_03450 341327 342070 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890403.1 protein_id gnl|my_center|LOCUS_03450 342221 342508 gene locus_tag LOCUS_03460 342221 342508 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061051.1 protein_id gnl|my_center|LOCUS_03460 342533 342865 gene locus_tag LOCUS_03470 342533 342865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 343230 344114 gene locus_tag LOCUS_03480 343230 344114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877147.1 protein_id gnl|my_center|LOCUS_03480 344382 345362 gene locus_tag LOCUS_03490 344382 345362 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643856.1 protein_id gnl|my_center|LOCUS_03490 345649 346176 gene locus_tag LOCUS_03500 345649 346176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 346322 346789 gene locus_tag LOCUS_03510 346322 346789 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869796.1 protein_id gnl|my_center|LOCUS_03510 346809 347174 gene locus_tag LOCUS_03520 346809 347174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 347193 347630 gene locus_tag LOCUS_03530 347193 347630 CDS product iron chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721468.1 protein_id gnl|my_center|LOCUS_03530 347660 348130 gene locus_tag LOCUS_03540 347660 348130 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031562.1 protein_id gnl|my_center|LOCUS_03540 348179 348928 gene locus_tag LOCUS_03550 348179 348928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 349672 348920 gene locus_tag LOCUS_03560 349672 348920 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876566.1 protein_id gnl|my_center|LOCUS_03560 350573 349698 gene locus_tag LOCUS_03570 350573 349698 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434727.1 protein_id gnl|my_center|LOCUS_03570 351083 350589 gene locus_tag LOCUS_03580 351083 350589 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869796.1 protein_id gnl|my_center|LOCUS_03580 351565 351113 gene locus_tag LOCUS_03590 351565 351113 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869796.1 protein_id gnl|my_center|LOCUS_03590 351957 351655 gene locus_tag LOCUS_03600 351957 351655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 352140 353291 gene locus_tag LOCUS_03610 352140 353291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 354501 353311 gene locus_tag LOCUS_03620 354501 353311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 354892 355935 gene locus_tag LOCUS_03630 354892 355935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 356618 356004 gene locus_tag LOCUS_03640 356618 356004 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065304.1 protein_id gnl|my_center|LOCUS_03640 356855 358495 gene locus_tag LOCUS_03650 356855 358495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 358637 359449 gene locus_tag LOCUS_03660 358637 359449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 359718 361625 gene locus_tag LOCUS_03670 359718 361625 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877460.1 protein_id gnl|my_center|LOCUS_03670 362526 361663 gene locus_tag LOCUS_03680 362526 361663 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868911.1 protein_id gnl|my_center|LOCUS_03680 362837 364744 gene locus_tag LOCUS_03690 362837 364744 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877460.1 protein_id gnl|my_center|LOCUS_03690 364999 365709 gene locus_tag LOCUS_03700 364999 365709 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461573.1 protein_id gnl|my_center|LOCUS_03700 366822 367025 gene locus_tag LOCUS_03710 366822 367025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 367597 367136 gene locus_tag LOCUS_03720 367597 367136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 367830 368498 gene locus_tag LOCUS_03730 367830 368498 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022003.1 protein_id gnl|my_center|LOCUS_03730 368574 368972 gene locus_tag LOCUS_03740 368574 368972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 369044 369508 gene locus_tag LOCUS_03750 369044 369508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 370009 369590 gene locus_tag LOCUS_03760 370009 369590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 370794 370066 gene locus_tag LOCUS_03770 370794 370066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 370927 371331 gene locus_tag LOCUS_03780 370927 371331 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890794.1 protein_id gnl|my_center|LOCUS_03780 371387 371797 gene locus_tag LOCUS_03790 371387 371797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 371889 371816 gene locus_tag LOCUS_t00070 371889 371816 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 372047 372802 gene locus_tag LOCUS_03800 372047 372802 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980255.1 protein_id gnl|my_center|LOCUS_03800 372844 373683 gene locus_tag LOCUS_03810 372844 373683 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809362.1 protein_id gnl|my_center|LOCUS_03810 373714 374298 gene locus_tag LOCUS_03820 373714 374298 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 protein_id gnl|my_center|LOCUS_03820 374466 375299 gene locus_tag LOCUS_03830 374466 375299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 376129 375320 gene locus_tag LOCUS_03840 376129 375320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 376352 376951 gene locus_tag LOCUS_03850 376352 376951 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942196.1 protein_id gnl|my_center|LOCUS_03850 377106 377909 gene locus_tag LOCUS_03860 377106 377909 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065502.1 protein_id gnl|my_center|LOCUS_03860 378434 377934 gene locus_tag LOCUS_03870 378434 377934 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877737.1 protein_id gnl|my_center|LOCUS_03870 379212 378487 gene locus_tag LOCUS_03880 379212 378487 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060988.1 protein_id gnl|my_center|LOCUS_03880 379350 380441 gene locus_tag LOCUS_03890 379350 380441 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060989.1 protein_id gnl|my_center|LOCUS_03890 380726 380544 gene locus_tag LOCUS_03900 380726 380544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 380834 381382 gene locus_tag LOCUS_03910 380834 381382 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966545.1 protein_id gnl|my_center|LOCUS_03910 381725 383386 gene locus_tag LOCUS_03920 381725 383386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 383843 384466 gene locus_tag LOCUS_03930 gene psmB 383843 384466 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876826.1 protein_id gnl|my_center|LOCUS_03930 384579 386486 gene locus_tag LOCUS_03940 384579 386486 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876827.1 protein_id gnl|my_center|LOCUS_03940 386767 387795 gene locus_tag LOCUS_03950 gene purM 386767 387795 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876828.1 protein_id gnl|my_center|LOCUS_03950 387805 388359 gene locus_tag LOCUS_03960 387805 388359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03960 388428 388766 gene locus_tag LOCUS_03970 388428 388766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03970 388868 390517 gene locus_tag LOCUS_03980 388868 390517 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061109.1 protein_id gnl|my_center|LOCUS_03980 390656 391150 gene locus_tag LOCUS_03990 gene comD 390656 391150 CDS product sulfopyruvate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876830.1 protein_id gnl|my_center|LOCUS_03990 391161 391712 gene locus_tag LOCUS_04000 gene comE 391161 391712 CDS product sulfopyruvate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876831.1 protein_id gnl|my_center|LOCUS_04000 391752 392150 gene locus_tag LOCUS_04010 gene crcB 391752 392150 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023830.1 protein_id gnl|my_center|LOCUS_04010 392152 392496 gene locus_tag LOCUS_04020 392152 392496 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023831.1 protein_id gnl|my_center|LOCUS_04020 392787 392500 gene locus_tag LOCUS_04030 gene hisE 392787 392500 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876900.1 protein_id gnl|my_center|LOCUS_04030 393622 392828 gene locus_tag LOCUS_04040 393622 392828 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876899.1 protein_id gnl|my_center|LOCUS_04040 393904 393677 gene locus_tag LOCUS_04050 393904 393677 CDS product DUF504 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876898.1 protein_id gnl|my_center|LOCUS_04050 395367 394012 gene locus_tag LOCUS_04060 gene gatB 395367 394012 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876897.1 protein_id gnl|my_center|LOCUS_04060 396503 395496 gene locus_tag LOCUS_04070 396503 395496 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496555.1 protein_id gnl|my_center|LOCUS_04070 396863 396936 gene locus_tag LOCUS_t00080 396863 396936 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 396939 397014 gene locus_tag LOCUS_t00090 396939 397014 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 397180 397254 gene locus_tag LOCUS_t00100 397180 397254 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 397283 397366 gene locus_tag LOCUS_t00110 397283 397366 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 397405 397480 gene locus_tag LOCUS_t00120 397405 397480 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 397656 397961 gene locus_tag LOCUS_04080 397656 397961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876893.1 protein_id gnl|my_center|LOCUS_04080 398052 398477 gene locus_tag LOCUS_04090 gene hjc 398052 398477 CDS product Holliday junction resolvase Hjc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876892.1 protein_id gnl|my_center|LOCUS_04090 398622 399083 gene locus_tag LOCUS_04100 398622 399083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 400079 399141 gene locus_tag LOCUS_04110 400079 399141 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876835.1 protein_id gnl|my_center|LOCUS_04110 401024 400230 gene locus_tag LOCUS_04120 401024 400230 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061285.1 protein_id gnl|my_center|LOCUS_04120 401955 401050 gene locus_tag LOCUS_04130 401955 401050 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060992.1 protein_id gnl|my_center|LOCUS_04130 402137 403348 gene locus_tag LOCUS_04140 402137 403348 CDS product NOP5/NOP56 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876838.1 protein_id gnl|my_center|LOCUS_04140 403368 403703 gene locus_tag LOCUS_04150 403368 403703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 403820 404680 gene locus_tag LOCUS_04160 403820 404680 CDS product CPBP family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558802.1 protein_id gnl|my_center|LOCUS_04160 404812 405477 gene locus_tag LOCUS_04170 404812 405477 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876839.1 protein_id gnl|my_center|LOCUS_04170 406136 405528 gene locus_tag LOCUS_04180 406136 405528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876599.1 protein_id gnl|my_center|LOCUS_04180 406303 406446 gene locus_tag LOCUS_04190 406303 406446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 407742 406594 gene locus_tag LOCUS_04200 gene coaBC 407742 406594 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876840.1 protein_id gnl|my_center|LOCUS_04200 408289 407792 gene locus_tag LOCUS_04210 408289 407792 CDS product transcription elongation factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060993.1 protein_id gnl|my_center|LOCUS_04210 409464 408769 gene locus_tag LOCUS_04220 409464 408769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 410141 409578 gene locus_tag LOCUS_04230 410141 409578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 410752 410210 gene locus_tag LOCUS_04240 410752 410210 CDS product PsbP-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876842.1 protein_id gnl|my_center|LOCUS_04240 411525 410941 gene locus_tag LOCUS_04250 411525 410941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 412348 411518 gene locus_tag LOCUS_04260 gene pheA 412348 411518 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060994.1 protein_id gnl|my_center|LOCUS_04260 413426 412482 gene locus_tag LOCUS_04270 gene mthRnl 413426 412482 CDS product ATP-dependent RNA/DNA ligase MthRnl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060995.1 protein_id gnl|my_center|LOCUS_04270 414560 413736 gene locus_tag LOCUS_04280 414560 413736 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060996.1 protein_id gnl|my_center|LOCUS_04280 415464 414622 gene locus_tag LOCUS_04290 415464 414622 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060997.1 protein_id gnl|my_center|LOCUS_04290 416463 415522 gene locus_tag LOCUS_04300 416463 415522 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876848.1 protein_id gnl|my_center|LOCUS_04300 417364 416552 gene locus_tag LOCUS_04310 417364 416552 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876849.1 protein_id gnl|my_center|LOCUS_04310 417927 417361 gene locus_tag LOCUS_04320 417927 417361 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876850.1 protein_id gnl|my_center|LOCUS_04320 418639 417938 gene locus_tag LOCUS_04330 418639 417938 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060998.1 protein_id gnl|my_center|LOCUS_04330 419140 418658 gene locus_tag LOCUS_04340 419140 418658 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060999.1 protein_id gnl|my_center|LOCUS_04340 419743 419171 gene locus_tag LOCUS_04350 419743 419171 CDS product DUF366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061000.1 protein_id gnl|my_center|LOCUS_04350 421972 419786 gene locus_tag LOCUS_04360 421972 419786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 422425 422045 gene locus_tag LOCUS_04370 422425 422045 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876854.1 protein_id gnl|my_center|LOCUS_04370 422508 423533 gene locus_tag LOCUS_04380 422508 423533 CDS product DNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876855.1 protein_id gnl|my_center|LOCUS_04380 423667 424950 gene locus_tag LOCUS_04390 423667 424950 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876856.1 protein_id gnl|my_center|LOCUS_04390 425154 425972 gene locus_tag LOCUS_04400 425154 425972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 426393 426073 gene locus_tag LOCUS_04410 426393 426073 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061058.1 protein_id gnl|my_center|LOCUS_04410 426623 426408 gene locus_tag LOCUS_04420 426623 426408 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877421.1 protein_id gnl|my_center|LOCUS_04420 427183 426671 gene locus_tag LOCUS_04430 427183 426671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 427432 427241 gene locus_tag LOCUS_04440 427432 427241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 427629 427913 gene locus_tag LOCUS_04450 427629 427913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061001.1 protein_id gnl|my_center|LOCUS_04450 428600 427944 gene locus_tag LOCUS_04460 428600 427944 CDS product DUF5612 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876859.1 protein_id gnl|my_center|LOCUS_04460 428909 428664 gene locus_tag LOCUS_04470 428909 428664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 429585 429082 gene locus_tag LOCUS_04480 429585 429082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 430197 429598 gene locus_tag LOCUS_04490 430197 429598 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226951.1 protein_id gnl|my_center|LOCUS_04490 430684 430217 gene locus_tag LOCUS_04500 430684 430217 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022180.1 protein_id gnl|my_center|LOCUS_04500 432014 430812 gene locus_tag LOCUS_04510 432014 430812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 435023 432069 gene locus_tag LOCUS_04520 435023 432069 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023457.1 protein_id gnl|my_center|LOCUS_04520 435279 435914 gene locus_tag LOCUS_04530 435279 435914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 436189 436905 gene locus_tag LOCUS_04540 436189 436905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 436966 438201 gene locus_tag LOCUS_04550 436966 438201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 438206 440986 gene locus_tag LOCUS_04560 438206 440986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 440983 441597 gene locus_tag LOCUS_04570 440983 441597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 441594 442889 gene locus_tag LOCUS_04580 441594 442889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 442952 443104 gene locus_tag LOCUS_04590 442952 443104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 443369 443139 gene locus_tag LOCUS_04600 443369 443139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 443527 443742 gene locus_tag LOCUS_04610 443527 443742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04610 443768 444100 gene locus_tag LOCUS_04620 443768 444100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04620 444194 444331 gene locus_tag LOCUS_04630 444194 444331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 444374 444943 gene locus_tag LOCUS_04640 444374 444943 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022274.1 protein_id gnl|my_center|LOCUS_04640 445083 445682 gene locus_tag LOCUS_04650 445083 445682 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948983.1 protein_id gnl|my_center|LOCUS_04650 446080 445745 gene locus_tag LOCUS_04660 446080 445745 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021357.1 protein_id gnl|my_center|LOCUS_04660 446176 446679 gene locus_tag LOCUS_04670 446176 446679 CDS product HXXEE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398792.1 protein_id gnl|my_center|LOCUS_04670 447028 446765 gene locus_tag LOCUS_04680 447028 446765 CDS product energy-converting hydrogenase B subunit P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061002.1 protein_id gnl|my_center|LOCUS_04680 448262 447258 gene locus_tag LOCUS_04690 448262 447258 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876861.1 protein_id gnl|my_center|LOCUS_04690 449480 448326 gene locus_tag LOCUS_04700 449480 448326 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061003.1 protein_id gnl|my_center|LOCUS_04700 450001 449555 gene locus_tag LOCUS_04710 450001 449555 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876863.1 protein_id gnl|my_center|LOCUS_04710 450547 450047 gene locus_tag LOCUS_04720 450547 450047 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061004.1 protein_id gnl|my_center|LOCUS_04720 451905 450544 gene locus_tag LOCUS_04730 451905 450544 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061005.1 protein_id gnl|my_center|LOCUS_04730 452216 451968 gene locus_tag LOCUS_04740 452216 451968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 452683 452213 gene locus_tag LOCUS_04750 452683 452213 CDS product MnhB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876867.1 protein_id gnl|my_center|LOCUS_04750 452964 452680 gene locus_tag LOCUS_04760 452964 452680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061006.1 protein_id gnl|my_center|LOCUS_04760 453295 452957 gene locus_tag LOCUS_04770 453295 452957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876869.1 protein_id gnl|my_center|LOCUS_04770 454831 453338 gene locus_tag LOCUS_04780 gene ehbF 454831 453338 CDS product energy conserving hydrogenase EhbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876870.1 protein_id gnl|my_center|LOCUS_04780 455232 454828 gene locus_tag LOCUS_04790 455232 454828 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330371.1 protein_id gnl|my_center|LOCUS_04790 455506 455270 gene locus_tag LOCUS_04800 455506 455270 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869936.1 protein_id gnl|my_center|LOCUS_04800 455775 455503 gene locus_tag LOCUS_04810 455775 455503 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496454.1 protein_id gnl|my_center|LOCUS_04810 456037 455777 gene locus_tag LOCUS_04820 456037 455777 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876874.1 protein_id gnl|my_center|LOCUS_04820 456384 456070 gene locus_tag LOCUS_04830 456384 456070 CDS product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876875.1 protein_id gnl|my_center|LOCUS_04830 457301 456627 gene locus_tag LOCUS_04840 457301 456627 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876876.1 protein_id gnl|my_center|LOCUS_04840 458071 457352 gene locus_tag LOCUS_04850 458071 457352 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061008.1 protein_id gnl|my_center|LOCUS_04850 458155 459336 gene locus_tag LOCUS_04860 458155 459336 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061009.1 protein_id gnl|my_center|LOCUS_04860 459605 460402 gene locus_tag LOCUS_04870 459605 460402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 460467 460826 gene locus_tag LOCUS_04880 460467 460826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 461339 460851 gene locus_tag LOCUS_04890 461339 460851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 463099 461612 gene locus_tag LOCUS_04900 463099 461612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 463452 463715 gene locus_tag LOCUS_04910 463452 463715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 465180 463708 gene locus_tag LOCUS_04920 465180 463708 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876880.1 protein_id gnl|my_center|LOCUS_04920 465272 467194 gene locus_tag LOCUS_04930 465272 467194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 468000 467281 gene locus_tag LOCUS_04940 468000 467281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 469219 468326 gene locus_tag LOCUS_04950 gene fhcD 469219 468326 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061010.1 protein_id gnl|my_center|LOCUS_04950 470468 469506 gene locus_tag LOCUS_04960 470468 469506 CDS product UPF0104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876885.1 protein_id gnl|my_center|LOCUS_04960 470428 470592 gene locus_tag LOCUS_04970 470428 470592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 471136 470600 gene locus_tag LOCUS_04980 471136 470600 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250569.1 protein_id gnl|my_center|LOCUS_04980 471220 471453 gene locus_tag LOCUS_04990 471220 471453 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876887.1 protein_id gnl|my_center|LOCUS_04990 472051 472821 gene locus_tag LOCUS_05000 472051 472821 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061142.1 protein_id gnl|my_center|LOCUS_05000 472999 474459 gene locus_tag LOCUS_05010 472999 474459 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061013.1 protein_id gnl|my_center|LOCUS_05010 474606 475256 gene locus_tag LOCUS_05020 474606 475256 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061014.1 protein_id gnl|my_center|LOCUS_05020 475281 476273 gene locus_tag LOCUS_05030 475281 476273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 476959 476339 gene locus_tag LOCUS_05040 476959 476339 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876891.1 protein_id gnl|my_center|LOCUS_05040 477238 477167 gene locus_tag LOCUS_t00130 477238 477167 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 478023 477472 gene locus_tag LOCUS_05050 478023 477472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 478632 478177 gene locus_tag LOCUS_05060 478632 478177 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485814.1 protein_id gnl|my_center|LOCUS_05060 479653 478826 gene locus_tag LOCUS_05070 gene proG 479653 478826 CDS product pyrroline-5-carboxylate reductase ProG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232626.1 protein_id gnl|my_center|LOCUS_05070 480397 479672 gene locus_tag LOCUS_05080 480397 479672 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221202124.1 protein_id gnl|my_center|LOCUS_05080 480885 480427 gene locus_tag LOCUS_05090 480885 480427 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023053.1 protein_id gnl|my_center|LOCUS_05090 481021 481278 gene locus_tag LOCUS_05100 481021 481278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 482512 481433 gene locus_tag LOCUS_05110 gene cofG 482512 481433 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876822.1 protein_id gnl|my_center|LOCUS_05110 482991 482560 gene locus_tag LOCUS_05120 482991 482560 CDS product DUF2120 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061284.1 protein_id gnl|my_center|LOCUS_05120 483981 483019 gene locus_tag LOCUS_05130 gene mptA 483981 483019 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876820.1 protein_id gnl|my_center|LOCUS_05130 484927 484247 gene locus_tag LOCUS_05140 484927 484247 CDS product DUF2100 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876819.1 protein_id gnl|my_center|LOCUS_05140 485964 484945 gene locus_tag LOCUS_05150 485964 484945 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876818.1 protein_id gnl|my_center|LOCUS_05150 486078 486602 gene locus_tag LOCUS_05160 486078 486602 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061149.1 protein_id gnl|my_center|LOCUS_05160 487899 486634 gene locus_tag LOCUS_05170 487899 486634 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 protein_id gnl|my_center|LOCUS_05170 487850 488077 gene locus_tag LOCUS_05180 487850 488077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 488979 488062 gene locus_tag LOCUS_05190 488979 488062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 489554 489066 gene locus_tag LOCUS_05200 489554 489066 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060987.1 protein_id gnl|my_center|LOCUS_05200 490166 489756 gene locus_tag LOCUS_05210 490166 489756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05210 490514 490236 gene locus_tag LOCUS_05220 490514 490236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 491368 490688 gene locus_tag LOCUS_05230 491368 490688 CDS product DUF4013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060986.1 protein_id gnl|my_center|LOCUS_05230 491750 492454 gene locus_tag LOCUS_05240 491750 492454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876815.1 protein_id gnl|my_center|LOCUS_05240 492570 494186 gene locus_tag LOCUS_05250 492570 494186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828678.1 protein_id gnl|my_center|LOCUS_05250 495376 494219 gene locus_tag LOCUS_05260 495376 494219 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876814.1 protein_id gnl|my_center|LOCUS_05260 495552 496544 gene locus_tag LOCUS_05270 495552 496544 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876813.1 protein_id gnl|my_center|LOCUS_05270 496710 496874 gene locus_tag LOCUS_05280 496710 496874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 496995 498596 gene locus_tag LOCUS_05290 496995 498596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 498845 500506 gene locus_tag LOCUS_05300 498845 500506 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876107.1 protein_id gnl|my_center|LOCUS_05300 500567 501103 gene locus_tag LOCUS_05310 500567 501103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 501467 502387 gene locus_tag LOCUS_05320 501467 502387 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05320 502718 502416 gene locus_tag LOCUS_05330 502718 502416 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876811.1 protein_id gnl|my_center|LOCUS_05330 502911 503759 gene locus_tag LOCUS_05340 502911 503759 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876810.1 protein_id gnl|my_center|LOCUS_05340 505349 503760 gene locus_tag LOCUS_05350 505349 503760 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876809.1 protein_id gnl|my_center|LOCUS_05350 505585 505409 gene locus_tag LOCUS_05360 505585 505409 CDS product DUF1922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876808.1 protein_id gnl|my_center|LOCUS_05360 507015 505786 gene locus_tag LOCUS_05370 507015 505786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 507711 507046 gene locus_tag LOCUS_05380 gene comB 507711 507046 CDS product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876806.1 protein_id gnl|my_center|LOCUS_05380 507984 507775 gene locus_tag LOCUS_05390 507984 507775 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064799.1 protein_id gnl|my_center|LOCUS_05390 508341 508604 gene locus_tag LOCUS_05400 508341 508604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 508625 509149 gene locus_tag LOCUS_05410 508625 509149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060984.1 protein_id gnl|my_center|LOCUS_05410 509134 510045 gene locus_tag LOCUS_05420 509134 510045 CDS product methanogenesis marker 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876804.1 protein_id gnl|my_center|LOCUS_05420 510118 511200 gene locus_tag LOCUS_05430 510118 511200 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876803.1 protein_id gnl|my_center|LOCUS_05430 512533 511283 gene locus_tag LOCUS_05440 gene mmp10 512533 511283 CDS product methyl coenzyme M reductase-arginine methyltransferase Mmp10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876794.1 protein_id gnl|my_center|LOCUS_05440 512825 514150 gene locus_tag LOCUS_05450 gene mcrB 512825 514150 CDS product coenzyme-B sulfoethylthiotransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061283.1 protein_id gnl|my_center|LOCUS_05450 514180 514623 gene locus_tag LOCUS_05460 gene mcrD 514180 514623 CDS product methyl-coenzyme M reductase operon protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876791.1 protein_id gnl|my_center|LOCUS_05460 514620 515216 gene locus_tag LOCUS_05470 gene mcrC 514620 515216 CDS product methyl-coenzyme M reductase I operon protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876790.1 protein_id gnl|my_center|LOCUS_05470 515219 515968 gene locus_tag LOCUS_05480 gene mcrG 515219 515968 CDS product coenzyme-B sulfoethylthiotransferase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060982.1 protein_id gnl|my_center|LOCUS_05480 515986 517638 gene locus_tag LOCUS_05490 gene mcrA 515986 517638 CDS product coenzyme-B sulfoethylthiotransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876788.1 protein_id gnl|my_center|LOCUS_05490 517698 518588 gene locus_tag LOCUS_05500 gene mtrE 517698 518588 CDS product tetrahydromethanopterin S-methyltransferase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870361.1 protein_id gnl|my_center|LOCUS_05500 518601 519326 gene locus_tag LOCUS_05510 gene mtrD 518601 519326 CDS product tetrahydromethanopterin S-methyltransferase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020333.1 protein_id gnl|my_center|LOCUS_05510 519326 520147 gene locus_tag LOCUS_05520 gene mtrC 519326 520147 CDS product tetrahydromethanopterin S-methyltransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876785.1 protein_id gnl|my_center|LOCUS_05520 520160 520462 gene locus_tag LOCUS_05530 520160 520462 CDS product tetrahydromethanopterin S-methyltransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876784.1 protein_id gnl|my_center|LOCUS_05530 520475 521197 gene locus_tag LOCUS_05540 gene mtrA 520475 521197 CDS product tetrahydromethanopterin S-methyltransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876783.1 protein_id gnl|my_center|LOCUS_05540 521210 521407 gene locus_tag LOCUS_05550 gene mtrF 521210 521407 CDS product tetrahydromethanopterin S-methyltransferase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876782.1 protein_id gnl|my_center|LOCUS_05550 521423 521686 gene locus_tag LOCUS_05560 gene mtrG 521423 521686 CDS product tetrahydromethanopterin S-methyltransferase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876781.1 protein_id gnl|my_center|LOCUS_05560 521703 522656 gene locus_tag LOCUS_05570 gene mtrH 521703 522656 CDS product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876780.1 protein_id gnl|my_center|LOCUS_05570 522987 524471 gene locus_tag LOCUS_05580 522987 524471 CDS product methanogenesis marker 14 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060979.1 protein_id gnl|my_center|LOCUS_05580 525365 524508 gene locus_tag LOCUS_05590 525365 524508 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868260.1 protein_id gnl|my_center|LOCUS_05590 525509 526105 gene locus_tag LOCUS_05600 525509 526105 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020976.1 protein_id gnl|my_center|LOCUS_05600 526095 526370 gene locus_tag LOCUS_05610 526095 526370 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876775.1 protein_id gnl|my_center|LOCUS_05610 527717 526485 gene locus_tag LOCUS_05620 527717 526485 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876774.1 protein_id gnl|my_center|LOCUS_05620 528472 527699 gene locus_tag LOCUS_05630 gene sufC 528472 527699 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876773.1 protein_id gnl|my_center|LOCUS_05630 528896 529336 gene locus_tag LOCUS_05640 528896 529336 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876760.1 protein_id gnl|my_center|LOCUS_05640 529339 530268 gene locus_tag LOCUS_05650 gene mvhG 529339 530268 CDS product F420-non-reducing hydrogenase subunit MvhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876759.1 protein_id gnl|my_center|LOCUS_05650 530269 531687 gene locus_tag LOCUS_05660 gene mvhA 530269 531687 CDS product F420-non-reducing hydrogenase subunit MvhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876758.1 protein_id gnl|my_center|LOCUS_05660 531708 532907 gene locus_tag LOCUS_05670 gene mvhB 531708 532907 CDS product polyferredoxin protein MvhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876757.1 protein_id gnl|my_center|LOCUS_05670 533178 532996 gene locus_tag LOCUS_05680 533178 532996 CDS product CooT family nickel-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876752.1 protein_id gnl|my_center|LOCUS_05680 534497 533214 gene locus_tag LOCUS_05690 gene pyrC 534497 533214 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060972.1 protein_id gnl|my_center|LOCUS_05690 536943 534697 gene locus_tag LOCUS_05700 536943 534697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 537532 536993 gene locus_tag LOCUS_05710 537532 536993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 537728 538762 gene locus_tag LOCUS_05720 537728 538762 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876750.1 protein_id gnl|my_center|LOCUS_05720 538753 539487 gene locus_tag LOCUS_05730 538753 539487 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876749.1 protein_id gnl|my_center|LOCUS_05730 539746 543432 gene locus_tag LOCUS_05740 539746 543432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 543446 544222 gene locus_tag LOCUS_05750 543446 544222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 544291 545556 gene locus_tag LOCUS_05760 544291 545556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 545557 546048 gene locus_tag LOCUS_05770 545557 546048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 546267 546461 gene locus_tag LOCUS_05780 546267 546461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 546477 546650 gene locus_tag LOCUS_05790 546477 546650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 546617 546967 gene locus_tag LOCUS_05800 546617 546967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05800 547005 547232 gene locus_tag LOCUS_05810 547005 547232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 547243 547959 gene locus_tag LOCUS_05820 547243 547959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 547992 548210 gene locus_tag LOCUS_05830 547992 548210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 548356 548213 gene locus_tag LOCUS_05840 548356 548213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 549106 548453 gene locus_tag LOCUS_05850 549106 548453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 549925 549191 gene locus_tag LOCUS_05860 549925 549191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05860 550741 549941 gene locus_tag LOCUS_05870 550741 