>Feature sequence001 93 857 gene locus_tag LOCUS_00010 93 857 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263785.1 protein_id gnl|my_center|LOCUS_00010 2535 1057 gene locus_tag LOCUS_00020 2535 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2658 3629 gene locus_tag LOCUS_00030 gene prmA 2658 3629 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385115.1 protein_id gnl|my_center|LOCUS_00030 3626 4348 gene locus_tag LOCUS_00040 3626 4348 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964597.1 protein_id gnl|my_center|LOCUS_00040 4345 5676 gene locus_tag LOCUS_00050 gene mtaB 4345 5676 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964598.1 protein_id gnl|my_center|LOCUS_00050 5627 5959 gene locus_tag LOCUS_00060 5627 5959 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948455.1 protein_id gnl|my_center|LOCUS_00060 5979 8285 gene locus_tag LOCUS_00070 gene clpC 5979 8285 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235011.1 protein_id gnl|my_center|LOCUS_00070 8291 9814 gene locus_tag LOCUS_00080 8291 9814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 10000 11088 gene locus_tag LOCUS_00090 10000 11088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11104 12000 gene locus_tag LOCUS_00100 gene murB 11104 12000 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048307.1 protein_id gnl|my_center|LOCUS_00100 12014 12889 gene locus_tag LOCUS_00110 gene rapZ 12014 12889 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_00110 12889 13830 gene locus_tag LOCUS_00120 gene whiA 12889 13830 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357358.1 protein_id gnl|my_center|LOCUS_00120 13830 17285 gene locus_tag LOCUS_00130 13830 17285 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963838.1 protein_id gnl|my_center|LOCUS_00130 17351 18268 gene locus_tag LOCUS_00140 gene pfkA 17351 18268 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_00140 19795 18314 gene locus_tag LOCUS_00150 gene spoIVA 19795 18314 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986845.1 protein_id gnl|my_center|LOCUS_00150 21191 19866 gene locus_tag LOCUS_00160 gene der 21191 19866 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965018.1 protein_id gnl|my_center|LOCUS_00160 22501 21197 gene locus_tag LOCUS_00170 22501 21197 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965017.1 protein_id gnl|my_center|LOCUS_00170 22646 23188 gene locus_tag LOCUS_00180 22646 23188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 23197 24567 gene locus_tag LOCUS_00190 23197 24567 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112884.1 protein_id gnl|my_center|LOCUS_00190 24633 25649 gene locus_tag LOCUS_00200 24633 25649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938446.1 protein_id gnl|my_center|LOCUS_00200 25767 27521 gene locus_tag LOCUS_00210 25767 27521 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193735789.1 protein_id gnl|my_center|LOCUS_00210 27518 28843 gene locus_tag LOCUS_00220 27518 28843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 30313 28889 gene locus_tag LOCUS_00230 gene glnA 30313 28889 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_00230 31772 30456 gene locus_tag LOCUS_00240 31772 30456 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869172.1 protein_id gnl|my_center|LOCUS_00240 32875 31769 gene locus_tag LOCUS_00250 32875 31769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 33075 34283 gene locus_tag LOCUS_00260 33075 34283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 34273 35223 gene locus_tag LOCUS_00270 34273 35223 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435695.1 protein_id gnl|my_center|LOCUS_00270 35282 36145 gene locus_tag LOCUS_00280 35282 36145 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391588.1 protein_id gnl|my_center|LOCUS_00280 37105 36185 gene locus_tag LOCUS_00290 37105 36185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 <38656 37128 gene locus_tag LOCUS_00300 <38656 37128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000478987.1:chromosome segregation protein SMC >Feature sequence002 1655 816 gene locus_tag LOCUS_00310 1655 816 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896901.1 protein_id gnl|my_center|LOCUS_00310 2483 1692 gene locus_tag LOCUS_00320 2483 1692 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_00320 3868 2480 gene locus_tag LOCUS_00330 3868 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 4535 3858 gene locus_tag LOCUS_00340 4535 3858 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_00340 4612 4977 gene locus_tag LOCUS_00350 4612 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 7269 5143 gene locus_tag LOCUS_00360 7269 5143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 7869 7330 gene locus_tag LOCUS_00370 7869 7330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 8529 7873 gene locus_tag LOCUS_00380 gene lepB 8529 7873 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_00380 8722 8513 gene locus_tag LOCUS_00390 8722 8513 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966985.1 protein_id gnl|my_center|LOCUS_00390 10698 8722 gene locus_tag LOCUS_00400 10698 8722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 11584 10814 gene locus_tag LOCUS_00410 11584 10814 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860835.1 protein_id gnl|my_center|LOCUS_00410 12324 11581 gene locus_tag LOCUS_00420 12324 11581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 12461 12679 gene locus_tag LOCUS_00430 12461 12679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 12879 13955 gene locus_tag LOCUS_00440 gene gcvT 12879 13955 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398598.1 protein_id gnl|my_center|LOCUS_00440 14071 14448 gene locus_tag LOCUS_00450 gene gcvH 14071 14448 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583866.1 protein_id gnl|my_center|LOCUS_00450 14520 15860 gene locus_tag LOCUS_00460 gene gcvPA 14520 15860 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393441.1 protein_id gnl|my_center|LOCUS_00460 15860 17311 gene locus_tag LOCUS_00470 gene gcvPB 15860 17311 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948420.1 protein_id gnl|my_center|LOCUS_00470 18710 17439 gene locus_tag LOCUS_00480 18710 17439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 18709 18963 gene locus_tag LOCUS_00490 18709 18963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 18960 20015 gene locus_tag LOCUS_00500 18960 20015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 20217 21794 gene locus_tag LOCUS_00510 20217 21794 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_00510 21791 23470 gene locus_tag LOCUS_00520 21791 23470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 23472 24527 gene locus_tag LOCUS_00530 23472 24527 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770049.1 protein_id gnl|my_center|LOCUS_00530 24889 25125 gene locus_tag LOCUS_00540 24889 25125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 25289 25825 gene locus_tag LOCUS_00550 25289 25825 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812221.1 protein_id gnl|my_center|LOCUS_00550 25822 26031 gene locus_tag LOCUS_00560 25822 26031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 26051 27064 gene locus_tag LOCUS_00570 gene floA 26051 27064 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812222.1 protein_id gnl|my_center|LOCUS_00570 27086 27706 gene locus_tag LOCUS_00580 27086 27706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 27778 28245 gene locus_tag LOCUS_00590 27778 28245 CDS product LURP-one-related/scramblase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847054.1 protein_id gnl|my_center|LOCUS_00590 28365 29249 gene locus_tag LOCUS_00600 28365 29249 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679543.1 protein_id gnl|my_center|LOCUS_00600 29949 29311 gene locus_tag LOCUS_00610 gene upp 29949 29311 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815407.1 protein_id gnl|my_center|LOCUS_00610 30423 29980 gene locus_tag LOCUS_00620 gene rpiB 30423 29980 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869549.1 protein_id gnl|my_center|LOCUS_00620 31485 30445 gene locus_tag LOCUS_00630 31485 30445 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393872.1 protein_id gnl|my_center|LOCUS_00630 32614 31544 gene locus_tag LOCUS_00640 gene prfA 32614 31544 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_00640 33433 32624 gene locus_tag LOCUS_00650 gene prmC 33433 32624 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_00650 34614 33430 gene locus_tag LOCUS_00660 34614 33430 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966170.1 protein_id gnl|my_center|LOCUS_00660 35806 34652 gene locus_tag LOCUS_00670 35806 34652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 >Feature sequence003 282 2027 gene locus_tag LOCUS_00680 282 2027 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430205.1 protein_id gnl|my_center|LOCUS_00680 3064 2198 gene locus_tag LOCUS_00690 3064 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 3186 3875 gene locus_tag LOCUS_00700 3186 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 3887 4150 gene locus_tag LOCUS_00710 3887 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 4271 4657 gene locus_tag LOCUS_00720 4271 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 4695 5327 gene locus_tag LOCUS_00730 gene udk 4695 5327 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648617.1 protein_id gnl|my_center|LOCUS_00730 5403 6593 gene locus_tag LOCUS_00740 5403 6593 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132377852.1 protein_id gnl|my_center|LOCUS_00740 6895 7197 gene locus_tag LOCUS_00750 6895 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 7299 8051 gene locus_tag LOCUS_00760 7299 8051 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680889.1 protein_id gnl|my_center|LOCUS_00760 8180 9562 gene locus_tag LOCUS_00770 gene murC 8180 9562 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_00770 9578 11062 gene locus_tag LOCUS_00780 9578 11062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 11067 12494 gene locus_tag LOCUS_00790 11067 12494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 13446 12556 gene locus_tag LOCUS_00800 13446 12556 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963403.1 protein_id gnl|my_center|LOCUS_00800 13618 13932 gene locus_tag LOCUS_00810 13618 13932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 13948 15891 gene locus_tag LOCUS_00820 13948 15891 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986938.1 protein_id gnl|my_center|LOCUS_00820 15918 16511 gene locus_tag LOCUS_00830 15918 16511 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422657.1 protein_id gnl|my_center|LOCUS_00830 16521 17099 gene locus_tag LOCUS_00840 16521 17099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 17114 18103 gene locus_tag LOCUS_00850 17114 18103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 18096 18407 gene locus_tag LOCUS_00860 18096 18407 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986934.1 protein_id gnl|my_center|LOCUS_00860 18776 20554 gene locus_tag LOCUS_00870 18776 20554 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033047490.1 protein_id gnl|my_center|LOCUS_00870 20547 21929 gene locus_tag LOCUS_00880 20547 21929 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986932.1 protein_id gnl|my_center|LOCUS_00880 21946 22575 gene locus_tag LOCUS_00890 21946 22575 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359170.1 protein_id gnl|my_center|LOCUS_00890 23757 22690 gene locus_tag LOCUS_00900 23757 22690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 24950 23763 gene locus_tag LOCUS_00910 24950 23763 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191948.1 protein_id gnl|my_center|LOCUS_00910 25142 26146 gene locus_tag LOCUS_00920 25142 26146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 26181 27023 gene locus_tag LOCUS_00930 26181 27023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 28345 27068 gene locus_tag LOCUS_00940 28345 27068 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225725.1 protein_id gnl|my_center|LOCUS_00940 29456 28338 gene locus_tag LOCUS_00950 29456 28338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 29586 30968 gene locus_tag LOCUS_00960 29586 30968 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966714.1 protein_id gnl|my_center|LOCUS_00960 30965 31840 gene locus_tag LOCUS_00970 30965 31840 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262272.1 protein_id gnl|my_center|LOCUS_00970 31842 32630 gene locus_tag LOCUS_00980 31842 32630 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080494.1 protein_id gnl|my_center|LOCUS_00980 32637 32906 gene locus_tag LOCUS_00990 32637 32906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 33584 34450 gene locus_tag LOCUS_01000 33584 34450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 35489 34506 gene locus_tag LOCUS_01010 35489 34506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 >Feature sequence004 158 1168 gene locus_tag LOCUS_01020 gene dusB 158 1168 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048374.1 protein_id gnl|my_center|LOCUS_01020 1279 1749 gene locus_tag LOCUS_01030 gene greA 1279 1749 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422204.1 protein_id gnl|my_center|LOCUS_01030 1968 2624 gene locus_tag LOCUS_01040 1968 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 3067 2696 gene locus_tag LOCUS_01050 3067 2696 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_01050 4644 3205 gene locus_tag LOCUS_01060 4644 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 5800 4796 gene locus_tag LOCUS_01070 5800 4796 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932715.1 protein_id gnl|my_center|LOCUS_01070 5961 6506 gene locus_tag LOCUS_01080 5961 6506 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890731.1 protein_id gnl|my_center|LOCUS_01080 7113 6517 gene locus_tag LOCUS_01090 7113 6517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 7828 7115 gene locus_tag LOCUS_01100 7828 7115 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680891.1 protein_id gnl|my_center|LOCUS_01100 9111 7825 gene locus_tag LOCUS_01110 9111 7825 CDS product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185847435.1 protein_id gnl|my_center|LOCUS_01110 9286 9417 gene locus_tag LOCUS_01120 9286 9417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 9666 9427 gene locus_tag LOCUS_01130 9666 9427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 9563 9892 gene locus_tag LOCUS_01140 9563 9892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 10120 10473 gene locus_tag LOCUS_01150 10120 10473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 10875 11006 gene locus_tag LOCUS_01160 10875 11006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 11045 11806 gene locus_tag LOCUS_01170 11045 11806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 12630 13634 gene locus_tag LOCUS_01180 12630 13634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 14605 14012 gene locus_tag LOCUS_01190 14605 14012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 17449 14711 gene locus_tag LOCUS_01200 17449 14711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 17662 18528 gene locus_tag LOCUS_01210 17662 18528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 18731 19099 gene locus_tag LOCUS_01220 18731 19099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 19096 19374 gene locus_tag LOCUS_01230 19096 19374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 19376 19807 gene locus_tag LOCUS_01240 19376 19807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01240 19916 20665 gene locus_tag LOCUS_01250 19916 20665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 20732 21598 gene locus_tag LOCUS_01260 20732 21598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 21585 21791 gene locus_tag LOCUS_01270 21585 21791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 21878 23581 gene locus_tag LOCUS_01280 21878 23581 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680024.1 protein_id gnl|my_center|LOCUS_01280 25685 23694 gene locus_tag LOCUS_01290 25685 23694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 27826 25826 gene locus_tag LOCUS_01300 27826 25826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 30024 27934 gene locus_tag LOCUS_01310 gene pnp 30024 27934 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_01310 30412 30149 gene locus_tag LOCUS_01320 gene rpsO 30412 30149 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388351.1 protein_id gnl|my_center|LOCUS_01320 31859 30561 gene locus_tag LOCUS_01330 31859 30561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 32830 31856 gene locus_tag LOCUS_01340 32830 31856 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_01340 >Feature sequence005 4303 71 gene locus_tag LOCUS_01350 4303 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 4566 4641 gene locus_tag LOCUS_t00010 4566 4641 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 6966 4891 gene locus_tag LOCUS_01360 6966 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 7049 7903 gene locus_tag LOCUS_01370 gene mscS 7049 7903 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420749.1 protein_id gnl|my_center|LOCUS_01370 7900 8220 gene locus_tag LOCUS_01380 7900 8220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 8376 8516 gene locus_tag LOCUS_01390 8376 8516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 8558 9037 gene locus_tag LOCUS_01400 8558 9037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 9069 9740 gene locus_tag LOCUS_01410 9069 9740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 9864 10064 gene locus_tag LOCUS_01420 9864 10064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 10061 10441 gene locus_tag LOCUS_01430 10061 10441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 10528 10776 gene locus_tag LOCUS_01440 10528 10776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 12108 10876 gene locus_tag LOCUS_01450 gene ywaD 12108 10876 CDS product aminopeptidase YwaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242515.1 protein_id gnl|my_center|LOCUS_01450 12200 13552 gene locus_tag LOCUS_01460 12200 13552 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666065.1 protein_id gnl|my_center|LOCUS_01460 13575 15359 gene locus_tag LOCUS_01470 gene hflX 13575 15359 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965596.1 protein_id gnl|my_center|LOCUS_01470 15381 16055 gene locus_tag LOCUS_01480 15381 16055 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858194.1 protein_id gnl|my_center|LOCUS_01480 16083 16820 gene locus_tag LOCUS_01490 16083 16820 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_01490 16817 17074 gene locus_tag LOCUS_01500 16817 17074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 17700 17134 gene locus_tag LOCUS_01510 17700 17134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 18835 17714 gene locus_tag LOCUS_01520 18835 17714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 19180 18932 gene locus_tag LOCUS_01530 19180 18932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 20155 19190 gene locus_tag LOCUS_01540 gene fba 20155 19190 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939420.1 protein_id gnl|my_center|LOCUS_01540 21632 20250 gene locus_tag LOCUS_01550 21632 20250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 21821 22246 gene locus_tag LOCUS_01560 gene tadA 21821 22246 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815124.1 protein_id gnl|my_center|LOCUS_01560 22233 24152 gene locus_tag LOCUS_01570 22233 24152 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437073.1 protein_id gnl|my_center|LOCUS_01570 26113 24218 gene locus_tag LOCUS_01580 26113 24218 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257959.1 protein_id gnl|my_center|LOCUS_01580 <27356 26133 gene locus_tag LOCUS_01590 <27356 26133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966041.1:ABC transporter ATP-binding protein >Feature sequence006 2113 914 gene locus_tag LOCUS_01600 2113 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 2973 2110 gene locus_tag LOCUS_01610 2973 2110 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861379.1 protein_id gnl|my_center|LOCUS_01610 5291 2982 gene locus_tag LOCUS_01620 5291 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 7193 5367 gene locus_tag LOCUS_01630 7193 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 8609 7251 gene locus_tag LOCUS_01640 8609 7251 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964815.1 protein_id gnl|my_center|LOCUS_01640 9260 8613 gene locus_tag LOCUS_01650 9260 8613 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964814.1 protein_id gnl|my_center|LOCUS_01650 9658 9972 gene locus_tag LOCUS_01660 9658 9972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 11362 10172 gene locus_tag LOCUS_01670 11362 10172 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359848.1 protein_id gnl|my_center|LOCUS_01670 11644 11441 gene locus_tag LOCUS_01680 11644 11441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 12504 11644 gene locus_tag LOCUS_01690 12504 11644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 12740 12949 gene locus_tag LOCUS_01700 12740 12949 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_01700 12946 13407 gene locus_tag LOCUS_01710 12946 13407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 13404 13748 gene locus_tag LOCUS_01720 13404 13748 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_01720 13745 14698 gene locus_tag LOCUS_01730 13745 14698 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681613.1 protein_id gnl|my_center|LOCUS_01730 15988 14699 gene locus_tag LOCUS_01740 15988 14699 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102364993.1 protein_id gnl|my_center|LOCUS_01740 16268 15990 gene locus_tag LOCUS_01750 16268 15990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 17720 16836 gene locus_tag LOCUS_01760 17720 16836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 18006 18527 gene locus_tag LOCUS_01770 18006 18527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 18574 19056 gene locus_tag LOCUS_01780 18574 19056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 19067 20089 gene locus_tag LOCUS_01790 19067 20089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 20102 20575 gene locus_tag LOCUS_01800 20102 20575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 20578 22023 gene locus_tag LOCUS_01810 20578 22023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 22038 22802 gene locus_tag LOCUS_01820 22038 22802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 23320 23445 gene locus_tag LOCUS_01830 23320 23445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 24136 23696 gene locus_tag LOCUS_01840 24136 23696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 24579 24142 gene locus_tag LOCUS_01850 24579 24142 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868208.1 protein_id gnl|my_center|LOCUS_01850 25650 24595 gene locus_tag LOCUS_01860 25650 24595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 26443 25700 gene locus_tag LOCUS_01870 26443 25700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 26937 26440 gene locus_tag LOCUS_01880 26937 26440 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016850.1 protein_id gnl|my_center|LOCUS_01880 >Feature sequence007 289 