549941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05870 551005 550769 gene locus_tag LOCUS_05880 551005 550769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 551796 551023 gene locus_tag LOCUS_05890 551796 551023 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060971.1 protein_id gnl|my_center|LOCUS_05890 551932 552414 gene locus_tag LOCUS_05900 gene rplJ 551932 552414 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876743.1 protein_id gnl|my_center|LOCUS_05900 552428 554725 gene locus_tag LOCUS_05910 gene ppsA 552428 554725 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250243.1 protein_id gnl|my_center|LOCUS_05910 554797 555945 gene locus_tag LOCUS_05920 gene mfnA 554797 555945 CDS product tyrosine decarboxylase MfnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250765.1 protein_id gnl|my_center|LOCUS_05920 556015 556509 gene locus_tag LOCUS_05930 556015 556509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 557243 556611 gene locus_tag LOCUS_05940 gene upp 557243 556611 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876738.1 protein_id gnl|my_center|LOCUS_05940 557686 558102 gene locus_tag LOCUS_05950 557686 558102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 559356 558214 gene locus_tag LOCUS_05960 559356 558214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 560039 559419 gene locus_tag LOCUS_05970 560039 559419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 561270 560089 gene locus_tag LOCUS_05980 561270 560089 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583648.1 protein_id gnl|my_center|LOCUS_05980 562209 561385 gene locus_tag LOCUS_05990 562209 561385 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876485.1 protein_id gnl|my_center|LOCUS_05990 563266 562451 gene locus_tag LOCUS_06000 563266 562451 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876485.1 protein_id gnl|my_center|LOCUS_06000 563840 563298 gene locus_tag LOCUS_06010 563840 563298 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061280.1 protein_id gnl|my_center|LOCUS_06010 564683 563862 gene locus_tag LOCUS_06020 gene cobS 564683 563862 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876736.1 protein_id gnl|my_center|LOCUS_06020 565912 564839 gene locus_tag LOCUS_06030 565912 564839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 566013 566348 gene locus_tag LOCUS_06040 566013 566348 CDS product MJ1244 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060970.1 protein_id gnl|my_center|LOCUS_06040 567052 567291 gene locus_tag LOCUS_06050 567052 567291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 567558 567902 gene locus_tag LOCUS_06060 567558 567902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 568081 569286 gene locus_tag LOCUS_06070 gene larC 568081 569286 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060969.1 protein_id gnl|my_center|LOCUS_06070 569302 569928 gene locus_tag LOCUS_06080 569302 569928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 570015 570920 gene locus_tag LOCUS_06090 570015 570920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 571015 571524 gene locus_tag LOCUS_06100 571015 571524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 571545 572234 gene locus_tag LOCUS_06110 gene queC 571545 572234 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876732.1 protein_id gnl|my_center|LOCUS_06110 572405 573016 gene locus_tag LOCUS_06120 572405 573016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876475.1 protein_id gnl|my_center|LOCUS_06120 573730 573035 gene locus_tag LOCUS_06130 573730 573035 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021737.1 protein_id gnl|my_center|LOCUS_06130 575528 573807 gene locus_tag LOCUS_06140 gene oadA 575528 573807 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876731.1 protein_id gnl|my_center|LOCUS_06140 575923 576750 gene locus_tag LOCUS_06150 gene nifH 575923 576750 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061088.1 protein_id gnl|my_center|LOCUS_06150 576774 577091 gene locus_tag LOCUS_06160 576774 577091 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061089.1 protein_id gnl|my_center|LOCUS_06160 577127 577495 gene locus_tag LOCUS_06170 577127 577495 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877171.1 protein_id gnl|my_center|LOCUS_06170 577559 578869 gene locus_tag LOCUS_06180 577559 578869 CDS product nitrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877172.1 protein_id gnl|my_center|LOCUS_06180 578866 580254 gene locus_tag LOCUS_06190 578866 580254 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877173.1 protein_id gnl|my_center|LOCUS_06190 580357 581934 gene locus_tag LOCUS_06200 gene nifE 580357 581934 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877174.1 protein_id gnl|my_center|LOCUS_06200 581951 583330 gene locus_tag LOCUS_06210 581951 583330 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877175.1 protein_id gnl|my_center|LOCUS_06210 583376 583687 gene locus_tag LOCUS_06220 583376 583687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 583763 583951 gene locus_tag LOCUS_06230 583763 583951 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061279.1 protein_id gnl|my_center|LOCUS_06230 584046 585986 gene locus_tag LOCUS_06240 584046 585986 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877176.1 protein_id gnl|my_center|LOCUS_06240 587112 586018 gene locus_tag LOCUS_06250 587112 586018 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060968.1 protein_id gnl|my_center|LOCUS_06250 587838 587386 gene locus_tag LOCUS_06260 587838 587386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 588895 588011 gene locus_tag LOCUS_06270 588895 588011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876728.1 protein_id gnl|my_center|LOCUS_06270 589188 590279 gene locus_tag LOCUS_06280 589188 590279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 590611 594909 gene locus_tag LOCUS_06290 590611 594909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 594945 597578 gene locus_tag LOCUS_06300 594945 597578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 598144 597644 gene locus_tag LOCUS_06310 598144 597644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 600305 598284 gene locus_tag LOCUS_06320 600305 598284 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223224.1 protein_id gnl|my_center|LOCUS_06320 600937 601158 gene locus_tag LOCUS_06330 600937 601158 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876887.1 protein_id gnl|my_center|LOCUS_06330 601440 601775 gene locus_tag LOCUS_06340 601440 601775 CDS product DUF2769 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875739.1 protein_id gnl|my_center|LOCUS_06340 601723 601905 gene locus_tag LOCUS_06350 601723 601905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 601973 604276 gene locus_tag LOCUS_06360 601973 604276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 604441 604992 gene locus_tag LOCUS_06370 604441 604992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 605586 605155 gene locus_tag LOCUS_06380 605586 605155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 605772 606320 gene locus_tag LOCUS_06390 605772 606320 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227754.1 protein_id gnl|my_center|LOCUS_06390 606332 606790 gene locus_tag LOCUS_06400 606332 606790 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060861.1 protein_id gnl|my_center|LOCUS_06400 606845 607468 gene locus_tag LOCUS_06410 606845 607468 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990775.1 protein_id gnl|my_center|LOCUS_06410 607483 607866 gene locus_tag LOCUS_06420 607483 607866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809191.1 protein_id gnl|my_center|LOCUS_06420 607903 608289 gene locus_tag LOCUS_06430 607903 608289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 608319 608747 gene locus_tag LOCUS_06440 608319 608747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 608758 609585 gene locus_tag LOCUS_06450 608758 609585 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938184.1 protein_id gnl|my_center|LOCUS_06450 609602 610612 gene locus_tag LOCUS_06460 609602 610612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 612047 610773 gene locus_tag LOCUS_06470 612047 610773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 614235 613078 gene locus_tag LOCUS_06480 614235 613078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 615813 614254 gene locus_tag LOCUS_06490 615813 614254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 616265 615993 gene locus_tag LOCUS_06500 616265 615993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 616865 616386 gene locus_tag LOCUS_06510 616865 616386 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876721.1 protein_id gnl|my_center|LOCUS_06510 617366 617019 gene locus_tag LOCUS_06520 617366 617019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 618822 617461 gene locus_tag LOCUS_06530 618822 617461 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022297.1 protein_id gnl|my_center|LOCUS_06530 619087 620028 gene locus_tag LOCUS_06540 619087 620028 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876717.1 protein_id gnl|my_center|LOCUS_06540 620029 620793 gene locus_tag LOCUS_06550 620029 620793 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061277.1 protein_id gnl|my_center|LOCUS_06550 621284 620805 gene locus_tag LOCUS_06560 621284 620805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 621588 621403 gene locus_tag LOCUS_06570 621588 621403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 621923 622627 gene locus_tag LOCUS_06580 621923 622627 CDS product S24/S26 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060845.1 protein_id gnl|my_center|LOCUS_06580 623185 623625 gene locus_tag LOCUS_06590 623185 623625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 623889 624893 gene locus_tag LOCUS_06600 623889 624893 CDS product UPF0104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876017.1 protein_id gnl|my_center|LOCUS_06600 625037 625642 gene locus_tag LOCUS_06610 625037 625642 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875754.1 protein_id gnl|my_center|LOCUS_06610 625815 627143 gene locus_tag LOCUS_06620 625815 627143 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875743.1 protein_id gnl|my_center|LOCUS_06620 627175 627876 gene locus_tag LOCUS_06630 627175 627876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 628143 628745 gene locus_tag LOCUS_06640 628143 628745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 628893 628967 gene locus_tag LOCUS_t00140 628893 628967 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 628991 630118 gene locus_tag LOCUS_06650 628991 630118 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013296134.1 protein_id gnl|my_center|LOCUS_06650 630295 630140 gene locus_tag LOCUS_06660 630295 630140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 630753 630352 gene locus_tag LOCUS_06670 630753 630352 CDS product DUF61 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876580.1 protein_id gnl|my_center|LOCUS_06670 630852 631184 gene locus_tag LOCUS_06680 630852 631184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876581.1 protein_id gnl|my_center|LOCUS_06680 631587 631201 gene locus_tag LOCUS_06690 631587 631201 CDS product DUF22 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876583.1 protein_id gnl|my_center|LOCUS_06690 632227 631826 gene locus_tag LOCUS_06700 632227 631826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06700 633652 632258 gene locus_tag LOCUS_06710 633652 632258 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013296141.1 protein_id gnl|my_center|LOCUS_06710 635406 633655 gene locus_tag LOCUS_06720 635406 633655 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876586.1 protein_id gnl|my_center|LOCUS_06720 635723 635403 gene locus_tag LOCUS_06730 635723 635403 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876587.1 protein_id gnl|my_center|LOCUS_06730 636742 635720 gene locus_tag LOCUS_06740 636742 635720 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876588.1 protein_id gnl|my_center|LOCUS_06740 636741 636881 gene locus_tag LOCUS_06750 636741 636881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 637516 636893 gene locus_tag LOCUS_06760 637516 636893 CDS product V-type ATP synthase subunit E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876589.1 protein_id gnl|my_center|LOCUS_06760 638017 637529 gene locus_tag LOCUS_06770 638017 637529 CDS product ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876590.1 protein_id gnl|my_center|LOCUS_06770 640029 638023 gene locus_tag LOCUS_06780 640029 638023 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060932.1 protein_id gnl|my_center|LOCUS_06780 640379 640065 gene locus_tag LOCUS_06790 gene ahaH 640379 640065 CDS product ATP synthase archaeal subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060933.1 protein_id gnl|my_center|LOCUS_06790 641306 640485 gene locus_tag LOCUS_06800 641306 640485 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876593.1 protein_id gnl|my_center|LOCUS_06800 642173 641313 gene locus_tag LOCUS_06810 642173 641313 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876594.1 protein_id gnl|my_center|LOCUS_06810 643097 642201 gene locus_tag LOCUS_06820 643097 642201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876595.1 protein_id gnl|my_center|LOCUS_06820 644429 643107 gene locus_tag LOCUS_06830 644429 643107 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876596.1 protein_id gnl|my_center|LOCUS_06830 645767 644511 gene locus_tag LOCUS_06840 645767 644511 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876597.1 protein_id gnl|my_center|LOCUS_06840 645823 646770 gene locus_tag LOCUS_06850 645823 646770 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876598.1 protein_id gnl|my_center|LOCUS_06850 647558 646809 gene locus_tag LOCUS_06860 647558 646809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061265.1 protein_id gnl|my_center|LOCUS_06860 647902 647567 gene locus_tag LOCUS_06870 647902 647567 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061225.1 protein_id gnl|my_center|LOCUS_06870 648277 649854 gene locus_tag LOCUS_06880 gene serA 648277 649854 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061266.1 protein_id gnl|my_center|LOCUS_06880 650587 650033 gene locus_tag LOCUS_06890 650587 650033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 651086 650658 gene locus_tag LOCUS_06900 651086 650658 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060934.1 protein_id gnl|my_center|LOCUS_06900 651933 651202 gene locus_tag LOCUS_06910 651933 651202 CDS product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 protein_id gnl|my_center|LOCUS_06910 652752 651988 gene locus_tag LOCUS_06920 652752 651988 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060936.1 protein_id gnl|my_center|LOCUS_06920 653087 652758 gene locus_tag LOCUS_06930 653087 652758 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060937.1 protein_id gnl|my_center|LOCUS_06930 653333 654055 gene locus_tag LOCUS_06940 653333 654055 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209477233.1 protein_id gnl|my_center|LOCUS_06940 654626 654066 gene locus_tag LOCUS_06950 654626 654066 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020386.1 protein_id gnl|my_center|LOCUS_06950 655072 654641 gene locus_tag LOCUS_06960 655072 654641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06960 655581 655288 gene locus_tag LOCUS_06970 655581 655288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939692.1 protein_id gnl|my_center|LOCUS_06970 656255 655614 gene locus_tag LOCUS_06980 656255 655614 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020384.1 protein_id gnl|my_center|LOCUS_06980 656523 656323 gene locus_tag LOCUS_06990 656523 656323 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992809.1 protein_id gnl|my_center|LOCUS_06990 657375 656542 gene locus_tag LOCUS_07000 657375 656542 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065510.1 protein_id gnl|my_center|LOCUS_07000 657542 657991 gene locus_tag LOCUS_07010 657542 657991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 659413 658001 gene locus_tag LOCUS_07020 659413 658001 CDS product lactaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870928.1 protein_id gnl|my_center|LOCUS_07020 659765 659562 gene locus_tag LOCUS_07030 659765 659562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 659974 659777 gene locus_tag LOCUS_07040 659974 659777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 660929 659997 gene locus_tag LOCUS_07050 660929 659997 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876611.1 protein_id gnl|my_center|LOCUS_07050 662066 661077 gene locus_tag LOCUS_07060 662066 661077 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485766.1 protein_id gnl|my_center|LOCUS_07060 662525 662070 gene locus_tag LOCUS_07070 662525 662070 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485767.1 protein_id gnl|my_center|LOCUS_07070 662839 664002 gene locus_tag LOCUS_07080 662839 664002 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088548.1 protein_id gnl|my_center|LOCUS_07080 664054 665175 gene locus_tag LOCUS_07090 664054 665175 CDS product histidine kinase dimerization/phosphoacceptor domain -containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876616.1 protein_id gnl|my_center|LOCUS_07090 665352 665903 gene locus_tag LOCUS_07100 665352 665903 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061267.1 protein_id gnl|my_center|LOCUS_07100 665933 667132 gene locus_tag LOCUS_07110 665933 667132 CDS product YcaO-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876618.1 protein_id gnl|my_center|LOCUS_07110 667116 668054 gene locus_tag LOCUS_07120 667116 668054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 668712 668104 gene locus_tag LOCUS_07130 668712 668104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877047.1 protein_id gnl|my_center|LOCUS_07130 669173 668757 gene locus_tag LOCUS_07140 669173 668757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 669275 669871 gene locus_tag LOCUS_07150 669275 669871 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029057.1 protein_id gnl|my_center|LOCUS_07150 670044 670577 gene locus_tag LOCUS_07160 670044 670577 CDS product PsbP-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750442.1 protein_id gnl|my_center|LOCUS_07160 670737 671075 gene locus_tag LOCUS_07170 gene pth2 670737 671075 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877304.1 protein_id gnl|my_center|LOCUS_07170 671099 671743 gene locus_tag LOCUS_07180 671099 671743 CDS product delta 1-pyrroline-5-carboxylate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061123.1 protein_id gnl|my_center|LOCUS_07180 671744 671905 gene locus_tag LOCUS_07190 671744 671905 CDS product zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877306.1 protein_id gnl|my_center|LOCUS_07190 672027 672296 gene locus_tag LOCUS_07200 672027 672296 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877307.1 protein_id gnl|my_center|LOCUS_07200 672490 673791 gene locus_tag LOCUS_07210 672490 673791 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892580.1 protein_id gnl|my_center|LOCUS_07210 674161 673826 gene locus_tag LOCUS_07220 674161 673826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 674805 674221 gene locus_tag LOCUS_07230 gene hxlB 674805 674221 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061192.1 protein_id gnl|my_center|LOCUS_07230 676727 674838 gene locus_tag LOCUS_07240 676727 674838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 677590 676838 gene locus_tag LOCUS_07250 677590 676838 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024418.1 protein_id gnl|my_center|LOCUS_07250 677877 679688 gene locus_tag LOCUS_07260 677877 679688 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750460.1 protein_id gnl|my_center|LOCUS_07260 679702 680769 gene locus_tag LOCUS_07270 679702 680769 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877311.1 protein_id gnl|my_center|LOCUS_07270 681646 680855 gene locus_tag LOCUS_07280 gene cbiQ 681646 680855 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877313.1 protein_id gnl|my_center|LOCUS_07280 681995 681696 gene locus_tag LOCUS_07290 681995 681696 CDS product PDGLE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877314.1 protein_id gnl|my_center|LOCUS_07290 682620 681988 gene locus_tag LOCUS_07300 gene cbiM 682620 681988 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065876.1 protein_id gnl|my_center|LOCUS_07300 682929 685283 gene locus_tag LOCUS_07310 gene cdhA 682929 685283 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061124.1 protein_id gnl|my_center|LOCUS_07310 685302 685811 gene locus_tag LOCUS_07320 gene cdhB 685302 685811 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877317.1 protein_id gnl|my_center|LOCUS_07320 685866 687254 gene locus_tag LOCUS_07330 gene cdhC 685866 687254 CDS product CO dehydrogenase/CO-methylating acetyl-CoA synthase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877318.1 protein_id gnl|my_center|LOCUS_07330 687282 688037 gene locus_tag LOCUS_07340 687282 688037 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061125.1 protein_id gnl|my_center|LOCUS_07340 688081 689244 gene locus_tag LOCUS_07350 gene cdhD 688081 689244 CDS product CO dehydrogenase/acetyl-CoA synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061126.1 protein_id gnl|my_center|LOCUS_07350 689265 690638 gene locus_tag LOCUS_07360 gene acsC 689265 690638 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877321.1 protein_id gnl|my_center|LOCUS_07360 690686 691141 gene locus_tag LOCUS_07370 690686 691141 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211305658.1 protein_id gnl|my_center|LOCUS_07370 691677 691138 gene locus_tag LOCUS_07380 691677 691138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 692852 691704 gene locus_tag LOCUS_07390 692852 691704 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061129.1 protein_id gnl|my_center|LOCUS_07390 693213 693019 gene locus_tag LOCUS_07400 693213 693019 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870037.1 protein_id gnl|my_center|LOCUS_07400 693563 693647 gene locus_tag LOCUS_t00150 693563 693647 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 693822 693896 gene locus_tag LOCUS_t00160 693822 693896 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 694040 694846 gene locus_tag LOCUS_07410 694040 694846 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877328.1 protein_id gnl|my_center|LOCUS_07410 694959 695555 gene locus_tag LOCUS_07420 694959 695555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877329.1 protein_id gnl|my_center|LOCUS_07420 695565 696479 gene locus_tag LOCUS_07430 695565 696479 CDS product PhoU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877330.1 protein_id gnl|my_center|LOCUS_07430 696795 696526 gene locus_tag LOCUS_07440 696795 696526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 697092 697922 gene locus_tag LOCUS_07450 697092 697922 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877333.1 protein_id gnl|my_center|LOCUS_07450 698059 698868 gene locus_tag LOCUS_07460 698059 698868 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877333.1 protein_id gnl|my_center|LOCUS_07460 698937 699809 gene locus_tag LOCUS_07470 gene pstC 698937 699809 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877335.1 protein_id gnl|my_center|LOCUS_07470 699852 700700 gene locus_tag LOCUS_07480 gene pstA 699852 700700 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877336.1 protein_id gnl|my_center|LOCUS_07480 700702 701457 gene locus_tag LOCUS_07490 gene pstB 700702 701457 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061132.1 protein_id gnl|my_center|LOCUS_07490 701532 702188 gene locus_tag LOCUS_07500 gene phoU 701532 702188 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877340.1 protein_id gnl|my_center|LOCUS_07500 703126 702287 gene locus_tag LOCUS_07510 703126 702287 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877341.1 protein_id gnl|my_center|LOCUS_07510 704200 703319 gene locus_tag LOCUS_07520 704200 703319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 706915 704213 gene locus_tag LOCUS_07530 706915 704213 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272585.1 protein_id gnl|my_center|LOCUS_07530 707491 707060 gene locus_tag LOCUS_07540 707491 707060 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877342.1 protein_id gnl|my_center|LOCUS_07540 707993 707502 gene locus_tag LOCUS_07550 707993 707502 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061134.1 protein_id gnl|my_center|LOCUS_07550 708872 708006 gene locus_tag LOCUS_07560 gene porB 708872 708006 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877344.1 protein_id gnl|my_center|LOCUS_07560 710028 708874 gene locus_tag LOCUS_07570 gene porA 710028 708874 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877345.1 protein_id gnl|my_center|LOCUS_07570 710271 710029 gene locus_tag LOCUS_07580 gene porD 710271 710029 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869765.1 protein_id gnl|my_center|LOCUS_07580 710811 710281 gene locus_tag LOCUS_07590 gene porC 710811 710281 CDS product pyruvate synthase subunit PorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892553.1 protein_id gnl|my_center|LOCUS_07590 711016 712584 gene locus_tag LOCUS_07600 711016 712584 CDS product dihydropteroate synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877347.1 protein_id gnl|my_center|LOCUS_07600 712638 713570 gene locus_tag LOCUS_07610 712638 713570 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877348.1 protein_id gnl|my_center|LOCUS_07610 713573 713773 gene locus_tag LOCUS_07620 713573 713773 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061136.1 protein_id gnl|my_center|LOCUS_07620 713866 714879 gene locus_tag LOCUS_07630 713866 714879 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868734.1 protein_id gnl|my_center|LOCUS_07630 714971 715831 gene locus_tag LOCUS_07640 714971 715831 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877350.1 protein_id gnl|my_center|LOCUS_07640 715888 716313 gene locus_tag LOCUS_07650 715888 716313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 716353 716970 gene locus_tag LOCUS_07660 716353 716970 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877352.1 protein_id gnl|my_center|LOCUS_07660 716991 717824 gene locus_tag LOCUS_07670 716991 717824 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877353.1 protein_id gnl|my_center|LOCUS_07670 719807 717834 gene locus_tag LOCUS_07680 719807 717834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 721305 720019 gene locus_tag LOCUS_07690 721305 720019 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892544.1 protein_id gnl|my_center|LOCUS_07690 721989 721600 gene locus_tag LOCUS_07700 721989 721600 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020467.1 protein_id gnl|my_center|LOCUS_07700 722141 722365 gene locus_tag LOCUS_07710 722141 722365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 722526 723686 gene locus_tag LOCUS_07720 722526 723686 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949066.1 protein_id gnl|my_center|LOCUS_07720 724167 724439 gene locus_tag LOCUS_07730 724167 724439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 724706 725800 gene locus_tag LOCUS_07740 724706 725800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 726863 725805 gene locus_tag LOCUS_07750 726863 725805 CDS product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870054.1 protein_id gnl|my_center|LOCUS_07750 727983 727018 gene locus_tag LOCUS_07760 gene mer 727983 727018 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877358.1 protein_id gnl|my_center|LOCUS_07760 728835 730303 gene locus_tag LOCUS_r00010 728835 730303 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 730386 730463 gene locus_tag LOCUS_t00170 730386 730463 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 730608 733228 gene locus_tag LOCUS_r00020 730608 733228 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 733229 733253 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 733605 733718 gene locus_tag LOCUS_r00030 733605 733718 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 735551 734055 gene locus_tag LOCUS_07770 735551 734055 CDS product glycosyltransferase family 20 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877359.1 protein_id gnl|my_center|LOCUS_07770 736914 735613 gene locus_tag LOCUS_07780 736914 735613 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877360.1 protein_id gnl|my_center|LOCUS_07780 738080 736944 gene locus_tag LOCUS_07790 738080 736944 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485794.1 protein_id gnl|my_center|LOCUS_07790 738993 738196 gene locus_tag LOCUS_07800 gene otsB 738993 738196 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877362.1 protein_id gnl|my_center|LOCUS_07800 740237 739098 gene locus_tag LOCUS_07810 740237 739098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877363.1 protein_id gnl|my_center|LOCUS_07810 740431 741075 gene locus_tag LOCUS_07820 740431 741075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 741590 741114 gene locus_tag LOCUS_07830 741590 741114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 741927 742622 gene locus_tag LOCUS_07840 741927 742622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 742619 743275 gene locus_tag LOCUS_07850 742619 743275 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871031.1 protein_id gnl|my_center|LOCUS_07850 744002 743301 gene locus_tag LOCUS_07860 744002 743301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876122.1 protein_id gnl|my_center|LOCUS_07860 746079 744184 gene locus_tag LOCUS_07870 746079 744184 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061138.1 protein_id gnl|my_center|LOCUS_07870 746378 747187 gene locus_tag LOCUS_07880 746378 747187 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066246.1 protein_id gnl|my_center|LOCUS_07880 747350 747730 gene locus_tag LOCUS_07890 747350 747730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 750398 747777 gene locus_tag LOCUS_07900 750398 747777 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877365.1 protein_id gnl|my_center|LOCUS_07900 750520 751095 gene locus_tag LOCUS_07910 gene tmk 750520 751095 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877367.1 protein_id gnl|my_center|LOCUS_07910 751418 751221 gene locus_tag LOCUS_07920 751418 751221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877368.1 protein_id gnl|my_center|LOCUS_07920 752390 751431 gene locus_tag LOCUS_07930 752390 751431 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877369.1 protein_id gnl|my_center|LOCUS_07930 753600 752545 gene locus_tag LOCUS_07940 753600 752545 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877370.1 protein_id gnl|my_center|LOCUS_07940 754060 753653 gene locus_tag LOCUS_07950 754060 753653 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877371.1 protein_id gnl|my_center|LOCUS_07950 756186 754183 gene locus_tag LOCUS_07960 756186 754183 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877372.1 protein_id gnl|my_center|LOCUS_07960 756350 756784 gene locus_tag LOCUS_07970 756350 756784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061140.1 protein_id gnl|my_center|LOCUS_07970 757508 756903 gene locus_tag LOCUS_07980 gene rrmJ 757508 756903 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877375.1 protein_id gnl|my_center|LOCUS_07980 758069 757542 gene locus_tag LOCUS_07990 758069 757542 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877376.1 protein_id gnl|my_center|LOCUS_07990 758452 760584 gene locus_tag LOCUS_08000 gene topA 758452 760584 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061102.1 protein_id gnl|my_center|LOCUS_08000 760739 763297 gene locus_tag LOCUS_08010 760739 763297 CDS product STT3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877231.1 protein_id gnl|my_center|LOCUS_08010 763646 764740 gene locus_tag LOCUS_08020 763646 764740 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061317.1 protein_id gnl|my_center|LOCUS_08020 764812 765591 gene locus_tag LOCUS_08030 764812 765591 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061316.1 protein_id gnl|my_center|LOCUS_08030 765612 766154 gene locus_tag LOCUS_08040 765612 766154 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877227.1 protein_id gnl|my_center|LOCUS_08040 766422 766793 gene locus_tag LOCUS_08050 766422 766793 CDS product ribonuclease P protein component 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877226.1 protein_id gnl|my_center|LOCUS_08050 766756 767016 gene locus_tag LOCUS_08060 766756 767016 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061101.1 protein_id gnl|my_center|LOCUS_08060 767031 767468 gene locus_tag LOCUS_08070 767031 767468 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877224.1 protein_id gnl|my_center|LOCUS_08070 767508 767843 gene locus_tag LOCUS_08080 767508 767843 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877223.1 protein_id gnl|my_center|LOCUS_08080 767885 768436 gene locus_tag LOCUS_08090 767885 768436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877222.1 protein_id gnl|my_center|LOCUS_08090 768469 768624 gene locus_tag LOCUS_08100 768469 768624 CDS product 50S ribosomal protein L39e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877221.1 protein_id gnl|my_center|LOCUS_08100 768637 768882 gene locus_tag LOCUS_08110 768637 768882 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877220.1 protein_id gnl|my_center|LOCUS_08110 768893 769567 gene locus_tag LOCUS_08120 768893 769567 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877219.1 protein_id gnl|my_center|LOCUS_08120 769564 769788 gene locus_tag LOCUS_08130 gene rpl18a 769564 769788 CDS product 50S ribosomal protein L18Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061100.1 protein_id gnl|my_center|LOCUS_08130 769801 770235 gene locus_tag LOCUS_08140 gene pfdA 769801 770235 CDS product prefoldin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877217.1 protein_id gnl|my_center|LOCUS_08140 770301 771500 gene locus_tag LOCUS_08150 gene ftsY 770301 771500 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877216.1 protein_id gnl|my_center|LOCUS_08150 771566 772402 gene locus_tag LOCUS_08160 771566 772402 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876722.1 protein_id gnl|my_center|LOCUS_08160 772444 772839 gene locus_tag LOCUS_08170 gene tsaA 772444 772839 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877752.1 protein_id gnl|my_center|LOCUS_08170 772899 773618 gene locus_tag LOCUS_08180 772899 773618 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990768.1 protein_id gnl|my_center|LOCUS_08180 773895 775316 gene locus_tag LOCUS_08190 773895 775316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 775414 776787 gene locus_tag LOCUS_08200 775414 776787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 777376 776885 gene locus_tag LOCUS_08210 777376 776885 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_08210 777898 777419 gene locus_tag LOCUS_08220 777898 777419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08220 778073 777900 gene locus_tag LOCUS_08230 778073 777900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08230 779154 778066 gene locus_tag LOCUS_08240 779154 778066 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064397.1 protein_id gnl|my_center|LOCUS_08240 779452 779246 gene locus_tag LOCUS_08250 779452 779246 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876941.1 protein_id gnl|my_center|LOCUS_08250 779918 779487 gene locus_tag LOCUS_08260 779918 779487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876940.1 protein_id gnl|my_center|LOCUS_08260 780120 781037 gene locus_tag LOCUS_08270 780120 781037 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876474.1 protein_id gnl|my_center|LOCUS_08270 781612 781040 gene locus_tag LOCUS_08280 781612 781040 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060967.1 protein_id gnl|my_center|LOCUS_08280 782212 781616 gene locus_tag LOCUS_08290 782212 781616 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485785.1 protein_id gnl|my_center|LOCUS_08290 782970 782314 gene locus_tag LOCUS_08300 782970 782314 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061278.1 protein_id gnl|my_center|LOCUS_08300 783077 783565 gene locus_tag LOCUS_08310 783077 783565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022230.1 protein_id gnl|my_center|LOCUS_08310 784879 783692 gene locus_tag LOCUS_08320 784879 783692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 785494 787002 gene locus_tag LOCUS_08330 785494 787002 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060924.1 protein_id gnl|my_center|LOCUS_08330 787044 787949 gene locus_tag LOCUS_08340 787044 787949 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_08340 789761 788034 gene locus_tag LOCUS_08350 789761 788034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 791769 789748 gene locus_tag LOCUS_08360 791769 789748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 795262 791912 gene locus_tag LOCUS_08370 795262 791912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 795822 796277 gene locus_tag LOCUS_08380 795822 796277 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061315.1 protein_id gnl|my_center|LOCUS_08380 797156 798193 gene locus_tag LOCUS_08390 gene purC 797156 798193 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582681.1 protein_id gnl|my_center|LOCUS_08390 798183 798563 gene locus_tag LOCUS_08400 798183 798563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 798577 800040 gene locus_tag LOCUS_08410 gene ppcA 798577 800040 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060929.1 protein_id gnl|my_center|LOCUS_08410 800942 800433 gene locus_tag LOCUS_08420 gene cdhB 800942 800433 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877317.1 protein_id gnl|my_center|LOCUS_08420 801052 803484 gene locus_tag LOCUS_08430 gene cdhA 801052 803484 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061124.1 protein_id gnl|my_center|LOCUS_08430 803623 804000 gene locus_tag LOCUS_08440 803623 804000 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869650.1 protein_id gnl|my_center|LOCUS_08440 805993 804041 gene locus_tag LOCUS_08450 gene acs 805993 804041 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319494.1 protein_id gnl|my_center|LOCUS_08450 807691 806168 gene locus_tag LOCUS_08460 807691 806168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 808073 809680 gene locus_tag LOCUS_08470 808073 809680 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877210.1 protein_id gnl|my_center|LOCUS_08470 809735 811093 gene locus_tag LOCUS_08480 809735 811093 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_08480 812353 811196 gene locus_tag LOCUS_08490 812353 811196 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061314.1 protein_id gnl|my_center|LOCUS_08490 812891 813334 gene locus_tag LOCUS_08500 812891 813334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08500 813391 813720 gene locus_tag LOCUS_08510 813391 813720 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461986.1 protein_id gnl|my_center|LOCUS_08510 814635 813742 gene locus_tag LOCUS_08520 814635 813742 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877489.1 protein_id gnl|my_center|LOCUS_08520 814762 815112 gene locus_tag LOCUS_08530 814762 815112 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877397.1 protein_id gnl|my_center|LOCUS_08530 816076 815459 gene locus_tag LOCUS_08540 816076 815459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 816325 817449 gene locus_tag LOCUS_08550 gene cdc6-2 816325 817449 CDS product ORC1-type DNA replication protein Cdc6-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877207.1 protein_id gnl|my_center|LOCUS_08550 817622 817446 gene locus_tag LOCUS_08560 817622 817446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 817836 818276 gene locus_tag LOCUS_08570 817836 818276 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877206.1 protein_id gnl|my_center|LOCUS_08570 818404 819852 gene locus_tag LOCUS_08580 818404 819852 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061099.1 protein_id gnl|my_center|LOCUS_08580 819903 820673 gene locus_tag LOCUS_08590 gene mtnP 819903 820673 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877204.1 protein_id gnl|my_center|LOCUS_08590 820847 821764 gene locus_tag LOCUS_08600 gene nadA 820847 821764 CDS product quinolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877429.1 protein_id gnl|my_center|LOCUS_08600 823524 821917 gene locus_tag LOCUS_08610 823524 821917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 823926 825080 gene locus_tag LOCUS_08620 823926 825080 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391684.1 protein_id gnl|my_center|LOCUS_08620 825567 826202 gene locus_tag LOCUS_08630 825567 826202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 826252 827241 gene locus_tag LOCUS_08640 826252 827241 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060741.1 protein_id gnl|my_center|LOCUS_08640 827410 829401 gene locus_tag LOCUS_08650 827410 829401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 829483 830250 gene locus_tag LOCUS_08660 829483 830250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022686.1 protein_id gnl|my_center|LOCUS_08660 830649 830284 gene locus_tag LOCUS_08670 830649 830284 CDS product DUF1284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024120.1 protein_id gnl|my_center|LOCUS_08670 831406 830744 gene locus_tag LOCUS_08680 831406 830744 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443401.1 protein_id gnl|my_center|LOCUS_08680 832151 831663 gene locus_tag LOCUS_08690 832151 831663 CDS product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024098.1 protein_id gnl|my_center|LOCUS_08690 833494 832307 gene locus_tag LOCUS_08700 833494 832307 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545988.1 protein_id gnl|my_center|LOCUS_08700 834624 833635 gene locus_tag LOCUS_08710 834624 833635 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876526.1 protein_id gnl|my_center|LOCUS_08710 836181 834670 gene locus_tag LOCUS_08720 836181 834670 CDS product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876525.1 protein_id gnl|my_center|LOCUS_08720 837453 836293 gene locus_tag LOCUS_08730 gene dnaG 837453 836293 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876524.1 protein_id gnl|my_center|LOCUS_08730 837966 837559 gene locus_tag LOCUS_08740 837966 837559 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876523.1 protein_id gnl|my_center|LOCUS_08740 838523 838813 gene locus_tag LOCUS_08750 838523 838813 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876522.1 protein_id gnl|my_center|LOCUS_08750 838820 839485 gene locus_tag LOCUS_08760 838820 839485 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876521.1 protein_id gnl|my_center|LOCUS_08760 839571 840638 gene locus_tag LOCUS_08770 839571 840638 CDS product UPF0104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061258.1 protein_id gnl|my_center|LOCUS_08770 840846 841121 gene locus_tag LOCUS_08780 840846 841121 CDS product Gar1/Naf1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876519.1 protein_id gnl|my_center|LOCUS_08780 841118 842053 gene locus_tag LOCUS_08790 841118 842053 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876518.1 protein_id gnl|my_center|LOCUS_08790 843792 842167 gene locus_tag LOCUS_08800 gene lfrA 843792 842167 CDS product efflux MFS transporter LfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731134.1 protein_id gnl|my_center|LOCUS_08800 844133 844894 gene locus_tag LOCUS_08810 844133 844894 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876144.1 protein_id gnl|my_center|LOCUS_08810 845098 844901 gene locus_tag LOCUS_08820 845098 844901 CDS product DUF2116 family Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876513.1 protein_id gnl|my_center|LOCUS_08820 846004 845330 gene locus_tag LOCUS_08830 gene pyrH 846004 845330 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876512.1 protein_id gnl|my_center|LOCUS_08830 846196 847425 gene locus_tag LOCUS_08840 gene prf1 846196 847425 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876511.1 protein_id gnl|my_center|LOCUS_08840 848296 847700 gene locus_tag LOCUS_08850 848296 847700 CDS product orotate phosphoribosyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876509.1 protein_id gnl|my_center|LOCUS_08850 849327 848374 gene locus_tag LOCUS_08860 849327 848374 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876508.1 protein_id gnl|my_center|LOCUS_08860 850196 849324 gene locus_tag LOCUS_08870 gene hemC 850196 849324 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876507.1 protein_id gnl|my_center|LOCUS_08870 851714 850353 gene locus_tag LOCUS_08880 gene cfbE 851714 850353 CDS product coenzyme F430 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485764.1 protein_id gnl|my_center|LOCUS_08880 852611 851769 gene locus_tag LOCUS_08890 852611 851769 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876505.1 protein_id gnl|my_center|LOCUS_08890 853438 852611 gene locus_tag LOCUS_08900 853438 852611 CDS product bifunctional fructose-bisphosphatase/inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876504.1 protein_id gnl|my_center|LOCUS_08900 853888 853445 gene locus_tag LOCUS_08910 853888 853445 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060917.1 protein_id gnl|my_center|LOCUS_08910 854167 854556 gene locus_tag LOCUS_08920 gene eif5A 854167 854556 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876502.1 protein_id gnl|my_center|LOCUS_08920 854644 855522 gene locus_tag LOCUS_08930 gene speB 854644 855522 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876501.1 protein_id gnl|my_center|LOCUS_08930 855745 856980 gene locus_tag LOCUS_08940 855745 856980 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876500.1 protein_id gnl|my_center|LOCUS_08940 857325 857017 gene locus_tag LOCUS_08950 857325 857017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 857408 858466 gene locus_tag LOCUS_08960 857408 858466 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020792.1 protein_id gnl|my_center|LOCUS_08960 858613 860220 gene locus_tag LOCUS_08970 gene ade 858613 860220 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876499.1 protein_id gnl|my_center|LOCUS_08970 860258 861133 gene locus_tag LOCUS_08980 860258 861133 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250632.1 protein_id gnl|my_center|LOCUS_08980 862523 861510 gene locus_tag LOCUS_08990 862523 861510 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875712.1 protein_id gnl|my_center|LOCUS_08990 864830 862548 gene locus_tag LOCUS_09000 864830 862548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 865557 864835 gene locus_tag LOCUS_09010 865557 864835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 >Feature sequence02 1443 826 gene locus_tag LOCUS_09020 1443 826 CDS product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876496.1 protein_id gnl|my_center|LOCUS_09020 1912 1454 gene locus_tag LOCUS_09030 1912 1454 CDS product DUF2124 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876495.1 protein_id gnl|my_center|LOCUS_09030 2293 2862 gene locus_tag LOCUS_09040 2293 2862 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060887.1 protein_id gnl|my_center|LOCUS_09040 4082 2889 gene locus_tag LOCUS_09050 4082 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 6199 4592 gene locus_tag LOCUS_09060 6199 4592 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114139.1 protein_id gnl|my_center|LOCUS_09060 6736 6305 gene locus_tag LOCUS_09070 6736 6305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 8354 6951 gene locus_tag LOCUS_09080 8354 6951 CDS product DUF2142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963353.1 protein_id gnl|my_center|LOCUS_09080 8531 9457 gene locus_tag LOCUS_09090 gene guaA 8531 9457 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060888.1 protein_id gnl|my_center|LOCUS_09090 10219 9518 gene locus_tag LOCUS_09100 10219 9518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 10392 10871 gene locus_tag LOCUS_09110 10392 10871 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305710.1 protein_id gnl|my_center|LOCUS_09110 10902 11495 gene locus_tag LOCUS_09120 10902 11495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 12358 11507 gene locus_tag LOCUS_09130 12358 11507 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943396.1 protein_id gnl|my_center|LOCUS_09130 13068 12502 gene locus_tag LOCUS_09140 13068 12502 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941232.1 protein_id gnl|my_center|LOCUS_09140 13216 13785 gene locus_tag LOCUS_09150 13216 13785 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141429.1 protein_id gnl|my_center|LOCUS_09150 13790 14596 gene locus_tag LOCUS_09160 13790 14596 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434727.1 protein_id gnl|my_center|LOCUS_09160 14611 15267 gene locus_tag LOCUS_09170 14611 15267 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860823.1 protein_id gnl|my_center|LOCUS_09170 15254 15958 gene locus_tag LOCUS_09180 15254 15958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 16796 15972 gene locus_tag LOCUS_09190 16796 15972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 17573 17007 gene locus_tag LOCUS_09200 17573 17007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 18633 17746 gene locus_tag LOCUS_09210 18633 17746 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044390572.1 protein_id gnl|my_center|LOCUS_09210 18778 19947 gene locus_tag LOCUS_09220 18778 19947 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061240.1 protein_id gnl|my_center|LOCUS_09220 20190 21518 gene locus_tag LOCUS_09230 20190 21518 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020186.1 protein_id gnl|my_center|LOCUS_09230 22075 21584 gene locus_tag LOCUS_09240 22075 21584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 22368 22144 gene locus_tag LOCUS_09250 22368 22144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 23606 22830 gene locus_tag LOCUS_09260 23606 22830 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815081.1 protein_id gnl|my_center|LOCUS_09260 24153 23608 gene locus_tag LOCUS_09270 24153 23608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 25194 24235 gene locus_tag LOCUS_09280 25194 24235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 25358 25738 gene locus_tag LOCUS_09290 25358 25738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 25779 26756 gene locus_tag LOCUS_09300 25779 26756 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876360.1 protein_id gnl|my_center|LOCUS_09300 27294 26791 gene locus_tag LOCUS_09310 gene cgi121 27294 26791 CDS product KEOPS complex subunit Cgi121 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876361.1 protein_id gnl|my_center|LOCUS_09310 27881 27315 gene locus_tag LOCUS_09320 27881 27315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 29454 27952 gene locus_tag LOCUS_09330 29454 27952 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876362.1 protein_id gnl|my_center|LOCUS_09330 30546 29512 gene locus_tag LOCUS_09340 30546 29512 CDS product TIGR01177 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876363.1 protein_id gnl|my_center|LOCUS_09340 31802 30633 gene locus_tag LOCUS_09350 31802 30633 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876364.1 protein_id gnl|my_center|LOCUS_09350 32491 32018 gene locus_tag LOCUS_09360 32491 32018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 33297 32698 gene locus_tag LOCUS_09370 33297 32698 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876365.1 protein_id gnl|my_center|LOCUS_09370 33378 34106 gene locus_tag LOCUS_09380 33378 34106 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060890.1 protein_id gnl|my_center|LOCUS_09380 34389 35687 gene locus_tag LOCUS_09390 34389 35687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 35983 35792 gene locus_tag LOCUS_09400 35983 35792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 36033 36338 gene locus_tag LOCUS_09410 36033 36338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 37925 36693 gene locus_tag LOCUS_09420 37925 36693 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876367.1 protein_id gnl|my_center|LOCUS_09420 38259 38717 gene locus_tag LOCUS_09430 38259 38717 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876368.1 protein_id gnl|my_center|LOCUS_09430 39112 38765 gene locus_tag LOCUS_09440 39112 38765 CDS product DUF356 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876369.1 protein_id gnl|my_center|LOCUS_09440 40455 39214 gene locus_tag LOCUS_09450 40455 39214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 40895 40452 gene locus_tag LOCUS_09460 40895 40452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876372.1 protein_id gnl|my_center|LOCUS_09460 42377 40935 gene locus_tag LOCUS_09470 42377 40935 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768129.1 protein_id gnl|my_center|LOCUS_09470 43469 42390 gene locus_tag LOCUS_09480 43469 42390 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876374.1 protein_id gnl|my_center|LOCUS_09480 44681 43566 gene locus_tag LOCUS_09490 44681 43566 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485757.1 protein_id gnl|my_center|LOCUS_09490 45396 44935 gene locus_tag LOCUS_09500 gene hycI 45396 44935 CDS product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485809.1 protein_id gnl|my_center|LOCUS_09500 46213 45377 gene locus_tag LOCUS_09510 46213 45377 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876377.1 protein_id gnl|my_center|LOCUS_09510 46757 46308 gene locus_tag LOCUS_09520 gene nikR 46757 46308 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876378.1 protein_id gnl|my_center|LOCUS_09520 47083 47484 gene locus_tag LOCUS_09530 47083 47484 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876379.1 protein_id gnl|my_center|LOCUS_09530 47738 47664 gene locus_tag LOCUS_t00180 47738 47664 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 47815 47740 gene locus_tag LOCUS_t00190 47815 47740 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 48146 49468 gene locus_tag LOCUS_09540 48146 49468 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876425.1 protein_id gnl|my_center|LOCUS_09540 51057 49528 gene locus_tag LOCUS_09550 gene cobQ 51057 49528 CDS product cobyric acid synthase CobQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061247.1 protein_id gnl|my_center|LOCUS_09550 51465 53357 gene locus_tag LOCUS_09560 gene lonB 51465 53357 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876422.1 protein_id gnl|my_center|LOCUS_09560 53618 55198 gene locus_tag LOCUS_09570 53618 55198 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_09570 57969 55321 gene locus_tag LOCUS_09580 57969 55321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 58898 58038 gene locus_tag LOCUS_09590 58898 58038 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876421.1 protein_id gnl|my_center|LOCUS_09590 59095 59475 gene locus_tag LOCUS_09600 gene hypA 59095 59475 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060898.1 protein_id gnl|my_center|LOCUS_09600 59468 60121 gene locus_tag LOCUS_09610 gene hypB 59468 60121 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876419.1 protein_id gnl|my_center|LOCUS_09610 60233 60583 gene locus_tag LOCUS_09620 60233 60583 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876396.1 protein_id gnl|my_center|LOCUS_09620 60806 60734 gene locus_tag LOCUS_t00200 60806 60734 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 61129 62205 gene locus_tag LOCUS_09630 61129 62205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060897.1 protein_id gnl|my_center|LOCUS_09630 62251 62715 gene locus_tag LOCUS_09640 62251 62715 CDS product DUF1890 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876415.1 protein_id gnl|my_center|LOCUS_09640 62918 63220 gene locus_tag LOCUS_09650 62918 63220 CDS product DUF1894 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876414.1 protein_id gnl|my_center|LOCUS_09650 63424 63771 gene locus_tag LOCUS_09660 63424 63771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 63820 64347 gene locus_tag LOCUS_09670 63820 64347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 64359 64826 gene locus_tag LOCUS_09680 64359 64826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 64876 65358 gene locus_tag LOCUS_09690 64876 65358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 65389 65778 gene locus_tag LOCUS_09700 65389 65778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 66135 66284 gene locus_tag LOCUS_09710 66135 66284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 66489 67514 gene locus_tag LOCUS_09720 66489 67514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 67651 68079 gene locus_tag LOCUS_09730 67651 68079 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814175.1 protein_id gnl|my_center|LOCUS_09730 68123 68773 gene locus_tag LOCUS_09740 68123 68773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 68905 69747 gene locus_tag LOCUS_09750 68905 69747 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925959.1 protein_id gnl|my_center|LOCUS_09750 70385 69774 gene locus_tag LOCUS_09760 70385 69774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 70557 71513 gene locus_tag LOCUS_09770 70557 71513 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876413.1 protein_id gnl|my_center|LOCUS_09770 71561 72238 gene locus_tag LOCUS_09780 71561 72238 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061245.1 protein_id gnl|my_center|LOCUS_09780 72489 73451 gene locus_tag LOCUS_09790 gene mch 72489 73451 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876411.1 protein_id gnl|my_center|LOCUS_09790 73702 74061 gene locus_tag LOCUS_09800 73702 74061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 74265 74615 gene locus_tag LOCUS_09810 74265 74615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 75026 74640 gene locus_tag LOCUS_09820 75026 74640 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876487.1 protein_id gnl|my_center|LOCUS_09820 76576 75023 gene locus_tag LOCUS_09830 76576 75023 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876488.1 protein_id gnl|my_center|LOCUS_09830 76958 78331 gene locus_tag LOCUS_09840 76958 78331 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876489.1 protein_id gnl|my_center|LOCUS_09840 78397 78957 gene locus_tag LOCUS_09850 78397 78957 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876490.1 protein_id gnl|my_center|LOCUS_09850 79271 80299 gene locus_tag LOCUS_09860 79271 80299 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876491.1 protein_id gnl|my_center|LOCUS_09860 80244 80555 gene locus_tag LOCUS_09870 80244 80555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 80521 80706 gene locus_tag LOCUS_09880 80521 80706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09880 81825 80800 gene locus_tag LOCUS_09890 81825 80800 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876493.1 protein_id gnl|my_center|LOCUS_09890 82659 82111 gene locus_tag LOCUS_09900 82659 82111 CDS product thiamine-phosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876494.1 protein_id gnl|my_center|LOCUS_09900 83219 84433 gene locus_tag LOCUS_09910 83219 84433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 84807 87020 gene locus_tag LOCUS_09920 84807 87020 CDS product pseudomurein-binding repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052261150.1 protein_id gnl|my_center|LOCUS_09920 88390 87074 gene locus_tag LOCUS_09930 88390 87074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 89688 89233 gene locus_tag LOCUS_09940 89688 89233 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876477.1 protein_id gnl|my_center|LOCUS_09940 89833 91068 gene locus_tag LOCUS_09950 89833 91068 CDS product PEP-utilizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876099.1 protein_id gnl|my_center|LOCUS_09950 91930 91166 gene locus_tag LOCUS_09960 gene hisA 91930 91166 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060911.1 protein_id gnl|my_center|LOCUS_09960 92863 92021 gene locus_tag LOCUS_09970 92863 92021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 93332 93120 gene locus_tag LOCUS_09980 93332 93120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 93638 94057 gene locus_tag LOCUS_09990 93638 94057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875858.1 protein_id gnl|my_center|LOCUS_09990 94148 95503 gene locus_tag LOCUS_10000 94148 95503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 95674 96477 gene locus_tag LOCUS_10010 gene truA 95674 96477 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876473.1 protein_id gnl|my_center|LOCUS_10010 96647 98053 gene locus_tag LOCUS_10020 96647 98053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 98351 101566 gene locus_tag LOCUS_10030 98351 101566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 101640 103427 gene locus_tag LOCUS_10040 101640 103427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 104492 103908 gene locus_tag LOCUS_10050 104492 103908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 105294 104509 gene locus_tag LOCUS_10060 105294 104509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 107656 105692 gene locus_tag LOCUS_10070 107656 105692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 108684 107659 gene locus_tag LOCUS_10080 108684 107659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 108886 109458 gene locus_tag LOCUS_10090 108886 109458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 109792 111093 gene locus_tag LOCUS_10100 109792 111093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 111816 111208 gene locus_tag LOCUS_10110 111816 111208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 112168 113181 gene locus_tag LOCUS_10120 112168 113181 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876468.1 protein_id gnl|my_center|LOCUS_10120 113233 114264 gene locus_tag LOCUS_10130 113233 114264 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876467.1 protein_id gnl|my_center|LOCUS_10130 114384 115064 gene locus_tag LOCUS_10140 114384 115064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876466.1 protein_id gnl|my_center|LOCUS_10140 115142 115831 gene locus_tag LOCUS_10150 115142 115831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876466.1 protein_id gnl|my_center|LOCUS_10150 116445 115927 gene locus_tag LOCUS_10160 116445 115927 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060908.1 protein_id gnl|my_center|LOCUS_10160 116522 118042 gene locus_tag LOCUS_10170 116522 118042 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060907.1 protein_id gnl|my_center|LOCUS_10170 118055 119041 gene locus_tag LOCUS_10180 118055 119041 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876463.1 protein_id gnl|my_center|LOCUS_10180 119051 119551 gene locus_tag LOCUS_10190 gene hacB 119051 119551 CDS product homoaconitase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876462.1 protein_id gnl|my_center|LOCUS_10190 119669 120289 gene locus_tag LOCUS_10200 119669 120289 CDS product HVO_0476 family zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876461.1 protein_id gnl|my_center|LOCUS_10200 120324 120977 gene locus_tag LOCUS_10210 120324 120977 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876460.1 protein_id gnl|my_center|LOCUS_10210 121114 122388 gene locus_tag LOCUS_10220 121114 122388 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876459.1 protein_id gnl|my_center|LOCUS_10220 122674 123447 gene locus_tag LOCUS_10230 122674 123447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 123538 124284 gene locus_tag LOCUS_10240 123538 124284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 124406 125149 gene locus_tag LOCUS_10250 124406 125149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 125180 125854 gene locus_tag LOCUS_10260 125180 125854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 125862 126749 gene locus_tag LOCUS_10270 125862 126749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 127092 126892 gene locus_tag LOCUS_10280 127092 126892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 127288 127215 gene locus_tag LOCUS_t00210 127288 127215 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 127649 128065 gene locus_tag LOCUS_10290 127649 128065 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876265.1 protein_id gnl|my_center|LOCUS_10290 128259 128711 gene locus_tag LOCUS_10300 128259 128711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 128715 128966 gene locus_tag LOCUS_10310 128715 128966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 129386 132790 gene locus_tag LOCUS_10320 129386 132790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 133216 132791 gene locus_tag LOCUS_10330 133216 132791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 133615 133812 gene locus_tag LOCUS_10340 133615 133812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060739.1 protein_id gnl|my_center|LOCUS_10340 134414 133866 gene locus_tag LOCUS_10350 134414 133866 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061179.1 protein_id gnl|my_center|LOCUS_10350 134578 135240 gene locus_tag LOCUS_10360 134578 135240 CDS product tributyrin esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875745.1 protein_id gnl|my_center|LOCUS_10360 135247 137106 gene locus_tag LOCUS_10370 135247 137106 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060738.1 protein_id gnl|my_center|LOCUS_10370 137689 137198 gene locus_tag LOCUS_10380 137689 137198 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876457.1 protein_id gnl|my_center|LOCUS_10380 138151 137945 gene locus_tag LOCUS_10390 138151 137945 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876456.1 protein_id gnl|my_center|LOCUS_10390 138447 139550 gene locus_tag LOCUS_10400 gene cofH 138447 139550 CDS product 5-amino-6-(D-ribitylamino)uracil--L-tyrosine 4-hydroxyphenyl transferase CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060905.1 protein_id gnl|my_center|LOCUS_10400 139583 139855 gene locus_tag LOCUS_10410 139583 139855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 140219 139869 gene locus_tag LOCUS_10420 140219 139869 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061251.1 protein_id gnl|my_center|LOCUS_10420 140409 140888 gene locus_tag LOCUS_10430 140409 140888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 141648 140944 gene locus_tag LOCUS_10440 gene deoC 141648 140944 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356166.1 protein_id gnl|my_center|LOCUS_10440 143330 141681 gene locus_tag LOCUS_10450 143330 141681 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061250.1 protein_id gnl|my_center|LOCUS_10450 144133 143510 gene locus_tag LOCUS_10460 144133 143510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 144186 144311 gene locus_tag LOCUS_10470 144186 144311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 144818 145387 gene locus_tag LOCUS_10480 144818 145387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 145565 145849 gene locus_tag LOCUS_10490 145565 145849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 145880 146176 gene locus_tag LOCUS_10500 145880 146176 CDS product DUF2098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060902.1 protein_id gnl|my_center|LOCUS_10500 146757 146266 gene locus_tag LOCUS_10510 146757 146266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 147094 148911 gene locus_tag LOCUS_10520 147094 148911 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876517.1 protein_id gnl|my_center|LOCUS_10520 149371 148913 gene locus_tag LOCUS_10530 149371 148913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 151048 149435 gene locus_tag LOCUS_10540 151048 149435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 151230 152246 gene locus_tag LOCUS_10550 151230 152246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 152385 152978 gene locus_tag LOCUS_10560 152385 152978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 153016 153798 gene locus_tag LOCUS_10570 153016 153798 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434727.1 protein_id gnl|my_center|LOCUS_10570 153821 154609 gene locus_tag LOCUS_10580 153821 154609 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947915.1 protein_id gnl|my_center|LOCUS_10580 155120 154734 gene locus_tag LOCUS_10590 155120 154734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 156035 155880 gene locus_tag LOCUS_10600 156035 155880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 156332 156952 gene locus_tag LOCUS_10610 156332 156952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 157509 156979 gene locus_tag LOCUS_10620 157509 156979 CDS product DUF2115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876447.1 protein_id gnl|my_center|LOCUS_10620 158224 157685 gene locus_tag LOCUS_10630 158224 157685 CDS product DUF2115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876447.1 protein_id gnl|my_center|LOCUS_10630 160333 158267 gene locus_tag LOCUS_10640 gene hel308 160333 158267 CDS product ATP-dependent DNA helicase Hel308 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876445.1 protein_id gnl|my_center|LOCUS_10640 160523 162073 gene locus_tag LOCUS_10650 160523 162073 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065424.1 protein_id gnl|my_center|LOCUS_10650 162204 162560 gene locus_tag LOCUS_10660 162204 162560 CDS product DUF5518 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061141.1 protein_id gnl|my_center|LOCUS_10660 163074 162604 gene locus_tag LOCUS_10670 gene moaC 163074 162604 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943324.1 protein_id gnl|my_center|LOCUS_10670 163314 164078 gene locus_tag LOCUS_10680 163314 164078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 165140 164157 gene locus_tag LOCUS_10690 gene cbiD 165140 164157 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876443.1 protein_id gnl|my_center|LOCUS_10690 165552 165286 gene locus_tag LOCUS_10700 165552 165286 CDS product MJ0307 family thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876442.1 protein_id gnl|my_center|LOCUS_10700 166565 165663 gene locus_tag LOCUS_10710 gene sppA 166565 165663 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876441.1 protein_id gnl|my_center|LOCUS_10710 167610 168941 gene locus_tag LOCUS_10720 gene mcrB 167610 168941 CDS product coenzyme-B sulfoethylthiotransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060974.1 protein_id gnl|my_center|LOCUS_10720 168967 169455 gene locus_tag LOCUS_10730 gene mcrD 168967 169455 CDS product methyl-coenzyme M reductase operon protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869611.1 protein_id gnl|my_center|LOCUS_10730 169458 170252 gene locus_tag LOCUS_10740 gene mcrG 169458 170252 CDS product coenzyme-B sulfoethylthiotransferase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876754.1 protein_id gnl|my_center|LOCUS_10740 170254 171909 gene locus_tag LOCUS_10750 gene mcrA 170254 171909 CDS product coenzyme-B sulfoethylthiotransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876753.1 protein_id gnl|my_center|LOCUS_10750 172169 172867 gene locus_tag LOCUS_10760 172169 172867 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990882.1 protein_id gnl|my_center|LOCUS_10760 173463 174329 gene locus_tag LOCUS_10770 173463 174329 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061249.1 protein_id gnl|my_center|LOCUS_10770 174368 174673 gene locus_tag LOCUS_10780 174368 174673 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876439.1 protein_id gnl|my_center|LOCUS_10780 174666 174863 gene