735 gene locus_tag LOCUS_01890 289 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 867 1535 gene locus_tag LOCUS_01900 867 1535 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_01900 1537 2715 gene locus_tag LOCUS_01910 1537 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 2951 3085 gene locus_tag LOCUS_01920 gene rpmH 2951 3085 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701411.1 protein_id gnl|my_center|LOCUS_01920 3272 3562 gene locus_tag LOCUS_01930 gene rnpA 3272 3562 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726621.1 protein_id gnl|my_center|LOCUS_01930 3966 5180 gene locus_tag LOCUS_01940 3966 5180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 5180 6430 gene locus_tag LOCUS_01950 5180 6430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 6423 7775 gene locus_tag LOCUS_01960 gene mnmE 6423 7775 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228302.1 protein_id gnl|my_center|LOCUS_01960 7816 9687 gene locus_tag LOCUS_01970 gene mnmG 7816 9687 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898858.1 protein_id gnl|my_center|LOCUS_01970 9698 10429 gene locus_tag LOCUS_01980 gene rsmG 9698 10429 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836617.1 protein_id gnl|my_center|LOCUS_01980 10529 11383 gene locus_tag LOCUS_01990 gene noc 10529 11383 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592794.1 protein_id gnl|my_center|LOCUS_01990 11473 11679 gene locus_tag LOCUS_02000 11473 11679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 11683 12453 gene locus_tag LOCUS_02010 11683 12453 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_02010 12440 13309 gene locus_tag LOCUS_02020 12440 13309 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966989.1 protein_id gnl|my_center|LOCUS_02020 13309 14046 gene locus_tag LOCUS_02030 13309 14046 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087456344.1 protein_id gnl|my_center|LOCUS_02030 14039 14914 gene locus_tag LOCUS_02040 gene rsmI 14039 14914 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166903.1 protein_id gnl|my_center|LOCUS_02040 15021 15581 gene locus_tag LOCUS_02050 15021 15581 CDS product spore maturation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356382.1 protein_id gnl|my_center|LOCUS_02050 15578 16084 gene locus_tag LOCUS_02060 15578 16084 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947935.1 protein_id gnl|my_center|LOCUS_02060 16173 16892 gene locus_tag LOCUS_02070 16173 16892 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099545.1 protein_id gnl|my_center|LOCUS_02070 17048 17896 gene locus_tag LOCUS_02080 17048 17896 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948024.1 protein_id gnl|my_center|LOCUS_02080 17935 19509 gene locus_tag LOCUS_02090 gene pckA 17935 19509 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393393.1 protein_id gnl|my_center|LOCUS_02090 21607 19901 gene locus_tag LOCUS_02100 21607 19901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 21871 22995 gene locus_tag LOCUS_02110 gene recF 21871 22995 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359456.1 protein_id gnl|my_center|LOCUS_02110 23028 24956 gene locus_tag LOCUS_02120 gene gyrB 23028 24956 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815132.1 protein_id gnl|my_center|LOCUS_02120 >Feature sequence008 169 822 gene locus_tag LOCUS_02130 169 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 1376 1303 gene locus_tag LOCUS_t00020 1376 1303 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1599 1514 gene locus_tag LOCUS_t00030 1599 1514 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1687 1612 gene locus_tag LOCUS_t00040 1687 1612 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1765 1691 gene locus_tag LOCUS_t00050 1765 1691 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1899 1823 gene locus_tag LOCUS_t00060 1899 1823 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2007 1931 gene locus_tag LOCUS_t00070 2007 1931 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2592 2092 gene locus_tag LOCUS_02140 2592 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 2705 4951 gene locus_tag LOCUS_02150 2705 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 5028 5687 gene locus_tag LOCUS_02160 5028 5687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 5936 6403 gene locus_tag LOCUS_02170 5936 6403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 7233 6526 gene locus_tag LOCUS_02180 7233 6526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 9656 7281 gene locus_tag LOCUS_02190 9656 7281 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860930.1 protein_id gnl|my_center|LOCUS_02190 11656 9671 gene locus_tag LOCUS_02200 11656 9671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 12090 11767 gene locus_tag LOCUS_02210 12090 11767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 13593 12232 gene locus_tag LOCUS_02220 13593 12232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 14502 13750 gene locus_tag LOCUS_02230 14502 13750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 15318 14557 gene locus_tag LOCUS_02240 15318 14557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 15395 15931 gene locus_tag LOCUS_02250 15395 15931 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814293.1 protein_id gnl|my_center|LOCUS_02250 15939 17090 gene locus_tag LOCUS_02260 15939 17090 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808433.1 protein_id gnl|my_center|LOCUS_02260 18418 17138 gene locus_tag LOCUS_02270 18418 17138 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963553.1 protein_id gnl|my_center|LOCUS_02270 19845 18433 gene locus_tag LOCUS_02280 19845 18433 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963552.1 protein_id gnl|my_center|LOCUS_02280 21093 19969 gene locus_tag LOCUS_02290 21093 19969 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053675.1 protein_id gnl|my_center|LOCUS_02290 21252 21578 gene locus_tag LOCUS_02300 21252 21578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 >Feature sequence009 3839 2682 gene locus_tag LOCUS_02310 3839 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 4536 3847 gene locus_tag LOCUS_02320 4536 3847 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963772.1 protein_id gnl|my_center|LOCUS_02320 4973 5269 gene locus_tag LOCUS_02330 4973 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 5262 5924 gene locus_tag LOCUS_02340 gene atpB 5262 5924 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768272.1 protein_id gnl|my_center|LOCUS_02340 5946 6179 gene locus_tag LOCUS_02350 gene atpE 5946 6179 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142903.1 protein_id gnl|my_center|LOCUS_02350 6198 6626 gene locus_tag LOCUS_02360 6198 6626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 6627 8858 gene locus_tag LOCUS_02370 6627 8858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 8858 9664 gene locus_tag LOCUS_02380 gene atpG 8858 9664 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272788.1 protein_id gnl|my_center|LOCUS_02380 9683 11086 gene locus_tag LOCUS_02390 gene atpD 9683 11086 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_02390 11083 11364 gene locus_tag LOCUS_02400 11083 11364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 11401 12333 gene locus_tag LOCUS_02410 11401 12333 CDS product alanine-tRNA synthetase second additional domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816923.1 protein_id gnl|my_center|LOCUS_02410 13828 12389 gene locus_tag LOCUS_02420 13828 12389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 14304 13825 gene locus_tag LOCUS_02430 14304 13825 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249319.1 protein_id gnl|my_center|LOCUS_02430 14588 15469 gene locus_tag LOCUS_02440 14588 15469 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870112.1 protein_id gnl|my_center|LOCUS_02440 15462 16868 gene locus_tag LOCUS_02450 gene citF 15462 16868 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272879.1 protein_id gnl|my_center|LOCUS_02450 16865 17704 gene locus_tag LOCUS_02460 16865 17704 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048346.1 protein_id gnl|my_center|LOCUS_02460 17716 18276 gene locus_tag LOCUS_02470 17716 18276 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669045.1 protein_id gnl|my_center|LOCUS_02470 19839 18589 gene locus_tag LOCUS_02480 19839 18589 CDS product methylaspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680089.1 protein_id gnl|my_center|LOCUS_02480 21341 19887 gene locus_tag LOCUS_02490 21341 19887 CDS product methylaspartate mutase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460941.1 protein_id gnl|my_center|LOCUS_02490 22656 21322 gene locus_tag LOCUS_02500 gene glmL 22656 21322 CDS product methylaspartate mutase accessory protein GlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945203.1 protein_id gnl|my_center|LOCUS_02500 23159 22743 gene locus_tag LOCUS_02510 gene glmS 23159 22743 CDS product methylaspartate mutase subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816944.1 protein_id gnl|my_center|LOCUS_02510 <24655 23388 gene locus_tag LOCUS_02520 <24655 23388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986285.1:NADPH-dependent glutamate synthase >Feature sequence010 740 1627 gene locus_tag LOCUS_02530 gene rfbA 740 1627 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389370.1 protein_id gnl|my_center|LOCUS_02530 1822 2259 gene locus_tag LOCUS_02540 1822 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 2359 3378 gene locus_tag LOCUS_02550 gene rfbB 2359 3378 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_02550 3384 5489 gene locus_tag LOCUS_02560 3384 5489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 5482 6018 gene locus_tag LOCUS_02570 5482 6018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 6011 6568 gene locus_tag LOCUS_02580 gene rfbC 6011 6568 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_02580 6558 7439 gene locus_tag LOCUS_02590 6558 7439 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989897.1 protein_id gnl|my_center|LOCUS_02590 7948 7502 gene locus_tag LOCUS_02600 7948 7502 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491986.1 protein_id gnl|my_center|LOCUS_02600 8132 9580 gene locus_tag LOCUS_02610 gene tilS 8132 9580 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048376.1 protein_id gnl|my_center|LOCUS_02610 9615 10178 gene locus_tag LOCUS_02620 9615 10178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02620 10168 11196 gene locus_tag LOCUS_02630 gene galE 10168 11196 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_02630 11230 12309 gene locus_tag LOCUS_02640 11230 12309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 12311 13288 gene locus_tag LOCUS_02650 12311 13288 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977679.1 protein_id gnl|my_center|LOCUS_02650 13406 13588 gene locus_tag LOCUS_02660 13406 13588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 13750 13881 gene locus_tag LOCUS_02670 13750 13881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 14339 14647 gene locus_tag LOCUS_02680 gene rpsJ 14339 14647 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290443.1 protein_id gnl|my_center|LOCUS_02680 14664 15290 gene locus_tag LOCUS_02690 gene rplC 14664 15290 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_02690 15305 15925 gene locus_tag LOCUS_02700 gene rplD 15305 15925 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357518.1 protein_id gnl|my_center|LOCUS_02700 15922 16215 gene locus_tag LOCUS_02710 gene rplW 15922 16215 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435681.1 protein_id gnl|my_center|LOCUS_02710 16228 17061 gene locus_tag LOCUS_02720 gene rplB 16228 17061 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966409.1 protein_id gnl|my_center|LOCUS_02720 17080 17361 gene locus_tag LOCUS_02730 gene rpsS 17080 17361 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966408.1 protein_id gnl|my_center|LOCUS_02730 17379 17765 gene locus_tag LOCUS_02740 gene rplV 17379 17765 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810154.1 protein_id gnl|my_center|LOCUS_02740 17769 18419 gene locus_tag LOCUS_02750 gene rpsC 17769 18419 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966406.1 protein_id gnl|my_center|LOCUS_02750 18435 18866 gene locus_tag LOCUS_02760 gene rplP 18435 18866 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_02760 18856 19059 gene locus_tag LOCUS_02770 gene rpmC 18856 19059 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357691.1 protein_id gnl|my_center|LOCUS_02770 19072 19350 gene locus_tag LOCUS_02780 gene rpsQ 19072 19350 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966403.1 protein_id gnl|my_center|LOCUS_02780 19366 19734 gene locus_tag LOCUS_02790 gene rplN 19366 19734 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966402.1 protein_id gnl|my_center|LOCUS_02790 19747 20079 gene locus_tag LOCUS_02800 gene rplX 19747 20079 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187422288.1 protein_id gnl|my_center|LOCUS_02800 20095 20718 gene locus_tag LOCUS_02810 gene rplE 20095 20718 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435673.1 protein_id gnl|my_center|LOCUS_02810 20735 20920 gene locus_tag LOCUS_02820 20735 20920 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966399.1 protein_id gnl|my_center|LOCUS_02820 20939 21337 gene locus_tag LOCUS_02830 gene rpsH 20939 21337 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357687.1 protein_id gnl|my_center|LOCUS_02830 21432 21968 gene locus_tag LOCUS_02840 gene rplF 21432 21968 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393922.1 protein_id gnl|my_center|LOCUS_02840 21982 22350 gene locus_tag LOCUS_02850 gene rplR 21982 22350 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645500.1 protein_id gnl|my_center|LOCUS_02850 22363 22872 gene locus_tag LOCUS_02860 gene rpsE 22363 22872 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966395.1 protein_id gnl|my_center|LOCUS_02860 22893 23072 gene locus_tag LOCUS_02870 gene rpmD 22893 23072 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258249.1 protein_id gnl|my_center|LOCUS_02870 23093 23533 gene locus_tag LOCUS_02880 gene rplO 23093 23533 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357513.1 protein_id gnl|my_center|LOCUS_02880 >Feature sequence011 <1 688 gene locus_tag LOCUS_02890 <1 688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002263054.1:aminopeptidase C 1620 685 gene locus_tag LOCUS_02900 1620 685 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360454.1 protein_id gnl|my_center|LOCUS_02900 3077 1617 gene locus_tag LOCUS_02910 3077 1617 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837035.1 protein_id gnl|my_center|LOCUS_02910 4562 3126 gene locus_tag LOCUS_02920 4562 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 5224 4577 gene locus_tag LOCUS_02930 5224 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 7112 5505 gene locus_tag LOCUS_02940 7112 5505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 7577 7164 gene locus_tag LOCUS_02950 7577 7164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 10344 7579 gene locus_tag LOCUS_02960 gene pulA 10344 7579 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082389.1 protein_id gnl|my_center|LOCUS_02960 12342 10357 gene locus_tag LOCUS_02970 12342 10357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 13421 12444 gene locus_tag LOCUS_02980 13421 12444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 16112 13941 gene locus_tag LOCUS_02990 16112 13941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 17065 16109 gene locus_tag LOCUS_03000 17065 16109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 17994 17065 gene locus_tag LOCUS_03010 17994 17065 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135810.1 protein_id gnl|my_center|LOCUS_03010 20358 18685 gene locus_tag LOCUS_03020 20358 18685 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256471.1 protein_id gnl|my_center|LOCUS_03020 22430 20568 gene locus_tag LOCUS_03030 22430 20568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 >Feature sequence012 3150 1642 gene locus_tag LOCUS_03040 gene malQ 3150 1642 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917858.1 protein_id gnl|my_center|LOCUS_03040 3371 5731 gene locus_tag LOCUS_03050 3371 5731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 5965 7077 gene locus_tag LOCUS_03060 gene dnaN 5965 7077 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963331.1 protein_id gnl|my_center|LOCUS_03060 7391 7540 gene locus_tag LOCUS_03070 gene rpmG 7391 7540 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966428.1 protein_id gnl|my_center|LOCUS_03070 7558 7806 gene locus_tag LOCUS_03080 7558 7806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 7819 8439 gene locus_tag LOCUS_03090 gene nusG 7819 8439 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_03090 8546 8971 gene locus_tag LOCUS_03100 gene rplK 8546 8971 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_03100 8985 9680 gene locus_tag LOCUS_03110 gene rplA 8985 9680 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357362.1 protein_id gnl|my_center|LOCUS_03110 9845 10303 gene locus_tag LOCUS_03120 9845 10303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 10315 11493 gene locus_tag LOCUS_03130 10315 11493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 11514 12749 gene locus_tag LOCUS_03140 11514 12749 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987074.1 protein_id gnl|my_center|LOCUS_03140 13029 13274 gene locus_tag LOCUS_03150 13029 13274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 13360 13743 gene locus_tag LOCUS_03160 13360 13743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 14723 13773 gene locus_tag LOCUS_03170 14723 13773 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 protein_id gnl|my_center|LOCUS_03170 15749 14760 gene locus_tag LOCUS_03180 gene argF 15749 14760 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861433.1 protein_id gnl|my_center|LOCUS_03180 16510 15869 gene locus_tag LOCUS_03190 16510 15869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 17416 16544 gene locus_tag LOCUS_03200 17416 16544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 17966 17397 gene locus_tag LOCUS_03210 17966 17397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 18927 18103 gene locus_tag LOCUS_03220 18927 18103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 19590 19042 gene locus_tag LOCUS_03230 19590 19042 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420711.1 protein_id gnl|my_center|LOCUS_03230 20346 19603 gene locus_tag LOCUS_03240 20346 19603 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_03240 21422 20352 gene locus_tag LOCUS_03250 21422 20352 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432442.1 protein_id gnl|my_center|LOCUS_03250 21648 21436 gene locus_tag LOCUS_03260 21648 21436 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420706.1 protein_id gnl|my_center|LOCUS_03260 21900 23060 gene locus_tag LOCUS_03270 21900 23060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 >Feature sequence013 <1 3108 gene locus_tag LOCUS_03280 <1 3108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009292032.1:GH92 family glycosyl hydrolase 3126 3650 gene locus_tag LOCUS_03290 3126 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 3792 3980 gene locus_tag LOCUS_03300 3792 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 6151 4307 gene locus_tag LOCUS_03310 6151 4307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 6368 6667 gene locus_tag LOCUS_03320 6368 6667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 6667 6981 gene locus_tag LOCUS_03330 6667 6981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 7991 7053 gene locus_tag LOCUS_03340 gene arcC 7991 7053 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869022.1 protein_id gnl|my_center|LOCUS_03340 8173 10701 gene locus_tag LOCUS_03350 8173 10701 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_03350 11341 10748 gene locus_tag LOCUS_03360 11341 10748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 12099 11428 gene locus_tag LOCUS_03370 12099 11428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 13002 12391 gene locus_tag LOCUS_03380 gene thyX 13002 12391 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393959.1 protein_id gnl|my_center|LOCUS_03380 13430 12990 gene locus_tag LOCUS_03390 13430 12990 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966160.1 protein_id gnl|my_center|LOCUS_03390 13539 14306 gene locus_tag LOCUS_03400 13539 14306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 14369 15850 gene locus_tag LOCUS_03410 14369 15850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 16590 16009 gene locus_tag LOCUS_03420 16590 16009 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259011.1 protein_id gnl|my_center|LOCUS_03420 17342 16590 gene locus_tag LOCUS_03430 17342 16590 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867289.1 protein_id gnl|my_center|LOCUS_03430 17602 17402 gene locus_tag LOCUS_03440 gene rpmE 17602 17402 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966172.1 protein_id gnl|my_center|LOCUS_03440 17913 18497 gene locus_tag LOCUS_03450 17913 18497 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259761.1 protein_id gnl|my_center|LOCUS_03450 18510 20057 gene locus_tag LOCUS_03460 18510 20057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 20120 20662 gene locus_tag LOCUS_03470 gene thpR 20120 20662 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583814.1 protein_id gnl|my_center|LOCUS_03470 20679 21707 gene locus_tag LOCUS_03480 20679 21707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 21704 22042 gene locus_tag LOCUS_03490 21704 22042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 22055 22192 gene locus_tag LOCUS_03500 22055 22192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 22196 22372 gene locus_tag LOCUS_03510 22196 22372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 22369 22614 gene locus_tag LOCUS_03520 22369 22614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 22595 22882 gene locus_tag LOCUS_03530 22595 22882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 >Feature sequence014 514 164 gene locus_tag LOCUS_03540 514 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018213024.1 protein_id gnl|my_center|LOCUS_03540 651 2543 gene locus_tag LOCUS_03550 gene htpG 651 2543 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966587.1 protein_id gnl|my_center|LOCUS_03550 2547 3113 gene locus_tag LOCUS_03560 2547 3113 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948163.1 protein_id gnl|my_center|LOCUS_03560 4185 3649 gene locus_tag LOCUS_03570 4185 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 4507 4205 gene locus_tag LOCUS_03580 4507 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 4947 4522 gene locus_tag LOCUS_03590 gene ruvX 4947 4522 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440635.1 protein_id gnl|my_center|LOCUS_03590 5221 4952 gene locus_tag LOCUS_03600 5221 4952 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964986.1 protein_id gnl|my_center|LOCUS_03600 5567 5412 gene locus_tag LOCUS_03610 5567 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 5737 6288 gene locus_tag LOCUS_03620 5737 6288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 6954 6484 gene locus_tag LOCUS_03630 