locus_tag LOCUS_10790 174666 174863 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876438.1 protein_id gnl|my_center|LOCUS_10790 174886 176109 gene locus_tag LOCUS_10800 174886 176109 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876437.1 protein_id gnl|my_center|LOCUS_10800 176106 176999 gene locus_tag LOCUS_10810 gene dapA 176106 176999 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869742.1 protein_id gnl|my_center|LOCUS_10810 177320 178141 gene locus_tag LOCUS_10820 gene dapB 177320 178141 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876435.1 protein_id gnl|my_center|LOCUS_10820 178219 179373 gene locus_tag LOCUS_10830 178219 179373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 179433 180476 gene locus_tag LOCUS_10840 gene asd 179433 180476 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876434.1 protein_id gnl|my_center|LOCUS_10840 180591 181172 gene locus_tag LOCUS_10850 180591 181172 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876433.1 protein_id gnl|my_center|LOCUS_10850 181543 182058 gene locus_tag LOCUS_10860 181543 182058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892171.1 protein_id gnl|my_center|LOCUS_10860 182110 182952 gene locus_tag LOCUS_10870 182110 182952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 183626 184783 gene locus_tag LOCUS_10880 183626 184783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 184957 186591 gene locus_tag LOCUS_10890 gene thsA 184957 186591 CDS product thermosome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876429.1 protein_id gnl|my_center|LOCUS_10890 187769 186735 gene locus_tag LOCUS_10900 187769 186735 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957530.1 protein_id gnl|my_center|LOCUS_10900 188171 189448 gene locus_tag LOCUS_10910 188171 189448 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023666.1 protein_id gnl|my_center|LOCUS_10910 189499 189852 gene locus_tag LOCUS_10920 189499 189852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 189874 190686 gene locus_tag LOCUS_10930 189874 190686 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933364.1 protein_id gnl|my_center|LOCUS_10930 191899 190748 gene locus_tag LOCUS_10940 191899 190748 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876428.1 protein_id gnl|my_center|LOCUS_10940 193015 191975 gene locus_tag LOCUS_10950 193015 191975 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060900.1 protein_id gnl|my_center|LOCUS_10950 193496 193266 gene locus_tag LOCUS_10960 193496 193266 CDS product LSM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877050.1 protein_id gnl|my_center|LOCUS_10960 194326 193640 gene locus_tag LOCUS_10970 194326 193640 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085687.1 protein_id gnl|my_center|LOCUS_10970 196452 194329 gene locus_tag LOCUS_10980 196452 194329 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_10980 196883 197812 gene locus_tag LOCUS_10990 196883 197812 CDS product DUF2121 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876390.1 protein_id gnl|my_center|LOCUS_10990 197878 198651 gene locus_tag LOCUS_11000 197878 198651 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876389.1 protein_id gnl|my_center|LOCUS_11000 199443 198685 gene locus_tag LOCUS_11010 199443 198685 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262657.1 protein_id gnl|my_center|LOCUS_11010 200871 199468 gene locus_tag LOCUS_11020 200871 199468 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065424.1 protein_id gnl|my_center|LOCUS_11020 201458 200928 gene locus_tag LOCUS_11030 201458 200928 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485761.1 protein_id gnl|my_center|LOCUS_11030 201699 202214 gene locus_tag LOCUS_11040 201699 202214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 203357 202266 gene locus_tag LOCUS_11050 gene aroC 203357 202266 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061243.1 protein_id gnl|my_center|LOCUS_11050 204090 203479 gene locus_tag LOCUS_11060 204090 203479 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107442.1 protein_id gnl|my_center|LOCUS_11060 204502 204119 gene locus_tag LOCUS_11070 204502 204119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 204629 205321 gene locus_tag LOCUS_11080 204629 205321 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022247.1 protein_id gnl|my_center|LOCUS_11080 205394 206263 gene locus_tag LOCUS_11090 205394 206263 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876384.1 protein_id gnl|my_center|LOCUS_11090 206323 207153 gene locus_tag LOCUS_11100 gene nudC 206323 207153 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021453.1 protein_id gnl|my_center|LOCUS_11100 207366 207842 gene locus_tag LOCUS_11110 207366 207842 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876288.1 protein_id gnl|my_center|LOCUS_11110 207861 208550 gene locus_tag LOCUS_11120 gene arfB 207861 208550 CDS product 2-amino-5-formylamino-6-ribosylaminopyrimidin-4(3H)-one 5'-monophosphate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876289.1 protein_id gnl|my_center|LOCUS_11120 208633 210216 gene locus_tag LOCUS_11130 208633 210216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 212705 210213 gene locus_tag LOCUS_11140 212705 210213 CDS product DUF5814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060872.1 protein_id gnl|my_center|LOCUS_11140 213185 212886 gene locus_tag LOCUS_11150 213185 212886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 215172 213394 gene locus_tag LOCUS_11160 gene glmS 215172 213394 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875810.1 protein_id gnl|my_center|LOCUS_11160 215311 216057 gene locus_tag LOCUS_11170 215311 216057 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875809.1 protein_id gnl|my_center|LOCUS_11170 216134 216385 gene locus_tag LOCUS_11180 gene purS 216134 216385 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875808.1 protein_id gnl|my_center|LOCUS_11180 216416 217075 gene locus_tag LOCUS_11190 gene purQ 216416 217075 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875807.1 protein_id gnl|my_center|LOCUS_11190 217160 217873 gene locus_tag LOCUS_11200 gene cobA 217160 217873 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060761.1 protein_id gnl|my_center|LOCUS_11200 217894 218673 gene locus_tag LOCUS_11210 217894 218673 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875805.1 protein_id gnl|my_center|LOCUS_11210 218692 218961 gene locus_tag LOCUS_11220 218692 218961 CDS product signal recognition particle subunit SRP19/SEC65 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875804.1 protein_id gnl|my_center|LOCUS_11220 219051 220460 gene locus_tag LOCUS_11230 gene recJ 219051 220460 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875803.1 protein_id gnl|my_center|LOCUS_11230 220486 221289 gene locus_tag LOCUS_11240 220486 221289 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875802.1 protein_id gnl|my_center|LOCUS_11240 222231 221359 gene locus_tag LOCUS_11250 222231 221359 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892274.1 protein_id gnl|my_center|LOCUS_11250 222515 222853 gene locus_tag LOCUS_11260 222515 222853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 223012 223167 gene locus_tag LOCUS_11270 223012 223167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 223872 223225 gene locus_tag LOCUS_11280 223872 223225 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875874.1 protein_id gnl|my_center|LOCUS_11280 224189 223932 gene locus_tag LOCUS_11290 224189 223932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 224319 224702 gene locus_tag LOCUS_11300 224319 224702 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875873.1 protein_id gnl|my_center|LOCUS_11300 225504 224746 gene locus_tag LOCUS_11310 225504 224746 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875872.1 protein_id gnl|my_center|LOCUS_11310 226333 225566 gene locus_tag LOCUS_11320 gene uppS 226333 225566 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875871.1 protein_id gnl|my_center|LOCUS_11320 227042 226308 gene locus_tag LOCUS_11330 gene mtxX 227042 226308 CDS product methanogenesis marker protein Mmp4/MtxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875870.1 protein_id gnl|my_center|LOCUS_11330 227530 228210 gene locus_tag LOCUS_11340 227530 228210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 229498 228239 gene locus_tag LOCUS_11350 gene hemL 229498 228239 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496557.1 protein_id gnl|my_center|LOCUS_11350 230232 229582 gene locus_tag LOCUS_11360 230232 229582 CDS product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060776.1 protein_id gnl|my_center|LOCUS_11360 230535 230876 gene locus_tag LOCUS_11370 230535 230876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 232147 230939 gene locus_tag LOCUS_11380 232147 230939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 232599 232159 gene locus_tag LOCUS_11390 232599 232159 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061215.1 protein_id gnl|my_center|LOCUS_11390 233717 232659 gene locus_tag LOCUS_11400 233717 232659 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892361.1 protein_id gnl|my_center|LOCUS_11400 234364 233924 gene locus_tag LOCUS_11410 234364 233924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 235478 234468 gene locus_tag LOCUS_11420 gene hypE 235478 234468 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060768.1 protein_id gnl|my_center|LOCUS_11420 235911 236291 gene locus_tag LOCUS_11430 235911 236291 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875846.1 protein_id gnl|my_center|LOCUS_11430 236345 236989 gene locus_tag LOCUS_11440 gene polB2 236345 236989 CDS product DNA polymerase PolB subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875847.1 protein_id gnl|my_center|LOCUS_11440 237128 237808 gene locus_tag LOCUS_11450 237128 237808 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875848.1 protein_id gnl|my_center|LOCUS_11450 237923 239467 gene locus_tag LOCUS_11460 237923 239467 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875849.1 protein_id gnl|my_center|LOCUS_11460 241325 239796 gene locus_tag LOCUS_11470 241325 239796 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876381.1 protein_id gnl|my_center|LOCUS_11470 242310 241402 gene locus_tag LOCUS_11480 242310 241402 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876382.1 protein_id gnl|my_center|LOCUS_11480 243336 242377 gene locus_tag LOCUS_11490 gene hemB 243336 242377 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060891.1 protein_id gnl|my_center|LOCUS_11490 243903 243475 gene locus_tag LOCUS_11500 243903 243475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 244259 244501 gene locus_tag LOCUS_11510 244259 244501 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013295846.1 protein_id gnl|my_center|LOCUS_11510 244618 244776 gene locus_tag LOCUS_11520 244618 244776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 244782 245651 gene locus_tag LOCUS_11530 244782 245651 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876285.1 protein_id gnl|my_center|LOCUS_11530 245742 247151 gene locus_tag LOCUS_11540 gene purF 245742 247151 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060868.1 protein_id gnl|my_center|LOCUS_11540 247284 248477 gene locus_tag LOCUS_11550 247284 248477 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060867.1 protein_id gnl|my_center|LOCUS_11550 250101 248629 gene locus_tag LOCUS_11560 250101 248629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 250562 250107 gene locus_tag LOCUS_11570 250562 250107 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445819.1 protein_id gnl|my_center|LOCUS_11570 250756 253461 gene locus_tag LOCUS_11580 250756 253461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 253619 254017 gene locus_tag LOCUS_11590 253619 254017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 254392 254871 gene locus_tag LOCUS_11600 254392 254871 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876282.1 protein_id gnl|my_center|LOCUS_11600 254868 255665 gene locus_tag LOCUS_11610 gene cfbC 254868 255665 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase ATP-dependent reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876281.1 protein_id gnl|my_center|LOCUS_11610 256124 255708 gene locus_tag LOCUS_11620 256124 255708 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583024.1 protein_id gnl|my_center|LOCUS_11620 256604 256203 gene locus_tag LOCUS_11630 256604 256203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 257403 256765 gene locus_tag LOCUS_11640 257403 256765 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024475.1 protein_id gnl|my_center|LOCUS_11640 257596 258009 gene locus_tag LOCUS_11650 257596 258009 CDS product DUF371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061234.1 protein_id gnl|my_center|LOCUS_11650 258949 258044 gene locus_tag LOCUS_11660 258949 258044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 259604 259062 gene locus_tag LOCUS_11670 259604 259062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 259935 260246 gene locus_tag LOCUS_11680 259935 260246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 260608 260524 gene locus_tag LOCUS_t00220 260608 260524 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 260924 261226 gene locus_tag LOCUS_11690 260924 261226 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060863.1 protein_id gnl|my_center|LOCUS_11690 261315 262484 gene locus_tag LOCUS_11700 261315 262484 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007652481.1 protein_id gnl|my_center|LOCUS_11700 263456 262524 gene locus_tag LOCUS_11710 gene rfbB 263456 262524 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_11710 263973 263506 gene locus_tag LOCUS_11720 263973 263506 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242881.1 protein_id gnl|my_center|LOCUS_11720 264097 264933 gene locus_tag LOCUS_11730 gene rfbD 264097 264933 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877394.1 protein_id gnl|my_center|LOCUS_11730 264979 265857 gene locus_tag LOCUS_11740 gene rfbA 264979 265857 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877393.1 protein_id gnl|my_center|LOCUS_11740 266089 266934 gene locus_tag LOCUS_11750 gene galU 266089 266934 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876273.1 protein_id gnl|my_center|LOCUS_11750 267083 268210 gene locus_tag LOCUS_11760 267083 268210 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021211.1 protein_id gnl|my_center|LOCUS_11760 268418 269560 gene locus_tag LOCUS_11770 268418 269560 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060795.1 protein_id gnl|my_center|LOCUS_11770 269613 270767 gene locus_tag LOCUS_11780 269613 270767 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675474.1 protein_id gnl|my_center|LOCUS_11780 270943 273120 gene locus_tag LOCUS_11790 270943 273120 CDS product DUF2206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875978.1 protein_id gnl|my_center|LOCUS_11790 274116 273151 gene locus_tag LOCUS_11800 274116 273151 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868306.1 protein_id gnl|my_center|LOCUS_11800 275184 274132 gene locus_tag LOCUS_11810 275184 274132 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868306.1 protein_id gnl|my_center|LOCUS_11810 276399 275287 gene locus_tag LOCUS_11820 276399 275287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 277575 276499 gene locus_tag LOCUS_11830 277575 276499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 277974 279053 gene locus_tag LOCUS_11840 277974 279053 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963743.1 protein_id gnl|my_center|LOCUS_11840 279899 279057 gene locus_tag LOCUS_11850 279899 279057 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_11850 281334 279913 gene locus_tag LOCUS_11860 281334 279913 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060802.1 protein_id gnl|my_center|LOCUS_11860 282722 281409 gene locus_tag LOCUS_11870 gene rfbH 282722 281409 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208596.1 protein_id gnl|my_center|LOCUS_11870 284475 282712 gene locus_tag LOCUS_11880 gene ilvB 284475 282712 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012310511.1 protein_id gnl|my_center|LOCUS_11880 285438 284485 gene locus_tag LOCUS_11890 gene rfbB 285438 284485 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877832.1 protein_id gnl|my_center|LOCUS_11890 286197 285448 gene locus_tag LOCUS_11900 286197 285448 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890732.1 protein_id gnl|my_center|LOCUS_11900 287188 286214 gene locus_tag LOCUS_11910 287188 286214 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244102.1 protein_id gnl|my_center|LOCUS_11910 287988 287212 gene locus_tag LOCUS_11920 gene rfbF 287988 287212 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937383.1 protein_id gnl|my_center|LOCUS_11920 289040 288111 gene locus_tag LOCUS_11930 289040 288111 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876019.1 protein_id gnl|my_center|LOCUS_11930 289342 290385 gene locus_tag LOCUS_11940 gene gmd 289342 290385 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056481.1 protein_id gnl|my_center|LOCUS_11940 291396 290416 gene locus_tag LOCUS_11950 291396 290416 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257987.1 protein_id gnl|my_center|LOCUS_11950 291882 292565 gene locus_tag LOCUS_11960 291882 292565 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875970.1 protein_id gnl|my_center|LOCUS_11960 292589 293776 gene locus_tag LOCUS_11970 292589 293776 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876015.1 protein_id gnl|my_center|LOCUS_11970 293773 294771 gene locus_tag LOCUS_11980 293773 294771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 294768 295916 gene locus_tag LOCUS_11990 294768 295916 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296321.1 protein_id gnl|my_center|LOCUS_11990 296928 296041 gene locus_tag LOCUS_12000 296928 296041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 297783 296929 gene locus_tag LOCUS_12010 297783 296929 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942894.1 protein_id gnl|my_center|LOCUS_12010 298706 298029 gene locus_tag LOCUS_12020 298706 298029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 299129 301345 gene locus_tag LOCUS_12030 299129 301345 CDS product DUF2206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021084.1 protein_id gnl|my_center|LOCUS_12030 301507 302445 gene locus_tag LOCUS_12040 301507 302445 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060800.1 protein_id gnl|my_center|LOCUS_12040 302520 303521 gene locus_tag LOCUS_12050 302520 303521 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060801.1 protein_id gnl|my_center|LOCUS_12050 305060 303618 gene locus_tag LOCUS_12060 305060 303618 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875981.1 protein_id gnl|my_center|LOCUS_12060 305344 307740 gene locus_tag LOCUS_12070 305344 307740 CDS product DUF2206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021084.1 protein_id gnl|my_center|LOCUS_12070 308216 307782 gene locus_tag LOCUS_12080 308216 307782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 308426 308737 gene locus_tag LOCUS_12090 gene ehaA 308426 308737 CDS product energy-converting NiFe hydrogenase A subunit EhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876023.1 protein_id gnl|my_center|LOCUS_12090 308730 309233 gene locus_tag LOCUS_12100 308730 309233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061212.1 protein_id gnl|my_center|LOCUS_12100 309301 309549 gene locus_tag LOCUS_12110 309301 309549 CDS product DUF2109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060804.1 protein_id gnl|my_center|LOCUS_12110 309566 309853 gene locus_tag LOCUS_12120 309566 309853 CDS product DUF2108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892391.1 protein_id gnl|my_center|LOCUS_12120 309846 310106 gene locus_tag LOCUS_12130 309846 310106 CDS product EhaE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060805.1 protein_id gnl|my_center|LOCUS_12130 310103 310612 gene locus_tag LOCUS_12140 310103 310612 CDS product DUF2106 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052261153.1 protein_id gnl|my_center|LOCUS_12140 310612 311298 gene locus_tag LOCUS_12150 310612 311298 CDS product EhaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060806.1 protein_id gnl|my_center|LOCUS_12150 311335 312006 gene locus_tag LOCUS_12160 311335 312006 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060807.1 protein_id gnl|my_center|LOCUS_12160 312036 312251 gene locus_tag LOCUS_12170 312036 312251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060808.1 protein_id gnl|my_center|LOCUS_12170 312276 313139 gene locus_tag LOCUS_12180 312276 313139 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876032.1 protein_id gnl|my_center|LOCUS_12180 313179 313436 gene locus_tag LOCUS_12190 313179 313436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876033.1 protein_id gnl|my_center|LOCUS_12190 313448 313771 gene locus_tag LOCUS_12200 313448 313771 CDS product DUF2104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876034.1 protein_id gnl|my_center|LOCUS_12200 313768 314169 gene locus_tag LOCUS_12210 313768 314169 CDS product DUF1959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876035.1 protein_id gnl|my_center|LOCUS_12210 314174 314623 gene locus_tag LOCUS_12220 314174 314623 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876036.1 protein_id gnl|my_center|LOCUS_12220 314620 315753 gene locus_tag LOCUS_12230 314620 315753 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876037.1 protein_id gnl|my_center|LOCUS_12230 315792 316829 gene locus_tag LOCUS_12240 315792 316829 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876038.1 protein_id gnl|my_center|LOCUS_12240 316826 318187 gene locus_tag LOCUS_12250 316826 318187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 318225 319250 gene locus_tag LOCUS_12260 318225 319250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876041.1 protein_id gnl|my_center|LOCUS_12260 319250 320152 gene locus_tag LOCUS_12270 319250 320152 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876042.1 protein_id gnl|my_center|LOCUS_12270 320168 321097 gene locus_tag LOCUS_12280 320168 321097 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876043.1 protein_id gnl|my_center|LOCUS_12280 321118 321879 gene locus_tag LOCUS_12290 321118 321879 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060810.1 protein_id gnl|my_center|LOCUS_12290 321869 322504 gene locus_tag LOCUS_12300 321869 322504 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876045.1 protein_id gnl|my_center|LOCUS_12300 322611 324098 gene locus_tag LOCUS_12310 gene asnB 322611 324098 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060813.1 protein_id gnl|my_center|LOCUS_12310 324113 324331 gene locus_tag LOCUS_12320 gene gatC 324113 324331 CDS product Asp-tRNA(Asn) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876054.1 protein_id gnl|my_center|LOCUS_12320 324368 324856 gene locus_tag LOCUS_12330 324368 324856 CDS product allosteric regulator of homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060814.1 protein_id gnl|my_center|LOCUS_12330 325041 326060 gene locus_tag LOCUS_12340 325041 326060 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876056.1 protein_id gnl|my_center|LOCUS_12340 326082 327281 gene locus_tag LOCUS_12350 326082 327281 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060815.1 protein_id gnl|my_center|LOCUS_12350 327399 329006 gene locus_tag LOCUS_12360 gene pyrG 327399 329006 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876058.1 protein_id gnl|my_center|LOCUS_12360 329039 330247 gene locus_tag LOCUS_12370 329039 330247 CDS product A24 family peptidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876060.1 protein_id gnl|my_center|LOCUS_12370 330353 330778 gene locus_tag LOCUS_12380 330353 330778 CDS product class III signal peptide-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060817.1 protein_id gnl|my_center|LOCUS_12380 330835 331722 gene locus_tag LOCUS_12390 330835 331722 CDS product DUF2101 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876062.1 protein_id gnl|my_center|LOCUS_12390 332151 331741 gene locus_tag LOCUS_12400 332151 331741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 332347 333252 gene locus_tag LOCUS_12410 332347 333252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 333257 335317 gene locus_tag LOCUS_12420 333257 335317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485731.1 protein_id gnl|my_center|LOCUS_12420 335344 336399 gene locus_tag LOCUS_12430 335344 336399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485732.1 protein_id gnl|my_center|LOCUS_12430 336400 336828 gene locus_tag LOCUS_12440 336400 336828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 336867 337283 gene locus_tag LOCUS_12450 336867 337283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876069.1 protein_id gnl|my_center|LOCUS_12450 337313 338110 gene locus_tag LOCUS_12460 337313 338110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060818.1 protein_id gnl|my_center|LOCUS_12460 338126 338806 gene locus_tag LOCUS_12470 338126 338806 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876071.1 protein_id gnl|my_center|LOCUS_12470 339274 338894 gene locus_tag LOCUS_12480 339274 338894 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876072.1 protein_id gnl|my_center|LOCUS_12480 339865 339308 gene locus_tag LOCUS_12490 339865 339308 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060819.1 protein_id gnl|my_center|LOCUS_12490 340795 340040 gene locus_tag LOCUS_12500 340795 340040 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876074.1 protein_id gnl|my_center|LOCUS_12500 341005 341244 gene locus_tag LOCUS_12510 341005 341244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 341410 342438 gene locus_tag LOCUS_12520 341410 342438 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060820.1 protein_id gnl|my_center|LOCUS_12520 343218 342502 gene locus_tag LOCUS_12530 343218 342502 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061067.1 protein_id gnl|my_center|LOCUS_12530 344544 343282 gene locus_tag LOCUS_12540 344544 343282 CDS product methanogen output domain 1-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876079.1 protein_id gnl|my_center|LOCUS_12540 346415 344631 gene locus_tag LOCUS_12550 gene uvrC 346415 344631 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876080.1 protein_id gnl|my_center|LOCUS_12550 347308 346523 gene locus_tag LOCUS_12560 347308 346523 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065422.1 protein_id gnl|my_center|LOCUS_12560 347586 349541 gene locus_tag LOCUS_12570 gene uvrB 347586 349541 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330366.1 protein_id gnl|my_center|LOCUS_12570 349538 352444 gene locus_tag LOCUS_12580 gene uvrA 349538 352444 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061214.1 protein_id gnl|my_center|LOCUS_12580 352756 353706 gene locus_tag LOCUS_12590 352756 353706 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876130.1 protein_id gnl|my_center|LOCUS_12590 353727 353906 gene locus_tag LOCUS_12600 353727 353906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 354012 355304 gene locus_tag LOCUS_12610 354012 355304 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693428.1 protein_id gnl|my_center|LOCUS_12610 355601 356512 gene locus_tag LOCUS_12620 355601 356512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 356923 356639 gene locus_tag LOCUS_12630 356923 356639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 357145 357975 gene locus_tag LOCUS_12640 357145 357975 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359074.1 protein_id gnl|my_center|LOCUS_12640 358046 358741 gene locus_tag LOCUS_12650 358046 358741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 359349 358792 gene locus_tag LOCUS_12660 359349 358792 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877408.1 protein_id gnl|my_center|LOCUS_12660 359640 360377 gene locus_tag LOCUS_12670 359640 360377 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877405.1 protein_id gnl|my_center|LOCUS_12670 360411 362993 gene locus_tag LOCUS_12680 360411 362993 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877404.1 protein_id gnl|my_center|LOCUS_12680 363393 363085 gene locus_tag LOCUS_12690 363393 363085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 364914 364117 gene locus_tag LOCUS_12700 364914 364117 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877442.1 protein_id gnl|my_center|LOCUS_12700 365116 365568 gene locus_tag LOCUS_12710 365116 365568 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071603.1 protein_id gnl|my_center|LOCUS_12710 365653 366618 gene locus_tag LOCUS_12720 365653 366618 CDS product alpha/beta fold hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877422.1 protein_id gnl|my_center|LOCUS_12720 366808 367086 gene locus_tag LOCUS_12730 366808 367086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892859.1 protein_id gnl|my_center|LOCUS_12730 367133 367981 gene locus_tag LOCUS_12740 367133 367981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 368564 368133 gene locus_tag LOCUS_12750 368564 368133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 368727 369479 gene locus_tag LOCUS_12760 368727 369479 CDS product ZIP family zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225190.1 protein_id gnl|my_center|LOCUS_12760 370759 369539 gene locus_tag LOCUS_12770 370759 369539 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870253.1 protein_id gnl|my_center|LOCUS_12770 372611 370881 gene locus_tag LOCUS_12780 372611 370881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 372920 373837 gene locus_tag LOCUS_12790 372920 373837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 374250 373849 gene locus_tag LOCUS_12800 374250 373849 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064953.1 protein_id gnl|my_center|LOCUS_12800 374815 374288 gene locus_tag LOCUS_12810 374815 374288 CDS product protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846965.1 protein_id gnl|my_center|LOCUS_12810 375020 376378 gene locus_tag LOCUS_12820 375020 376378 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 protein_id gnl|my_center|LOCUS_12820 376658 376434 gene locus_tag LOCUS_12830 376658 376434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 377085 376678 gene locus_tag LOCUS_12840 377085 376678 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061150.1 protein_id gnl|my_center|LOCUS_12840 377547 377149 gene locus_tag LOCUS_12850 377547 377149 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251148.1 protein_id gnl|my_center|LOCUS_12850 377848 380136 gene locus_tag LOCUS_12860 377848 380136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 380881 380171 gene locus_tag LOCUS_12870 380881 380171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 382976 380967 gene locus_tag LOCUS_12880 gene feoB 382976 380967 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060770.1 protein_id gnl|my_center|LOCUS_12880 383713 382979 gene locus_tag LOCUS_12890 383713 382979 CDS product DtxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330364.1 protein_id gnl|my_center|LOCUS_12890 383939 384421 gene locus_tag LOCUS_12900 383939 384421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 384454 385653 gene locus_tag LOCUS_12910 384454 385653 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876486.1 protein_id gnl|my_center|LOCUS_12910 385669 386061 gene locus_tag LOCUS_12920 385669 386061 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206529.1 protein_id gnl|my_center|LOCUS_12920 386792 386208 gene locus_tag LOCUS_12930 386792 386208 CDS product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060771.1 protein_id gnl|my_center|LOCUS_12930 388724 386820 gene locus_tag LOCUS_12940 gene acs 388724 386820 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319494.1 protein_id gnl|my_center|LOCUS_12940 389408 388896 gene locus_tag LOCUS_12950 389408 388896 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060743.1 protein_id gnl|my_center|LOCUS_12950 391292 389667 gene locus_tag LOCUS_12960 gene thsA 391292 389667 CDS product thermosome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060772.1 protein_id gnl|my_center|LOCUS_12960 391989 391600 gene locus_tag LOCUS_12970 391989 391600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 392359 394026 gene locus_tag LOCUS_12980 gene pheT 392359 394026 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876408.1 protein_id gnl|my_center|LOCUS_12980 394458 394048 gene locus_tag LOCUS_12990 394458 394048 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876409.1 protein_id gnl|my_center|LOCUS_12990 395689 394580 gene locus_tag LOCUS_13000 395689 394580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 396181 395717 gene locus_tag LOCUS_13010 gene pyrI 396181 395717 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060913.1 protein_id gnl|my_center|LOCUS_13010 396383 396760 gene locus_tag LOCUS_13020 396383 396760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 397179 396772 gene locus_tag LOCUS_13030 397179 396772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 398728 397514 gene locus_tag LOCUS_13040 398728 397514 CDS product preprotein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876482.1 protein_id gnl|my_center|LOCUS_13040 399567 398725 gene locus_tag LOCUS_13050 399567 398725 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870766.1 protein_id gnl|my_center|LOCUS_13050 400070 399576 gene locus_tag LOCUS_13060 400070 399576 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060912.1 protein_id gnl|my_center|LOCUS_13060 401287 400277 gene locus_tag LOCUS_13070 gene argC 401287 400277 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876479.1 protein_id gnl|my_center|LOCUS_13070 402337 401456 gene locus_tag LOCUS_13080 gene argB 402337 401456 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875822.1 protein_id gnl|my_center|LOCUS_13080 403587 402394 gene locus_tag LOCUS_13090 gene argJ 403587 402394 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330363.1 protein_id gnl|my_center|LOCUS_13090 403968 403663 gene locus_tag LOCUS_13100 403968 403663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 405270 404065 gene locus_tag LOCUS_13110 405270 404065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060765.1 protein_id gnl|my_center|LOCUS_13110 406338 405316 gene locus_tag LOCUS_13120 406338 405316 CDS product Zc3h12a-like ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060764.1 protein_id gnl|my_center|LOCUS_13120 407090 406335 gene locus_tag LOCUS_13130 407090 406335 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877328.1 protein_id gnl|my_center|LOCUS_13130 407444 407091 gene locus_tag LOCUS_13140 407444 407091 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875816.1 protein_id gnl|my_center|LOCUS_13140 409477 407444 gene locus_tag LOCUS_13150 gene tgtA 409477 407444 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060763.1 protein_id gnl|my_center|LOCUS_13150 410749 409541 gene locus_tag LOCUS_13160 410749 409541 CDS product MnmC family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875814.1 protein_id gnl|my_center|LOCUS_13160 410887 411471 gene locus_tag LOCUS_13170 410887 411471 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870595.1 protein_id gnl|my_center|LOCUS_13170 411591 412397 gene locus_tag LOCUS_13180 411591 412397 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892786.1 protein_id gnl|my_center|LOCUS_13180 412397 412774 gene locus_tag LOCUS_13190 412397 412774 CDS product DUF2304 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875776.1 protein_id gnl|my_center|LOCUS_13190 412801 