6954 6484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 7447 6980 gene locus_tag LOCUS_03640 7447 6980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 8666 7701 gene locus_tag LOCUS_03650 8666 7701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 9359 8757 gene locus_tag LOCUS_03660 9359 8757 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392072.1 protein_id gnl|my_center|LOCUS_03660 9583 10053 gene locus_tag LOCUS_03670 gene mraZ 9583 10053 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723756.1 protein_id gnl|my_center|LOCUS_03670 10050 11006 gene locus_tag LOCUS_03680 gene rsmH 10050 11006 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_03680 11018 11485 gene locus_tag LOCUS_03690 11018 11485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 11511 13688 gene locus_tag LOCUS_03700 11511 13688 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392356.1 protein_id gnl|my_center|LOCUS_03700 13703 15160 gene locus_tag LOCUS_03710 13703 15160 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_03710 15195 16220 gene locus_tag LOCUS_03720 gene mraY 15195 16220 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427000.1 protein_id gnl|my_center|LOCUS_03720 16447 17832 gene locus_tag LOCUS_03730 gene murD 16447 17832 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454967.1 protein_id gnl|my_center|LOCUS_03730 17868 19046 gene locus_tag LOCUS_03740 gene ftsW 17868 19046 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_03740 19144 20091 gene locus_tag LOCUS_03750 19144 20091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 20446 21612 gene locus_tag LOCUS_03760 gene ftsA 20446 21612 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364017.1 protein_id gnl|my_center|LOCUS_03760 21672 22769 gene locus_tag LOCUS_03770 gene ftsZ 21672 22769 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386373.1 protein_id gnl|my_center|LOCUS_03770 >Feature sequence015 2 1411 gene locus_tag LOCUS_03780 2 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 1413 2072 gene locus_tag LOCUS_03790 1413 2072 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546189.1 protein_id gnl|my_center|LOCUS_03790 2086 2595 gene locus_tag LOCUS_03800 gene rimI 2086 2595 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393645.1 protein_id gnl|my_center|LOCUS_03800 2588 2971 gene locus_tag LOCUS_03810 2588 2971 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925584.1 protein_id gnl|my_center|LOCUS_03810 2964 4499 gene locus_tag LOCUS_03820 2964 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 4496 5488 gene locus_tag LOCUS_03830 gene holA 4496 5488 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430958.1 protein_id gnl|my_center|LOCUS_03830 5816 5556 gene locus_tag LOCUS_03840 gene rpsT 5816 5556 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774009.1 protein_id gnl|my_center|LOCUS_03840 5973 6890 gene locus_tag LOCUS_03850 gene gpr 5973 6890 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964587.1 protein_id gnl|my_center|LOCUS_03850 8593 6887 gene locus_tag LOCUS_03860 gene rqcH 8593 6887 CDS product tRNA modification protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886504.1 protein_id gnl|my_center|LOCUS_03860 9345 8593 gene locus_tag LOCUS_03870 9345 8593 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393001.1 protein_id gnl|my_center|LOCUS_03870 10615 9353 gene locus_tag LOCUS_03880 gene clpX 10615 9353 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_03880 11227 10643 gene locus_tag LOCUS_03890 gene clpP 11227 10643 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357557.1 protein_id gnl|my_center|LOCUS_03890 12612 11305 gene locus_tag LOCUS_03900 gene tig 12612 11305 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417090.1 protein_id gnl|my_center|LOCUS_03900 12882 14192 gene locus_tag LOCUS_03910 12882 14192 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964854.1 protein_id gnl|my_center|LOCUS_03910 14211 15233 gene locus_tag LOCUS_03920 gene queA 14211 15233 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965581.1 protein_id gnl|my_center|LOCUS_03920 15249 16370 gene locus_tag LOCUS_03930 gene tgt 15249 16370 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_03930 16363 16827 gene locus_tag LOCUS_03940 gene tsaE 16363 16827 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_03940 16821 17420 gene locus_tag LOCUS_03950 16821 17420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 17692 17423 gene locus_tag LOCUS_03960 gene spoIIID 17692 17423 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420727.1 protein_id gnl|my_center|LOCUS_03960 18596 17802 gene locus_tag LOCUS_03970 18596 17802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 18841 20514 gene locus_tag LOCUS_03980 18841 20514 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460967.1 protein_id gnl|my_center|LOCUS_03980 20578 21756 gene locus_tag LOCUS_03990 20578 21756 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020963.1 protein_id gnl|my_center|LOCUS_03990 >Feature sequence016 531 603 gene locus_tag LOCUS_t00080 531 603 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 761 1012 gene locus_tag LOCUS_04000 gene rpsT 761 1012 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767624.1 protein_id gnl|my_center|LOCUS_04000 1151 3154 gene locus_tag LOCUS_04010 gene gyrB 1151 3154 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763685.1 protein_id gnl|my_center|LOCUS_04010 3844 3233 gene locus_tag LOCUS_04020 3844 3233 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965678.1 protein_id gnl|my_center|LOCUS_04020 4383 3985 gene locus_tag LOCUS_04030 4383 3985 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084116061.1 protein_id gnl|my_center|LOCUS_04030 4592 4383 gene locus_tag LOCUS_04040 4592 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 5247 4597 gene locus_tag LOCUS_04050 5247 4597 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965791.1 protein_id gnl|my_center|LOCUS_04050 6391 5249 gene locus_tag LOCUS_04060 gene hemW 6391 5249 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964591.1 protein_id gnl|my_center|LOCUS_04060 8193 6391 gene locus_tag LOCUS_04070 gene lepA 8193 6391 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229999.1 protein_id gnl|my_center|LOCUS_04070 10186 8213 gene locus_tag LOCUS_04080 gene tkt 10186 8213 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964657.1 protein_id gnl|my_center|LOCUS_04080 11637 10345 gene locus_tag LOCUS_04090 11637 10345 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814758.1 protein_id gnl|my_center|LOCUS_04090 13029 11854 gene locus_tag LOCUS_04100 13029 11854 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_04100 14156 13047 gene locus_tag LOCUS_04110 14156 13047 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_04110 15698 14196 gene locus_tag LOCUS_04120 gene glpK 15698 14196 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_04120 15850 16692 gene locus_tag LOCUS_04130 gene mreC 15850 16692 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048032.1 protein_id gnl|my_center|LOCUS_04130 16692 17204 gene locus_tag LOCUS_04140 16692 17204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 17216 19774 gene locus_tag LOCUS_04150 17216 19774 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964558.1 protein_id gnl|my_center|LOCUS_04150 19809 20921 gene locus_tag LOCUS_04160 19809 20921 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918104.1 protein_id gnl|my_center|LOCUS_04160 20918 21514 gene locus_tag LOCUS_04170 20918 21514 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948910.1 protein_id gnl|my_center|LOCUS_04170 >Feature sequence017 2250 1750 gene locus_tag LOCUS_04180 2250 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 3559 2243 gene locus_tag LOCUS_04190 3559 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 4566 3556 gene locus_tag LOCUS_04200 4566 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 5492 4830 gene locus_tag LOCUS_04210 5492 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 8137 5600 gene locus_tag LOCUS_04220 8137 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 9526 8225 gene locus_tag LOCUS_04230 9526 8225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 10545 9595 gene locus_tag LOCUS_04240 10545 9595 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893618.1 protein_id gnl|my_center|LOCUS_04240 12359 10557 gene locus_tag LOCUS_04250 12359 10557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 13407 12376 gene locus_tag LOCUS_04260 13407 12376 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921892.1 protein_id gnl|my_center|LOCUS_04260 14993 13407 gene locus_tag LOCUS_04270 14993 13407 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902452.1 protein_id gnl|my_center|LOCUS_04270 17455 15287 gene locus_tag LOCUS_04280 17455 15287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 18359 17778 gene locus_tag LOCUS_04290 18359 17778 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948863.1 protein_id gnl|my_center|LOCUS_04290 18624 18379 gene locus_tag LOCUS_04300 18624 18379 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438891.1 protein_id gnl|my_center|LOCUS_04300 18859 18635 gene locus_tag LOCUS_04310 18859 18635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 18981 19124 gene locus_tag LOCUS_04320 18981 19124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 >Feature sequence018 <1 990 gene locus_tag LOCUS_04330 <1 990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250770.1:flippase 1036 2067 gene locus_tag LOCUS_04340 1036 2067 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107231.1 protein_id gnl|my_center|LOCUS_04340 2067 3311 gene locus_tag LOCUS_04350 2067 3311 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107232.1 protein_id gnl|my_center|LOCUS_04350 3326 4453 gene locus_tag LOCUS_04360 gene cap8G 3326 4453 CDS product type 8 capsular polysaccharide synthesis protein Cap8G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413171.1 protein_id gnl|my_center|LOCUS_04360 4571 5419 gene locus_tag LOCUS_04370 4571 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 5419 6906 gene locus_tag LOCUS_04380 5419 6906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 6899 8488 gene locus_tag LOCUS_04390 6899 8488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 8541 9587 gene locus_tag LOCUS_04400 8541 9587 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020704.1 protein_id gnl|my_center|LOCUS_04400 9906 11483 gene locus_tag LOCUS_04410 9906 11483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 12016 11576 gene locus_tag LOCUS_04420 gene aroQ 12016 11576 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083137.1 protein_id gnl|my_center|LOCUS_04420 12103 12846 gene locus_tag LOCUS_04430 12103 12846 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867574.1 protein_id gnl|my_center|LOCUS_04430 13571 12906 gene locus_tag LOCUS_04440 13571 12906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 13745 15394 gene locus_tag LOCUS_04450 13745 15394 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428989.1 protein_id gnl|my_center|LOCUS_04450 15401 16582 gene locus_tag LOCUS_04460 15401 16582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 16659 17927 gene locus_tag LOCUS_04470 16659 17927 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_04470 19358 17970 gene locus_tag LOCUS_04480 gene ssnA 19358 17970 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861868.1 protein_id gnl|my_center|LOCUS_04480 19620 20837 gene locus_tag LOCUS_04490 gene pepT 19620 20837 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460034.1 protein_id gnl|my_center|LOCUS_04490 >Feature sequence019 998 324 gene locus_tag LOCUS_04500 998 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 2846 1032 gene locus_tag LOCUS_04510 2846 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 3127 2837 gene locus_tag LOCUS_04520 3127 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 3940 3764 gene locus_tag LOCUS_04530 3940 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 4120 5061 gene locus_tag LOCUS_04540 4120 5061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 5078 6130 gene locus_tag LOCUS_04550 5078 6130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 6205 6660 gene locus_tag LOCUS_04560 gene rplI 6205 6660 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048442.1 protein_id gnl|my_center|LOCUS_04560 6663 8006 gene locus_tag LOCUS_04570 6663 8006 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966975.1 protein_id gnl|my_center|LOCUS_04570 8240 8995 gene locus_tag LOCUS_04580 8240 8995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 9857 9030 gene locus_tag LOCUS_04590 9857 9030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 9957 10709 gene locus_tag LOCUS_04600 9957 10709 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549867.1 protein_id gnl|my_center|LOCUS_04600 10706 11425 gene locus_tag LOCUS_04610 10706 11425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 11539 11961 gene locus_tag LOCUS_04620 11539 11961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 12290 12003 gene locus_tag LOCUS_04630 12290 12003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 12544 12305 gene locus_tag LOCUS_04640 12544 12305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 13145 12657 gene locus_tag LOCUS_04650 gene rplQ 13145 12657 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357477.1 protein_id gnl|my_center|LOCUS_04650 14127 13186 gene locus_tag LOCUS_04660 14127 13186 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810110.1 protein_id gnl|my_center|LOCUS_04660 14828 14199 gene locus_tag LOCUS_04670 gene rpsD 14828 14199 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_04670 15248 14844 gene locus_tag LOCUS_04680 gene rpsK 15248 14844 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401717.1 protein_id gnl|my_center|LOCUS_04680 15629 15264 gene locus_tag LOCUS_04690 gene rpsM 15629 15264 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966388.1 protein_id gnl|my_center|LOCUS_04690 16331 16110 gene locus_tag LOCUS_04700 gene infA 16331 16110 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_04700 16689 16333 gene locus_tag LOCUS_04710 16689 16333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 17507 16743 gene locus_tag LOCUS_04720 gene map 17507 16743 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_04720 18194 17565 gene locus_tag LOCUS_04730 18194 17565 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357697.1 protein_id gnl|my_center|LOCUS_04730 19602 18211 gene locus_tag LOCUS_04740 gene secY 19602 18211 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810127.1 protein_id gnl|my_center|LOCUS_04740 20042 19602 gene locus_tag LOCUS_04750 gene rplO 20042 19602 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936637.1 protein_id gnl|my_center|LOCUS_04750 20234 20055 gene locus_tag LOCUS_04760 gene rpmD 20234 20055 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894509.1 protein_id gnl|my_center|LOCUS_04760 20757 20248 gene locus_tag LOCUS_04770 gene rpsE 20757 20248 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966395.1 protein_id gnl|my_center|LOCUS_04770 >Feature sequence020 1253 177 gene locus_tag LOCUS_04780 1253 177 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941317.1 protein_id gnl|my_center|LOCUS_04780 1924 1274 gene locus_tag LOCUS_04790 1924 1274 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926669.1 protein_id gnl|my_center|LOCUS_04790 3157 1973 gene locus_tag LOCUS_04800 3157 1973 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003392901.1 protein_id gnl|my_center|LOCUS_04800 4082 3312 gene locus_tag LOCUS_04810 4082 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 5131 4079 gene locus_tag LOCUS_04820 gene aroC 5131 4079 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964214.1 protein_id gnl|my_center|LOCUS_04820 6246 5146 gene locus_tag LOCUS_04830 gene aroA 6246 5146 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_04830 6360 8345 gene locus_tag LOCUS_04840 6360 8345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 10013 8445 gene locus_tag LOCUS_04850 10013 8445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 11300 10068 gene locus_tag LOCUS_04860 11300 10068 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920595.1 protein_id gnl|my_center|LOCUS_04860 11506 12480 gene locus_tag LOCUS_04870 11506 12480 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769713.1 protein_id gnl|my_center|LOCUS_04870 12749 12483 gene locus_tag LOCUS_04880 12749 12483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 13511 12762 gene locus_tag LOCUS_04890 13511 12762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 13979 13542 gene locus_tag LOCUS_04900 13979 13542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 15136 13964 gene locus_tag LOCUS_04910 15136 13964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 16368 15157 gene locus_tag LOCUS_04920 16368 15157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 16791 16387 gene locus_tag LOCUS_04930 16791 16387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 17129 17425 gene locus_tag LOCUS_04940 17129 17425 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229490.1 protein_id gnl|my_center|LOCUS_04940 17556 19805 gene locus_tag LOCUS_04950 17556 19805 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461677.1 protein_id gnl|my_center|LOCUS_04950 19897 20376 gene locus_tag LOCUS_04960 19897 20376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 >Feature sequence021 1477 575 gene locus_tag LOCUS_04970 1477 575 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964846.1 protein_id gnl|my_center|LOCUS_04970 2741 1818 gene locus_tag LOCUS_04980 2741 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 3747 2941 gene locus_tag LOCUS_04990 3747 2941 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674361.1 protein_id gnl|my_center|LOCUS_04990 4879 3734 gene locus_tag LOCUS_05000 4879 3734 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237280.1 protein_id gnl|my_center|LOCUS_05000 6099 5239 gene locus_tag LOCUS_05010 6099 5239 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434193.1 protein_id gnl|my_center|LOCUS_05010 6536 6225 gene locus_tag LOCUS_05020 6536 6225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 6964 6563 gene locus_tag LOCUS_05030 6964 6563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 7573 6968 gene locus_tag LOCUS_05040 7573 6968 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802006.1 protein_id gnl|my_center|LOCUS_05040 8612 7653 gene locus_tag LOCUS_05050 8612 7653 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027305.1 protein_id gnl|my_center|LOCUS_05050 9306 9605 gene locus_tag LOCUS_05060 gene citD 9306 9605 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263227.1 protein_id gnl|my_center|LOCUS_05060 9626 10495 gene locus_tag LOCUS_05070 gene citE 9626 10495 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922329.1 protein_id gnl|my_center|LOCUS_05070 10506 12047 gene locus_tag LOCUS_05080 gene citF 10506 12047 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263225.1 protein_id gnl|my_center|LOCUS_05080 12122 13150 gene locus_tag LOCUS_05090 gene citC 12122 13150 CDS product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704362.1 protein_id gnl|my_center|LOCUS_05090 13150 13893 gene locus_tag LOCUS_05100 13150 13893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 13890 15458 gene locus_tag LOCUS_05110 gene citG 13890 15458 CDS product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668027.1 protein_id gnl|my_center|LOCUS_05110 15455 16276 gene locus_tag LOCUS_05120 gene murI 15455 16276 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048400.1 protein_id gnl|my_center|LOCUS_05120 16269 16850 gene locus_tag LOCUS_05130 16269 16850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 17220 16918 gene locus_tag LOCUS_05140 17220 16918 CDS product cysteine-rich small domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437519.1 protein_id gnl|my_center|LOCUS_05140 18138 17233 gene locus_tag LOCUS_05150 gene trxB 18138 17233 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434033.1 protein_id gnl|my_center|LOCUS_05150 18312 18752 gene locus_tag LOCUS_05160 18312 18752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 20101 18809 gene locus_tag LOCUS_05170 20101 18809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 >Feature sequence022 1651 350 gene locus_tag LOCUS_05180 1651 350 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392478.1 protein_id gnl|my_center|LOCUS_05180 2477 1644 gene locus_tag LOCUS_05190 2477 1644 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965364.1 protein_id gnl|my_center|LOCUS_05190 3546 2470 gene locus_tag LOCUS_05200 gene mtnA 3546 2470 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948892.1 protein_id gnl|my_center|LOCUS_05200 3876 3550 gene locus_tag LOCUS_05210 3876 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 4615 3902 gene locus_tag LOCUS_05220 4615 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 5853 4612 gene locus_tag LOCUS_05230 5853 4612 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345604.1 protein_id gnl|my_center|LOCUS_05230 6203 8278 gene locus_tag LOCUS_05240 6203 8278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 8469 9395 gene locus_tag LOCUS_05250 8469 9395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 9502 10002 gene locus_tag LOCUS_05260 9502 10002 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987071.1 protein_id gnl|my_center|LOCUS_05260 10261 10106 gene locus_tag LOCUS_05270 10261 10106 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688501.1 protein_id gnl|my_center|LOCUS_05270 10827 10291 gene locus_tag LOCUS_05280 10827 10291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 11148 10840 gene locus_tag LOCUS_05290 gene trxA 11148 10840 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329897.1 protein_id gnl|my_center|LOCUS_05290 11769 11263 gene locus_tag LOCUS_05300 11769 11263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 11925 12815 gene locus_tag LOCUS_05310 11925 12815 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812450.1 protein_id gnl|my_center|LOCUS_05310 12788 14431 gene locus_tag LOCUS_05320 12788 14431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 14418 15152 gene locus_tag LOCUS_05330 14418 15152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 15164 16210 gene locus_tag LOCUS_05340 15164 16210 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966712.1 protein_id gnl|my_center|LOCUS_05340 16221 17546 gene locus_tag LOCUS_05350 16221 17546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 17644 18372 gene locus_tag LOCUS_05360 17644 18372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 >Feature sequence023 1286 732 gene locus_tag LOCUS_05370 1286 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 1498 2703 gene locus_tag LOCUS_05380 gene pgsB 1498 2703 CDS product poly-gamma-glutamate synthase PgsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227883.1 protein_id gnl|my_center|LOCUS_05380 2709 3170 gene locus_tag LOCUS_05390 gene pgsC 2709 3170 CDS product poly-gamma-glutamate biosynthesis protein PgsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943109.1 protein_id gnl|my_center|LOCUS_05390 3186 4355 gene locus_tag LOCUS_05400 gene pgsA 3186 4355 CDS product capsular polyglutamate synthetase PgsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243306.1 protein_id gnl|my_center|LOCUS_05400 4369 6153 gene locus_tag LOCUS_05410 gene ggt 4369 6153 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231470.1 protein_id gnl|my_center|LOCUS_05410 6262 6882 gene locus_tag LOCUS_05420 6262 6882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 6916 7902 gene locus_tag LOCUS_05430 6916 7902 CDS product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965559.1 protein_id gnl|my_center|LOCUS_05430 9208 7979 gene locus_tag LOCUS_05440 9208 7979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 9431 11203 gene locus_tag LOCUS_05450 9431 11203 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679753.1 protein_id gnl|my_center|LOCUS_05450 11200 11709 gene locus_tag LOCUS_05460 11200 11709 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143027.1 protein_id gnl|my_center|LOCUS_05460 12423 12052 gene locus_tag LOCUS_05470 12423 12052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 13611 12706 gene locus_tag LOCUS_05480 13611 12706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 14405 13707 gene locus_tag LOCUS_05490 14405 13707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 14642 16144 gene locus_tag LOCUS_05500 gene hutH 14642 16144 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017128.1 protein_id gnl|my_center|LOCUS_05500 >Feature sequence024 361 561 gene locus_tag LOCUS_05510 361 561 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_05510 595 834 gene locus_tag LOCUS_05520 595 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 991 2208 gene locus_tag LOCUS_05530 991 2208 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_05530 3710 2655 gene locus_tag LOCUS_05540 3710 2655 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475608.1 protein_id gnl|my_center|LOCUS_05540 4647 3766 gene locus_tag LOCUS_05550 4647 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 5280 4657 gene locus_tag LOCUS_05560 5280 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 5419 5625 gene locus_tag LOCUS_05570 5419 5625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 5618 5752 gene locus_tag LOCUS_05580 5618 5752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 5768 6019 gene locus_tag LOCUS_05590 5768 6019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 5997 6239 gene locus_tag LOCUS_05600 5997 6239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 6221 6391 gene locus_tag LOCUS_05610 6221 6391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 6401 6535 gene locus_tag LOCUS_05620 6401 6535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 6535 6777 gene locus_tag LOCUS_05630 6535 6777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 6774 7031 gene locus_tag LOCUS_05640 6774 7031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 7028 7192 gene locus_tag LOCUS_05650 7028 7192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 7243 7590 gene locus_tag LOCUS_05660 7243 7590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 7600 9315 gene locus_tag LOCUS_05670 7600 9315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 9269 10273 gene locus_tag LOCUS_05680 9269 10273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 10478 10999 gene locus_tag LOCUS_05690 10478 10999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 10986 11225 gene locus_tag LOCUS_05700 10986 11225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 11225 11665 gene locus_tag LOCUS_05710 11225 11665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 11658 11870 gene locus_tag LOCUS_05720 11658 11870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 11867 12448 gene locus_tag LOCUS_05730 11867 12448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 12435 12662 gene locus_tag LOCUS_05740 12435 12662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 12756 13649 gene locus_tag LOCUS_05750 12756 13649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 13646 14293 gene locus_tag LOCUS_05760 13646 14293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 14283 14678 gene locus_tag LOCUS_05770 14283 14678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 14668 14943 gene locus_tag LOCUS_05780 14668 14943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 14943 15404 gene locus_tag LOCUS_05790 14943 15404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 15553 15816 gene locus_tag LOCUS_05800 15553 15816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 15785 16312 gene locus_tag LOCUS_05810 15785 16312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 16305 17339 gene locus_tag LOCUS_05820 16305 17339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05820 >Feature sequence025 4245 3733 gene locus_tag LOCUS_05830 4245 3733 CDS product DNA topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684238.1 protein_id gnl|my_center|LOCUS_05830 4970 4254 gene locus_tag LOCUS_05840 gene recO 4970 4254 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487015.1 protein_id gnl|my_center|LOCUS_05840 6083 5178 gene locus_tag LOCUS_05850 gene era 6083 5178 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_05850 6501 6085 gene locus_tag LOCUS_05860 6501 6085 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721969.1 protein_id gnl|my_center|LOCUS_05860 6944 6498 gene locus_tag LOCUS_05870 gene ybeY 6944 6498 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816440.1 protein_id gnl|my_center|LOCUS_05870 8515 6941 gene locus_tag LOCUS_05880 8515 6941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 9515 8526 gene locus_tag LOCUS_05890 9515 8526 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840510.1 protein_id gnl|my_center|LOCUS_05890 10657 9515 gene locus_tag LOCUS_05900 gene yqfD 10657 9515 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047998.1 protein_id gnl|my_center|LOCUS_05900 10980 10672 gene locus_tag LOCUS_05910 10980 10672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 12329 11124 gene locus_tag LOCUS_05920 12329 11124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 13347 12331 gene locus_tag LOCUS_05930 13347 12331 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680378.1 protein_id gnl|my_center|LOCUS_05930 14419 13385 gene locus_tag LOCUS_05940 14419 13385 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141484866.1 protein_id gnl|my_center|LOCUS_05940 16199 14433 gene locus_tag LOCUS_05950 16199 14433 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964921.1 protein_id gnl|my_center|LOCUS_05950 16392 16189 gene locus_tag LOCUS_05960 16392 16189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 >Feature sequence026 379 678 gene locus_tag LOCUS_05970 379 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 675 3686 gene locus_tag LOCUS_05980 675 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 3683 4354 gene locus_tag LOCUS_05990 3683 4354 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454838.1 protein_id gnl|my_center|LOCUS_05990 6490 4415 gene locus_tag LOCUS_06000 gene fusA 6490 4415 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_06000 6751 7452 gene locus_tag LOCUS_06010 gene pyrH 6751 7452 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215090.1 protein_id gnl|my_center|LOCUS_06010 7544 8098 gene locus_tag LOCUS_06020 gene frr 7544 8098 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810666.1 protein_id gnl|my_center|LOCUS_06020 8095 8292 gene locus_tag LOCUS_06030 8095 8292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 8302 9048 gene locus_tag LOCUS_06040 8302 9048 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469563.1 protein_id gnl|my_center|LOCUS_06040 9106 9921 gene locus_tag LOCUS_06050 9106 9921 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434000.1 protein_id gnl|my_center|LOCUS_06050 9928 11073 gene locus_tag LOCUS_06060 9928 11073 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931819.1 protein_id gnl|my_center|LOCUS_06060 11077 12189 gene locus_tag LOCUS_06070 gene rseP 11077 12189 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583162.1 protein_id gnl|my_center|LOCUS_06070 12199 13242 gene locus_tag LOCUS_06080 gene ispG 12199 13242 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986795.1 protein_id gnl|my_center|LOCUS_06080 >Feature sequence027 1016 941 gene locus_tag LOCUS_t00090 1016 941 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2691 1165 gene locus_tag LOCUS_06090 2691 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 2869 3357 gene locus_tag LOCUS_06100 2869 3357 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966687.1 protein_id gnl|my_center|LOCUS_06100 5068 3392 gene locus_tag LOCUS_06110 5068 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 5277 5984 gene locus_tag LOCUS_06120 5277 5984 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250526.1 protein_id gnl|my_center|LOCUS_06120 6036 8192 gene locus_tag LOCUS_06130 6036 8192 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948404.1 protein_id gnl|my_center|LOCUS_06130 8292 9491 gene locus_tag LOCUS_06140 gene pncB 8292 9491 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010358295.1 protein_id gnl|my_center|LOCUS_06140 10691 9549 gene locus_tag LOCUS_06150 10691 9549 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964085.1 protein_id gnl|my_center|LOCUS_06150 10970 12571 gene locus_tag LOCUS_06160 gene pyrG 10970 12571 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170458.1 protein_id gnl|my_center|LOCUS_06160 13539 12616 gene locus_tag LOCUS_06170 13539 12616 CDS product CorA family divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682345.1 protein_id gnl|my_center|LOCUS_06170 14236 13553 gene locus_tag LOCUS_06180 14236 13553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 15428 14259 gene locus_tag LOCUS_06190 15428 14259 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379231.1 protein_id gnl|my_center|LOCUS_06190 >Feature sequence028 778 266 gene locus_tag LOCUS_06200 778 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 1308 805 gene locus_tag LOCUS_06210 1308 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 1719 1321 gene locus_tag LOCUS_06220 1719 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 2212 1754 gene locus_tag LOCUS_06230 2212 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 2677 2291 gene locus_tag LOCUS_06240 2677 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 3058 2690 gene locus_tag LOCUS_06250 3058 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 3335 4810 gene locus_tag LOCUS_06260 3335 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 5028 5732 gene locus_tag LOCUS_06270 5028 5732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 5729 6376 gene locus_tag LOCUS_06280 gene fabG 5729 6376 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792012.1 protein_id gnl|my_center|LOCUS_06280 6900 6463 gene locus_tag LOCUS_06290 6900 6463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643513.1 protein_id gnl|my_center|LOCUS_06290 7066 7512 gene locus_tag LOCUS_06300 7066 7512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 7871 7560 gene locus_tag LOCUS_06310 7871 7560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 8200 10317 gene locus_tag LOCUS_06320 8200 10317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 10319 11554 gene locus_tag LOCUS_06330 10319 11554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 11559 12440 gene locus_tag LOCUS_06340 11559 12440 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048019.1 protein_id gnl|my_center|LOCUS_06340 12624 13508 gene locus_tag LOCUS_06350 12624 13508 CDS product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850516.1 protein_id gnl|my_center|LOCUS_06350 14455 13781 gene locus_tag LOCUS_06360 14455 13781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 15015 14455 gene locus_tag LOCUS_06370 15015 14455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 15636 16406 gene locus_tag LOCUS_06380 15636 16406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 >Feature sequence029 2518 341 gene locus_tag LOCUS_06390 2518 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 3273 2515 gene locus_tag LOCUS_06400 3273 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 4478 3300 gene locus_tag LOCUS_06410 4478 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 5749 4547 gene locus_tag LOCUS_06420 5749 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 6517 6693 gene locus_tag LOCUS_06430 6517 6693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 6823 7200 gene locus_tag LOCUS_06440 6823 7200 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814133.1 protein_id gnl|my_center|LOCUS_06440 7201 9195 gene locus_tag LOCUS_06450 7201 9195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 9230 10594 gene locus_tag LOCUS_06460 9230 10594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 10604 13030 gene locus_tag LOCUS_06470 10604 13030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 13167 14708 gene locus_tag LOCUS_06480 13167 14708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 14714 14881 gene locus_tag LOCUS_06490 14714 14881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 14944 16197 gene locus_tag LOCUS_06500 14944 16197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 >Feature sequence030 <1 909 gene locus_tag LOCUS_06510 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070666.1:tryptophan--tRNA ligase 935 1756 gene locus_tag LOCUS_06520 935 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 1861 2997 gene locus_tag LOCUS_06530 1861 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 4038 3070 gene locus_tag LOCUS_06540 4038 3070 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_06540 4222 4040 gene locus_tag LOCUS_06550 4222 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06550 5983 4259 gene locus_tag LOCUS_06560 gene ligA 5983 4259 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965961.1 protein_id gnl|my_center|LOCUS_06560 8289 5995 gene locus_tag LOCUS_06570 gene pcrA 8289 5995 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674369.1 protein_id gnl|my_center|LOCUS_06570 9464 8286 gene locus_tag LOCUS_06580 9464 8286 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679364.1 protein_id gnl|my_center|LOCUS_06580 10033 9464 gene locus_tag LOCUS_06590 10033 9464 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965300.1 protein_id gnl|my_center|LOCUS_06590 11781 10051 gene locus_tag LOCUS_06600 gene iorA 11781 10051 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_06600 11940 13532 gene locus_tag LOCUS_06610 11940 13532 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048527824.1 protein_id gnl|my_center|LOCUS_06610 13529 14626 gene locus_tag LOCUS_06620 13529 14626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 14623 15828 gene locus_tag LOCUS_06630 14623 15828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 15828 15974 gene locus_tag LOCUS_06640 15828 15974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 >Feature sequence031 159 34 gene locus_tag LOCUS_06650 159 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 6952 200 gene locus_tag LOCUS_06660 6952 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 8038 6971 gene locus_tag LOCUS_06670 8038 6971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 8223 9500 gene locus_tag LOCUS_06680 8223 9500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 9665 10486 gene locus_tag LOCUS_06690 9665 10486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 10511 11527 gene locus_tag LOCUS_06700 10511 11527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 12697 11591 gene locus_tag LOCUS_06710 12697 11591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 12878 13600 gene locus_tag LOCUS_06720 12878 13600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 13674 13901 gene locus_tag LOCUS_06730 13674 13901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 13913 14209 gene locus_tag LOCUS_06740 13913 14209 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939281.1 protein_id gnl|my_center|LOCUS_06740 15690 14458 gene locus_tag LOCUS_06750 15690 14458 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073727.1 protein_id gnl|my_center|LOCUS_06750 >Feature sequence032 1038 664 gene locus_tag LOCUS_06760 1038 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 1233 2246 gene locus_tag LOCUS_06770 1233 2246 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963925.1 protein_id gnl|my_center|LOCUS_06770 2248 2607 gene locus_tag LOCUS_06780 2248 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 4155 2665 gene locus_tag LOCUS_06790 4155 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 5328 4321 gene locus_tag LOCUS_06800 5328 4321 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028324.1 protein_id gnl|my_center|LOCUS_06800 5499 6530 gene locus_tag LOCUS_06810 5499 6530 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902145.1 protein_id gnl|my_center|LOCUS_06810 6685 8529 gene locus_tag LOCUS_06820 gene typA 6685 8529 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 protein_id gnl|my_center|LOCUS_06820 8578 9096 gene locus_tag LOCUS_06830 8578 9096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 9173 10144 gene locus_tag LOCUS_06840 9173 10144 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_06840 10163 11095 gene locus_tag LOCUS_06850 gene cysK 10163 11095 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_06850 11256 11978 gene locus_tag LOCUS_06860 11256 11978 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454770.1 protein_id gnl|my_center|LOCUS_06860 11975 14089 gene locus_tag LOCUS_06870 11975 14089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 14086 15339 gene locus_tag LOCUS_06880 14086 15339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 >Feature sequence033 128 919 gene locus_tag LOCUS_06890 128 919 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_06890 922 2259 gene locus_tag LOCUS_06900 922 2259 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437815.1 protein_id gnl|my_center|LOCUS_06900 2432 5905 gene locus_tag LOCUS_06910 gene mfd 2432 5905 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048383.1 protein_id gnl|my_center|LOCUS_06910 5925 7292 gene locus_tag LOCUS_06920 5925 7292 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986389.1 protein_id gnl|my_center|LOCUS_06920 7289 7867 gene locus_tag LOCUS_06930 7289 7867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 7777 8190 gene locus_tag LOCUS_06940 7777 8190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 8442 8227 gene locus_tag LOCUS_06950 8442 8227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 8635 9675 gene locus_tag LOCUS_06960 8635 9675 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420729.1 protein_id gnl|my_center|LOCUS_06960 9796 11313 gene locus_tag LOCUS_06970 9796 11313 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454621.1 protein_id gnl|my_center|LOCUS_06970 11313 12473 gene locus_tag LOCUS_06980 11313 12473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 12470 13246 gene locus_tag LOCUS_06990 12470 13246 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815002.1 protein_id gnl|my_center|LOCUS_06990 14535 13816 gene locus_tag LOCUS_07000 14535 13816 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880775.1 protein_id gnl|my_center|LOCUS_07000 <15378 14566 gene locus_tag LOCUS_07010 <15378 14566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964615.1:Nif3-like dinuclear metal center hexameric protein >Feature sequence034 <1 652 gene locus_tag LOCUS_07020 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013094783.1:sugar-phosphatase 657 1562 gene locus_tag LOCUS_07030 657 1562 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416574.1 protein_id gnl|my_center|LOCUS_07030 1579 2256 gene locus_tag LOCUS_07040 1579 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141459.1 protein_id gnl|my_center|LOCUS_07040 2332 3609 gene locus_tag LOCUS_07050 2332 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 3645 4121 gene locus_tag LOCUS_07060 3645 4121 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392594.1 protein_id gnl|my_center|LOCUS_07060 4121 5704 gene locus_tag LOCUS_07070 4121 5704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 5717 6895 gene locus_tag LOCUS_07080 5717 6895 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964358.1 protein_id gnl|my_center|LOCUS_07080 6899 7468 gene locus_tag LOCUS_07090 6899 7468 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_07090 7555 8118 gene locus_tag LOCUS_07100 gene rsmD 7555 8118 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_07100 8115 8588 gene locus_tag LOCUS_07110 gene coaD 8115 8588 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200601.1 protein_id gnl|my_center|LOCUS_07110 8591 9319 gene locus_tag LOCUS_07120 8591 9319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 10084 9332 gene locus_tag LOCUS_07130 10084 9332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 10020 10244 gene locus_tag LOCUS_07140 10020 10244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 11632 10427 gene locus_tag LOCUS_07150 11632 10427 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861133.1 protein_id gnl|my_center|LOCUS_07150 11739 12737 gene locus_tag LOCUS_07160 gene pta 11739 12737 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_07160 12752 13951 gene locus_tag LOCUS_07170 12752 13951 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438096.1 protein_id gnl|my_center|LOCUS_07170 14143 14658 gene locus_tag LOCUS_07180 14143 14658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 14671 14862 gene locus_tag LOCUS_07190 gene rpmF 14671 14862 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362601.1 protein_id gnl|my_center|LOCUS_07190 15033 15109 gene locus_tag LOCUS_t00100 15033 15109 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 15117 15191 gene locus_tag LOCUS_t00110 15117 15191 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 15198 15274 gene locus_tag LOCUS_t00120 15198 15274 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 15285 15361 gene locus_tag LOCUS_t00130 15285 15361 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence035 288 1571 gene locus_tag LOCUS_07200 288 1571 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000353378.1 protein_id gnl|my_center|LOCUS_07200 2335 1928 gene locus_tag LOCUS_07210 2335 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 3536 2316 gene locus_tag LOCUS_07220 3536 2316 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964224.1 protein_id gnl|my_center|LOCUS_07220 5101 3551 gene locus_tag LOCUS_07230 5101 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 6163 5102 gene locus_tag LOCUS_07240 6163 5102 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965529.1 protein_id gnl|my_center|LOCUS_07240 6479 7912 gene locus_tag LOCUS_07250 gene purF 6479 7912 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964701.1 protein_id gnl|my_center|LOCUS_07250 7918 8646 gene locus_tag LOCUS_07260 7918 8646 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948252.1 protein_id gnl|my_center|LOCUS_07260 8647 9393 gene locus_tag LOCUS_07270 8647 9393 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890403.1 protein_id gnl|my_center|LOCUS_07270 9531 10244 gene locus_tag LOCUS_07280 9531 10244 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047943.1 protein_id gnl|my_center|LOCUS_07280 10231 11541 gene