413985 gene locus_tag LOCUS_13200 412801 413985 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868579.1 protein_id gnl|my_center|LOCUS_13200 414029 415210 gene locus_tag LOCUS_13210 414029 415210 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023661.1 protein_id gnl|my_center|LOCUS_13210 416224 415202 gene locus_tag LOCUS_13220 416224 415202 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023662.1 protein_id gnl|my_center|LOCUS_13220 416777 416244 gene locus_tag LOCUS_13230 416777 416244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 417351 418277 gene locus_tag LOCUS_13240 417351 418277 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561952.1 protein_id gnl|my_center|LOCUS_13240 418267 418767 gene locus_tag LOCUS_13250 418267 418767 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937385.1 protein_id gnl|my_center|LOCUS_13250 418912 420219 gene locus_tag LOCUS_13260 418912 420219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 420311 421198 gene locus_tag LOCUS_13270 420311 421198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 421233 422348 gene locus_tag LOCUS_13280 421233 422348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 422402 423079 gene locus_tag LOCUS_13290 422402 423079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 423126 424337 gene locus_tag LOCUS_13300 423126 424337 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875779.1 protein_id gnl|my_center|LOCUS_13300 424493 425206 gene locus_tag LOCUS_13310 424493 425206 CDS product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875780.1 protein_id gnl|my_center|LOCUS_13310 425384 426871 gene locus_tag LOCUS_13320 gene guaB 425384 426871 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871141.1 protein_id gnl|my_center|LOCUS_13320 426933 427526 gene locus_tag LOCUS_13330 426933 427526 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892791.1 protein_id gnl|my_center|LOCUS_13330 427953 428411 gene locus_tag LOCUS_13340 427953 428411 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485814.1 protein_id gnl|my_center|LOCUS_13340 428510 429832 gene locus_tag LOCUS_13350 gene wecB 428510 429832 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060909.1 protein_id gnl|my_center|LOCUS_13350 430930 429938 gene locus_tag LOCUS_13360 430930 429938 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022155.1 protein_id gnl|my_center|LOCUS_13360 431118 432491 gene locus_tag LOCUS_13370 431118 432491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545573.1 protein_id gnl|my_center|LOCUS_13370 432493 433536 gene locus_tag LOCUS_13380 432493 433536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 433943 435529 gene locus_tag LOCUS_13390 433943 435529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 435582 436574 gene locus_tag LOCUS_13400 435582 436574 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023662.1 protein_id gnl|my_center|LOCUS_13400 436680 437696 gene locus_tag LOCUS_13410 436680 437696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 438413 438264 gene locus_tag LOCUS_13420 438413 438264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 438659 438468 gene locus_tag LOCUS_13430 438659 438468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 438865 439422 gene locus_tag LOCUS_13440 438865 439422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 440554 439445 gene locus_tag LOCUS_13450 440554 439445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 441878 441729 gene locus_tag LOCUS_13460 441878 441729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 443267 442905 gene locus_tag LOCUS_13470 443267 442905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 444466 443330 gene locus_tag LOCUS_13480 444466 443330 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868366.1 protein_id gnl|my_center|LOCUS_13480 446361 444466 gene locus_tag LOCUS_13490 446361 444466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 447242 446361 gene locus_tag LOCUS_13500 447242 446361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 448521 447316 gene locus_tag LOCUS_13510 448521 447316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 449205 448585 gene locus_tag LOCUS_13520 449205 448585 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582953.1 protein_id gnl|my_center|LOCUS_13520 450110 449259 gene locus_tag LOCUS_13530 450110 449259 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024069.1 protein_id gnl|my_center|LOCUS_13530 451278 450103 gene locus_tag LOCUS_13540 451278 450103 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582952.1 protein_id gnl|my_center|LOCUS_13540 452640 451456 gene locus_tag LOCUS_13550 452640 451456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 452779 453180 gene locus_tag LOCUS_13560 452779 453180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 455022 453208 gene locus_tag LOCUS_13570 455022 453208 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528118.1 protein_id gnl|my_center|LOCUS_13570 455960 455058 gene locus_tag LOCUS_13580 455960 455058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528117.1 protein_id gnl|my_center|LOCUS_13580 456168 456037 gene locus_tag LOCUS_13590 456168 456037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 458158 456266 gene locus_tag LOCUS_13600 458158 456266 CDS product lasso peptide isopeptide bond-forming cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528116.1 protein_id gnl|my_center|LOCUS_13600 458589 458155 gene locus_tag LOCUS_13610 458589 458155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 458987 458685 gene locus_tag LOCUS_13620 458987 458685 CDS product PqqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528114.1 protein_id gnl|my_center|LOCUS_13620 459315 463226 gene locus_tag LOCUS_13630 459315 463226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 463422 464276 gene locus_tag LOCUS_13640 463422 464276 CDS product DUF1616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065996.1 protein_id gnl|my_center|LOCUS_13640 464494 464730 gene locus_tag LOCUS_13650 464494 464730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060862.1 protein_id gnl|my_center|LOCUS_13650 464741 465562 gene locus_tag LOCUS_13660 464741 465562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 465649 466251 gene locus_tag LOCUS_13670 465649 466251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 467623 466283 gene locus_tag LOCUS_13680 467623 466283 CDS product CPBP family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876272.1 protein_id gnl|my_center|LOCUS_13680 467908 468876 gene locus_tag LOCUS_13690 467908 468876 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022154.1 protein_id gnl|my_center|LOCUS_13690 469100 469999 gene locus_tag LOCUS_13700 469100 469999 CDS product DUF166 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061232.1 protein_id gnl|my_center|LOCUS_13700 470019 470780 gene locus_tag LOCUS_13710 gene cobM 470019 470780 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876241.1 protein_id gnl|my_center|LOCUS_13710 470847 472082 gene locus_tag LOCUS_13720 470847 472082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 472526 472143 gene locus_tag LOCUS_13730 472526 472143 CDS product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876242.1 protein_id gnl|my_center|LOCUS_13730 472642 473550 gene locus_tag LOCUS_13740 472642 473550 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876243.1 protein_id gnl|my_center|LOCUS_13740 473584 474330 gene locus_tag LOCUS_13750 473584 474330 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_13750 474327 475163 gene locus_tag LOCUS_13760 474327 475163 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485751.1 protein_id gnl|my_center|LOCUS_13760 475499 476125 gene locus_tag LOCUS_13770 475499 476125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 476131 476445 gene locus_tag LOCUS_13780 476131 476445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 476830 476468 gene locus_tag LOCUS_13790 476830 476468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 477037 479706 gene locus_tag LOCUS_13800 gene valS 477037 479706 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060895.1 protein_id gnl|my_center|LOCUS_13800 479723 480997 gene locus_tag LOCUS_13810 gene aroA 479723 480997 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876404.1 protein_id gnl|my_center|LOCUS_13810 481050 481535 gene locus_tag LOCUS_13820 481050 481535 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876403.1 protein_id gnl|my_center|LOCUS_13820 481585 482505 gene locus_tag LOCUS_13830 481585 482505 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879664.1 protein_id gnl|my_center|LOCUS_13830 482535 483167 gene locus_tag LOCUS_13840 482535 483167 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485759.1 protein_id gnl|my_center|LOCUS_13840 483547 484479 gene locus_tag LOCUS_13850 483547 484479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 484489 485988 gene locus_tag LOCUS_13860 484489 485988 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870705.1 protein_id gnl|my_center|LOCUS_13860 486008 486490 gene locus_tag LOCUS_13870 486008 486490 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021168.1 protein_id gnl|my_center|LOCUS_13870 486475 487215 gene locus_tag LOCUS_13880 gene tatC 486475 487215 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545000.1 protein_id gnl|my_center|LOCUS_13880 487228 487497 gene locus_tag LOCUS_13890 487228 487497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 487664 488326 gene locus_tag LOCUS_13900 487664 488326 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022504.1 protein_id gnl|my_center|LOCUS_13900 488942 491488 gene locus_tag LOCUS_13910 488942 491488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 493743 491560 gene locus_tag LOCUS_13920 493743 491560 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060894.1 protein_id gnl|my_center|LOCUS_13920 494346 493855 gene locus_tag LOCUS_13930 494346 493855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876397.1 protein_id gnl|my_center|LOCUS_13930 496059 494542 gene locus_tag LOCUS_13940 496059 494542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 496495 496151 gene locus_tag LOCUS_13950 496495 496151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 497169 497038 gene locus_tag LOCUS_13960 497169 497038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 497734 497273 gene locus_tag LOCUS_13970 497734 497273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 498214 497945 gene locus_tag LOCUS_13980 498214 497945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 498651 498265 gene locus_tag LOCUS_13990 498651 498265 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878336.1 protein_id gnl|my_center|LOCUS_13990 499251 498667 gene locus_tag LOCUS_14000 499251 498667 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060893.1 protein_id gnl|my_center|LOCUS_14000 499557 500951 gene locus_tag LOCUS_14010 499557 500951 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 protein_id gnl|my_center|LOCUS_14010 503415 500965 gene locus_tag LOCUS_14020 503415 500965 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876179.1 protein_id gnl|my_center|LOCUS_14020 504685 503417 gene locus_tag LOCUS_14030 504685 503417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14030 506344 504692 gene locus_tag LOCUS_14040 506344 504692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 507472 506363 gene locus_tag LOCUS_14050 507472 506363 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485746.1 protein_id gnl|my_center|LOCUS_14050 507663 508178 gene locus_tag LOCUS_14060 507663 508178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052457324.1 protein_id gnl|my_center|LOCUS_14060 508944 508351 gene locus_tag LOCUS_14070 508944 508351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 509972 509457 gene locus_tag LOCUS_14080 509972 509457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 510578 511549 gene locus_tag LOCUS_14090 gene galE 510578 511549 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876270.1 protein_id gnl|my_center|LOCUS_14090 511858 511613 gene locus_tag LOCUS_14100 511858 511613 CDS product TIGR00304 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060854.1 protein_id gnl|my_center|LOCUS_14100 512406 511894 gene locus_tag LOCUS_14110 512406 511894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 512523 512963 gene locus_tag LOCUS_14120 512523 512963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 513019 513513 gene locus_tag LOCUS_14130 513019 513513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 514021 513554 gene locus_tag LOCUS_14140 514021 513554 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060850.1 protein_id gnl|my_center|LOCUS_14140 515679 514108 gene locus_tag LOCUS_14150 515679 514108 CDS product DUF530 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876227.1 protein_id gnl|my_center|LOCUS_14150 517695 515710 gene locus_tag LOCUS_14160 gene metG 517695 515710 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876226.1 protein_id gnl|my_center|LOCUS_14160 518042 519340 gene locus_tag LOCUS_14170 gene priL 518042 519340 CDS product DNA primase large subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876225.1 protein_id gnl|my_center|LOCUS_14170 519378 520349 gene locus_tag LOCUS_14180 gene priS 519378 520349 CDS product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061231.1 protein_id gnl|my_center|LOCUS_14180 521749 520364 gene locus_tag LOCUS_14190 gene cca 521749 520364 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876223.1 protein_id gnl|my_center|LOCUS_14190 522368 521817 gene locus_tag LOCUS_14200 gene thpR 522368 521817 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876222.1 protein_id gnl|my_center|LOCUS_14200 523313 522372 gene locus_tag LOCUS_14210 523313 522372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 524496 523372 gene locus_tag LOCUS_14220 524496 523372 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060849.1 protein_id gnl|my_center|LOCUS_14220 525337 524543 gene locus_tag LOCUS_14230 525337 524543 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876218.1 protein_id gnl|my_center|LOCUS_14230 525880 525350 gene locus_tag LOCUS_14240 525880 525350 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876217.1 protein_id gnl|my_center|LOCUS_14240 526155 526367 gene locus_tag LOCUS_14250 526155 526367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 527636 526392 gene locus_tag LOCUS_14260 527636 526392 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986386.1 protein_id gnl|my_center|LOCUS_14260 529042 527723 gene locus_tag LOCUS_14270 gene aspS 529042 527723 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875865.1 protein_id gnl|my_center|LOCUS_14270 <530267 529081 gene locus_tag LOCUS_14280 <530267 529081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060775.1:histidinol dehydrogenase >Feature sequence03 2373 154 gene locus_tag LOCUS_14290 2373 154 CDS product dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit STT3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061170.1 protein_id gnl|my_center|LOCUS_14290 4649 2403 gene locus_tag LOCUS_14300 4649 2403 CDS product dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit STT3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061170.1 protein_id gnl|my_center|LOCUS_14300 4762 6159 gene locus_tag LOCUS_14310 4762 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 7186 6233 gene locus_tag LOCUS_14320 gene wecB 7186 6233 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_14320 7361 8305 gene locus_tag LOCUS_14330 7361 8305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 9060 8314 gene locus_tag LOCUS_14340 9060 8314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 10243 9065 gene locus_tag LOCUS_14350 gene bshA 10243 9065 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230645.1 protein_id gnl|my_center|LOCUS_14350 10990 10271 gene locus_tag LOCUS_14360 10990 10271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 12936 11212 gene locus_tag LOCUS_14370 12936 11212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 13274 13071 gene locus_tag LOCUS_14380 13274 13071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 13462 13722 gene locus_tag LOCUS_14390 13462 13722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 13924 14085 gene locus_tag LOCUS_14400 13924 14085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 14680 14829 gene locus_tag LOCUS_14410 14680 14829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 15891 14803 gene locus_tag LOCUS_14420 15891 14803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 15947 16126 gene locus_tag LOCUS_14430 15947 16126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 16942 16412 gene locus_tag LOCUS_14440 gene yjjX 16942 16412 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061167.1 protein_id gnl|my_center|LOCUS_14440 17422 16970 gene locus_tag LOCUS_14450 17422 16970 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061166.1 protein_id gnl|my_center|LOCUS_14450 17531 19093 gene locus_tag LOCUS_14460 17531 19093 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877491.1 protein_id gnl|my_center|LOCUS_14460 19303 20418 gene locus_tag LOCUS_14470 gene gntC 19303 20418 CDS product guanitoxin biosynthesis PLP-dependent (S)-gamma-hydroxy-L-arginine cyclodehydratase GntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061335.1 protein_id gnl|my_center|LOCUS_14470 20512 21090 gene locus_tag LOCUS_14480 20512 21090 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021440.1 protein_id gnl|my_center|LOCUS_14480 21141 21551 gene locus_tag LOCUS_14490 21141 21551 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021439.1 protein_id gnl|my_center|LOCUS_14490 21578 23227 gene locus_tag LOCUS_14500 21578 23227 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876295.1 protein_id gnl|my_center|LOCUS_14500 23575 24477 gene locus_tag LOCUS_14510 23575 24477 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877489.1 protein_id gnl|my_center|LOCUS_14510 24636 27176 gene locus_tag LOCUS_14520 24636 27176 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086596.1 protein_id gnl|my_center|LOCUS_14520 27263 28441 gene locus_tag LOCUS_14530 27263 28441 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939637.1 protein_id gnl|my_center|LOCUS_14530 29217 28717 gene locus_tag LOCUS_14540 29217 28717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061165.1 protein_id gnl|my_center|LOCUS_14540 29374 29844 gene locus_tag LOCUS_14550 29374 29844 CDS product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064815.1 protein_id gnl|my_center|LOCUS_14550 30060 31115 gene locus_tag LOCUS_14560 30060 31115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 31209 31123 gene locus_tag LOCUS_t00230 31209 31123 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 32289 31894 gene locus_tag LOCUS_14570 32289 31894 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877486.1 protein_id gnl|my_center|LOCUS_14570 33190 32267 gene locus_tag LOCUS_14580 33190 32267 CDS product 2-phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877485.1 protein_id gnl|my_center|LOCUS_14580 34379 33711 gene locus_tag LOCUS_14590 34379 33711 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877484.1 protein_id gnl|my_center|LOCUS_14590 34982 34455 gene locus_tag LOCUS_14600 34982 34455 CDS product DUF2096 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877483.1 protein_id gnl|my_center|LOCUS_14600 35245 34979 gene locus_tag LOCUS_14610 35245 34979 CDS product DUF749 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877482.1 protein_id gnl|my_center|LOCUS_14610 36467 35544 gene locus_tag LOCUS_14620 gene hdrB 36467 35544 CDS product CoB--CoM heterodisulfide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877481.1 protein_id gnl|my_center|LOCUS_14620 37322 36480 gene locus_tag LOCUS_14630 37322 36480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 37984 37469 gene locus_tag LOCUS_14640 gene pgsA 37984 37469 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244753.1 protein_id gnl|my_center|LOCUS_14640 38113 38844 gene locus_tag LOCUS_14650 38113 38844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877479.1 protein_id gnl|my_center|LOCUS_14650 39431 38865 gene locus_tag LOCUS_14660 39431 38865 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880943.1 protein_id gnl|my_center|LOCUS_14660 39585 39809 gene locus_tag LOCUS_14670 39585 39809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877477.1 protein_id gnl|my_center|LOCUS_14670 40784 39840 gene locus_tag LOCUS_14680 40784 39840 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870102.1 protein_id gnl|my_center|LOCUS_14680 41594 40806 gene locus_tag LOCUS_14690 gene dph5 41594 40806 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877476.1 protein_id gnl|my_center|LOCUS_14690 41755 42777 gene locus_tag LOCUS_14700 41755 42777 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877475.1 protein_id gnl|my_center|LOCUS_14700 42838 43383 gene locus_tag LOCUS_14710 42838 43383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875941.1 protein_id gnl|my_center|LOCUS_14710 44383 43454 gene locus_tag LOCUS_14720 gene mtnA 44383 43454 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061163.1 protein_id gnl|my_center|LOCUS_14720 45287 44436 gene locus_tag LOCUS_14730 gene nifB 45287 44436 CDS product FeMo cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877473.1 protein_id gnl|my_center|LOCUS_14730 45887 45336 gene locus_tag LOCUS_14740 45887 45336 CDS product methanogenesis marker 17 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877472.1 protein_id gnl|my_center|LOCUS_14740 47130 45901 gene locus_tag LOCUS_14750 47130 45901 CDS product methanogenesis marker 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877471.1 protein_id gnl|my_center|LOCUS_14750 47569 47123 gene locus_tag LOCUS_14760 47569 47123 CDS product methanogenesis marker 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877470.1 protein_id gnl|my_center|LOCUS_14760 47949 47566 gene locus_tag LOCUS_14770 47949 47566 CDS product DUF2111 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877469.1 protein_id gnl|my_center|LOCUS_14770 48423 47995 gene locus_tag LOCUS_14780 48423 47995 CDS product methanogenesis marker 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061162.1 protein_id gnl|my_center|LOCUS_14780 49939 48407 gene locus_tag LOCUS_14790 49939 48407 CDS product methanogenesis marker 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061161.1 protein_id gnl|my_center|LOCUS_14790 50938 49952 gene locus_tag LOCUS_14800 50938 49952 CDS product methanogenesis marker 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061160.1 protein_id gnl|my_center|LOCUS_14800 52041 50947 gene locus_tag LOCUS_14810 52041 50947 CDS product DUF2117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869557.1 protein_id gnl|my_center|LOCUS_14810 52648 52139 gene locus_tag LOCUS_14820 52648 52139 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877464.1 protein_id gnl|my_center|LOCUS_14820 53053 53577 gene locus_tag LOCUS_14830 53053 53577 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061158.1 protein_id gnl|my_center|LOCUS_14830 54169 53639 gene locus_tag LOCUS_14840 gene pyrE 54169 53639 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877462.1 protein_id gnl|my_center|LOCUS_14840 54727 54461 gene locus_tag LOCUS_14850 54727 54461 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877461.1 protein_id gnl|my_center|LOCUS_14850 55041 55226 gene locus_tag LOCUS_14860 55041 55226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 55317 55799 gene locus_tag LOCUS_14870 55317 55799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 57637 56039 gene locus_tag LOCUS_14880 57637 56039 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877458.1 protein_id gnl|my_center|LOCUS_14880 57857 57651 gene locus_tag LOCUS_14890 57857 57651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877459.1 protein_id gnl|my_center|LOCUS_14890 58154 58510 gene locus_tag LOCUS_14900 58154 58510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 59982 58555 gene locus_tag LOCUS_14910 59982 58555 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875879.1 protein_id gnl|my_center|LOCUS_14910 60948 59983 gene locus_tag LOCUS_14920 60948 59983 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060778.1 protein_id gnl|my_center|LOCUS_14920 61272 61610 gene locus_tag LOCUS_14930 61272 61610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 61639 61857 gene locus_tag LOCUS_14940 61639 61857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 63140 61905 gene locus_tag LOCUS_14950 63140 61905 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877430.1 protein_id gnl|my_center|LOCUS_14950 64753 63305 gene locus_tag LOCUS_14960 gene mvhA 64753 63305 CDS product F420-non-reducing hydrogenase subunit MvhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876758.1 protein_id gnl|my_center|LOCUS_14960 65680 64769 gene locus_tag LOCUS_14970 65680 64769 CDS product F420-nonreducing hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496953.1 protein_id gnl|my_center|LOCUS_14970 66234 65680 gene locus_tag LOCUS_14980 66234 65680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 66498 66247 gene locus_tag LOCUS_14990 66498 66247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 67362 66757 gene locus_tag LOCUS_15000 67362 66757 CDS product sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877431.1 protein_id gnl|my_center|LOCUS_15000 68235 67471 gene locus_tag LOCUS_15010 68235 67471 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877432.1 protein_id gnl|my_center|LOCUS_15010 69246 68338 gene locus_tag LOCUS_15020 gene rnz 69246 68338 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061333.1 protein_id gnl|my_center|LOCUS_15020 69404 70240 gene locus_tag LOCUS_15030 gene nadC 69404 70240 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877434.1 protein_id gnl|my_center|LOCUS_15030 70485 70919 gene locus_tag LOCUS_15040 70485 70919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061151.1 protein_id gnl|my_center|LOCUS_15040 71704 71141 gene locus_tag LOCUS_15050 71704 71141 CDS product ZPR1 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877436.1 protein_id gnl|my_center|LOCUS_15050 72757 71798 gene locus_tag LOCUS_15060 72757 71798 CDS product 3H domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877437.1 protein_id gnl|my_center|LOCUS_15060 73226 72879 gene locus_tag LOCUS_15070 73226 72879 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877438.1 protein_id gnl|my_center|LOCUS_15070 73424 74476 gene locus_tag LOCUS_15080 73424 74476 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877439.1 protein_id gnl|my_center|LOCUS_15080 74532 74882 gene locus_tag LOCUS_15090 gene sepF 74532 74882 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877440.1 protein_id gnl|my_center|LOCUS_15090 75033 76187 gene locus_tag LOCUS_15100 75033 76187 CDS product DUF2226 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061152.1 protein_id gnl|my_center|LOCUS_15100 76198 76980 gene locus_tag LOCUS_15110 76198 76980 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877442.1 protein_id gnl|my_center|LOCUS_15110 76992 77789 gene locus_tag LOCUS_15120 76992 77789 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877442.1 protein_id gnl|my_center|LOCUS_15120 77961 78839 gene locus_tag LOCUS_15130 77961 78839 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061153.1 protein_id gnl|my_center|LOCUS_15130 79606 78851 gene locus_tag LOCUS_15140 79606 78851 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061154.1 protein_id gnl|my_center|LOCUS_15140 79787 80623 gene locus_tag LOCUS_15150 79787 80623 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877445.1 protein_id gnl|my_center|LOCUS_15150 80730 81596 gene locus_tag LOCUS_15160 80730 81596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 82350 81643 gene locus_tag LOCUS_15170 82350 81643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 82572 82724 gene locus_tag LOCUS_15180 82572 82724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 84484 82754 gene locus_tag LOCUS_15190 gene glyS 84484 82754 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061155.1 protein_id gnl|my_center|LOCUS_15190 85216 84596 gene locus_tag LOCUS_15200 gene dcd 85216 84596 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061156.1 protein_id gnl|my_center|LOCUS_15200 86410 85259 gene locus_tag LOCUS_15210 86410 85259 CDS product DUF1512 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877450.1 protein_id gnl|my_center|LOCUS_15210 87145 86444 gene locus_tag LOCUS_15220 87145 86444 CDS product TrmJ/YjtD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877451.1 protein_id gnl|my_center|LOCUS_15220 88676 87186 gene locus_tag LOCUS_15230 88676 87186 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061157.1 protein_id gnl|my_center|LOCUS_15230 89287 88997 gene locus_tag LOCUS_15240 89287 88997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 89941 89369 gene locus_tag LOCUS_15250 89941 89369 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876572.1 protein_id gnl|my_center|LOCUS_15250 90099 91949 gene locus_tag LOCUS_15260 gene iorA 90099 91949 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877454.1 protein_id gnl|my_center|LOCUS_15260 91979 92572 gene locus_tag LOCUS_15270 gene iorB 91979 92572 CDS product indolepyruvate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877455.1 protein_id gnl|my_center|LOCUS_15270 92653 93999 gene locus_tag LOCUS_15280 92653 93999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 94512 94081 gene locus_tag LOCUS_15290 94512 94081 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877456.1 protein_id gnl|my_center|LOCUS_15290 95829 94525 gene locus_tag LOCUS_15300 95829 94525 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060759.1 protein_id gnl|my_center|LOCUS_15300 96174 97031 gene locus_tag LOCUS_15310 96174 97031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 97137 97799 gene locus_tag LOCUS_15320 97137 97799 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966429.1 protein_id gnl|my_center|LOCUS_15320 100025 97824 gene locus_tag LOCUS_15330 100025 97824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 100130 100951 gene locus_tag LOCUS_15340 100130 100951 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259109.1 protein_id gnl|my_center|LOCUS_15340 102272 101220 gene locus_tag LOCUS_15350 102272 101220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 102476 104020 gene locus_tag LOCUS_15360 102476 104020 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065424.1 protein_id gnl|my_center|LOCUS_15360 104377 105138 gene locus_tag LOCUS_15370 104377 105138 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876497.1 protein_id gnl|my_center|LOCUS_15370 105803 105141 gene locus_tag LOCUS_15380 105803 105141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892482.1 protein_id gnl|my_center|LOCUS_15380 106447 105968 gene locus_tag LOCUS_15390 106447 105968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 106677 107606 gene locus_tag LOCUS_15400 106677 107606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875877.1 protein_id gnl|my_center|LOCUS_15400 107672 108280 gene locus_tag LOCUS_15410 107672 108280 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722009.1 protein_id gnl|my_center|LOCUS_15410 108567 108376 gene locus_tag LOCUS_15420 108567 108376 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014310.1 protein_id gnl|my_center|LOCUS_15420 109280 108630 gene locus_tag LOCUS_15430 109280 108630 CDS product S24/S26 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060845.1 protein_id gnl|my_center|LOCUS_15430 109948 109277 gene locus_tag LOCUS_15440 gene aroD 109948 109277 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876205.1 protein_id gnl|my_center|LOCUS_15440 110180 110911 gene locus_tag LOCUS_15450 110180 110911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060844.1 protein_id gnl|my_center|LOCUS_15450 110915 111775 gene locus_tag LOCUS_15460 gene sucD 110915 111775 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750467.1 protein_id gnl|my_center|LOCUS_15460 111830 113041 gene locus_tag LOCUS_15470 gene hmgA 111830 113041 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876201.1 protein_id gnl|my_center|LOCUS_15470 113077 113655 gene locus_tag LOCUS_15480 113077 113655 CDS product TIGR00267 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876200.1 protein_id gnl|my_center|LOCUS_15480 114543 113698 gene locus_tag LOCUS_15490 114543 113698 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876199.1 protein_id gnl|my_center|LOCUS_15490 115024 114674 gene locus_tag LOCUS_15500 115024 114674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 116032 115190 gene locus_tag LOCUS_15510 116032 115190 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892481.1 protein_id gnl|my_center|LOCUS_15510 116269 116943 gene locus_tag LOCUS_15520 116269 116943 CDS product RNA ligase partner protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875882.1 protein_id gnl|my_center|LOCUS_15520 117076 118368 gene locus_tag LOCUS_15530 gene hisS 117076 118368 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061190.1 protein_id gnl|my_center|LOCUS_15530 118374 118769 gene locus_tag LOCUS_15540 gene hisI 118374 118769 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061191.1 protein_id gnl|my_center|LOCUS_15540 118812 120635 gene locus_tag LOCUS_15550 118812 120635 CDS product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875885.1 protein_id gnl|my_center|LOCUS_15550 120694 121446 gene locus_tag LOCUS_15560 120694 121446 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485719.1 protein_id gnl|my_center|LOCUS_15560 121657 122163 gene locus_tag LOCUS_15570 121657 122163 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892113.1 protein_id gnl|my_center|LOCUS_15570 122232 123635 gene locus_tag LOCUS_15580 122232 123635 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021944.1 protein_id gnl|my_center|LOCUS_15580 123869 124543 gene locus_tag LOCUS_15590 gene npdG 123869 124543 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060779.1 protein_id gnl|my_center|LOCUS_15590 124573 125160 gene locus_tag LOCUS_15600 gene hxlB 124573 125160 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061192.1 protein_id gnl|my_center|LOCUS_15600 125263 125766 gene locus_tag LOCUS_15610 gene endA 125263 125766 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060780.1 protein_id gnl|my_center|LOCUS_15610 125870 126976 gene locus_tag LOCUS_15620 125870 126976 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875890.1 protein_id gnl|my_center|LOCUS_15620 126970 127623 gene locus_tag LOCUS_15630 126970 127623 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892541.1 protein_id gnl|my_center|LOCUS_15630 127704 128900 gene locus_tag LOCUS_15640 gene thrC 127704 128900 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061193.1 protein_id gnl|my_center|LOCUS_15640 129138 129341 gene locus_tag LOCUS_15650 129138 129341 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877303.1 protein_id gnl|my_center|LOCUS_15650 129874 130245 gene locus_tag LOCUS_15660 gene rpl7ae 129874 130245 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061194.1 protein_id gnl|my_center|LOCUS_15660 130304 130510 gene locus_tag LOCUS_15670 130304 130510 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875895.1 protein_id gnl|my_center|LOCUS_15670 130527 130688 gene locus_tag LOCUS_15680 130527 130688 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875896.1 protein_id gnl|my_center|LOCUS_15680 130685 131137 gene locus_tag LOCUS_15690 gene ndk 130685 131137 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875897.1 