locus_tag LOCUS_07290 10231 11541 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966856.1 protein_id gnl|my_center|LOCUS_07290 11557 12972 gene locus_tag LOCUS_07300 gene purB 11557 12972 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_07300 14084 13110 gene locus_tag LOCUS_07310 14084 13110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 >Feature sequence036 1975 1466 gene locus_tag LOCUS_07320 1975 1466 CDS product SLOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485423.1 protein_id gnl|my_center|LOCUS_07320 2688 1975 gene locus_tag LOCUS_07330 2688 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357453.1 protein_id gnl|my_center|LOCUS_07330 4300 2705 gene locus_tag LOCUS_07340 4300 2705 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048336.1 protein_id gnl|my_center|LOCUS_07340 5723 4338 gene locus_tag LOCUS_07350 5723 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 6579 5683 gene locus_tag LOCUS_07360 gene cdaA 6579 5683 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360232.1 protein_id gnl|my_center|LOCUS_07360 6815 9637 gene locus_tag LOCUS_07370 6815 9637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 9714 10859 gene locus_tag LOCUS_07380 9714 10859 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391743.1 protein_id gnl|my_center|LOCUS_07380 10974 12104 gene locus_tag LOCUS_07390 gene thiI 10974 12104 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966254.1 protein_id gnl|my_center|LOCUS_07390 12101 12817 gene locus_tag LOCUS_07400 12101 12817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 12990 13751 gene locus_tag LOCUS_07410 gene rpsB 12990 13751 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_07410 >Feature sequence037 1337 198 gene locus_tag LOCUS_07420 gene tgt 1337 198 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965580.1 protein_id gnl|my_center|LOCUS_07420 2243 1371 gene locus_tag LOCUS_07430 2243 1371 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392086.1 protein_id gnl|my_center|LOCUS_07430 2931 2245 gene locus_tag LOCUS_07440 2931 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 3610 2984 gene locus_tag LOCUS_07450 3610 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 3817 3936 gene locus_tag LOCUS_07460 3817 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 4636 4013 gene locus_tag LOCUS_07470 4636 4013 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198805.1 protein_id gnl|my_center|LOCUS_07470 4767 6566 gene locus_tag LOCUS_07480 4767 6566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 7136 6645 gene locus_tag LOCUS_07490 7136 6645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 7634 7203 gene locus_tag LOCUS_07500 gene sepF 7634 7203 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360699.1 protein_id gnl|my_center|LOCUS_07500 8496 7783 gene locus_tag LOCUS_07510 8496 7783 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082246.1 protein_id gnl|my_center|LOCUS_07510 9692 8478 gene locus_tag LOCUS_07520 9692 8478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 10060 9689 gene locus_tag LOCUS_07530 10060 9689 CDS product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284098.1 protein_id gnl|my_center|LOCUS_07530 11337 10057 gene locus_tag LOCUS_07540 11337 10057 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392573.1 protein_id gnl|my_center|LOCUS_07540 12101 11415 gene locus_tag LOCUS_07550 12101 11415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 12310 13701 gene locus_tag LOCUS_07560 12310 13701 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964406.1 protein_id gnl|my_center|LOCUS_07560 >Feature sequence038 985 221 gene locus_tag LOCUS_07570 985 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 1081 2781 gene locus_tag LOCUS_07580 gene argS 1081 2781 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436885.1 protein_id gnl|my_center|LOCUS_07580 3015 3752 gene locus_tag LOCUS_07590 3015 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 3882 4913 gene locus_tag LOCUS_07600 gene prfB 3882 4913 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181244843.1 protein_id gnl|my_center|LOCUS_07600 4980 6791 gene locus_tag LOCUS_07610 4980 6791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 7664 6843 gene locus_tag LOCUS_07620 7664 6843 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262663.1 protein_id gnl|my_center|LOCUS_07620 7975 7664 gene locus_tag LOCUS_07630 7975 7664 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681704.1 protein_id gnl|my_center|LOCUS_07630 10457 8043 gene locus_tag LOCUS_07640 gene pheT 10457 8043 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_07640 11516 10488 gene locus_tag LOCUS_07650 gene pheS 11516 10488 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436795.1 protein_id gnl|my_center|LOCUS_07650 11916 13868 gene locus_tag LOCUS_07660 11916 13868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 >Feature sequence039 248 117 gene locus_tag LOCUS_07670 248 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 2918 429 gene locus_tag LOCUS_07680 2918 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 4649 3300 gene locus_tag LOCUS_07690 gene gdhA 4649 3300 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020063.1 protein_id gnl|my_center|LOCUS_07690 4858 5517 gene locus_tag LOCUS_07700 4858 5517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 5542 7905 gene locus_tag LOCUS_07710 5542 7905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 9554 8367 gene locus_tag LOCUS_07720 9554 8367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 10514 9600 gene locus_tag LOCUS_07730 10514 9600 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674286.1 protein_id gnl|my_center|LOCUS_07730 11849 10605 gene locus_tag LOCUS_07740 11849 10605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 13477 11846 gene locus_tag LOCUS_07750 13477 11846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 >Feature sequence040 <1 1555 gene locus_tag LOCUS_07760 <1 1555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048348.1:Na/Pi cotransporter family protein 2899 1634 gene locus_tag LOCUS_07770 2899 1634 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204864755.1 protein_id gnl|my_center|LOCUS_07770 2948 3151 gene locus_tag LOCUS_07780 2948 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 3195 3314 gene locus_tag LOCUS_07790 3195 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 3314 3868 gene locus_tag LOCUS_07800 3314 3868 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_07800 5164 3983 gene locus_tag LOCUS_07810 gene hydF 5164 3983 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546707.1 protein_id gnl|my_center|LOCUS_07810 6623 5166 gene locus_tag LOCUS_07820 gene hydG 6623 5166 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_07820 7721 6672 gene locus_tag LOCUS_07830 gene hydE 7721 6672 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048412.1 protein_id gnl|my_center|LOCUS_07830 7978 7718 gene locus_tag LOCUS_07840 7978 7718 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868899.1 protein_id gnl|my_center|LOCUS_07840 8465 9277 gene locus_tag LOCUS_07850 gene rhaD 8465 9277 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924506.1 protein_id gnl|my_center|LOCUS_07850 9666 9355 gene locus_tag LOCUS_07860 9666 9355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 10819 9692 gene locus_tag LOCUS_07870 10819 9692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 11696 10902 gene locus_tag LOCUS_07880 11696 10902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 12880 11699 gene locus_tag LOCUS_07890 12880 11699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 >Feature sequence041 739 2142 gene locus_tag LOCUS_07900 739 2142 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_07900 2519 3733 gene locus_tag LOCUS_07910 gene tyrS 2519 3733 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_07910 3761 4093 gene locus_tag LOCUS_07920 3761 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 4497 4180 gene locus_tag LOCUS_07930 4497 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 5932 4511 gene locus_tag LOCUS_07940 5932 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 6488 5925 gene locus_tag LOCUS_07950 6488 5925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 7899 6592 gene locus_tag LOCUS_07960 7899 6592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 8071 8913 gene locus_tag LOCUS_07970 8071 8913 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680483.1 protein_id gnl|my_center|LOCUS_07970 8906 9373 gene locus_tag LOCUS_07980 8906 9373 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793479.1 protein_id gnl|my_center|LOCUS_07980 9376 10206 gene locus_tag LOCUS_07990 9376 10206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 10203 10904 gene locus_tag LOCUS_08000 10203 10904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 10897 11970 gene locus_tag LOCUS_08010 gene tsaD 10897 11970 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_08010 12072 12154 gene locus_tag LOCUS_t00140 12072 12154 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12499 13290 gene locus_tag LOCUS_08020 12499 13290 CDS product aminoglycoside 3'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547977.1 protein_id gnl|my_center|LOCUS_08020 >Feature sequence042 1 558 gene locus_tag LOCUS_08030 1 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 574 2253 gene locus_tag LOCUS_08040 574 2253 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_08040 2253 2594 gene locus_tag LOCUS_08050 2253 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 2614 4146 gene locus_tag LOCUS_08060 2614 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 4166 5500 gene locus_tag LOCUS_08070 4166 5500 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460317.1 protein_id gnl|my_center|LOCUS_08070 5641 5976 gene locus_tag LOCUS_08080 5641 5976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 5992 7926 gene locus_tag LOCUS_08090 5992 7926 CDS product bifunctional phosphoglycerate kinase/triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081072.1 protein_id gnl|my_center|LOCUS_08090 8003 8458 gene locus_tag LOCUS_08100 8003 8458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 8475 10019 gene locus_tag LOCUS_08110 gene gpmI 8475 10019 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861866.1 protein_id gnl|my_center|LOCUS_08110 10024 10608 gene locus_tag LOCUS_08120 10024 10608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 10720 11025 gene locus_tag LOCUS_08130 10720 11025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 11382 11855 gene locus_tag LOCUS_08140 gene smpB 11382 11855 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_08140 12617 11910 gene locus_tag LOCUS_08150 12617 11910 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922653.1 protein_id gnl|my_center|LOCUS_08150 12754 13108 gene locus_tag LOCUS_tm00010 12754 13108 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence043 1598 2062 gene locus_tag LOCUS_08160 1598 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 2084 2590 gene locus_tag LOCUS_08170 2084 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 3382 2651 gene locus_tag LOCUS_08180 3382 2651 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_08180 5130 3460 gene locus_tag LOCUS_08190 5130 3460 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853994.1 protein_id gnl|my_center|LOCUS_08190 5212 6615 gene locus_tag LOCUS_08200 gene lpdA 5212 6615 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393264.1 protein_id gnl|my_center|LOCUS_08200 7259 6672 gene locus_tag LOCUS_08210 7259 6672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 8422 7256 gene locus_tag LOCUS_08220 gene alr 8422 7256 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_08220 9510 8437 gene locus_tag LOCUS_08230 gene orr 9510 8437 CDS product ornithine racemase Orr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986511.1 protein_id gnl|my_center|LOCUS_08230 10896 9520 gene locus_tag LOCUS_08240 10896 9520 CDS product GlmL-related ornithine degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895468.1 protein_id gnl|my_center|LOCUS_08240 13177 10952 gene locus_tag LOCUS_08250 gene oraE 13177 10952 CDS product D-ornithine 4,5-aminomutase subunit OraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895465.1 protein_id gnl|my_center|LOCUS_08250 >Feature sequence044 633 412 gene locus_tag LOCUS_08260 633 412 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_08260 858 646 gene locus_tag LOCUS_08270 858 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 1103 1483 gene locus_tag LOCUS_08280 1103 1483 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_08280 1659 2702 gene locus_tag LOCUS_08290 1659 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 2974 3468 gene locus_tag LOCUS_08300 gene nuoE 2974 3468 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_08300 3508 3906 gene locus_tag LOCUS_08310 3508 3906 CDS product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583275.1 protein_id gnl|my_center|LOCUS_08310 3890 4330 gene locus_tag LOCUS_08320 3890 4330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 4374 5645 gene locus_tag LOCUS_08330 4374 5645 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_08330 5680 6066 gene locus_tag LOCUS_08340 5680 6066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 6082 6813 gene locus_tag LOCUS_08350 6082 6813 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_08350 6810 7364 gene locus_tag LOCUS_08360 6810 7364 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869297.1 protein_id gnl|my_center|LOCUS_08360 7444 7812 gene locus_tag LOCUS_08370 7444 7812 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_08370 7828 9621 gene locus_tag LOCUS_08380 gene nuoF 7828 9621 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_08380 9634 11382 gene locus_tag LOCUS_08390 9634 11382 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_08390 12419 11448 gene locus_tag LOCUS_08400 12419 11448 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922580.1 protein_id gnl|my_center|LOCUS_08400 12535 13215 gene locus_tag LOCUS_08410 12535 13215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 >Feature sequence045 2181 514 gene locus_tag LOCUS_08420 gene tndX 2181 514 CDS product site-specific resolvase TndX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324544.1 protein_id gnl|my_center|LOCUS_08420 2459 2262 gene locus_tag LOCUS_08430 2459 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 3327 2446 gene locus_tag LOCUS_08440 3327 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 4689 3400 gene locus_tag LOCUS_08450 4689 3400 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102364993.1 protein_id gnl|my_center|LOCUS_08450 4969 4691 gene locus_tag LOCUS_08460 4969 4691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 5548 5210 gene locus_tag LOCUS_08470 5548 5210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 6468 5545 gene locus_tag LOCUS_08480 6468 5545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 6628 6482 gene locus_tag LOCUS_08490 6628 6482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 6921 7664 gene locus_tag LOCUS_08500 6921 7664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 7753 8658 gene locus_tag LOCUS_08510 7753 8658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 8802 10208 gene locus_tag LOCUS_08520 8802 10208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 10319 12229 gene locus_tag LOCUS_08530 10319 12229 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083531262.1 protein_id gnl|my_center|LOCUS_08530 <13302 12322 gene locus_tag LOCUS_08540 <13302 12322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263395.1:HsdR family type I site-specific deoxyribonuclease >Feature sequence046 332 523 gene locus_tag LOCUS_08550 332 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 854 1543 gene locus_tag LOCUS_08560 854 1543 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913203.1 protein_id gnl|my_center|LOCUS_08560 1666 2931 gene locus_tag LOCUS_08570 1666 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 2942 4279 gene locus_tag LOCUS_08580 gene radA 2942 4279 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075213698.1 protein_id gnl|my_center|LOCUS_08580 5247 4348 gene locus_tag LOCUS_08590 5247 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 5380 5628 gene locus_tag LOCUS_08600 5380 5628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 5717 6181 gene locus_tag LOCUS_08610 gene nrdR 5717 6181 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_08610 6162 7022 gene locus_tag LOCUS_08620 gene pgeF 6162 7022 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_08620 7078 7671 gene locus_tag LOCUS_08630 7078 7671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 7898 7710 gene locus_tag LOCUS_08640 7898 7710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 7804 8637 gene locus_tag LOCUS_08650 gene spoIIIAA 7804 8637 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665889.1 protein_id gnl|my_center|LOCUS_08650 8634 9131 gene locus_tag LOCUS_08660 8634 9131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 9146 9343 gene locus_tag LOCUS_08670 9146 9343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 9350 9742 gene locus_tag LOCUS_08680 gene spoIIIAD 9350 9742 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810912.1 protein_id gnl|my_center|LOCUS_08680 9739 10908 gene locus_tag LOCUS_08690 gene spoIIIAE 9739 10908 CDS product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393041.1 protein_id gnl|my_center|LOCUS_08690 10929 11102 gene locus_tag LOCUS_08700 10929 11102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 11099 11623 gene locus_tag LOCUS_08710 11099 11623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 11709 12299 gene locus_tag LOCUS_08720 11709 12299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 12381 12806 gene locus_tag LOCUS_08730 12381 12806 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_08730 >Feature sequence047 <1 553 gene locus_tag LOCUS_08740 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943629.1:precorrin-8X methylmutase 550 1686 gene locus_tag LOCUS_08750 gene cbiD 550 1686 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836528.1 protein_id gnl|my_center|LOCUS_08750 1689 2441 gene locus_tag LOCUS_08760 1689 2441 CDS product cobalt-precorrin-4 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891957.1 protein_id gnl|my_center|LOCUS_08760 2438 3448 gene locus_tag LOCUS_08770 gene cbiG 2438 3448 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948632.1 protein_id gnl|my_center|LOCUS_08770 3441 4172 gene locus_tag LOCUS_08780 gene cobJ 3441 4172 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392608.1 protein_id gnl|my_center|LOCUS_08780 4165 6135 gene locus_tag LOCUS_08790 4165 6135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 6135 7118 gene locus_tag LOCUS_08800 gene cbiB 6135 7118 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861967.1 protein_id gnl|my_center|LOCUS_08800 7108 8160 gene locus_tag LOCUS_08810 gene cobD 7108 8160 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173241.1 protein_id gnl|my_center|LOCUS_08810 8145 9605 gene locus_tag LOCUS_08820 8145 9605 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836536.1 protein_id gnl|my_center|LOCUS_08820 9672 10937 gene locus_tag LOCUS_08830 9672 10937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 11820 11086 gene locus_tag LOCUS_08840 11820 11086 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459260.1 protein_id gnl|my_center|LOCUS_08840 12082 11822 gene locus_tag LOCUS_08850 12082 11822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 12170 12823 gene locus_tag LOCUS_08860 12170 12823 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_08860 >Feature sequence048 120 32 gene locus_tag LOCUS_t00150 120 32 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 338 631 gene locus_tag LOCUS_08870 338 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 732 2090 gene locus_tag LOCUS_08880 gene trkA 732 2090 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_08880 2103 3563 gene locus_tag LOCUS_08890 2103 3563 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_08890 4110 3607 gene locus_tag LOCUS_08900 4110 3607 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131089.1 protein_id gnl|my_center|LOCUS_08900 4475 4107 gene locus_tag LOCUS_08910 4475 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 5335 4520 gene locus_tag LOCUS_08920 5335 4520 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869100.1 protein_id gnl|my_center|LOCUS_08920 5942 5340 gene locus_tag LOCUS_08930 gene rsxA 5942 5340 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_08930 6636 5929 gene locus_tag LOCUS_08940 6636 5929 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904084.1 protein_id gnl|my_center|LOCUS_08940 7167 6637 gene locus_tag LOCUS_08950 7167 6637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 8117 7164 gene locus_tag LOCUS_08960 8117 7164 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_08960 9449 8118 gene locus_tag LOCUS_08970 gene rsxC 9449 8118 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_08970 9629 10741 gene locus_tag LOCUS_08980 9629 10741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 11164 10742 gene locus_tag LOCUS_08990 11164 10742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 11312 11998 gene locus_tag LOCUS_09000 11312 11998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 11995 12405 gene locus_tag LOCUS_09010 11995 12405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 <13016 12406 gene locus_tag LOCUS_09020 <13016 12406 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583981.1:glucose-1-phosphate thymidylyltransferase >Feature sequence049 1596 148 gene locus_tag LOCUS_09030 1596 148 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_09030 2243 1593 gene locus_tag LOCUS_09040 2243 1593 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_09040 2701 2255 gene locus_tag LOCUS_09050 gene dtd 2701 2255 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289097.1 protein_id gnl|my_center|LOCUS_09050 4881 2713 gene locus_tag LOCUS_09060 4881 2713 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723527.1 protein_id gnl|my_center|LOCUS_09060 5439 4915 gene locus_tag LOCUS_09070 5439 4915 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_09070 7865 5463 gene locus_tag LOCUS_09080 gene recJ 7865 5463 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861665.1 protein_id gnl|my_center|LOCUS_09080 8136 7867 gene locus_tag LOCUS_09090 8136 7867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 9033 8179 gene locus_tag LOCUS_09100 9033 8179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 10325 9045 gene locus_tag LOCUS_09110 gene scfB 10325 9045 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_09110 10540 10397 gene locus_tag LOCUS_09120 gene scfA 10540 10397 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_09120 11061 10672 gene locus_tag LOCUS_09130 11061 10672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 11582 11175 gene locus_tag LOCUS_09140 11582 11175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 12506 11664 gene locus_tag LOCUS_09150 12506 11664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 >Feature sequence050 <1 2853 gene locus_tag LOCUS_09160 <1 2853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966420.1:DNA-directed RNA polymerase subunit beta' 2932 3810 gene locus_tag LOCUS_09170 2932 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 3911 4699 gene locus_tag LOCUS_09180 3911 4699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 4848 7583 gene locus_tag LOCUS_09190 4848 7583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 7794 11828 gene locus_tag LOCUS_09200 7794 11828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 >Feature sequence051 1207 1073 gene locus_tag LOCUS_09210 1207 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 1613 2188 gene locus_tag LOCUS_09220 1613 2188 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_09220 2627 2460 gene locus_tag LOCUS_09230 2627 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 3038 3343 gene locus_tag LOCUS_09240 3038 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 3440 3811 gene locus_tag LOCUS_09250 3440 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 4021 5166 gene locus_tag LOCUS_09260 gene fucO 4021 5166 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766959.1 protein_id gnl|my_center|LOCUS_09260 5242 5442 gene locus_tag LOCUS_09270 5242 5442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 5577 6518 gene locus_tag LOCUS_09280 5577 6518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 6601 7689 gene locus_tag LOCUS_09290 6601 7689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 7664 7885 gene locus_tag LOCUS_09300 7664 7885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 8011 8229 gene locus_tag LOCUS_09310 8011 8229 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263301.1 protein_id gnl|my_center|LOCUS_09310 8226 9617 gene locus_tag LOCUS_09320 8226 9617 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440033.1 protein_id gnl|my_center|LOCUS_09320 10081 9719 gene locus_tag LOCUS_09330 10081 9719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 10242 10078 gene locus_tag LOCUS_09340 10242 10078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 10370 11239 gene locus_tag LOCUS_09350 10370 11239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 11279 11797 gene locus_tag LOCUS_09360 11279 11797 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665857.1 protein_id gnl|my_center|LOCUS_09360 11864 12169 gene locus_tag LOCUS_09370 11864 12169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 >Feature sequence052 1357 536 gene locus_tag LOCUS_09380 1357 536 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461790.1 protein_id gnl|my_center|LOCUS_09380 1503 1841 gene locus_tag LOCUS_09390 1503 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 1866 2990 gene locus_tag LOCUS_09400 1866 2990 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949069.1 protein_id gnl|my_center|LOCUS_09400 2987 3874 gene locus_tag LOCUS_09410 2987 3874 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949070.1 protein_id gnl|my_center|LOCUS_09410 3885 4754 gene locus_tag LOCUS_09420 3885 4754 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355144.1 protein_id gnl|my_center|LOCUS_09420 4751 6364 gene locus_tag LOCUS_09430 4751 6364 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003601692.1 protein_id gnl|my_center|LOCUS_09430 6462 7211 gene locus_tag LOCUS_09440 6462 7211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 8693 7665 gene locus_tag LOCUS_09450 8693 7665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 8911 10710 gene locus_tag LOCUS_09460 gene pepF 8911 10710 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967010.1 protein_id gnl|my_center|LOCUS_09460 11136 11879 gene locus_tag LOCUS_09470 11136 11879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 >Feature sequence053 <1 547 gene locus_tag LOCUS_09480 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003398976.1:DnaJ domain-containing protein 738 1283 gene locus_tag LOCUS_09490 738 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 1348 1866 gene locus_tag LOCUS_09500 1348 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 2189 3358 gene locus_tag LOCUS_09510 gene metK 2189 3358 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947992.1 protein_id gnl|my_center|LOCUS_09510 3365 4186 gene locus_tag LOCUS_09520 3365 4186 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227801.1 protein_id gnl|my_center|LOCUS_09520 4183 4932 gene locus_tag LOCUS_09530 4183 4932 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015919.1 protein_id gnl|my_center|LOCUS_09530 5080 5511 gene locus_tag LOCUS_09540 5080 5511 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048129.1 protein_id gnl|my_center|LOCUS_09540 5530 6243 gene locus_tag LOCUS_09550 5530 6243 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_09550 6265 7725 gene locus_tag LOCUS_09560 6265 7725 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048386.1 protein_id gnl|my_center|LOCUS_09560 7727 8275 gene locus_tag LOCUS_09570 7727 8275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 9237 8347 gene locus_tag LOCUS_09580 9237 8347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 9384 9911 gene locus_tag LOCUS_09590 9384 9911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 10319 9966 gene locus_tag LOCUS_09600 gene rplT 10319 9966 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720097.1 protein_id gnl|my_center|LOCUS_09600 10535 10335 gene locus_tag LOCUS_09610 gene rpmI 10535 10335 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965657.1 protein_id gnl|my_center|LOCUS_09610 11066 10566 gene locus_tag LOCUS_09620 gene infC 11066 10566 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048135.1 protein_id gnl|my_center|LOCUS_09620 11806 11306 gene locus_tag LOCUS_09630 11806 11306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 >Feature sequence054 459 1811 gene locus_tag LOCUS_09640 459 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 2013 2303 gene locus_tag LOCUS_09650 2013 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 3651 2383 gene locus_tag LOCUS_09660 gene serS 3651 2383 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947906.1 protein_id gnl|my_center|LOCUS_09660 6516 3775 gene locus_tag LOCUS_09670 gene secA 6516 3775 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_09670 7880 6534 gene locus_tag LOCUS_09680 gene mgtE 7880 6534 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_09680 9942 8074 gene locus_tag LOCUS_09690 9942 8074 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796600.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09690 10168 9947 gene locus_tag LOCUS_09700 10168 9947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09700 10546 10199 gene locus_tag LOCUS_09710 10546 10199 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807902.1 protein_id gnl|my_center|LOCUS_09710 11920 10667 gene locus_tag LOCUS_09720 gene ftsZ 11920 10667 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383204.1 protein_id gnl|my_center|LOCUS_09720 >Feature sequence055 38 272 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaatccacgctccccgcgtggggagcgac 1181 288 gene locus_tag LOCUS_09730 gene cas7c 1181 288 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_09730 2940 1183 gene locus_tag LOCUS_09740 gene cas8c 2940 1183 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384679.1 protein_id gnl|my_center|LOCUS_09740 3602 2937 gene locus_tag LOCUS_09750 gene cas5c 3602 2937 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388584.1 protein_id gnl|my_center|LOCUS_09750 4507 3653 gene locus_tag LOCUS_09760 4507 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 6725 5850 gene locus_tag LOCUS_09770 6725 5850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 7294 6737 gene locus_tag LOCUS_09780 7294 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 7840 7406 gene locus_tag LOCUS_09790 7840 7406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 8207 8527 gene locus_tag LOCUS_09800 8207 8527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 8524 9414 gene locus_tag LOCUS_09810 8524 9414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 9411 9659 gene locus_tag LOCUS_09820 9411 9659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 9656 11356 gene locus_tag LOCUS_09830 gene tndX 9656 11356 CDS product site-specific resolvase TndX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324544.1 protein_id gnl|my_center|LOCUS_09830 11498 11416 gene locus_tag LOCUS_t00160 11498 11416 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence056 <1 2298 gene locus_tag LOCUS_09840 <1 2298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047993.1:pyruvate, phosphate dikinase 2371 3138 gene locus_tag LOCUS_09850 2371 3138 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436810.1 protein_id gnl|my_center|LOCUS_09850 3140 4063 gene locus_tag LOCUS_09860 3140 4063 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203305.1 protein_id gnl|my_center|LOCUS_09860 5510 4116 gene locus_tag LOCUS_09870 5510 4116 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_09870 5719 5528 gene locus_tag LOCUS_09880 gene rpmB 5719 5528 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395976.1 protein_id gnl|my_center|LOCUS_09880 5886 6365 gene locus_tag LOCUS_09890 5886 6365 CDS product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963585.1 protein_id gnl|my_center|LOCUS_09890 7216 6503 gene locus_tag LOCUS_09900 7216 6503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 8899 7718 gene locus_tag LOCUS_09910 8899 7718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 10238 9300 gene locus_tag LOCUS_09920 10238 9300 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917329.1 protein_id gnl|my_center|LOCUS_09920 10735 10235 gene locus_tag LOCUS_09930 gene lspA 10735 10235 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358651.1 protein_id gnl|my_center|LOCUS_09930 >Feature sequence057 282 356 gene locus_tag LOCUS_t00170 282 356 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 4082 768 gene locus_tag LOCUS_09940 4082 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 4335 4901 gene locus_tag LOCUS_09950 4335 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 5010 5432 gene locus_tag LOCUS_09960 5010 5432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 6490 5489 gene locus_tag LOCUS_09970 6490 5489 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047751.1 protein_id gnl|my_center|LOCUS_09970 9359 6501 gene locus_tag LOCUS_09980 9359 6501 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966288.1 protein_id gnl|my_center|LOCUS_09980 9568 10050 gene locus_tag LOCUS_09990 9568 10050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 10061 10318 gene locus_tag LOCUS_10000 10061 10318 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231396.1 protein_id gnl|my_center|LOCUS_10000 11488 10439 gene locus_tag LOCUS_10010 11488 10439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 >Feature sequence058 305 814 gene locus_tag LOCUS_10020 305 814 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665857.1 protein_id gnl|my_center|LOCUS_10020 849 1406 gene locus_tag LOCUS_10030 849 1406 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009911193.1 protein_id gnl|my_center|LOCUS_10030 1590 1946 gene locus_tag LOCUS_10040 1590 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10040 1943 2785 gene locus_tag LOCUS_10050 1943 2785 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148335055.1 protein_id gnl|my_center|LOCUS_10050 3745 2849 gene locus_tag LOCUS_10060 3745 2849 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542436.1 protein_id gnl|my_center|LOCUS_10060 5559 3742 gene locus_tag LOCUS_10070 5559 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 6250 5549 gene locus_tag LOCUS_10080 6250 5549 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461250.1 protein_id gnl|my_center|LOCUS_10080 6493 7719 gene locus_tag LOCUS_10090 6493 7719 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258067.1 protein_id gnl|my_center|LOCUS_10090 8731 7772 gene locus_tag LOCUS_10100 8731 7772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 9258 8821 gene locus_tag LOCUS_10110 9258 8821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 11132 9258 gene locus_tag LOCUS_10120 11132 9258 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 protein_id gnl|my_center|LOCUS_10120 >Feature sequence059 526 50 gene locus_tag LOCUS_10130 526 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 1232 546 gene locus_tag LOCUS_10140 1232 546 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875848.1 protein_id gnl|my_center|LOCUS_10140 2130 1189 gene locus_tag LOCUS_10150 2130 1189 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392568.1 protein_id gnl|my_center|LOCUS_10150 3060 2146 gene locus_tag LOCUS_10160 gene truB 3060 2146 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203915.1 protein_id gnl|my_center|LOCUS_10160 4011 3064 gene locus_tag LOCUS_10170 4011 3064 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_10170 4366 4001 gene locus_tag LOCUS_10180 gene rbfA 4366 4001 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670660.1 protein_id gnl|my_center|LOCUS_10180 7006 4442 gene locus_tag LOCUS_10190 7006 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 7337 7023 gene locus_tag LOCUS_10200 7337 7023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 7609 7334 gene locus_tag LOCUS_10210 7609 7334 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392562.1 protein_id gnl|my_center|LOCUS_10210 8740 7625 gene locus_tag LOCUS_10220 gene nusA 8740 7625 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 protein_id gnl|my_center|LOCUS_10220 9230 8763 gene locus_tag LOCUS_10230 gene rimP 9230 8763 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965104.1 protein_id gnl|my_center|LOCUS_10230 9670 10488 gene locus_tag LOCUS_10240 gene spo0A 9670 10488 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424711.1 protein_id gnl|my_center|LOCUS_10240 11026 11244 gene locus_tag LOCUS_10250 11026 11244 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037754.1 protein_id gnl|my_center|LOCUS_10250 >Feature sequence060 <1 4228 gene locus_tag LOCUS_10260 <1 4228 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027390899.1:InlB B-repeat-containing protein 4376 4945 gene locus_tag LOCUS_10270 4376 4945 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680868.1 protein_id gnl|my_center|LOCUS_10270 4951 5607 gene locus_tag LOCUS_10280 4951 5607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 6349 5615 gene locus_tag LOCUS_10290 6349 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 6870 6346 gene locus_tag LOCUS_10300 6870 6346 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_10300 7464 7009 gene locus_tag LOCUS_10310 7464 7009 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_10310 8751 7744 gene locus_tag LOCUS_10320 8751 7744 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082273.1 protein_id gnl|my_center|LOCUS_10320 8929 9990 gene locus_tag LOCUS_10330 8929 9990 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224333.1 protein_id gnl|my_center|LOCUS_10330 10134 10985 gene locus_tag LOCUS_10340 10134 10985 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393027.1 protein_id gnl|my_center|LOCUS_10340 10987 11376 gene locus_tag LOCUS_10350 10987 11376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 >Feature sequence061 384 1691 gene locus_tag LOCUS_10360 gene trmFO 384 1691 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989721.1 protein_id gnl|my_center|LOCUS_10360 1691 2227 gene locus_tag LOCUS_10370 gene hslV 1691 2227 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172636479.1 protein_id gnl|my_center|LOCUS_10370 2230 3627 gene locus_tag LOCUS_10380 gene hslU 2230 3627 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245556.1 protein_id gnl|my_center|LOCUS_10380 3665 4675 gene locus_tag LOCUS_10390 3665 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 4675 5136 gene locus_tag LOCUS_10400 gene trmL 4675 5136 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_10400 5139 5774 gene locus_tag LOCUS_10410 gene eda 5139 5774 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_10410 5886 6920 gene locus_tag LOCUS_10420 gene spoVAD 5886 6920 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403641.1 protein_id gnl|my_center|LOCUS_10420 6917 7285 gene locus_tag LOCUS_10430 gene spoVAE 6917 7285 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403640.1 protein_id gnl|my_center|LOCUS_10430 8818 7280 gene locus_tag LOCUS_10440 8818 7280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 9723 8896 gene locus_tag LOCUS_10450 gene coaW 9723 8896 CDS product type II pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442504.1 protein_id gnl|my_center|LOCUS_10450 9871 9955 gene locus_tag LOCUS_t00180 9871 9955 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 9961 10047 gene locus_tag LOCUS_t00190 9961 10047 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10553 10786 gene locus_tag LOCUS_10460 10553 10786 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985621.1 protein_id gnl|my_center|LOCUS_10460 11107 11334 gene locus_tag LOCUS_10470 11107 11334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 >Feature sequence062 229 744 gene locus_tag LOCUS_10480 229 744 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003305140.1 protein_id gnl|my_center|LOCUS_10480 775 1236 gene locus_tag LOCUS_10490 775 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 1248 2519 gene locus_tag LOCUS_10500 1248 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 2529 3059 gene locus_tag LOCUS_10510 2529 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 3695 3060 gene locus_tag LOCUS_10520 3695 3060 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679500.1 protein_id gnl|my_center|LOCUS_10520 3836 4966 gene locus_tag LOCUS_10530 3836 4966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 5086 6477 gene locus_tag LOCUS_10540 5086 6477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 6482 6802 gene locus_tag LOCUS_10550 6482 6802 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813638.1 protein_id gnl|my_center|LOCUS_10550 6869 7417 gene locus_tag LOCUS_10560 6869 7417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 7410 8747 gene locus_tag LOCUS_10570 7410 8747 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048125.1 protein_id gnl|my_center|LOCUS_10570 8751 9659 gene locus_tag LOCUS_10580 8751 9659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 9691 10662 gene locus_tag LOCUS_10590 9691 10662 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_10590 11292 10609 gene locus_tag LOCUS_10600 11292 10609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 >Feature sequence063 2329 353 gene locus_tag LOCUS_10610 2329 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 3557 2250 gene locus_tag LOCUS_10620 3557 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 4139 3582 gene locus_tag LOCUS_10630 4139 3582 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966691.1 protein_id gnl|my_center|LOCUS_10630 4909 4142 gene locus_tag LOCUS_10640 4909 4142 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897160.1 protein_id gnl|my_center|LOCUS_10640 5643 4966 gene locus_tag LOCUS_10650 5643 4966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 6837 5704 gene locus_tag LOCUS_10660 6837 5704 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261742.1 protein_id gnl|my_center|LOCUS_10660 7675 6854 gene locus_tag LOCUS_10670 7675 6854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 8723 7683 gene locus_tag LOCUS_10680 8723 7683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 10091 8826 gene locus_tag LOCUS_10690 10091 8826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 10951 10085 gene locus_tag LOCUS_10700 10951 10085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 >Feature sequence064 1647 553 gene locus_tag LOCUS_10710 1647 553 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048364.1 protein_id gnl|my_center|LOCUS_10710 2142 1678 gene locus_tag LOCUS_10720 2142 1678 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_10720 2367 2918 gene locus_tag LOCUS_10730 2367 2918 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459480.1 protein_id gnl|my_center|LOCUS_10730 2921 4459 gene locus_tag LOCUS_10740 2921 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 5253 4543 gene locus_tag LOCUS_10750 gene deoD 5253 4543 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160304.1 protein_id gnl|my_center|LOCUS_10750 7181 5265 gene locus_tag LOCUS_10760 gene thrS 7181 5265 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965659.1 protein_id gnl|my_center|LOCUS_10760 7655 8257 gene locus_tag LOCUS_10770 7655 8257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 8516 9859 gene locus_tag LOCUS_10780 8516 9859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 9883 10839 gene locus_tag LOCUS_10790 9883 10839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 >Feature sequence065 1552 368 gene locus_tag LOCUS_10800 1552 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 2772 1549 gene locus_tag LOCUS_10810 2772 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 4103 2769 gene locus_tag LOCUS_10820 4103 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 5107 4100 gene locus_tag LOCUS_10830 5107 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 6503 5130 gene locus_tag LOCUS_10840 6503 5130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 7622 6516 gene locus_tag LOCUS_10850 7622 6516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 8791 7619 gene locus_tag LOCUS_10860 8791 7619 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203512.1 protein_id gnl|my_center|LOCUS_10860 10011 8800 gene locus_tag LOCUS_10870 10011 8800 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776619.1 protein_id gnl|my_center|LOCUS_10870 10665 10015 gene locus_tag LOCUS_10880 10665 10015 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902061.1 protein_id gnl|my_center|LOCUS_10880 <11207 10693 gene locus_tag LOCUS_10890 <11207 10693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009897930.1:nucleoside-diphosphate sugar epimerase/dehydratase >Feature sequence066 <1 2433 gene locus_tag LOCUS_10900 <1 2433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460242.1:ferrous iron transport protein B 2458 2637 gene locus_tag LOCUS_10910 2458 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 2709 3410 gene locus_tag LOCUS_10920 2709 3410 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286289.1 protein_id gnl|my_center|LOCUS_10920 3410 5797 gene locus_tag LOCUS_10930 3410 5797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 6110 5913 gene locus_tag LOCUS_10940 6110 5913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 7563 6142 gene locus_tag LOCUS_10950 7563 6142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 8109 7573 gene locus_tag LOCUS_10960 8109 7573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 8358 8128 gene locus_tag LOCUS_10970 8358 8128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 8652 8909 gene locus_tag LOCUS_10980 8652 8909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 9066 9713 gene locus_tag LOCUS_10990 9066 9713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 >Feature sequence067 543 965 gene locus_tag LOCUS_11000 543 965 CDS product 3-aminobutyryl-CoA ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902967.1 protein_id gnl|my_center|LOCUS_11000 976 1803 gene locus_tag LOCUS_11010 