protein_id gnl|my_center|LOCUS_15690 131174 132952 gene locus_tag LOCUS_15700 gene infB 131174 132952 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875898.1 protein_id gnl|my_center|LOCUS_15700 133034 133420 gene locus_tag LOCUS_15710 133034 133420 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875899.1 protein_id gnl|my_center|LOCUS_15710 133456 134682 gene locus_tag LOCUS_15720 gene eif2g 133456 134682 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875900.1 protein_id gnl|my_center|LOCUS_15720 134710 135069 gene locus_tag LOCUS_15730 134710 135069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875901.1 protein_id gnl|my_center|LOCUS_15730 135269 135790 gene locus_tag LOCUS_15740 135269 135790 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875902.1 protein_id gnl|my_center|LOCUS_15740 135807 136361 gene locus_tag LOCUS_15750 gene rpoE 135807 136361 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875903.1 protein_id gnl|my_center|LOCUS_15750 136361 136543 gene locus_tag LOCUS_15760 136361 136543 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875904.1 protein_id gnl|my_center|LOCUS_15760 136575 137078 gene locus_tag LOCUS_15770 136575 137078 CDS product GTP-dependent dephospho-CoA kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875905.1 protein_id gnl|my_center|LOCUS_15770 137078 137389 gene locus_tag LOCUS_15780 137078 137389 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875906.1 protein_id gnl|my_center|LOCUS_15780 137389 137544 gene locus_tag LOCUS_15790 137389 137544 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875907.1 protein_id gnl|my_center|LOCUS_15790 137582 138991 gene locus_tag LOCUS_15800 gene argH 137582 138991 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875908.1 protein_id gnl|my_center|LOCUS_15800 140339 139317 gene locus_tag LOCUS_15810 140339 139317 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892473.1 protein_id gnl|my_center|LOCUS_15810 141253 140342 gene locus_tag LOCUS_15820 141253 140342 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870529.1 protein_id gnl|my_center|LOCUS_15820 141467 142078 gene locus_tag LOCUS_15830 141467 142078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 142500 142706 gene locus_tag LOCUS_15840 142500 142706 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877303.1 protein_id gnl|my_center|LOCUS_15840 143467 142871 gene locus_tag LOCUS_15850 143467 142871 CDS product CRISPR-associated transcriptional regulator Csa3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061223.1 protein_id gnl|my_center|LOCUS_15850 143736 144059 gene locus_tag LOCUS_15860 143736 144059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 144229 144951 gene locus_tag LOCUS_15870 gene cas6 144229 144951 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750454.1 protein_id gnl|my_center|LOCUS_15870 145013 146491 gene locus_tag LOCUS_15880 145013 146491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 146505 147458 gene locus_tag LOCUS_15890 gene cas7i 146505 147458 CDS product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023574.1 protein_id gnl|my_center|LOCUS_15890 147471 148136 gene locus_tag LOCUS_15900 147471 148136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 148195 150648 gene locus_tag LOCUS_15910 gene cas3 148195 150648 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869875.1 protein_id gnl|my_center|LOCUS_15910 150863 152314 gene locus_tag LOCUS_15920 150863 152314 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871161.1 protein_id gnl|my_center|LOCUS_15920 152426 152839 gene locus_tag LOCUS_15930 gene cas4 152426 152839 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876709.1 protein_id gnl|my_center|LOCUS_15930 152874 153839 gene locus_tag LOCUS_15940 gene cas1b 152874 153839 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060964.1 protein_id gnl|my_center|LOCUS_15940 153823 154128 gene locus_tag LOCUS_15950 gene cas2 153823 154128 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496911.1 protein_id gnl|my_center|LOCUS_15950 154483 156383 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcttaaatcagactattttaggattgaaat 156387 157271 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcttaaatcagactattttaggattgaaat 157394 157657 gene locus_tag LOCUS_15960 157394 157657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 158417 157773 gene locus_tag LOCUS_15970 158417 157773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 158810 158673 gene locus_tag LOCUS_15980 158810 158673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 159115 159336 gene locus_tag LOCUS_15990 159115 159336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 159412 159813 gene locus_tag LOCUS_16000 159412 159813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 160933 160034 gene locus_tag LOCUS_16010 160933 160034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 161382 160939 gene locus_tag LOCUS_16020 161382 160939 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021289.1 protein_id gnl|my_center|LOCUS_16020 161746 161444 gene locus_tag LOCUS_16030 161746 161444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 164531 162057 gene locus_tag LOCUS_16040 164531 162057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 165409 164756 gene locus_tag LOCUS_16050 gene rnc 165409 164756 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903151.1 protein_id gnl|my_center|LOCUS_16050 165988 165602 gene locus_tag LOCUS_16060 165988 165602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 166344 168119 gene locus_tag LOCUS_16070 166344 168119 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061122.1 protein_id gnl|my_center|LOCUS_16070 169319 168162 gene locus_tag LOCUS_16080 169319 168162 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877301.1 protein_id gnl|my_center|LOCUS_16080 170219 169524 gene locus_tag LOCUS_16090 gene radB 170219 169524 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877300.1 protein_id gnl|my_center|LOCUS_16090 171023 170412 gene locus_tag LOCUS_16100 171023 170412 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877299.1 protein_id gnl|my_center|LOCUS_16100 171136 171723 gene locus_tag LOCUS_16110 gene pgsA 171136 171723 CDS product archaetidylinositol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061121.1 protein_id gnl|my_center|LOCUS_16110 171739 171984 gene locus_tag LOCUS_16120 171739 171984 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877297.1 protein_id gnl|my_center|LOCUS_16120 172059 172718 gene locus_tag LOCUS_16130 172059 172718 CDS product DUF434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870449.1 protein_id gnl|my_center|LOCUS_16130 172838 173182 gene locus_tag LOCUS_16140 172838 173182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877508.1 protein_id gnl|my_center|LOCUS_16140 173468 173992 gene locus_tag LOCUS_16150 173468 173992 CDS product TIGR00288 family NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877509.1 protein_id gnl|my_center|LOCUS_16150 173982 175157 gene locus_tag LOCUS_16160 173982 175157 CDS product TIGR03576 family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877510.1 protein_id gnl|my_center|LOCUS_16160 175220 176236 gene locus_tag LOCUS_16170 gene rtcA 175220 176236 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877511.1 protein_id gnl|my_center|LOCUS_16170 177201 176233 gene locus_tag LOCUS_16180 177201 176233 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877512.1 protein_id gnl|my_center|LOCUS_16180 178743 177265 gene locus_tag LOCUS_16190 178743 177265 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877513.1 protein_id gnl|my_center|LOCUS_16190 178929 179567 gene locus_tag LOCUS_16200 178929 179567 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892753.1 protein_id gnl|my_center|LOCUS_16200 179769 180584 gene locus_tag LOCUS_16210 179769 180584 CDS product putative RNA uridine N3 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875643.1 protein_id gnl|my_center|LOCUS_16210 180629 181642 gene locus_tag LOCUS_16220 gene rpl3p 180629 181642 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875644.1 protein_id gnl|my_center|LOCUS_16220 181690 182472 gene locus_tag LOCUS_16230 gene rpl4p 181690 182472 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875645.1 protein_id gnl|my_center|LOCUS_16230 182492 182752 gene locus_tag LOCUS_16240 182492 182752 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060727.1 protein_id gnl|my_center|LOCUS_16240 182817 183542 gene locus_tag LOCUS_16250 182817 183542 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875647.1 protein_id gnl|my_center|LOCUS_16250 183718 184128 gene locus_tag LOCUS_16260 gene rpsS 183718 184128 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875648.1 protein_id gnl|my_center|LOCUS_16260 184141 184608 gene locus_tag LOCUS_16270 gene rplV 184141 184608 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875649.1 protein_id gnl|my_center|LOCUS_16270 184609 185652 gene locus_tag LOCUS_16280 184609 185652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 185693 185899 gene locus_tag LOCUS_16290 gene rpmC 185693 185899 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875651.1 protein_id gnl|my_center|LOCUS_16290 185905 186210 gene locus_tag LOCUS_16300 gene yciH 185905 186210 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875652.1 protein_id gnl|my_center|LOCUS_16300 186303 186587 gene locus_tag LOCUS_16310 186303 186587 CDS product ribonuclease P protein component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875653.1 protein_id gnl|my_center|LOCUS_16310 186592 186912 gene locus_tag LOCUS_16320 186592 186912 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875654.1 protein_id gnl|my_center|LOCUS_16320 186913 187311 gene locus_tag LOCUS_16330 186913 187311 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875655.1 protein_id gnl|my_center|LOCUS_16330 187322 187675 gene locus_tag LOCUS_16340 gene rplX 187322 187675 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875656.1 protein_id gnl|my_center|LOCUS_16340 187677 188405 gene locus_tag LOCUS_16350 187677 188405 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875657.1 protein_id gnl|my_center|LOCUS_16350 188406 188912 gene locus_tag LOCUS_16360 188406 188912 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875658.1 protein_id gnl|my_center|LOCUS_16360 188973 189116 gene locus_tag LOCUS_16370 188973 189116 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013295326.1 protein_id gnl|my_center|LOCUS_16370 189129 189518 gene locus_tag LOCUS_16380 189129 189518 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060728.1 protein_id gnl|my_center|LOCUS_16380 189528 190061 gene locus_tag LOCUS_16390 189528 190061 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875661.1 protein_id gnl|my_center|LOCUS_16390 190075 190410 gene locus_tag LOCUS_16400 190075 190410 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875662.1 protein_id gnl|my_center|LOCUS_16400 190636 191082 gene locus_tag LOCUS_16410 190636 191082 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875663.1 protein_id gnl|my_center|LOCUS_16410 191099 191680 gene locus_tag LOCUS_16420 191099 191680 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875664.1 protein_id gnl|my_center|LOCUS_16420 191680 192321 gene locus_tag LOCUS_16430 gene rpsE 191680 192321 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192961070.1 protein_id gnl|my_center|LOCUS_16430 192331 192789 gene locus_tag LOCUS_16440 gene rpmD 192331 192789 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875666.1 protein_id gnl|my_center|LOCUS_16440 192855 193292 gene locus_tag LOCUS_16450 192855 193292 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875667.1 protein_id gnl|my_center|LOCUS_16450 193320 194663 gene locus_tag LOCUS_16460 gene secY 193320 194663 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875668.1 protein_id gnl|my_center|LOCUS_16460 194679 195236 gene locus_tag LOCUS_16470 194679 195236 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060730.1 protein_id gnl|my_center|LOCUS_16470 195277 195846 gene locus_tag LOCUS_16480 195277 195846 CDS product DUF106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875670.1 protein_id gnl|my_center|LOCUS_16480 196028 196294 gene locus_tag LOCUS_16490 196028 196294 CDS product 50S ribosomal protein L34e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875671.1 protein_id gnl|my_center|LOCUS_16490 196291 196821 gene locus_tag LOCUS_16500 196291 196821 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879393.1 protein_id gnl|my_center|LOCUS_16500 196809 197036 gene locus_tag LOCUS_16510 196809 197036 CDS product 50S ribosomal protein L14e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875673.1 protein_id gnl|my_center|LOCUS_16510 197082 198044 gene locus_tag LOCUS_16520 197082 198044 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060731.1 protein_id gnl|my_center|LOCUS_16520 198210 198295 gene locus_tag LOCUS_t00240 198210 198295 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 198488 198943 gene locus_tag LOCUS_16530 198488 198943 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875675.1 protein_id gnl|my_center|LOCUS_16530 198977 199507 gene locus_tag LOCUS_16540 gene rpsD 198977 199507 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875676.1 protein_id gnl|my_center|LOCUS_16540 199522 199914 gene locus_tag LOCUS_16550 199522 199914 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875677.1 protein_id gnl|my_center|LOCUS_16550 199916 200719 gene locus_tag LOCUS_16560 199916 200719 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875678.1 protein_id gnl|my_center|LOCUS_16560 200716 201075 gene locus_tag LOCUS_16570 200716 201075 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875679.1 protein_id gnl|my_center|LOCUS_16570 201091 201519 gene locus_tag LOCUS_16580 gene rplM 201091 201519 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250452.1 protein_id gnl|my_center|LOCUS_16580 201528 201929 gene locus_tag LOCUS_16590 201528 201929 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061175.1 protein_id gnl|my_center|LOCUS_16590 201886 202104 gene locus_tag LOCUS_16600 201886 202104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 202137 202304 gene locus_tag LOCUS_16610 202137 202304 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875681.1 protein_id gnl|my_center|LOCUS_16610 202543 202716 gene locus_tag LOCUS_16620 202543 202716 CDS product DNA-directed RNA polymerase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162828720.1 protein_id gnl|my_center|LOCUS_16620 202746 203984 gene locus_tag LOCUS_16630 gene eno 202746 203984 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875683.1 protein_id gnl|my_center|LOCUS_16630 204022 204213 gene locus_tag LOCUS_16640 204022 204213 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061279.1 protein_id gnl|my_center|LOCUS_16640 204337 204933 gene locus_tag LOCUS_16650 gene rpsB 204337 204933 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875684.1 protein_id gnl|my_center|LOCUS_16650 204956 205795 gene locus_tag LOCUS_16660 gene amrB 204956 205795 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875685.1 protein_id gnl|my_center|LOCUS_16660 205863 206828 gene locus_tag LOCUS_16670 gene mvk 205863 206828 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875686.1 protein_id gnl|my_center|LOCUS_16670 206843 207646 gene locus_tag LOCUS_16680 206843 207646 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875687.1 protein_id gnl|my_center|LOCUS_16680 207648 208709 gene locus_tag LOCUS_16690 gene fni 207648 208709 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875688.1 protein_id gnl|my_center|LOCUS_16690 208846 210195 gene locus_tag LOCUS_16700 208846 210195 CDS product RNase J family beta-CASP ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875689.1 protein_id gnl|my_center|LOCUS_16700 210195 211181 gene locus_tag LOCUS_16710 gene idsA 210195 211181 CDS product short chain isoprenyl diphosphate synthase IdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875690.1 protein_id gnl|my_center|LOCUS_16710 211227 212900 gene locus_tag LOCUS_16720 gene gltX 211227 212900 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875691.1 protein_id gnl|my_center|LOCUS_16720 212926 214158 gene locus_tag LOCUS_16730 212926 214158 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_16730 214544 215872 gene locus_tag LOCUS_16740 214544 215872 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876255.1 protein_id gnl|my_center|LOCUS_16740 216015 217037 gene locus_tag LOCUS_16750 216015 217037 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876254.1 protein_id gnl|my_center|LOCUS_16750 217905 217105 gene locus_tag LOCUS_16760 217905 217105 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073567.1 protein_id gnl|my_center|LOCUS_16760 218150 218482 gene locus_tag LOCUS_16770 218150 218482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 218633 221008 gene locus_tag LOCUS_16780 gene lon 218633 221008 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021863.1 protein_id gnl|my_center|LOCUS_16780 221539 221189 gene locus_tag LOCUS_16790 221539 221189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 221985 224021 gene locus_tag LOCUS_16800 221985 224021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 224140 229827 gene locus_tag LOCUS_16810 224140 229827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 231271 229985 gene locus_tag LOCUS_16820 231271 229985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 231937 231662 gene locus_tag LOCUS_16830 231937 231662 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868779.1 protein_id gnl|my_center|LOCUS_16830 232246 232539 gene locus_tag LOCUS_16840 232246 232539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 232565 232954 gene locus_tag LOCUS_16850 232565 232954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 233658 233008 gene locus_tag LOCUS_16860 233658 233008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 234458 233730 gene locus_tag LOCUS_16870 234458 233730 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964627.1 protein_id gnl|my_center|LOCUS_16870 234582 234812 gene locus_tag LOCUS_16880 234582 234812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 234864 235112 gene locus_tag LOCUS_16890 234864 235112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 235775 235134 gene locus_tag LOCUS_16900 235775 235134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 236088 235744 gene locus_tag LOCUS_16910 236088 235744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 236246 236500 gene locus_tag LOCUS_16920 236246 236500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 237113 236874 gene locus_tag LOCUS_16930 237113 236874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 237651 237148 gene locus_tag LOCUS_16940 237651 237148 CDS product CRISPR-associated transcriptional regulator Csa3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061223.1 protein_id gnl|my_center|LOCUS_16940 238196 238369 gene locus_tag LOCUS_16950 238196 238369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 238383 238886 gene locus_tag LOCUS_16960 238383 238886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 239035 239823 gene locus_tag LOCUS_16970 239035 239823 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764971.1 protein_id gnl|my_center|LOCUS_16970 239984 240382 gene locus_tag LOCUS_16980 239984 240382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 240661 242187 gene locus_tag LOCUS_16990 240661 242187 CDS product glycosyltransferase family 20 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877359.1 protein_id gnl|my_center|LOCUS_16990 242257 243393 gene locus_tag LOCUS_17000 242257 243393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 243841 243443 gene locus_tag LOCUS_17010 243841 243443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 244018 244251 gene locus_tag LOCUS_17020 244018 244251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 245482 244292 gene locus_tag LOCUS_17030 245482 244292 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065939.1 protein_id gnl|my_center|LOCUS_17030 247050 245503 gene locus_tag LOCUS_17040 247050 245503 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060924.1 protein_id gnl|my_center|LOCUS_17040 247386 247129 gene locus_tag LOCUS_17050 247386 247129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 249679 247397 gene locus_tag LOCUS_17060 249679 247397 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876131.1 protein_id gnl|my_center|LOCUS_17060 250719 249943 gene locus_tag LOCUS_17070 gene xth 250719 249943 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_17070 250898 251857 gene locus_tag LOCUS_17080 250898 251857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 251935 252132 gene locus_tag LOCUS_17090 251935 252132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892228.1 protein_id gnl|my_center|LOCUS_17090 253062 252172 gene locus_tag LOCUS_17100 253062 252172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 253769 253086 gene locus_tag LOCUS_17110 253769 253086 CDS product HisA/HisF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876307.1 protein_id gnl|my_center|LOCUS_17110 254135 253878 gene locus_tag LOCUS_17120 254135 253878 CDS product DUF3194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876315.1 protein_id gnl|my_center|LOCUS_17120 254497 254147 gene locus_tag LOCUS_17130 254497 254147 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876316.1 protein_id gnl|my_center|LOCUS_17130 254797 254537 gene locus_tag LOCUS_17140 254797 254537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 255180 254794 gene locus_tag LOCUS_17150 255180 254794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 255447 255316 gene locus_tag LOCUS_17160 255447 255316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 255810 255541 gene locus_tag LOCUS_17170 gene rpl37A 255810 255541 CDS product 50S ribosomal protein L37Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876320.1 protein_id gnl|my_center|LOCUS_17170 256653 255865 gene locus_tag LOCUS_17180 gene rrp42 256653 255865 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876321.1 protein_id gnl|my_center|LOCUS_17180 257365 256646 gene locus_tag LOCUS_17190 gene rrp41 257365 256646 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876322.1 protein_id gnl|my_center|LOCUS_17190 258103 257372 gene locus_tag LOCUS_17200 258103 257372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 258840 258148 gene locus_tag LOCUS_17210 258840 258148 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876324.1 protein_id gnl|my_center|LOCUS_17210 259615 258845 gene locus_tag LOCUS_17220 gene psmA 259615 258845 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876325.1 protein_id gnl|my_center|LOCUS_17220 260136 259756 gene locus_tag LOCUS_17230 260136 259756 CDS product Rpp14/Pop5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876326.1 protein_id gnl|my_center|LOCUS_17230 260824 260138 gene locus_tag LOCUS_17240 260824 260138 CDS product ribonuclease P protein component 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876327.1 protein_id gnl|my_center|LOCUS_17240 261249 260827 gene locus_tag LOCUS_17250 261249 260827 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061237.1 protein_id gnl|my_center|LOCUS_17250 261836 261291 gene locus_tag LOCUS_17260 261836 261291 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750468.1 protein_id gnl|my_center|LOCUS_17260 262274 262062 gene locus_tag LOCUS_17270 262274 262062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 262789 262466 gene locus_tag LOCUS_17280 262789 262466 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060879.1 protein_id gnl|my_center|LOCUS_17280 263951 262908 gene locus_tag LOCUS_17290 263951 262908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 266669 264012 gene locus_tag LOCUS_17300 266669 264012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 268130 266907 gene locus_tag LOCUS_17310 268130 266907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 271178 268224 gene locus_tag LOCUS_17320 271178 268224 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022738.1 protein_id gnl|my_center|LOCUS_17320 271943 271485 gene locus_tag LOCUS_17330 gene ribC 271943 271485 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061180.1 protein_id gnl|my_center|LOCUS_17330 272816 271977 gene locus_tag LOCUS_17340 272816 271977 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060749.1 protein_id gnl|my_center|LOCUS_17340 273742 272954 gene locus_tag LOCUS_17350 gene cbiQ 273742 272954 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060748.1 protein_id gnl|my_center|LOCUS_17350 274114 273779 gene locus_tag LOCUS_17360 274114 273779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 274800 274114 gene locus_tag LOCUS_17370 gene cbiM 274800 274114 CDS product cobalt ECF transporter S component CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875769.1 protein_id gnl|my_center|LOCUS_17370 274944 275594 gene locus_tag LOCUS_17380 gene pyrF 274944 275594 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060747.1 protein_id gnl|my_center|LOCUS_17380 276188 275595 gene locus_tag LOCUS_17390 276188 275595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875767.1 protein_id gnl|my_center|LOCUS_17390 277192 276287 gene locus_tag LOCUS_17400 277192 276287 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060746.1 protein_id gnl|my_center|LOCUS_17400 278182 277301 gene locus_tag LOCUS_17410 278182 277301 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060745.1 protein_id gnl|my_center|LOCUS_17410 279042 278398 gene locus_tag LOCUS_17420 279042 278398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 279503 279156 gene locus_tag LOCUS_17430 279503 279156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 279663 280499 gene locus_tag LOCUS_17440 279663 280499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 280504 281001 gene locus_tag LOCUS_17450 280504 281001 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876564.1 protein_id gnl|my_center|LOCUS_17450 281039 281572 gene locus_tag LOCUS_17460 281039 281572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 281827 282579 gene locus_tag LOCUS_17470 gene nucS 281827 282579 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061145.1 protein_id gnl|my_center|LOCUS_17470 282901 282710 gene locus_tag LOCUS_17480 282901 282710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 283301 283113 gene locus_tag LOCUS_17490 283301 283113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060744.1 protein_id gnl|my_center|LOCUS_17490 283795 283559 gene locus_tag LOCUS_17500 283795 283559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 284403 284050 gene locus_tag LOCUS_17510 284403 284050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 284668 285057 gene locus_tag LOCUS_17520 284668 285057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 285235 285459 gene locus_tag LOCUS_17530 285235 285459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 286179 285589 gene locus_tag LOCUS_17540 286179 285589 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_17540 286382 287536 gene locus_tag LOCUS_17550 286382 287536 CDS product TIGR04083 family peptide-modifying radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023249.1 protein_id gnl|my_center|LOCUS_17550 288207 287629 gene locus_tag LOCUS_17560 288207 287629 CDS product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948539.1 protein_id gnl|my_center|LOCUS_17560 288392 288562 gene locus_tag LOCUS_17570 288392 288562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 288998 289141 gene locus_tag LOCUS_17580 288998 289141 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061197.1 protein_id gnl|my_center|LOCUS_17580 289158 290342 gene locus_tag LOCUS_17590 289158 290342 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061196.1 protein_id gnl|my_center|LOCUS_17590 291199 290402 gene locus_tag LOCUS_17600 291199 290402 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875914.1 protein_id gnl|my_center|LOCUS_17600 292032 291286 gene locus_tag LOCUS_17610 292032 291286 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892471.1 protein_id gnl|my_center|LOCUS_17610 292178 293677 gene locus_tag LOCUS_17620 292178 293677 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877273.1 protein_id gnl|my_center|LOCUS_17620 294011 298810 gene locus_tag LOCUS_17630 294011 298810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 298969 299880 gene locus_tag LOCUS_17640 298969 299880 CDS product DUF5591 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061115.1 protein_id gnl|my_center|LOCUS_17640 300066 300359 gene locus_tag LOCUS_17650 300066 300359 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061319.1 protein_id gnl|my_center|LOCUS_17650 300389 300946 gene locus_tag LOCUS_17660 300389 300946 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877270.1 protein_id gnl|my_center|LOCUS_17660 301072 301144 gene locus_tag LOCUS_t00250 301072 301144 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 302381 301323 gene locus_tag LOCUS_17670 gene trpD 302381 301323 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877269.1 protein_id gnl|my_center|LOCUS_17670 303205 302396 gene locus_tag LOCUS_17680 gene trpA 303205 302396 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750470.1 protein_id gnl|my_center|LOCUS_17680 304374 303202 gene locus_tag LOCUS_17690 gene trpB 304374 303202 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877267.1 protein_id gnl|my_center|LOCUS_17690 305024 304371 gene locus_tag LOCUS_17700 305024 304371 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877266.1 protein_id gnl|my_center|LOCUS_17700 305817 305014 gene locus_tag LOCUS_17710 305817 305014 CDS product indole-3-glycerol-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877265.1 protein_id gnl|my_center|LOCUS_17710 306389 305814 gene locus_tag LOCUS_17720 306389 305814 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877264.1 protein_id gnl|my_center|LOCUS_17720 306634 306392 gene locus_tag LOCUS_17730 306634 306392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 307979 306594 gene locus_tag LOCUS_17740 gene trpE 307979 306594 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877263.1 protein_id gnl|my_center|LOCUS_17740 308155 308658 gene locus_tag LOCUS_17750 308155 308658 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061113.1 protein_id gnl|my_center|LOCUS_17750 309314 309078 gene locus_tag LOCUS_17760 309314 309078 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877257.1 protein_id gnl|my_center|LOCUS_17760 309456 310745 gene locus_tag LOCUS_17770 309456 310745 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892604.1 protein_id gnl|my_center|LOCUS_17770 310992 310831 gene locus_tag LOCUS_17780 310992 310831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 311149 311511 gene locus_tag LOCUS_17790 311149 311511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 312607 311567 gene locus_tag LOCUS_17800 312607 311567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 313532 312735 gene locus_tag LOCUS_17810 313532 312735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 314111 313569 gene locus_tag LOCUS_17820 314111 313569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 314574 314413 gene locus_tag LOCUS_17830 314574 314413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 314561 315289 gene locus_tag LOCUS_17840 314561 315289 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966543.1 protein_id gnl|my_center|LOCUS_17840 315286 316422 gene locus_tag LOCUS_17850 315286 316422 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733783.1 protein_id gnl|my_center|LOCUS_17850 316475 316639 gene locus_tag LOCUS_17860 316475 316639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 318326 316758 gene locus_tag LOCUS_17870 318326 316758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 319360 318542 gene locus_tag LOCUS_17880 319360 318542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877252.1 protein_id gnl|my_center|LOCUS_17880 319299 319544 gene locus_tag LOCUS_17890 319299 319544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 320128 319514 gene locus_tag LOCUS_17900 320128 319514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 320976 320326 gene locus_tag LOCUS_17910 320976 320326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 322119 321058 gene locus_tag LOCUS_17920 322119 321058 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061107.1 protein_id gnl|my_center|LOCUS_17920 322386 322706 gene locus_tag LOCUS_17930 322386 322706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 322949 324253 gene locus_tag LOCUS_17940 322949 324253 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877248.1 protein_id gnl|my_center|LOCUS_17940 324525 326711 gene locus_tag LOCUS_17950 324525 326711 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061106.1 protein_id gnl|my_center|LOCUS_17950 327309 326854 gene locus_tag LOCUS_17960 327309 326854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 327670 328920 gene locus_tag LOCUS_17970 gene ahcY 327670 328920 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877244.1 protein_id gnl|my_center|LOCUS_17970 328984 329595 gene locus_tag LOCUS_17980 328984 329595 CDS product DUF2119 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061105.1 protein_id gnl|my_center|LOCUS_17980 331304 329622 gene locus_tag LOCUS_17990 331304 329622 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086257.1 protein_id gnl|my_center|LOCUS_17990 331719 331549 gene locus_tag LOCUS_18000 331719 331549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 332555 331752 gene locus_tag LOCUS_18010 332555 331752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 332863 332624 gene locus_tag LOCUS_18020 332863 332624 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877461.1 protein_id gnl|my_center|LOCUS_18020 333246 333085 gene locus_tag LOCUS_18030 333246 333085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 333523 333377 gene locus_tag LOCUS_18040 333523 333377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 334852 333878 gene locus_tag LOCUS_18050 gene mer 334852 333878 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877358.1 protein_id gnl|my_center|LOCUS_18050 335521 335099 gene locus_tag LOCUS_18060 335521 335099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 335845 336276 gene locus_tag LOCUS_18070 335845 336276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 336660 336388 gene locus_tag LOCUS_18080 gene albA 336660 336388 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061063.1 protein_id gnl|my_center|LOCUS_18080 337134 336832 gene locus_tag LOCUS_18090 337134 336832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 339283 337340 gene locus_tag LOCUS_18100 339283 337340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 339697 339284 gene locus_tag LOCUS_18110 339697 339284 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883308.1 protein_id gnl|my_center|LOCUS_18110 340098 339802 gene locus_tag LOCUS_18120 340098 339802 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809935.1 protein_id gnl|my_center|LOCUS_18120 341904 340162 gene locus_tag LOCUS_18130 341904 340162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 349773 341914 gene locus_tag LOCUS_18140 349773 341914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 350455 349790 gene locus_tag LOCUS_18150 350455 349790 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964638.1 protein_id gnl|my_center|LOCUS_18150 350703 351479 gene locus_tag LOCUS_18160 350703 351479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 351720 353132 gene locus_tag LOCUS_18170 351720 353132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 353604 353146 gene