976 1803 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_11010 1848 2888 gene locus_tag LOCUS_11020 gene kdd 1848 2888 CDS product L-erythro-3,5-diaminohexanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015884.1 protein_id gnl|my_center|LOCUS_11020 2957 3625 gene locus_tag LOCUS_11030 2957 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 3648 4928 gene locus_tag LOCUS_11040 gene ablA 3648 4928 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_11040 4921 6474 gene locus_tag LOCUS_11050 4921 6474 CDS product D-lysine 5,6-aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015881.1 protein_id gnl|my_center|LOCUS_11050 6478 7266 gene locus_tag LOCUS_11060 6478 7266 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 protein_id gnl|my_center|LOCUS_11060 8508 10073 gene locus_tag LOCUS_11070 8508 10073 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_11070 10066 10500 gene locus_tag LOCUS_11080 10066 10500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 >Feature sequence068 804 208 gene locus_tag LOCUS_11090 804 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 942 1856 gene locus_tag LOCUS_11100 942 1856 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288377.1 protein_id gnl|my_center|LOCUS_11100 1939 2814 gene locus_tag LOCUS_11110 1939 2814 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_11110 3585 2989 gene locus_tag LOCUS_11120 3585 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 3777 4271 gene locus_tag LOCUS_11130 3777 4271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 4268 6007 gene locus_tag LOCUS_11140 4268 6007 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_11140 6004 7950 gene locus_tag LOCUS_11150 6004 7950 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_11150 7962 9761 gene locus_tag LOCUS_11160 7962 9761 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726970.1 protein_id gnl|my_center|LOCUS_11160 10025 10855 gene locus_tag LOCUS_11170 10025 10855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 >Feature sequence069 284 1153 gene locus_tag LOCUS_11180 284 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1295 3325 gene locus_tag LOCUS_11190 gene uvrB 1295 3325 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357634.1 protein_id gnl|my_center|LOCUS_11190 3322 6153 gene locus_tag LOCUS_11200 gene uvrA 3322 6153 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_11200 6171 6917 gene locus_tag LOCUS_11210 6171 6917 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964066.1 protein_id gnl|my_center|LOCUS_11210 6914 7390 gene locus_tag LOCUS_11220 gene rnhA 6914 7390 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933276.1 protein_id gnl|my_center|LOCUS_11220 7484 8578 gene locus_tag LOCUS_11230 7484 8578 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435347.1 protein_id gnl|my_center|LOCUS_11230 8607 9485 gene locus_tag LOCUS_11240 8607 9485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 9560 10147 gene locus_tag LOCUS_11250 9560 10147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 >Feature sequence070 297 743 gene locus_tag LOCUS_11260 297 743 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391911.1 protein_id gnl|my_center|LOCUS_11260 740 1900 gene locus_tag LOCUS_11270 gene nifS 740 1900 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986887.1 protein_id gnl|my_center|LOCUS_11270 1914 2315 gene locus_tag LOCUS_11280 gene nifU 1914 2315 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_11280 2322 3212 gene locus_tag LOCUS_11290 2322 3212 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108933.1 protein_id gnl|my_center|LOCUS_11290 4010 3258 gene locus_tag LOCUS_11300 4010 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 4172 4744 gene locus_tag LOCUS_11310 gene pgsA 4172 4744 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966859.1 protein_id gnl|my_center|LOCUS_11310 4808 5818 gene locus_tag LOCUS_11320 4808 5818 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461077.1 protein_id gnl|my_center|LOCUS_11320 6545 5916 gene locus_tag LOCUS_11330 6545 5916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 7153 6719 gene locus_tag LOCUS_11340 7153 6719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 7301 7975 gene locus_tag LOCUS_11350 gene lexA 7301 7975 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897067.1 protein_id gnl|my_center|LOCUS_11350 9273 8044 gene locus_tag LOCUS_11360 9273 8044 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460292.1 protein_id gnl|my_center|LOCUS_11360 9514 9266 gene locus_tag LOCUS_11370 gene hfq 9514 9266 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965139.1 protein_id gnl|my_center|LOCUS_11370 10466 9492 gene locus_tag LOCUS_11380 gene miaA 10466 9492 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861408.1 protein_id gnl|my_center|LOCUS_11380 <11001 10466 gene locus_tag LOCUS_11390 <11001 10466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257019.1:DNA mismatch repair endonuclease MutL >Feature sequence071 1054 464 gene locus_tag LOCUS_11400 1054 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 1597 1115 gene locus_tag LOCUS_11410 gene spoVAC 1597 1115 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418420.1 protein_id gnl|my_center|LOCUS_11410 1550 1726 gene locus_tag LOCUS_11420 1550 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1822 3372 gene locus_tag LOCUS_11430 gene rny 1822 3372 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428216.1 protein_id gnl|my_center|LOCUS_11430 3453 4370 gene locus_tag LOCUS_11440 3453 4370 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434938.1 protein_id gnl|my_center|LOCUS_11440 4523 5224 gene locus_tag LOCUS_11450 4523 5224 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814520.1 protein_id gnl|my_center|LOCUS_11450 5221 5913 gene locus_tag LOCUS_11460 5221 5913 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_11460 6061 7347 gene locus_tag LOCUS_11470 6061 7347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 7477 8034 gene locus_tag LOCUS_11480 7477 8034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 8031 9341 gene locus_tag LOCUS_11490 8031 9341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 10631 9414 gene locus_tag LOCUS_11500 gene arcA 10631 9414 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385506.1 protein_id gnl|my_center|LOCUS_11500 >Feature sequence072 2930 276 gene locus_tag LOCUS_11510 gene polA 2930 276 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393341.1 protein_id gnl|my_center|LOCUS_11510 3711 2956 gene locus_tag LOCUS_11520 3711 2956 CDS product DUF3307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262283.1 protein_id gnl|my_center|LOCUS_11520 4364 3708 gene locus_tag LOCUS_11530 4364 3708 CDS product SatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836845.1 protein_id gnl|my_center|LOCUS_11530 4633 4457 gene locus_tag LOCUS_11540 4633 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 6978 4633 gene locus_tag LOCUS_11550 gene feoB 6978 4633 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_11550 7588 6980 gene locus_tag LOCUS_11560 gene scpB 7588 6980 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402814.1 protein_id gnl|my_center|LOCUS_11560 8354 7566 gene locus_tag LOCUS_11570 8354 7566 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382313.1 protein_id gnl|my_center|LOCUS_11570 9099 8356 gene locus_tag LOCUS_11580 9099 8356 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372459.1 protein_id gnl|my_center|LOCUS_11580 9272 10357 gene locus_tag LOCUS_11590 9272 10357 CDS product endonuclease subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387048.1 protein_id gnl|my_center|LOCUS_11590 10370 10804 gene locus_tag LOCUS_11600 10370 10804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 >Feature sequence073 <1 2251 gene locus_tag LOCUS_11610 <1 2251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003429305.1:DNA gyrase subunit A 2367 3737 gene locus_tag LOCUS_11620 2367 3737 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_11620 5067 3925 gene locus_tag LOCUS_11630 5067 3925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 5256 6293 gene locus_tag LOCUS_11640 5256 6293 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476237.1 protein_id gnl|my_center|LOCUS_11640 6305 7540 gene locus_tag LOCUS_11650 6305 7540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 7564 9525 gene locus_tag LOCUS_11660 7564 9525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 <10834 9586 gene locus_tag LOCUS_11670 <10834 9586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860977.1:glycogen synthase GlgA >Feature sequence074 1649 2770 gene locus_tag LOCUS_11680 1649 2770 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265899.1 protein_id gnl|my_center|LOCUS_11680 2936 3961 gene locus_tag LOCUS_11690 2936 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 3977 5041 gene locus_tag LOCUS_11700 3977 5041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 6206 5181 gene locus_tag LOCUS_11710 gene plsX 6206 5181 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965053.1 protein_id gnl|my_center|LOCUS_11710 7099 6230 gene locus_tag LOCUS_11720 7099 6230 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063653047.1 protein_id gnl|my_center|LOCUS_11720 8765 7119 gene locus_tag LOCUS_11730 8765 7119 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245033.1 protein_id gnl|my_center|LOCUS_11730 9119 9565 gene locus_tag LOCUS_11740 9119 9565 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706144.1 protein_id gnl|my_center|LOCUS_11740 9599 10540 gene locus_tag LOCUS_11750 9599 10540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 >Feature sequence075 1543 1205 gene locus_tag LOCUS_11760 1543 1205 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032497467.1 protein_id gnl|my_center|LOCUS_11760 2799 1567 gene locus_tag LOCUS_11770 2799 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 3924 2899 gene locus_tag LOCUS_11780 3924 2899 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905873.1 protein_id gnl|my_center|LOCUS_11780 4392 3952 gene locus_tag LOCUS_11790 4392 3952 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775651.1 protein_id gnl|my_center|LOCUS_11790 5116 4604 gene locus_tag LOCUS_11800 5116 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 5345 6043 gene locus_tag LOCUS_11810 5345 6043 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437036.1 protein_id gnl|my_center|LOCUS_11810 6040 7377 gene locus_tag LOCUS_11820 6040 7377 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437034.1 protein_id gnl|my_center|LOCUS_11820 7725 9017 gene locus_tag LOCUS_11830 7725 9017 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899577.1 protein_id gnl|my_center|LOCUS_11830 9065 10423 gene locus_tag LOCUS_11840 gene htrA 9065 10423 CDS product serine protease HtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967069.1 protein_id gnl|my_center|LOCUS_11840 10690 10499 gene locus_tag LOCUS_11850 10690 10499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 >Feature sequence076 1361 642 gene locus_tag LOCUS_11860 1361 642 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436256.1 protein_id gnl|my_center|LOCUS_11860 2194 1358 gene locus_tag LOCUS_11870 2194 1358 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370295.1 protein_id gnl|my_center|LOCUS_11870 2526 3407 gene locus_tag LOCUS_11880 2526 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 3590 4129 gene locus_tag LOCUS_11890 3590 4129 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418769.1 protein_id gnl|my_center|LOCUS_11890 4151 5527 gene locus_tag LOCUS_11900 gene potA 4151 5527 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769055.1 protein_id gnl|my_center|LOCUS_11900 5530 6327 gene locus_tag LOCUS_11910 5530 6327 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964157.1 protein_id gnl|my_center|LOCUS_11910 6321 7196 gene locus_tag LOCUS_11920 6321 7196 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_11920 7196 8293 gene locus_tag LOCUS_11930 7196 8293 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895984.1 protein_id gnl|my_center|LOCUS_11930 8421 9470 gene locus_tag LOCUS_11940 8421 9470 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114722.1 protein_id gnl|my_center|LOCUS_11940 >Feature sequence077 180 1154 gene locus_tag LOCUS_11950 180 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 2605 1226 gene locus_tag LOCUS_11960 2605 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 3515 2616 gene locus_tag LOCUS_11970 3515 2616 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_11970 4230 3526 gene locus_tag LOCUS_11980 4230 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 5360 4227 gene locus_tag LOCUS_11990 5360 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 6295 5414 gene locus_tag LOCUS_12000 6295 5414 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_12000 6482 7825 gene locus_tag LOCUS_12010 6482 7825 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_12010 8529 8077 gene locus_tag LOCUS_12020 8529 8077 CDS product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460334.1 protein_id gnl|my_center|LOCUS_12020 8752 8828 gene locus_tag LOCUS_t00200 8752 8828 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence078 1650 1147 gene locus_tag LOCUS_12030 1650 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 3217 1634 gene locus_tag LOCUS_12040 3217 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 4209 3217 gene locus_tag LOCUS_12050 4209 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 5184 4534 gene locus_tag LOCUS_12060 5184 4534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 7634 5322 gene locus_tag LOCUS_12070 7634 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 9542 7896 gene locus_tag LOCUS_12080 9542 7896 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681065.1 protein_id gnl|my_center|LOCUS_12080 <10132 9622 gene locus_tag LOCUS_12090 <10132 9622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681067.1:iron ABC transporter permease >Feature sequence079 1486 371 gene locus_tag LOCUS_12100 gene dprA 1486 371 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_12100 3028 1496 gene locus_tag LOCUS_12110 3028 1496 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_12110 3551 3033 gene locus_tag LOCUS_12120 3551 3033 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413285.1 protein_id gnl|my_center|LOCUS_12120 6424 3572 gene locus_tag LOCUS_12130 6424 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 8055 6472 gene locus_tag LOCUS_12140 8055 6472 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963676.1 protein_id gnl|my_center|LOCUS_12140 8487 8128 gene locus_tag LOCUS_12150 8487 8128 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938134.1 protein_id gnl|my_center|LOCUS_12150 9112 8480 gene locus_tag LOCUS_12160 9112 8480 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369352.1 protein_id gnl|my_center|LOCUS_12160 10004 9096 gene locus_tag LOCUS_12170 gene ylqF 10004 9096 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047861.1 protein_id gnl|my_center|LOCUS_12170 >Feature sequence080 1547 918 gene locus_tag LOCUS_12180 1547 918 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948611.1 protein_id gnl|my_center|LOCUS_12180 2898 1540 gene locus_tag LOCUS_12190 2898 1540 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989704.1 protein_id gnl|my_center|LOCUS_12190 3475 2891 gene locus_tag LOCUS_12200 3475 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 3846 3472 gene locus_tag LOCUS_12210 3846 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 4592 3849 gene locus_tag LOCUS_12220 gene cobS 4592 3849 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943638.1 protein_id gnl|my_center|LOCUS_12220 5119 4589 gene locus_tag LOCUS_12230 5119 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 6213 5116 gene locus_tag LOCUS_12240 gene cobT 6213 5116 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943639.1 protein_id gnl|my_center|LOCUS_12240 6961 6200 gene locus_tag LOCUS_12250 6961 6200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 8052 6961 gene locus_tag LOCUS_12260 8052 6961 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682004.1 protein_id gnl|my_center|LOCUS_12260 9083 8049 gene locus_tag LOCUS_12270 9083 8049 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682008.1 protein_id gnl|my_center|LOCUS_12270 9693 9881 gene locus_tag LOCUS_12280 9693 9881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 >Feature sequence081 1148 1321 gene locus_tag LOCUS_12290 1148 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 1979 1584 gene locus_tag LOCUS_12300 1979 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 3120 1963 gene locus_tag LOCUS_12310 3120 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 4649 3498 gene locus_tag LOCUS_12320 4649 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 4966 4640 gene locus_tag LOCUS_12330 4966 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 6043 4970 gene locus_tag LOCUS_12340 6043 4970 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_12340 6230 6030 gene locus_tag LOCUS_12350 6230 6030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 6482 7012 gene locus_tag LOCUS_12360 6482 7012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 8770 7250 gene locus_tag LOCUS_12370 gene guaA 8770 7250 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162837124.1 protein_id gnl|my_center|LOCUS_12370 9376 8804 gene locus_tag LOCUS_12380 9376 8804 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057285.1 protein_id gnl|my_center|LOCUS_12380 >Feature sequence082 1213 188 gene locus_tag LOCUS_12390 1213 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 1400 3121 gene locus_tag LOCUS_12400 1400 3121 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_12400 3131 4141 gene locus_tag LOCUS_12410 3131 4141 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_12410 4680 5162 gene locus_tag LOCUS_12420 gene purE 4680 5162 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393549.1 protein_id gnl|my_center|LOCUS_12420 5228 6256 gene locus_tag LOCUS_12430 gene purM 5228 6256 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813914.1 protein_id gnl|my_center|LOCUS_12430 6258 6875 gene locus_tag LOCUS_12440 gene purN 6258 6875 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_12440 6872 7573 gene locus_tag LOCUS_12450 6872 7573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 7596 8780 gene locus_tag LOCUS_12460 7596 8780 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence083 799 53 gene locus_tag LOCUS_12470 799 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 1457 1104 gene locus_tag LOCUS_12480 gene rplS 1457 1104 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_12480 2316 1588 gene locus_tag LOCUS_12490 gene trmD 2316 1588 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_12490 2821 2306 gene locus_tag LOCUS_12500 gene rimM 2821 2306 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_12500 3080 2823 gene locus_tag LOCUS_12510 3080 2823 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965063.1 protein_id gnl|my_center|LOCUS_12510 3337 3095 gene locus_tag LOCUS_12520 gene rpsP 3337 3095 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965062.1 protein_id gnl|my_center|LOCUS_12520 4769 3429 gene locus_tag LOCUS_12530 gene ffh 4769 3429 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863461.1 protein_id gnl|my_center|LOCUS_12530 5126 4788 gene locus_tag LOCUS_12540 5126 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 5308 6324 gene locus_tag LOCUS_12550 gene plsX 5308 6324 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047867.1 protein_id gnl|my_center|LOCUS_12550 6388 6612 gene locus_tag LOCUS_12560 gene acpP 6388 6612 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163100.1 protein_id gnl|my_center|LOCUS_12560 6715 7452 gene locus_tag LOCUS_12570 gene rncS 6715 7452 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146873.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence084 2748 724 gene locus_tag LOCUS_12580 gene recG 2748 724 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_12580 4409 2748 gene locus_tag LOCUS_12590 4409 2748 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440884.1 protein_id gnl|my_center|LOCUS_12590 4785 4429 gene locus_tag LOCUS_12600 4785 4429 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021109.1 protein_id gnl|my_center|LOCUS_12600 5630 4866 gene locus_tag LOCUS_12610 gene truA 5630 4866 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943506.1 protein_id gnl|my_center|LOCUS_12610 6040 5627 gene locus_tag LOCUS_12620 6040 5627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 6894 6040 gene locus_tag LOCUS_12630 6894 6040 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860635.1 protein_id gnl|my_center|LOCUS_12630 7747 6887 gene locus_tag LOCUS_12640 7747 6887 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966382.1 protein_id gnl|my_center|LOCUS_12640 8550 7723 gene locus_tag LOCUS_12650 8550 7723 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435660.