locus_tag LOCUS_18180 353604 353146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 355220 353874 gene locus_tag LOCUS_18190 355220 353874 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225752.1 protein_id gnl|my_center|LOCUS_18190 356110 355610 gene locus_tag LOCUS_18200 356110 355610 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485739.1 protein_id gnl|my_center|LOCUS_18200 356490 357122 gene locus_tag LOCUS_18210 356490 357122 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864829.1 protein_id gnl|my_center|LOCUS_18210 357230 358090 gene locus_tag LOCUS_18220 357230 358090 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064910.1 protein_id gnl|my_center|LOCUS_18220 358399 359370 gene locus_tag LOCUS_18230 358399 359370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 359590 360099 gene locus_tag LOCUS_18240 359590 360099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 360138 360539 gene locus_tag LOCUS_18250 360138 360539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 361606 360590 gene locus_tag LOCUS_18260 gene fen 361606 360590 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877241.1 protein_id gnl|my_center|LOCUS_18260 362196 361657 gene locus_tag LOCUS_18270 362196 361657 CDS product chorismate pyruvate-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877240.1 protein_id gnl|my_center|LOCUS_18270 363499 362252 gene locus_tag LOCUS_18280 gene hacA 363499 362252 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061104.1 protein_id gnl|my_center|LOCUS_18280 364723 363548 gene locus_tag LOCUS_18290 364723 363548 CDS product homocitrate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877238.1 protein_id gnl|my_center|LOCUS_18290 365604 365056 gene locus_tag LOCUS_18300 gene cyaB 365604 365056 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877237.1 protein_id gnl|my_center|LOCUS_18300 366082 365687 gene locus_tag LOCUS_18310 366082 365687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877236.1 protein_id gnl|my_center|LOCUS_18310 366413 366958 gene locus_tag LOCUS_18320 366413 366958 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877235.1 protein_id gnl|my_center|LOCUS_18320 366991 368484 gene locus_tag LOCUS_18330 gene serB 366991 368484 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061103.1 protein_id gnl|my_center|LOCUS_18330 369445 368609 gene locus_tag LOCUS_18340 369445 368609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 370023 369532 gene locus_tag LOCUS_18350 370023 369532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 370765 370016 gene locus_tag LOCUS_18360 370765 370016 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876232.1 protein_id gnl|my_center|LOCUS_18360 371484 370765 gene locus_tag LOCUS_18370 371484 370765 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876232.1 protein_id gnl|my_center|LOCUS_18370 372663 371485 gene locus_tag LOCUS_18380 372663 371485 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060852.1 protein_id gnl|my_center|LOCUS_18380 373044 372667 gene locus_tag LOCUS_18390 373044 372667 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060853.1 protein_id gnl|my_center|LOCUS_18390 373281 373054 gene locus_tag LOCUS_18400 373281 373054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 373826 373602 gene locus_tag LOCUS_18410 373826 373602 CDS product pseudomurein-binding repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060751.1 protein_id gnl|my_center|LOCUS_18410 374685 373903 gene locus_tag LOCUS_18420 374685 373903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875784.1 protein_id gnl|my_center|LOCUS_18420 375281 374712 gene locus_tag LOCUS_18430 gene cbiT 375281 374712 CDS product precorrin-6Y C5,15-methyltransferase (decarboxylating) subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875785.1 protein_id gnl|my_center|LOCUS_18430 375857 375297 gene locus_tag LOCUS_18440 375857 375297 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060752.1 protein_id gnl|my_center|LOCUS_18440 377092 375908 gene locus_tag LOCUS_18450 377092 375908 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875787.1 protein_id gnl|my_center|LOCUS_18450 377573 377130 gene locus_tag LOCUS_18460 377573 377130 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875788.1 protein_id gnl|my_center|LOCUS_18460 378147 377617 gene locus_tag LOCUS_18470 378147 377617 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060754.1 protein_id gnl|my_center|LOCUS_18470 378445 380151 gene locus_tag LOCUS_18480 378445 380151 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060755.1 protein_id gnl|my_center|LOCUS_18480 380223 380774 gene locus_tag LOCUS_18490 380223 380774 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892795.1 protein_id gnl|my_center|LOCUS_18490 380802 381197 gene locus_tag LOCUS_18500 380802 381197 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875792.1 protein_id gnl|my_center|LOCUS_18500 381353 381712 gene locus_tag LOCUS_18510 381353 381712 CDS product pyrimidine dimer DNA glycosylase/endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582775.1 protein_id gnl|my_center|LOCUS_18510 381843 382007 gene locus_tag LOCUS_18520 381843 382007 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013295425.1 protein_id gnl|my_center|LOCUS_18520 382094 382255 gene locus_tag LOCUS_18530 382094 382255 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875795.1 protein_id gnl|my_center|LOCUS_18530 382258 383442 gene locus_tag LOCUS_18540 382258 383442 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584117.1 protein_id gnl|my_center|LOCUS_18540 383475 383987 gene locus_tag LOCUS_18550 383475 383987 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875797.1 protein_id gnl|my_center|LOCUS_18550 384046 384795 gene locus_tag LOCUS_18560 384046 384795 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582946.1 protein_id gnl|my_center|LOCUS_18560 384851 385231 gene locus_tag LOCUS_18570 384851 385231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18570 385280 385471 gene locus_tag LOCUS_18580 385280 385471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18580 385631 386929 gene locus_tag LOCUS_18590 385631 386929 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877457.1 protein_id gnl|my_center|LOCUS_18590 386966 387397 gene locus_tag LOCUS_18600 386966 387397 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877456.1 protein_id gnl|my_center|LOCUS_18600 387550 388704 gene locus_tag LOCUS_18610 387550 388704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 389585 388809 gene locus_tag LOCUS_18620 389585 388809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 390353 389607 gene locus_tag LOCUS_18630 gene thiD 390353 389607 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876253.1 protein_id gnl|my_center|LOCUS_18630 391030 390350 gene locus_tag LOCUS_18640 gene cofC 391030 390350 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876252.1 protein_id gnl|my_center|LOCUS_18640 391802 391110 gene locus_tag LOCUS_18650 391802 391110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 393233 391824 gene locus_tag LOCUS_18660 gene proS 393233 391824 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060857.1 protein_id gnl|my_center|LOCUS_18660 393825 393655 gene locus_tag LOCUS_18670 393825 393655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 394271 395314 gene locus_tag LOCUS_18680 394271 395314 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876249.1 protein_id gnl|my_center|LOCUS_18680 395484 395915 gene locus_tag LOCUS_18690 395484 395915 CDS product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876248.1 protein_id gnl|my_center|LOCUS_18690 395985 396659 gene locus_tag LOCUS_18700 gene rpiA 395985 396659 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060856.1 protein_id gnl|my_center|LOCUS_18700 398022 396682 gene locus_tag LOCUS_18710 398022 396682 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060774.1 protein_id gnl|my_center|LOCUS_18710 398487 398149 gene locus_tag LOCUS_18720 398487 398149 CDS product UPF0058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875863.1 protein_id gnl|my_center|LOCUS_18720 >Feature sequence04 25 1515 gene locus_tag LOCUS_18730 25 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 1527 2243 gene locus_tag LOCUS_18740 1527 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 2276 2527 gene locus_tag LOCUS_18750 2276 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 2934 5471 gene locus_tag LOCUS_18760 2934 5471 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060943.1 protein_id gnl|my_center|LOCUS_18760 5468 6247 gene locus_tag LOCUS_18770 gene cobK 5468 6247 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876633.1 protein_id gnl|my_center|LOCUS_18770 6417 7166 gene locus_tag LOCUS_18780 6417 7166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839849.1 protein_id gnl|my_center|LOCUS_18780 7230 7700 gene locus_tag LOCUS_18790 7230 7700 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060912.1 protein_id gnl|my_center|LOCUS_18790 7863 8663 gene locus_tag LOCUS_18800 7863 8663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 9896 8679 gene locus_tag LOCUS_18810 9896 8679 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060944.1 protein_id gnl|my_center|LOCUS_18810 10447 10677 gene locus_tag LOCUS_18820 10447 10677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18820 10796 11572 gene locus_tag LOCUS_18830 10796 11572 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060945.1 protein_id gnl|my_center|LOCUS_18830 11614 12180 gene locus_tag LOCUS_18840 11614 12180 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060946.1 protein_id gnl|my_center|LOCUS_18840 12265 13866 gene locus_tag LOCUS_18850 gene top6B 12265 13866 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876638.1 protein_id gnl|my_center|LOCUS_18850 13856 14911 gene locus_tag LOCUS_18860 13856 14911 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876639.1 protein_id gnl|my_center|LOCUS_18860 15073 16002 gene locus_tag LOCUS_18870 gene moaA 15073 16002 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061083.1 protein_id gnl|my_center|LOCUS_18870 16137 16673 gene locus_tag LOCUS_18880 gene hxlB 16137 16673 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061311.1 protein_id gnl|my_center|LOCUS_18880 16670 17686 gene locus_tag LOCUS_18890 16670 17686 CDS product phosphorylating glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876640.1 protein_id gnl|my_center|LOCUS_18890 17887 18765 gene locus_tag LOCUS_18900 17887 18765 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986782.1 protein_id gnl|my_center|LOCUS_18900 18767 20464 gene locus_tag LOCUS_18910 18767 20464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 20544 22112 gene locus_tag LOCUS_18920 20544 22112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 22137 22772 gene locus_tag LOCUS_18930 22137 22772 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_18930 22833 23768 gene locus_tag LOCUS_18940 22833 23768 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259445.1 protein_id gnl|my_center|LOCUS_18940 23783 24910 gene locus_tag LOCUS_18950 23783 24910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 25103 25423 gene locus_tag LOCUS_18960 25103 25423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 25420 25788 gene locus_tag LOCUS_18970 25420 25788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272171.1 protein_id gnl|my_center|LOCUS_18970 25840 26598 gene locus_tag LOCUS_18980 25840 26598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 26627 27613 gene locus_tag LOCUS_18990 26627 27613 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079210.1 protein_id gnl|my_center|LOCUS_18990 27672 28523 gene locus_tag LOCUS_19000 27672 28523 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060947.1 protein_id gnl|my_center|LOCUS_19000 28772 29893 gene locus_tag LOCUS_19010 28772 29893 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060948.1 protein_id gnl|my_center|LOCUS_19010 29962 30729 gene locus_tag LOCUS_19020 29962 30729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 30882 31832 gene locus_tag LOCUS_19030 30882 31832 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358342.1 protein_id gnl|my_center|LOCUS_19030 31810 31947 gene locus_tag LOCUS_19040 31810 31947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 32104 33249 gene locus_tag LOCUS_19050 gene thiI 32104 33249 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877292.1 protein_id gnl|my_center|LOCUS_19050 33418 34239 gene locus_tag LOCUS_19060 33418 34239 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903946.1 protein_id gnl|my_center|LOCUS_19060 34320 34757 gene locus_tag LOCUS_19070 34320 34757 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943409.1 protein_id gnl|my_center|LOCUS_19070 35192 34779 gene locus_tag LOCUS_19080 gene nifU 35192 34779 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877697.1 protein_id gnl|my_center|LOCUS_19080 36402 35230 gene locus_tag LOCUS_19090 gene nifS 36402 35230 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_19090 37942 36473 gene locus_tag LOCUS_19100 37942 36473 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990604.1 protein_id gnl|my_center|LOCUS_19100 39324 38017 gene locus_tag LOCUS_19110 39324 38017 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022675.1 protein_id gnl|my_center|LOCUS_19110 39682 39752 gene locus_tag LOCUS_t00260 39682 39752 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 39976 41355 gene locus_tag LOCUS_19120 gene cysS 39976 41355 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868520.1 protein_id gnl|my_center|LOCUS_19120 41760 41365 gene locus_tag LOCUS_19130 41760 41365 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990605.1 protein_id gnl|my_center|LOCUS_19130 42728 42015 gene locus_tag LOCUS_19140 gene cysE 42728 42015 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476494.1 protein_id gnl|my_center|LOCUS_19140 43804 42815 gene locus_tag LOCUS_19150 gene cysK 43804 42815 CDS product O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899275.1 protein_id gnl|my_center|LOCUS_19150 44352 44002 gene locus_tag LOCUS_19160 44352 44002 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022881.1 protein_id gnl|my_center|LOCUS_19160 44483 44704 gene locus_tag LOCUS_19170 44483 44704 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020854.1 protein_id gnl|my_center|LOCUS_19170 44714 45133 gene locus_tag LOCUS_19180 44714 45133 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020853.1 protein_id gnl|my_center|LOCUS_19180 45145 46311 gene locus_tag LOCUS_19190 45145 46311 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020852.1 protein_id gnl|my_center|LOCUS_19190 46776 46378 gene locus_tag LOCUS_19200 46776 46378 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876052.1 protein_id gnl|my_center|LOCUS_19200 46991 47266 gene locus_tag LOCUS_19210 46991 47266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 47337 48236 gene locus_tag LOCUS_19220 47337 48236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 50676 48301 gene locus_tag LOCUS_19230 50676 48301 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065616.1 protein_id gnl|my_center|LOCUS_19230 51804 50857 gene locus_tag LOCUS_19240 51804 50857 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023064.1 protein_id gnl|my_center|LOCUS_19240 52390 51785 gene locus_tag LOCUS_19250 52390 51785 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023065.1 protein_id gnl|my_center|LOCUS_19250 53537 52521 gene locus_tag LOCUS_19260 53537 52521 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158098.1 protein_id gnl|my_center|LOCUS_19260 54928 53594 gene locus_tag LOCUS_19270 54928 53594 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876486.1 protein_id gnl|my_center|LOCUS_19270 55094 55702 gene locus_tag LOCUS_19280 55094 55702 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875693.1 protein_id gnl|my_center|LOCUS_19280 56514 55711 gene locus_tag LOCUS_19290 56514 55711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 57757 56555 gene locus_tag LOCUS_19300 gene hemA 57757 56555 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060949.1 protein_id gnl|my_center|LOCUS_19300 58410 57796 gene locus_tag LOCUS_19310 58410 57796 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060950.1 protein_id gnl|my_center|LOCUS_19310 58912 58436 gene locus_tag LOCUS_19320 58912 58436 CDS product methanogenesis marker 9 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876645.1 protein_id gnl|my_center|LOCUS_19320 60822 59227 gene locus_tag LOCUS_19330 gene atwA 60822 59227 CDS product methyl coenzyme M reductase system, component A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060951.1 protein_id gnl|my_center|LOCUS_19330 61636 60899 gene locus_tag LOCUS_19340 61636 60899 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876647.1 protein_id gnl|my_center|LOCUS_19340 62465 61710 gene locus_tag LOCUS_19350 62465 61710 CDS product GTP cyclohydrolase IIa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876648.1 protein_id gnl|my_center|LOCUS_19350 63367 62462 gene locus_tag LOCUS_19360 gene cofD 63367 62462 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060952.1 protein_id gnl|my_center|LOCUS_19360 64199 63438 gene locus_tag LOCUS_19370 gene cofE 64199 63438 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 protein_id gnl|my_center|LOCUS_19370 64826 64224 gene locus_tag LOCUS_19380 gene purO 64826 64224 CDS product IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876651.1 protein_id gnl|my_center|LOCUS_19380 65252 64854 gene locus_tag LOCUS_19390 65252 64854 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876652.1 protein_id gnl|my_center|LOCUS_19390 66135 65296 gene locus_tag LOCUS_19400 66135 65296 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876653.1 protein_id gnl|my_center|LOCUS_19400 66839 66228 gene locus_tag LOCUS_19410 gene rnhB 66839 66228 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876654.1 protein_id gnl|my_center|LOCUS_19410 67975 66902 gene locus_tag LOCUS_19420 67975 66902 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876655.1 protein_id gnl|my_center|LOCUS_19420 68606 67977 gene locus_tag LOCUS_19430 68606 67977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876656.1 protein_id gnl|my_center|LOCUS_19430 69056 69733 gene locus_tag LOCUS_19440 69056 69733 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933279.1 protein_id gnl|my_center|LOCUS_19440 70036 70659 gene locus_tag LOCUS_19450 70036 70659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 70649 71962 gene locus_tag LOCUS_19460 70649 71962 CDS product DUF515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876659.1 protein_id gnl|my_center|LOCUS_19460 72007 72963 gene locus_tag LOCUS_19470 72007 72963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060954.1 protein_id gnl|my_center|LOCUS_19470 72998 73729 gene locus_tag LOCUS_19480 72998 73729 CDS product sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876661.1 protein_id gnl|my_center|LOCUS_19480 73788 74156 gene locus_tag LOCUS_19490 73788 74156 CDS product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060955.1 protein_id gnl|my_center|LOCUS_19490 74329 74535 gene locus_tag LOCUS_19500 74329 74535 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869641.1 protein_id gnl|my_center|LOCUS_19500 74558 75694 gene locus_tag LOCUS_19510 74558 75694 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191216118.1 protein_id gnl|my_center|LOCUS_19510 75731 76603 gene locus_tag LOCUS_19520 gene korB 75731 76603 CDS product 2-oxoglutarate synthase subunit KorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876665.1 protein_id gnl|my_center|LOCUS_19520 76634 77188 gene locus_tag LOCUS_19530 76634 77188 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060957.1 protein_id gnl|my_center|LOCUS_19530 77193 78296 gene locus_tag LOCUS_19540 gene sucC 77193 78296 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876667.1 protein_id gnl|my_center|LOCUS_19540 79313 78297 gene locus_tag LOCUS_19550 79313 78297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 79876 79439 gene locus_tag LOCUS_19560 79876 79439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 80172 80981 gene locus_tag LOCUS_19570 80172 80981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 82072 81047 gene locus_tag LOCUS_19580 82072 81047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876668.1 protein_id gnl|my_center|LOCUS_19580 83156 82290 gene locus_tag LOCUS_19590 83156 82290 CDS product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060958.1 protein_id gnl|my_center|LOCUS_19590 84181 83267 gene locus_tag LOCUS_19600 gene twy1 84181 83267 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061270.1 protein_id gnl|my_center|LOCUS_19600 84670 85356 gene locus_tag LOCUS_19610 84670 85356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 85568 86248 gene locus_tag LOCUS_19620 gene tpiA 85568 86248 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876672.1 protein_id gnl|my_center|LOCUS_19620 86261 87490 gene locus_tag LOCUS_19630 gene pgk 86261 87490 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061271.1 protein_id gnl|my_center|LOCUS_19630 87686 87698 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 87699 87775 gene locus_tag LOCUS_t00270 87699 87775 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 87817 87890 gene locus_tag LOCUS_t00280 87817 87890 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 88009 88082 gene locus_tag LOCUS_t00290 88009 88082 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 88091 88164 gene locus_tag LOCUS_t00300 88091 88164 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 88386 88619 gene locus_tag LOCUS_19640 88386 88619 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876674.1 protein_id gnl|my_center|LOCUS_19640 88643 90136 gene locus_tag LOCUS_19650 88643 90136 CDS product DNA-directed RNA polymerase subunit B'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060959.1 protein_id gnl|my_center|LOCUS_19650 90149 91963 gene locus_tag LOCUS_19660 gene rpoB 90149 91963 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876676.1 protein_id gnl|my_center|LOCUS_19660 92013 94625 gene locus_tag LOCUS_19670 gene rpoA1 92013 94625 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876677.1 protein_id gnl|my_center|LOCUS_19670 94653 95798 gene locus_tag LOCUS_19680 gene rpoA2 94653 95798 CDS product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876678.1 protein_id gnl|my_center|LOCUS_19680 95849 96145 gene locus_tag LOCUS_19690 95849 96145 CDS product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876679.1 protein_id gnl|my_center|LOCUS_19690 96151 96582 gene locus_tag LOCUS_19700 96151 96582 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876680.1 protein_id gnl|my_center|LOCUS_19700 96668 97093 gene locus_tag LOCUS_19710 96668 97093 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876681.1 protein_id gnl|my_center|LOCUS_19710 97159 97719 gene locus_tag LOCUS_19720 gene rpsG 97159 97719 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876682.1 protein_id gnl|my_center|LOCUS_19720 97844 100036 gene locus_tag LOCUS_19730 97844 100036 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060960.1 protein_id gnl|my_center|LOCUS_19730 100199 101440 gene locus_tag LOCUS_19740 gene tuf 100199 101440 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876684.1 protein_id gnl|my_center|LOCUS_19740 101493 101801 gene locus_tag LOCUS_19750 gene rpsJ 101493 101801 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876685.1 protein_id gnl|my_center|LOCUS_19750 101934 102020 gene locus_tag LOCUS_t00310 101934 102020 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 102387 103076 gene locus_tag LOCUS_19760 102387 103076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 103129 103596 gene locus_tag LOCUS_19770 103129 103596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 104286 103666 gene locus_tag LOCUS_19780 104286 103666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 104609 105010 gene locus_tag LOCUS_19790 104609 105010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 106439 105180 gene locus_tag LOCUS_19800 106439 105180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 108907 106508 gene locus_tag LOCUS_19810 108907 106508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 109790 108918 gene locus_tag LOCUS_19820 109790 108918 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921011.1 protein_id gnl|my_center|LOCUS_19820 110604 109810 gene locus_tag LOCUS_19830 110604 109810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 111506 110826 gene locus_tag LOCUS_19840 111506 110826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 111880 112044 gene locus_tag LOCUS_19850 111880 112044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 112404 112255 gene locus_tag LOCUS_19860 112404 112255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 112531 112914 gene locus_tag LOCUS_19870 112531 112914 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021357.1 protein_id gnl|my_center|LOCUS_19870 113084 113302 gene locus_tag LOCUS_19880 113084 113302 CDS product TIGR04165 family Cys-rich peptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875760.1 protein_id gnl|my_center|LOCUS_19880 113895 113476 gene locus_tag LOCUS_19890 113895 113476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 115152 114295 gene locus_tag LOCUS_19900 115152 114295 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229423.1 protein_id gnl|my_center|LOCUS_19900 115464 116852 gene locus_tag LOCUS_19910 115464 116852 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485723.1 protein_id gnl|my_center|LOCUS_19910 116970 116842 gene locus_tag LOCUS_19920 116970 116842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 117713 117021 gene locus_tag LOCUS_19930 117713 117021 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279101.1 protein_id gnl|my_center|LOCUS_19930 118487 117792 gene locus_tag LOCUS_19940 118487 117792 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279101.1 protein_id gnl|my_center|LOCUS_19940 118889 118695 gene locus_tag LOCUS_19950 118889 118695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 119501 119061 gene locus_tag LOCUS_19960 119501 119061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 122035 119579 gene locus_tag LOCUS_19970 122035 119579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 122189 122007 gene locus_tag LOCUS_19980 122189 122007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 122562 123095 gene locus_tag LOCUS_19990 122562 123095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 123137 124372 gene locus_tag LOCUS_20000 123137 124372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 124563 125054 gene locus_tag LOCUS_20010 124563 125054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 126016 125849 gene locus_tag LOCUS_20020 126016 125849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 126448 126615 gene locus_tag LOCUS_20030 126448 126615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 126891 126709 gene locus_tag LOCUS_20040 126891 126709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20040 127195 126866 gene locus_tag LOCUS_20050 127195 126866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20050 128172 127354 gene locus_tag LOCUS_20060 128172 127354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 128544 130013 gene locus_tag LOCUS_20070 128544 130013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 130058 130393 gene locus_tag LOCUS_20080 130058 130393 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404111.1 protein_id gnl|my_center|LOCUS_20080 130409 132130 gene locus_tag LOCUS_20090 130409 132130 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061055.1 protein_id gnl|my_center|LOCUS_20090 132181 133533 gene locus_tag LOCUS_20100 132181 133533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 133586 134017 gene locus_tag LOCUS_20110 133586 134017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 134073 135374 gene locus_tag LOCUS_20120 gene ripA 134073 135374 CDS product itaconate CoA-transferase RipA/Ict inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212070.1 protein_id gnl|my_center|LOCUS_20120 136910 135702 gene locus_tag LOCUS_20130 136910 135702 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975556.1 protein_id gnl|my_center|LOCUS_20130 137156 137536 gene locus_tag LOCUS_20140 137156 137536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 137831 137625 gene locus_tag LOCUS_20150 137831 137625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876238.1 protein_id gnl|my_center|LOCUS_20150 138494 138039 gene locus_tag LOCUS_20160 138494 138039 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061149.1 protein_id gnl|my_center|LOCUS_20160 138993 144089 gene locus_tag LOCUS_20170 138993 144089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 144422 147889 gene locus_tag LOCUS_20180 144422 147889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 148710 150005 gene locus_tag LOCUS_20190 148710 150005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 150077 151444 gene locus_tag LOCUS_20200 150077 151444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 151654 152154 gene locus_tag LOCUS_20210 151654 152154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 152547 152215 gene locus_tag LOCUS_20220 152547 152215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 153183 152710 gene locus_tag LOCUS_20230 153183 152710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 153754 153476 gene locus_tag LOCUS_20240 153754 153476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 154307 153873 gene locus_tag LOCUS_20250 154307 153873 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461316.1 protein_id gnl|my_center|LOCUS_20250 154397 155473 gene locus_tag LOCUS_20260 154397 155473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 155564 155719 gene locus_tag LOCUS_20270 155564 155719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 156228 155800 gene locus_tag LOCUS_20280 156228 155800 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020496.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20280 156944 157159 gene locus_tag LOCUS_20290 156944 157159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20290 157203 157847 gene locus_tag LOCUS_20300 157203 157847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 157887 158585 gene locus_tag LOCUS_20310 157887 158585 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022003.1 protein_id gnl|my_center|LOCUS_20310 158638 159303 gene locus_tag LOCUS_20320 158638 159303 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762040.1 protein_id gnl|my_center|LOCUS_20320 159669 159448 gene locus_tag LOCUS_20330 159669 159448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 162047 160377 gene locus_tag LOCUS_20340 162047 160377 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886094.1 protein_id gnl|my_center|LOCUS_20340 162338 163039 gene locus_tag LOCUS_20350 162338 163039 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020206.1 protein_id gnl|my_center|LOCUS_20350 163358 163065 gene locus_tag LOCUS_20360 163358 163065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 164254 163568 gene locus_tag LOCUS_20370 164254 163568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 164351 164617 gene locus_tag LOCUS_20380 164351 164617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 164916 164638 gene locus_tag LOCUS_20390 164916 164638 CDS product ATP cone domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876119.1 protein_id gnl|my_center|LOCUS_20390 165966 164950 gene locus_tag LOCUS_20400 165966 164950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 166686 167162 gene locus_tag LOCUS_20410 166686 167162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 167212 167700 gene locus_tag LOCUS_20420 167212 167700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 167758 169071 gene locus_tag LOCUS_20430 167758 169071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 170463 169222 gene locus_tag LOCUS_20440 170463 169222 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020474.1 protein_id gnl|my_center|LOCUS_20440 171699 170473 gene locus_tag LOCUS_20450 171699 170473 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022271.1 protein_id gnl|my_center|LOCUS_20450 172329 171769 gene locus_tag LOCUS_20460 172329 171769 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020425.1 protein_id gnl|my_center|LOCUS_20460 173741 172440 gene locus_tag LOCUS_20470 173741 172440 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680701.1 protein_id gnl|my_center|LOCUS_20470 173856 174284 gene locus_tag LOCUS_20480 173856 174284 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964774.1 protein_id gnl|my_center|LOCUS_20480 174452 174946 gene locus_tag LOCUS_20490 174452 174946 CDS product TIGR00288 family NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877509.1 protein_id gnl|my_center|LOCUS_20490 175235 175498 gene locus_tag LOCUS_20500 175235 175498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 175745 175897 gene locus_tag LOCUS_20510 175745 175897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 176344 177267 gene locus_tag LOCUS_20520 176344 177267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 177439 177900 gene locus_tag LOCUS_20530 177439 177900 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060861.1 protein_id gnl|my_center|LOCUS_20530 177992 178456 gene locus_tag LOCUS_20540 177992 178456 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060861.1 protein_id gnl|my_center|LOCUS_20540 178552 179427 gene locus_tag LOCUS_20550 178552 179427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 179476 180456 gene locus_tag LOCUS_20560 179476 180456 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_20560 180484 180942 gene locus_tag LOCUS_20570 180484 180942 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228335.1 protein_id gnl|my_center|LOCUS_20570 182148 181009 gene locus_tag LOCUS_20580 gene pscS 182148 181009 CDS product O-phospho-L-seryl-tRNA:Cys-tRNA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876691.1 protein_id gnl|my_center|LOCUS_20580 183106 182195 gene locus_tag LOCUS_20590 gene trxB 183106 182195 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060886.1 protein_id gnl|my_center|LOCUS_20590 185065 183197 gene locus_tag LOCUS_20600 gene gatE 185065 183197 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876346.1 protein_id gnl|my_center|LOCUS_20600 186398 185085 gene locus_tag LOCUS_20610 gene gatD 186398 185085 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876345.1 protein_id gnl|my_center|LOCUS_20610 186531 187361 gene locus_tag LOCUS_20620 186531 187361 CDS product DUF2099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061092.1 protein_id gnl|my_center|LOCUS_20620 187710 187363 gene locus_tag LOCUS_20630 187710 187363 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061093.1 protein_id gnl|my_center|LOCUS_20630 187872 189146 gene locus_tag LOCUS_20640 gene thiC 187872 189146 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877184.1 protein_id gnl|my_center|LOCUS_20640 189185 189463 gene locus_tag LOCUS_20650 189185 189463 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877185.1 protein_id gnl|my_center|LOCUS_20650 189460 189972 gene locus_tag LOCUS_20660 189460 189972 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065175.1 protein_id gnl|my_center|LOCUS_20660 190613 190068 gene locus_tag LOCUS_20670 190613 190068 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583745.1 protein_id gnl|my_center|LOCUS_20670 191495 190704 gene locus_tag LOCUS_20680 191495 190704 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403240.1 protein_id gnl|my_center|LOCUS_20680 191654 193324 gene locus_tag LOCUS_20690 191654 193324 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061094.1 protein_id gnl|my_center|LOCUS_20690 193453 193845 gene locus_tag LOCUS_20700 193453 193845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 194868 193861 gene locus_tag LOCUS_20710 194868 193861 CDS product UPF0104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876017.1 protein_id gnl|my_center|LOCUS_20710 195632 194952 gene locus_tag LOCUS_20720 195632 194952 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061211.1 protein_id gnl|my_center|LOCUS_20720 195899 197248 gene locus_tag LOCUS_20730 gene glmM 195899 197248 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877192.1 protein_id gnl|my_center|LOCUS_20730 197516 197340 gene locus_tag LOCUS_20740 197516 197340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 197733 198296 gene locus_tag LOCUS_20750 gene afpA 197733 198296 CDS product archaeoflavoprotein AfpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064401.1 protein_id gnl|my_center|LOCUS_20750 198785 198447 gene locus_tag LOCUS_20760 198785 198447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 199397 198909 gene locus_tag LOCUS_20770 199397 198909 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060883.1 protein_id gnl|my_center|LOCUS_20770 200021 202204 gene locus_tag LOCUS_20780 200021 202204 CDS product pseudomurein-binding repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052261150.1 protein_id gnl|my_center|LOCUS_20780 202432 202235 gene locus_tag LOCUS_20790 202432 202235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 203162 202434 gene locus_tag LOCUS_20800 203162 202434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 203404 203177 gene locus_tag LOCUS_20810 203404 203177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 204326 203442 gene locus_tag LOCUS_20820 204326 203442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 208275 204334 gene locus_tag LOCUS_20830 208275 204334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 208625 209179 gene locus_tag LOCUS_20840 208625 209179 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876339.1 protein_id gnl|my_center|LOCUS_20840 209220 210887 gene locus_tag LOCUS_20850 209220 210887 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065557.1 protein_id gnl|my_center|LOCUS_20850 210962 211216 gene locus_tag LOCUS_20860 210962 211216 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022860.1 protein_id gnl|my_center|LOCUS_20860 211219 212283 gene locus_tag LOCUS_20870 gene vorB 211219 212283 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060884.1 protein_id gnl|my_center|LOCUS_20870 212325 213764 gene locus_tag LOCUS_20880 212325 213764 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060885.1 protein_id gnl|my_center|LOCUS_20880 213955 215685 gene locus_tag LOCUS_20890 213955 215685 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080205.1 protein_id gnl|my_center|LOCUS_20890 215825 216691 gene locus_tag LOCUS_20900 215825 216691 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080204.1 protein_id gnl|my_center|LOCUS_20900 217111 217959 gene locus_tag LOCUS_20910 217111 217959 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121737.1 protein_id gnl|my_center|LOCUS_20910 218135 218887 gene locus_tag LOCUS_20920 218135 218887 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877180.1 protein_id gnl|my_center|LOCUS_20920 219038 220366 gene locus_tag LOCUS_20930 gene glnA 219038 220366 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877179.1 protein_id gnl|my_center|LOCUS_20930 220521 222233 gene locus_tag LOCUS_20940 220521 222233 CDS product DUF128 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061091.1 protein_id gnl|my_center|LOCUS_20940 222385 223242 gene locus_tag LOCUS_20950 222385 223242 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021151.1 protein_id gnl|my_center|LOCUS_20950 223413 223604 gene locus_tag LOCUS_20960 223413 223604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 223610 224620 gene locus_tag LOCUS_20970 223610 224620 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876559.1 protein_id gnl|my_center|LOCUS_20970 224741 227185 gene locus_tag LOCUS_20980 224741 227185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 227615 228505 gene locus_tag LOCUS_20990 227615 228505 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876118.1 protein_id gnl|my_center|LOCUS_20990 228615 229304 gene locus_tag LOCUS_21000 228615 229304 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060828.1 protein_id gnl|my_center|LOCUS_21000 229365 230426 gene locus_tag LOCUS_21010 229365 230426 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060827.1 protein_id gnl|my_center|LOCUS_21010 231204 230428 gene locus_tag LOCUS_21020 231204 230428 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065064.1 protein_id gnl|my_center|LOCUS_21020 232100 231201 gene locus_tag LOCUS_21030 232100 231201 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021255.1 protein_id gnl|my_center|LOCUS_21030 232027 232263 gene locus_tag LOCUS_21040 232027 232263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 233330 232260 gene locus_tag LOCUS_21050 233330 232260 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066011.1 protein_id gnl|my_center|LOCUS_21050 233513 234301 gene locus_tag LOCUS_21060 233513 234301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 234335 234976 gene locus_tag LOCUS_21070 234335 234976 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876309.1 protein_id gnl|my_center|LOCUS_21070 234976 235332 gene locus_tag LOCUS_21080 234976 235332 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060878.1 protein_id gnl|my_center|LOCUS_21080 235393 236094 gene locus_tag LOCUS_21090 235393 236094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 237484 236180 gene locus_tag LOCUS_21100 237484 236180 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061087.1 protein_id gnl|my_center|LOCUS_21100 238323 237511 gene locus_tag LOCUS_21110 238323 237511 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877167.1 protein_id gnl|my_center|LOCUS_21110 240038 238329 gene locus_tag LOCUS_21120 240038 238329 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877166.1 protein_id gnl|my_center|LOCUS_21120 240452 240060 gene locus_tag LOCUS_21130 240452 240060 CDS product molybdopterin dinucleotide binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877165.1 protein_id gnl|my_center|LOCUS_21130 240697 240449 gene locus_tag LOCUS_21140 240697 240449 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877164.1 protein_id gnl|my_center|LOCUS_21140 241761 240697 gene locus_tag LOCUS_21150 241761 240697 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061086.1 protein_id gnl|my_center|LOCUS_21150 242462 241995 gene locus_tag LOCUS_21160 242462 241995 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061085.1 protein_id gnl|my_center|LOCUS_21160 242940 242665 gene locus_tag LOCUS_21170 242940 242665 CDS product DUF2097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061090.1 protein_id gnl|my_center|LOCUS_21170 245685 243010 gene locus_tag LOCUS_21180 gene fdhF 245685 243010 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061084.1 protein_id gnl|my_center|LOCUS_21180 245796 246503 gene locus_tag LOCUS_21190 gene mobB 245796 246503 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877160.1 protein_id gnl|my_center|LOCUS_21190 248504 246603 gene locus_tag LOCUS_21200 248504 246603 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877158.1 protein_id gnl|my_center|LOCUS_21200 249006 248539 gene locus_tag LOCUS_21210 gene nuoE 249006 248539 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877157.1 protein_id gnl|my_center|LOCUS_21210 249272 249619 gene locus_tag LOCUS_21220 249272 249619 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255937.1 protein_id gnl|my_center|LOCUS_21220 249675 250427 gene locus_tag LOCUS_21230 gene fdhD 249675 250427 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877156.1 protein_id gnl|my_center|LOCUS_21230 251214 250489 gene locus_tag LOCUS_21240 251214 250489 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867364.1 protein_id gnl|my_center|LOCUS_21240 251510 251268 gene locus_tag LOCUS_21250 251510 251268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 252262 251543 gene locus_tag LOCUS_21260 252262 251543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 252451 252290 gene locus_tag LOCUS_21270 252451 252290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 253315 252536 gene locus_tag LOCUS_21280 253315 252536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 254672 253875 gene locus_tag LOCUS_21290 254672 253875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 255148 254687 gene locus_tag LOCUS_21300 255148 254687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 255603 255184 gene locus_tag LOCUS_21310 255603 255184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 >Feature sequence05 843 259 gene locus_tag LOCUS_21320 gene hxlB 843 259 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061311.1 protein_id gnl|my_center|LOCUS_21320 1013 1882 gene locus_tag LOCUS_21330 1013 1882 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061082.1 protein_id gnl|my_center|LOCUS_21330 1976 2995 gene locus_tag LOCUS_21340 1976 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 3215 4138 gene locus_tag LOCUS_21350 3215 4138 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877153.1 protein_id gnl|my_center|LOCUS_21350 4345 5643 gene locus_tag LOCUS_21360 gene thiC 4345 5643 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877152.1 protein_id gnl|my_center|LOCUS_21360 5812 7389 gene locus_tag LOCUS_21370 gene lysS 5812 7389 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061081.1 protein_id gnl|my_center|LOCUS_21370 7920 8435 gene locus_tag LOCUS_21380 7920 8435 CDS product UGSC family (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877150.1 protein_id gnl|my_center|LOCUS_21380 8453 9568 gene locus_tag LOCUS_21390 8453 9568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_21390 9936 9595 gene locus_tag LOCUS_21400 9936 9595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 10219 10536 gene locus_tag LOCUS_21410 10219 10536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 10605 11126 gene locus_tag LOCUS_21420 10605 11126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 11277 12074 gene locus_tag LOCUS_21430 11277 12074 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860395.1 protein_id gnl|my_center|LOCUS_21430 12104 12607 gene locus_tag LOCUS_21440 12104 12607 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_21440 12675 13337 gene locus_tag LOCUS_21450 12675 13337 CDS product DUF166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876968.1 protein_id gnl|my_center|LOCUS_21450 14273 13407 gene locus_tag LOCUS_21460 14273 13407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 16628 14316 gene locus_tag LOCUS_21470 gene nrdD 16628 14316 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330373.1 protein_id gnl|my_center|LOCUS_21470 19964 16677 gene locus_tag LOCUS_21480 gene polC 19964 16677 CDS product DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061308.1 protein_id gnl|my_center|LOCUS_21480 20454 21503 gene locus_tag LOCUS_21490 20454 21503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 21717 21875 gene locus_tag LOCUS_21500 21717 21875 CDS product preprotein translocase subunit Sec61beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013294958.1 protein_id gnl|my_center|LOCUS_21500 21914 23263 gene locus_tag LOCUS_21510 gene purB 21914 23263 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877146.1 protein_id gnl|my_center|LOCUS_21510 23510 23824 gene locus_tag LOCUS_21520 23510 23824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 23970 24839 gene locus_tag LOCUS_21530 23970 24839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877147.1 protein_id gnl|my_center|LOCUS_21530 25687 24953 gene locus_tag LOCUS_21540 25687 24953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 26035 25697 gene locus_tag LOCUS_21550 26035 25697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 26240 26644 gene locus_tag LOCUS_21560 26240 26644 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877139.1 protein_id gnl|my_center|LOCUS_21560 27140 26724 gene locus_tag LOCUS_21570 27140 26724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 27561 27427 gene locus_tag LOCUS_21580 27561 27427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 28307 27948 gene locus_tag LOCUS_21590 28307 27948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 28574 29812 gene locus_tag LOCUS_21600 28574 29812 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052457408.1 protein_id gnl|my_center|LOCUS_21600 29847 32267 gene locus_tag LOCUS_21610 29847 32267 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877144.1 protein_id gnl|my_center|LOCUS_21610 32332 32475 gene locus_tag LOCUS_21620 32332 32475 CDS product YHS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583928.1 protein_id gnl|my_center|LOCUS_21620 33188 32508 gene locus_tag LOCUS_21630 33188 32508 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877398.1 protein_id gnl|my_center|LOCUS_21630 33328 33453 gene locus_tag LOCUS_21640 33328 33453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 34787 33522 gene locus_tag LOCUS_21650 gene truD 34787 33522 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877138.1 protein_id gnl|my_center|LOCUS_21650 36250 34913 gene locus_tag LOCUS_21660 gene ftsA 36250 34913 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877137.1 protein_id gnl|my_center|LOCUS_21660 36449 37738 gene locus_tag LOCUS_21670 36449 37738 CDS product acyl-CoA thioesterase/bile acid-CoA:amino acid N-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966677.1 protein_id gnl|my_center|LOCUS_21670 37770 38213 gene locus_tag LOCUS_21680 37770 38213 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272018.1 protein_id gnl|my_center|LOCUS_21680 38528 40012 gene locus_tag LOCUS_21690 38528 40012 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061013.1 protein_id gnl|my_center|LOCUS_21690 40750 40076 gene locus_tag LOCUS_21700 40750 40076 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877395.1 protein_id gnl|my_center|LOCUS_21700 42056 40764 gene locus_tag LOCUS_21710 42056 40764 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_21710 47382 42247 gene locus_tag LOCUS_21720 47382 42247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 47587 48447 gene locus_tag LOCUS_21730 gene hisG 47587 48447 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877116.1 protein_id gnl|my_center|LOCUS_21730 48577 48825 gene locus_tag LOCUS_21740 48577 48825 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061051.1 protein_id gnl|my_center|LOCUS_21740 48871 49299 gene locus_tag LOCUS_21750 48871 49299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 51141 49384 gene locus_tag LOCUS_21760 51141 49384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 51939 52310 gene locus_tag LOCUS_21770 51939 52310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 52450 52737 gene locus_tag LOCUS_21780 52450 52737 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061051.1 protein_id gnl|my_center|LOCUS_21780 52754 53053 gene locus_tag LOCUS_21790 52754 53053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 53234 54367 gene locus_tag LOCUS_21800 53234 54367 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876334.1 protein_id gnl|my_center|LOCUS_21800 54360 55058 gene locus_tag LOCUS_21810 54360 55058 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876335.1 protein_id gnl|my_center|LOCUS_21810 55402 55698 gene locus_tag LOCUS_21820 55402 55698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 55930 56703 gene locus_tag LOCUS_21830 55930 56703 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162828730.1 protein_id gnl|my_center|LOCUS_21830 59923 56753 gene locus_tag LOCUS_21840 59923 56753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 60165 59983 gene locus_tag LOCUS_21850 60165 59983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 63093 60229 gene locus_tag LOCUS_21860 gene leuS 63093 60229 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061305.1 protein_id gnl|my_center|LOCUS_21860 63471 63145 gene locus_tag LOCUS_21870 63471 63145 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877119.1 protein_id gnl|my_center|LOCUS_21870 64315 63518 gene locus_tag LOCUS_21880 64315 63518 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061072.1 protein_id gnl|my_center|LOCUS_21880 65649 64393 gene locus_tag LOCUS_21890 65649 64393 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964004.1 protein_id gnl|my_center|LOCUS_21890 66905 65661 gene locus_tag LOCUS_21900 66905 65661 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355958.1 protein_id gnl|my_center|LOCUS_21900 67386 66934 gene locus_tag LOCUS_21910 67386 66934 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867606.1 protein_id gnl|my_center|LOCUS_21910 68085 67798 gene locus_tag LOCUS_21920 68085 67798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 68827 68312 gene locus_tag LOCUS_21930 68827 68312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 69101 68868 gene locus_tag LOCUS_21940 69101 68868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 69488 69225 gene locus_tag LOCUS_21950 69488 69225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 70225 69494 gene locus_tag LOCUS_21960 70225 69494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 73876 70229 gene locus_tag LOCUS_21970 73876 70229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 75333 74344 gene locus_tag LOCUS_21980 75333 74344 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 protein_id gnl|my_center|LOCUS_21980 76190 75576 gene locus_tag LOCUS_21990 76190 75576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 77353 76358 gene locus_tag LOCUS_22000 77353 76358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 78339 77362 gene locus_tag LOCUS_22010 78339 77362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877011.1 protein_id gnl|my_center|LOCUS_22010 78675 79073 gene locus_tag LOCUS_22020 78675 79073 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061298.1 protein_id gnl|my_center|LOCUS_22020 79045 79500 gene locus_tag LOCUS_22030 gene cfbA 79045 79500 CDS product sirohydrochlorin nickelochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061042.1 protein_id gnl|my_center|LOCUS_22030 79536 80549 gene locus_tag LOCUS_22040 gene thiL 79536 80549 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877008.1 protein_id gnl|my_center|LOCUS_22040 80894 81901 gene locus_tag LOCUS_22050 gene amrS 80894 81901 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877007.1 protein_id gnl|my_center|LOCUS_22050 81949 82353 gene locus_tag LOCUS_22060 81949 82353 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143490.1 protein_id gnl|my_center|LOCUS_22060 82555 83634 gene locus_tag LOCUS_22070 82555 83634 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296317.1 protein_id gnl|my_center|LOCUS_22070 83910 84326 gene locus_tag LOCUS_22080 83910 84326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 >Feature sequence06 624 238 gene locus_tag LOCUS_22090 624 238 CDS product UPF0146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876631.1 protein_id gnl|my_center|LOCUS_22090 644 1087 gene locus_tag LOCUS_22100 gene rimI 644 1087 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876630.1 protein_id gnl|my_center|LOCUS_22100 1215 2297 gene locus_tag LOCUS_22110 gene carA 1215 2297 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060942.1 protein_id gnl|my_center|LOCUS_22110 2413 5592 gene locus_tag LOCUS_22120 gene carB 2413 5592 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878769.1 protein_id gnl|my_center|LOCUS_22120 5833 7116 gene locus_tag LOCUS_22130 5833 7116 CDS product PKD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060941.1 protein_id gnl|my_center|LOCUS_22130 7690 8553 gene locus_tag LOCUS_22140 7690 8553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 8743 9852 gene locus_tag LOCUS_22150 8743 9852 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876625.1 protein_id gnl|my_center|LOCUS_22150 10024 10473 gene locus_tag LOCUS_22160 10024 10473 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876624.1 protein_id gnl|my_center|LOCUS_22160 10538 11374 gene locus_tag LOCUS_22170 10538 11374 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060939.1 protein_id gnl|my_center|LOCUS_22170 11376 11798 gene locus_tag LOCUS_22180 11376 11798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876622.1 protein_id gnl|my_center|LOCUS_22180 12870 11815 gene locus_tag LOCUS_22190 gene larE 12870 11815 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876621.1 protein_id gnl|my_center|LOCUS_22190 13638 12991 gene locus_tag LOCUS_22200 13638 12991 CDS product TfuA-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020222.1 protein_id gnl|my_center|LOCUS_22200 14055 13759 gene locus_tag LOCUS_22210 14055 13759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22210 14250 14116 gene locus_tag LOCUS_22220 14250 14116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 14818 14282 gene locus_tag LOCUS_22230 gene tfe 14818 14282 CDS product transcription factor E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877276.1 protein_id gnl|my_center|LOCUS_22230 15929 15087 gene locus_tag LOCUS_22240 15929 15087 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877277.1 protein_id gnl|my_center|LOCUS_22240 16823 15942 gene locus_tag LOCUS_22250 16823 15942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 17331 16849 gene locus_tag LOCUS_22260 17331 16849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 17466 18149 gene locus_tag LOCUS_22270 17466 18149 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024089.1 protein_id gnl|my_center|LOCUS_22270 18493 18951 gene locus_tag LOCUS_22280 18493 18951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 19323 22244 gene locus_tag LOCUS_22290 19323 22244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 23197 22505 gene locus_tag LOCUS_22300 23197 22505 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877278.1 protein_id gnl|my_center|LOCUS_22300 23920 23219 gene locus_tag LOCUS_22310 23920 23219 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173402640.1 protein_id gnl|my_center|LOCUS_22310 24805 24035 gene locus_tag LOCUS_22320 24805 24035 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877280.1 protein_id gnl|my_center|LOCUS_22320 25578 24805 gene locus_tag LOCUS_22330 gene comA 25578 24805 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877281.1 protein_id gnl|my_center|LOCUS_22330 25752 26315 gene locus_tag LOCUS_22340 25752 26315 CDS product pyruvate kinase alpha/beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877282.1 protein_id gnl|my_center|LOCUS_22340 26532 27683 gene locus_tag LOCUS_22350 gene ftsZ 26532 27683 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877283.1 protein_id gnl|my_center|LOCUS_22350 27876 28061 gene locus_tag LOCUS_22360 27876 28061 CDS product protein translocase SEC61 complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877284.1 protein_id gnl|my_center|LOCUS_22360 28116 28559 gene locus_tag LOCUS_22370 28116 28559 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061118.1 protein_id gnl|my_center|LOCUS_22370 28559 29038 gene locus_tag LOCUS_22380 28559 29038 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877286.1 protein_id gnl|my_center|LOCUS_22380 29136 29774 gene locus_tag LOCUS_22390 29136 29774 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061119.1 protein_id gnl|my_center|LOCUS_22390 29774 30775 gene locus_tag LOCUS_22400 29774 30775 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877288.1 protein_id gnl|my_center|LOCUS_22400 30914 31219 gene locus_tag LOCUS_22410 30914 31219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 31315 34011 gene locus_tag LOCUS_22420 gene alaS 31315 34011 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877290.1 protein_id gnl|my_center|LOCUS_22420 34188 34358 gene locus_tag LOCUS_22430 34188 34358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 34563 35828 gene locus_tag LOCUS_22440 34563 35828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 36008 37267 gene locus_tag LOCUS_22450 36008 37267 CDS product methanogenesis marker 16 metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877291.1 protein_id gnl|my_center|LOCUS_22450 37765 37286 gene locus_tag LOCUS_22460 37765 37286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 38839 37778 gene locus_tag LOCUS_22470 38839 37778 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061273.1 protein_id gnl|my_center|LOCUS_22470 40290 38989 gene locus_tag LOCUS_22480 40290 38989 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876694.1 protein_id gnl|my_center|LOCUS_22480 40970 40305 gene locus_tag LOCUS_22490 40970 40305 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876695.1 protein_id gnl|my_center|LOCUS_22490 42114 41065 gene locus_tag LOCUS_22500 gene hypD 42114 41065 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876696.1 protein_id gnl|my_center|LOCUS_22500 42819 45611 gene locus_tag LOCUS_22510 42819 45611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22510 45627 47144 gene locus_tag LOCUS_22520 45627 47144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22520 47125 48294 gene locus_tag LOCUS_22530 47125 48294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296325.1 protein_id gnl|my_center|LOCUS_22530 48383 49039 gene locus_tag LOCUS_22540 48383 49039 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060837.1 protein_id gnl|my_center|LOCUS_22540 49375 49247 gene locus_tag LOCUS_22550 49375 49247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 49539 49889 gene locus_tag LOCUS_22560 49539 49889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 50675 49989 gene locus_tag LOCUS_22570 50675 49989 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876165.1 protein_id gnl|my_center|LOCUS_22570 51687 50950 gene locus_tag LOCUS_22580 51687 50950 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060841.1 protein_id gnl|my_center|LOCUS_22580 51958 51812 gene locus_tag LOCUS_22590 51958 51812 CDS product 50S ribosomal protein L40e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876192.1 protein_id gnl|my_center|LOCUS_22590 52521 52015 gene locus_tag LOCUS_22600 52521 52015 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060842.1 protein_id gnl|my_center|LOCUS_22600 54686 52704 gene locus_tag LOCUS_22610 54686 52704 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020921.1 protein_id gnl|my_center|LOCUS_22610 54891 55046 gene locus_tag LOCUS_22620 54891 55046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 55004 55495 gene locus_tag LOCUS_22630 55004 55495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023265.1 protein_id gnl|my_center|LOCUS_22630 55576 56289 gene locus_tag LOCUS_22640 55576 56289 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892283.1 protein_id gnl|my_center|LOCUS_22640 56982 56302 gene locus_tag LOCUS_22650 56982 56302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 57254 57015 gene locus_tag LOCUS_22660 57254 57015 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496448.1 protein_id gnl|my_center|LOCUS_22660 57660 57220 gene locus_tag LOCUS_22670 57660 57220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 58550 58017 gene locus_tag LOCUS_22680 58550 58017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 58459 58746 gene locus_tag LOCUS_22690 58459 58746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 58862 59431 gene locus_tag LOCUS_22700 58862 59431 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197538709.1 protein_id gnl|my_center|LOCUS_22700 >Feature sequence07 392 958 gene locus_tag LOCUS_22710 392 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061169.1 protein_id gnl|my_center|LOCUS_22710 1159 986 gene locus_tag LOCUS_22720 1159 986 CDS product class III signal peptide-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061337.1 protein_id gnl|my_center|LOCUS_22720 1337 2497 gene locus_tag LOCUS_22730 1337 2497 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020503.1 protein_id gnl|my_center|LOCUS_22730 2534 3718 gene locus_tag LOCUS_22740 2534 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 3740 4438 gene locus_tag LOCUS_22750 3740 4438 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877498.1 protein_id gnl|my_center|LOCUS_22750 4443 5063 gene locus_tag LOCUS_22760 4443 5063 CDS product Era-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877499.1 protein_id gnl|my_center|LOCUS_22760 5108 5476 gene locus_tag LOCUS_22770 5108 5476 CDS product DUF2073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877500.1 protein_id gnl|my_center|LOCUS_22770 5460 5765 gene locus_tag LOCUS_22780 5460 5765 CDS product Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877501.1 protein_id gnl|my_center|LOCUS_22780 7770 5794 gene locus_tag LOCUS_22790 gene rqcH 7770 5794 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061171.1 protein_id gnl|my_center|LOCUS_22790 8430 8687 gene locus_tag LOCUS_22800 8430 8687 CDS product DUF5379 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877504.1 protein_id gnl|my_center|LOCUS_22800 10591 8750 gene locus_tag LOCUS_22810 10591 8750 CDS product DUF2070 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877505.1 protein_id gnl|my_center|LOCUS_22810 10762 11325 gene locus_tag LOCUS_22820 10762 11325 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485798.1 protein_id gnl|my_center|LOCUS_22820 11346 12125 gene locus_tag LOCUS_22830 11346 12125 CDS product DUF6282 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877507.1 protein_id gnl|my_center|LOCUS_22830 13267 12170 gene locus_tag LOCUS_22840 gene fbp 13267 12170 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877293.1 protein_id gnl|my_center|LOCUS_22840 14533 13538 gene locus_tag LOCUS_22850 gene aksF 14533 13538 CDS product homoisocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875823.1 protein_id gnl|my_center|LOCUS_22850 14784 15755 gene locus_tag LOCUS_22860 14784 15755 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750435.1 protein_id gnl|my_center|LOCUS_22860 16097 16657 gene locus_tag LOCUS_22870 16097 16657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 16910 17872 gene locus_tag LOCUS_22880 16910 17872 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875827.1 protein_id gnl|my_center|LOCUS_22880 18223 17957 gene locus_tag LOCUS_22890 18223 17957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 18566 19144 gene locus_tag LOCUS_22900 gene pdxT 18566 19144 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875829.1 protein_id gnl|my_center|LOCUS_22900 19132 20049 gene locus_tag LOCUS_22910 19132 20049 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875830.1 protein_id gnl|my_center|LOCUS_22910 20063 20752 gene locus_tag LOCUS_22920 20063 20752 CDS product GXGXG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875831.1 protein_id gnl|my_center|LOCUS_22920 20727 21854 gene locus_tag LOCUS_22930 20727 21854 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875832.1 protein_id gnl|my_center|LOCUS_22930 21856 23355 gene locus_tag LOCUS_22940 21856 23355 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875833.1 protein_id gnl|my_center|LOCUS_22940 23666 24898 gene locus_tag LOCUS_22950 23666 24898 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876299.1 protein_id gnl|my_center|LOCUS_22950 24961 25299 gene locus_tag LOCUS_22960 24961 25299 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060875.1 protein_id gnl|my_center|LOCUS_22960 25579 26808 gene locus_tag LOCUS_22970 25579 26808 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060874.1 protein_id gnl|my_center|LOCUS_22970 26832 27170 gene locus_tag LOCUS_22980 26832 27170 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060875.1 protein_id gnl|my_center|LOCUS_22980 27379 27864 gene locus_tag LOCUS_22990 27379 27864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 27938 28852 gene locus_tag LOCUS_23000 27938 28852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 29108 29494 gene locus_tag LOCUS_23010 29108 29494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 30514 29633 gene locus_tag LOCUS_23020 gene pdxS 30514 29633 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876304.1 protein_id gnl|my_center|LOCUS_23020 31981 30848 gene locus_tag LOCUS_23030 31981 30848 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892639.1 protein_id gnl|my_center|LOCUS_23030 >Feature sequence08 2598 1432 gene locus_tag LOCUS_23040 2598 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 7467 2680 gene locus_tag LOCUS_23050 7467 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077139241.1 protein_id gnl|my_center|LOCUS_23050 10247 7518 gene locus_tag LOCUS_23060 10247 7518 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065303.1 protein_id gnl|my_center|LOCUS_23060 10520 10927 gene locus_tag LOCUS_23070 10520 10927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 12028 11114 gene locus_tag LOCUS_23080 12028 11114 CDS product DUF5655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109315.1 protein_id gnl|my_center|LOCUS_23080 12956 12033 gene locus_tag LOCUS_23090 12956 12033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 >Feature sequence09 1808 708 gene locus_tag LOCUS_23100 gene hisC 1808 708 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877195.1 protein_id gnl|my_center|LOCUS_23100 2296 1823 gene locus_tag LOCUS_23110 2296 1823 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877196.1 protein_id gnl|my_center|LOCUS_23110 3627 2353 gene locus_tag LOCUS_23120 3627 2353 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877197.1 protein_id gnl|my_center|LOCUS_23120 4979 3624 gene locus_tag LOCUS_23130 gene glmM 4979 3624 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877198.1 protein_id gnl|my_center|LOCUS_23130 6250 5015 gene locus_tag LOCUS_23140 6250 5015 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877199.1 protein_id gnl|my_center|LOCUS_23140 6958 6290 gene locus_tag LOCUS_23150 6958 6290 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877200.1 protein_id gnl|my_center|LOCUS_23150 7583 6996 gene locus_tag LOCUS_23160 7583 6996 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877201.1 protein_id gnl|my_center|LOCUS_23160 8402 8088 gene locus_tag LOCUS_23170 8402 8088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 8976 8647 gene locus_tag LOCUS_23180 8976 8647 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877202.1 protein_id gnl|my_center|LOCUS_23180 >Feature sequence10 1281 1976 gene locus_tag LOCUS_23190 1281 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 1992 2426 gene locus_tag LOCUS_23200 1992 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 2806 2952 gene locus_tag LOCUS_23210 2806 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 2966 3736 gene locus_tag LOCUS_23220 2966 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 4012 5265 gene locus_tag LOCUS_23230 4012 5265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 5076 5149 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence11 774 848 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 999 1604 gene locus_tag LOCUS_23240 999 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 3636 1798 gene locus_tag LOCUS_23250 3636 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 4700 3552 gene locus_tag LOCUS_23260 4700 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 5265 4705 gene locus_tag LOCUS_23270 5265 4705 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948274.1 protein_id gnl|my_center|LOCUS_23270