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence085 231 2573 gene locus_tag LOCUS_12660 231 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 4067 2715 gene locus_tag LOCUS_12670 4067 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 4215 5609 gene locus_tag LOCUS_12680 gene miaB 4215 5609 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965143.1 protein_id gnl|my_center|LOCUS_12680 5628 8231 gene locus_tag LOCUS_12690 gene mutS 5628 8231 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047675.1 protein_id gnl|my_center|LOCUS_12690 >Feature sequence086 1574 414 gene locus_tag LOCUS_12700 1574 414 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393009.1 protein_id gnl|my_center|LOCUS_12700 2411 1608 gene locus_tag LOCUS_12710 gene spo0A 2411 1608 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460261.1 protein_id gnl|my_center|LOCUS_12710 3681 2437 gene locus_tag LOCUS_12720 3681 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 5427 3745 gene locus_tag LOCUS_12730 gene recN 5427 3745 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699855.1 protein_id gnl|my_center|LOCUS_12730 6300 5449 gene locus_tag LOCUS_12740 6300 5449 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876505.1 protein_id gnl|my_center|LOCUS_12740 7100 6297 gene locus_tag LOCUS_12750 7100 6297 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438136.1 protein_id gnl|my_center|LOCUS_12750 8952 7093 gene locus_tag LOCUS_12760 gene dxs 8952 7093 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_12760 <9515 8954 gene locus_tag LOCUS_12770 <9515 8954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005810943.1:polyprenyl synthetase family protein >Feature sequence087 <1 2242 gene locus_tag LOCUS_12780 <1 2242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027390899.1:InlB B-repeat-containing protein 2317 4182 gene locus_tag LOCUS_12790 2317 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 4283 4423 gene locus_tag LOCUS_12800 4283 4423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 4968 4489 gene locus_tag LOCUS_12810 gene rlmH 4968 4489 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053094.1 protein_id gnl|my_center|LOCUS_12810 6002 4968 gene locus_tag LOCUS_12820 6002 4968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 6856 6071 gene locus_tag LOCUS_12830 6856 6071 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048403.1 protein_id gnl|my_center|LOCUS_12830 7646 6876 gene locus_tag LOCUS_12840 7646 6876 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895510.1 protein_id gnl|my_center|LOCUS_12840 >Feature sequence088 1639 224 gene locus_tag LOCUS_12850 1639 224 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682366.1 protein_id gnl|my_center|LOCUS_12850 1881 8594 gene locus_tag LOCUS_12860 1881 8594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 >Feature sequence089 1341 184 gene locus_tag LOCUS_12870 1341 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 2407 1424 gene locus_tag LOCUS_12880 2407 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 3371 2517 gene locus_tag LOCUS_12890 3371 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 4141 3425 gene locus_tag LOCUS_12900 4141 3425 CDS product YlmH/Sll1252 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358628.1 protein_id gnl|my_center|LOCUS_12900 6705 4117 gene locus_tag LOCUS_12910 6705 4117 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_12910 8168 6840 gene locus_tag LOCUS_12920 8168 6840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 8908 8258 gene locus_tag LOCUS_12930 gene catA 8908 8258 CDS product type A-1 chloramphenicol O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412211.1 protein_id gnl|my_center|LOCUS_12930 >Feature sequence090 1835 105 gene locus_tag LOCUS_12940 1835 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 3415 2303 gene locus_tag LOCUS_12950 3415 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 4590 3412 gene locus_tag LOCUS_12960 4590 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 5174 4587 gene locus_tag LOCUS_12970 5174 4587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 7090 5258 gene locus_tag LOCUS_12980 7090 5258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 7283 8671 gene locus_tag LOCUS_12990 7283 8671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 >Feature sequence091 <1 5945 gene locus_tag LOCUS_13000 <1 5945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011101804.1:MucBP domain-containing protein 5966 6253 gene locus_tag LOCUS_13010 5966 6253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 6368 7117 gene locus_tag LOCUS_13020 6368 7117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 7110 7415 gene locus_tag LOCUS_13030 7110 7415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 7408 7755 gene locus_tag LOCUS_13040 7408 7755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 7765 8988 gene locus_tag LOCUS_13050 7765 8988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 >Feature sequence092 2694 1189 gene locus_tag LOCUS_13060 gene mazG 2694 1189 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391632.1 protein_id gnl|my_center|LOCUS_13060 3697 2711 gene locus_tag LOCUS_13070 3697 2711 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549977.1 protein_id gnl|my_center|LOCUS_13070 3884 4459 gene locus_tag LOCUS_13080 3884 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 4614 5135 gene locus_tag LOCUS_13090 gene raiA 4614 5135 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_13090 8736 5257 gene locus_tag LOCUS_13100 gene addA 8736 5257 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989936.1 protein_id gnl|my_center|LOCUS_13100 >Feature sequence093 90 15 gene locus_tag LOCUS_t00210 90 15 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 269 1027 gene locus_tag LOCUS_13110 269 1027 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949104.1 protein_id gnl|my_center|LOCUS_13110 1155 2006 gene locus_tag LOCUS_13120 1155 2006 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622462.1 protein_id gnl|my_center|LOCUS_13120 3482 2076 gene locus_tag LOCUS_13130 3482 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 4891 3479 gene locus_tag LOCUS_13140 4891 3479 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021843.1 protein_id gnl|my_center|LOCUS_13140 6115 4982 gene locus_tag LOCUS_13150 6115 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 6239 7162 gene locus_tag LOCUS_13160 6239 7162 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213640.1 protein_id gnl|my_center|LOCUS_13160 7312 7878 gene locus_tag LOCUS_13170 7312 7878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 >Feature sequence094 2360 36 gene locus_tag LOCUS_13180 gene lon 2360 36 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_13180 2613 3092 gene locus_tag LOCUS_13190 gene def 2613 3092 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_13190 3094 4029 gene locus_tag LOCUS_13200 gene fmt 3094 4029 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_13200 4026 5345 gene locus_tag LOCUS_13210 gene rsmB 4026 5345 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861607.1 protein_id gnl|my_center|LOCUS_13210 5346 6404 gene locus_tag LOCUS_13220 gene rlmN 5346 6404 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965033.1 protein_id gnl|my_center|LOCUS_13220 6401 7138 gene locus_tag LOCUS_13230 6401 7138 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416261.1 protein_id gnl|my_center|LOCUS_13230 >Feature sequence095 2984 1128 gene locus_tag LOCUS_13240 2984 1128 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680842.1 protein_id gnl|my_center|LOCUS_13240 3212 3060 gene locus_tag LOCUS_13250 3212 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 3399 3683 gene locus_tag LOCUS_13260 gene groES 3399 3683 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965991.1 protein_id gnl|my_center|LOCUS_13260 3698 5326 gene locus_tag LOCUS_13270 gene groL 3698 5326 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965990.1 protein_id gnl|my_center|LOCUS_13270 5394 6392 gene locus_tag LOCUS_13280 5394 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 8031 6550 gene locus_tag LOCUS_13290 8031 6550 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861592.1 protein_id gnl|my_center|LOCUS_13290 8516 8031 gene locus_tag LOCUS_13300 8516 8031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 >Feature sequence096 754 1581 gene locus_tag LOCUS_13310 754 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 1604 1759 gene locus_tag LOCUS_13320 1604 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 1779 2927 gene locus_tag LOCUS_13330 1779 2927 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861239.1 protein_id gnl|my_center|LOCUS_13330 2947 4053 gene locus_tag LOCUS_13340 2947 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 4988 4167 gene locus_tag LOCUS_13350 4988 4167 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548564.1 protein_id gnl|my_center|LOCUS_13350 5922 4981 gene locus_tag LOCUS_13360 5922 4981 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548569.1 protein_id gnl|my_center|LOCUS_13360 6131 6769 gene locus_tag LOCUS_13370 6131 6769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 7480 6881 gene locus_tag LOCUS_13380 7480 6881 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678780.1 protein_id gnl|my_center|LOCUS_13380 7548 8510 gene locus_tag LOCUS_13390 7548 8510 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906252.1 protein_id gnl|my_center|LOCUS_13390 >Feature sequence097 239 610 gene locus_tag LOCUS_13400 gene rplL 239 610 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583725.1 protein_id gnl|my_center|LOCUS_13400 2495 1131 gene locus_tag LOCUS_13410 gene pepV 2495 1131 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459801.1 protein_id gnl|my_center|LOCUS_13410 3434 2517 gene locus_tag LOCUS_13420 3434 2517 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964635.1 protein_id gnl|my_center|LOCUS_13420 4267 3452 gene locus_tag LOCUS_13430 4267 3452 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104281.1 protein_id gnl|my_center|LOCUS_13430 5912 4413 gene locus_tag LOCUS_13440 gene ypwA 5912 4413 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398513.1 protein_id gnl|my_center|LOCUS_13440 6104 6874 gene locus_tag LOCUS_13450 6104 6874 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357525.1 protein_id gnl|my_center|LOCUS_13450 6855 7649 gene locus_tag LOCUS_13460 6855 7649 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815800.1 protein_id gnl|my_center|LOCUS_13460 8348 7701 gene locus_tag LOCUS_13470 8348 7701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 >Feature sequence098 499 879 gene locus_tag LOCUS_13480 499 879 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680537.1 protein_id gnl|my_center|LOCUS_13480 830 1030 gene locus_tag LOCUS_13490 830 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 1064 2497 gene locus_tag LOCUS_13500 1064 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 3104 3520 gene locus_tag LOCUS_13510 3104 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 3517 4044 gene locus_tag LOCUS_13520 3517 4044 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965770.1 protein_id gnl|my_center|LOCUS_13520 4059 4802 gene locus_tag LOCUS_13530 4059 4802 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895510.1 protein_id gnl|my_center|LOCUS_13530 4812 5147 gene locus_tag LOCUS_13540 4812 5147 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721726.1 protein_id gnl|my_center|LOCUS_13540 5159 5971 gene locus_tag LOCUS_13550 5159 5971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 6049 6465 gene locus_tag LOCUS_13560 6049 6465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 6638 7621 gene locus_tag LOCUS_13570 6638 7621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 >Feature sequence099 132 410 gene locus_tag LOCUS_13580 132 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13580 828 457 gene locus_tag LOCUS_13590 828 457 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036686.1 protein_id gnl|my_center|LOCUS_13590 1511 828 gene locus_tag LOCUS_13600 1511 828 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263299.1 protein_id gnl|my_center|LOCUS_13600 2356 1508 gene locus_tag LOCUS_13610 2356 1508 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890775.1 protein_id gnl|my_center|LOCUS_13610 2495 3049 gene locus_tag LOCUS_13620 gene spoVT 2495 3049 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391631.1 protein_id gnl|my_center|LOCUS_13620 3201 4133 gene locus_tag LOCUS_13630 3201 4133 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288377.1 protein_id gnl|my_center|LOCUS_13630 4152 5801 gene locus_tag LOCUS_13640 4152 5801 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723060.1 protein_id gnl|my_center|LOCUS_13640 5829 6722 gene locus_tag LOCUS_13650 5829 6722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 6753 7727 gene locus_tag LOCUS_13660 6753 7727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 >Feature sequence100 517 1005 gene locus_tag LOCUS_13670 517 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 1607 1065 gene locus_tag LOCUS_13680 1607 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 2889 1765 gene locus_tag LOCUS_13690 2889 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 3659 2886 gene locus_tag LOCUS_13700 3659 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 3814 4380 gene locus_tag LOCUS_13710 3814 4380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 4559 5434 gene locus_tag LOCUS_13720 4559 5434 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256218.1 protein_id gnl|my_center|LOCUS_13720 5491 5685 gene locus_tag LOCUS_13730 5491 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 6403 5747 gene locus_tag LOCUS_13740 6403 5747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 7071 6535 gene locus_tag LOCUS_13750 7071 6535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 8370 7084 gene locus_tag LOCUS_13760 gene aspS 8370 7084 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868079.1 protein_id gnl|my_center|LOCUS_13760 >Feature sequence101 934 230 gene locus_tag LOCUS_13770 934 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 1506 931 gene locus_tag LOCUS_13780 1506 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 2046 1696 gene locus_tag LOCUS_13790 2046 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 2351 2061 gene locus_tag LOCUS_13800 2351 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 2508 3332 gene locus_tag LOCUS_13810 2508 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 4703 3699 gene locus_tag LOCUS_13820 4703 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 4917 5984 gene locus_tag LOCUS_13830 gene pepQ 4917 5984 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411039.1 protein_id gnl|my_center|LOCUS_13830 6042 6599 gene locus_tag LOCUS_13840 gene efp 6042 6599 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_13840 6599 6991 gene locus_tag LOCUS_13850 6599 6991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428343.1 protein_id gnl|my_center|LOCUS_13850 8203 7046 gene locus_tag LOCUS_13860 8203 7046 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963530.1 protein_id gnl|my_center|LOCUS_13860 8486 8259 gene locus_tag LOCUS_13870 8486 8259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 >Feature sequence102 167 715 gene locus_tag LOCUS_13880 167 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 1478 918 gene locus_tag LOCUS_13890 1478 918 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878142.1 protein_id gnl|my_center|LOCUS_13890 2221 1469 gene locus_tag LOCUS_13900 2221 1469 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812246.1 protein_id gnl|my_center|LOCUS_13900 3165 2221 gene locus_tag LOCUS_13910 3165 2221 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948969.1 protein_id gnl|my_center|LOCUS_13910 3825 3196 gene locus_tag LOCUS_13920 3825 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 4001 4555 gene locus_tag LOCUS_13930 4001 4555 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966058.1 protein_id gnl|my_center|LOCUS_13930 6362 4743 gene locus_tag LOCUS_13940 6362 4743 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_13940 6927 6343 gene locus_tag LOCUS_13950 6927 6343 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048036.1 protein_id gnl|my_center|LOCUS_13950 7423 6914 gene locus_tag LOCUS_13960 7423 6914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13960 <8505 7652 gene locus_tag LOCUS_13970 <8505 7652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948293.1:energy-coupled thiamine transporter ThiT >Feature sequence103 2020 470 gene locus_tag LOCUS_13980 2020 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 2988 2017 gene locus_tag LOCUS_13990 2988 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 3901 2999 gene locus_tag LOCUS_14000 3901 2999 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048420.1 protein_id gnl|my_center|LOCUS_14000 4734 3898 gene locus_tag LOCUS_14010 4734 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 5422 4769 gene locus_tag LOCUS_14020 5422 4769 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202264.1 protein_id gnl|my_center|LOCUS_14020 6918 5449 gene locus_tag LOCUS_14030 6918 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 <8450 6929 gene locus_tag LOCUS_14040 <8450 6929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803942.1:polysaccharide biosynthesis tyrosine autokinase >Feature sequence104 594 1349 gene locus_tag LOCUS_14050 594 1349 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173372.1 protein_id gnl|my_center|LOCUS_14050 1356 3410 gene locus_tag LOCUS_14060 1356 3410 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906117.1 protein_id gnl|my_center|LOCUS_14060 3438 4103 gene locus_tag LOCUS_14070 3438 4103 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272034.1 protein_id gnl|my_center|LOCUS_14070 4100 5089 gene locus_tag LOCUS_14080 4100 5089 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272213.1 protein_id gnl|my_center|LOCUS_14080 6464 5523 gene locus_tag LOCUS_14090 6464 5523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 7021 6461 gene locus_tag LOCUS_14100 7021 6461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 7704 7351 gene locus_tag LOCUS_14110 7704 7351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 7858 7706 gene locus_tag LOCUS_14120 7858 7706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 >Feature sequence105 813 385 gene locus_tag LOCUS_14130 813 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 1300 791 gene locus_tag LOCUS_14140 1300 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 2150 1290 gene locus_tag LOCUS_14150 2150 1290 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902122.1 protein_id gnl|my_center|LOCUS_14150 3488 2196 gene locus_tag LOCUS_14160 3488 2196 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_14160 3714 4391 gene locus_tag LOCUS_14170 3714 4391 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206385.1 protein_id gnl|my_center|LOCUS_14170 5426 4464 gene locus_tag LOCUS_14180 5426 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 7244 5508 gene locus_tag LOCUS_14190 7244 5508 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104219.1 protein_id gnl|my_center|LOCUS_14190 <8266 7348 gene locus_tag LOCUS_14200 <8266 7348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948326.1:asparagine--tRNA ligase >Feature sequence106 91 9 gene locus_tag LOCUS_t00220 91 9 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 268 1023 gene locus_tag LOCUS_14210 268 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 1023 1733 gene locus_tag LOCUS_14220 gene sigE 1023 1733 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_14220 5927 1779 gene locus_tag LOCUS_14230 5927 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 7825 6059 gene locus_tag LOCUS_14240 7825 6059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 >Feature sequence107 160 1326 gene locus_tag LOCUS_14250 160 1326 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811039.1 protein_id gnl|my_center|LOCUS_14250 3635 1374 gene locus_tag LOCUS_14260 gene priA 3635 1374 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047882.1 protein_id gnl|my_center|LOCUS_14260 3880 3668 gene locus_tag LOCUS_14270 3880 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 4525 3908 gene locus_tag LOCUS_14280 gene gmk 4525 3908 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547929.1 protein_id gnl|my_center|LOCUS_14280 5419 4541 gene locus_tag LOCUS_14290 5419 4541 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811868.1 protein_id gnl|my_center|LOCUS_14290 5960 5499 gene locus_tag LOCUS_14300 5960 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 6586 6068 gene locus_tag LOCUS_14310 6586 6068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 7109 6726 gene locus_tag LOCUS_14320 7109 6726 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021359045.1 protein_id gnl|my_center|LOCUS_14320 7561 7485 gene locus_tag LOCUS_t00230 7561 7485 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 <8238 7633 gene locus_tag LOCUS_14330 <8238 7633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080399.1:DNA gyrase subunit A >Feature sequence108 1581 496 gene locus_tag LOCUS_14340 1581 496 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_14340 2576 1578 gene locus_tag LOCUS_14350 2576 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 2960 2589 gene locus_tag LOCUS_14360 2960 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 4160 3171 gene locus_tag LOCUS_14370 4160 3171 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837192.1 protein_id gnl|my_center|LOCUS_14370 5060 4176 gene locus_tag LOCUS_14380 5060 4176 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905213.1 protein_id gnl|my_center|LOCUS_14380 6298 5090 gene locus_tag LOCUS_14390 6298 5090 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107236.1 protein_id gnl|my_center|LOCUS_14390 7388 6273 gene locus_tag LOCUS_14400 7388 6273 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143696.1 protein_id gnl|my_center|LOCUS_14400 <8134 7385 gene locus_tag LOCUS_14410 <8134 7385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003242735.1:glycosyltransferase family 4 protein >Feature sequence109 347 577 gene locus_tag LOCUS_14420 347 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 577 993 gene locus_tag LOCUS_14430 577 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 1356 2390 gene locus_tag LOCUS_14440 gene gap 1356 2390 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_14440 2618 3538 gene locus_tag LOCUS_14450 2618 3538 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004846624.1 protein_id gnl|my_center|LOCUS_14450 3535 4356 gene locus_tag LOCUS_14460 3535 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 4371 4586 gene locus_tag LOCUS_14470 4371 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 4623 5360 gene locus_tag LOCUS_14480 4623 5360 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895510.1 protein_id gnl|my_center|LOCUS_14480 5372 6154 gene locus_tag LOCUS_14490 5372 6154 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943610.1 protein_id gnl|my_center|LOCUS_14490 6171 7154 gene locus_tag LOCUS_14500 6171 7154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 7311 7604 gene locus_tag LOCUS_14510 7311 7604 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943754.1 protein_id gnl|my_center|LOCUS_14510 >Feature sequence110 326 751 gene locus_tag LOCUS_14520 326 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 1159 2949 gene locus_tag LOCUS_14530 1159 2949 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_14530 2960 3709 gene locus_tag LOCUS_14540 2960 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 3733 4608 gene locus_tag LOCUS_14550 3733 4608 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021379.1 protein_id gnl|my_center|LOCUS_14550 4605 5417 gene locus_tag LOCUS_14560 4605 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 5844 7433 gene locus_tag LOCUS_14570 5844 7433 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704217.1 protein_id gnl|my_center|LOCUS_14570 >Feature sequence111 254 892 gene locus_tag LOCUS_14580 254 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 889 1677 gene locus_tag LOCUS_14590 889 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14590 1735 2505 gene locus_tag LOCUS_14600 1735 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 4052 2550 gene locus_tag LOCUS_14610 4052 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 5544 4285 gene locus_tag LOCUS_14620 5544 4285 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250733.1 protein_id gnl|my_center|LOCUS_14620 5711 7498 gene locus_tag LOCUS_14630 gene uvrC 5711 7498 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_14630 >Feature sequence112 1402 845 gene locus_tag LOCUS_14640 1402 845 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895379.1 protein_id gnl|my_center|LOCUS_14640 2825 1455 gene locus_tag LOCUS_14650 2825 1455 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_14650 2907 3380 gene locus_tag LOCUS_14660 2907 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 4892 3618 gene locus_tag LOCUS_14670 4892 3618 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_14670 5240 4902 gene locus_tag LOCUS_14680 5240 4902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 6153 5386 gene locus_tag LOCUS_14690 6153 5386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 6334 7428 gene locus_tag LOCUS_14700 6334 7428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 >Feature sequence113 1465 995 gene locus_tag LOCUS_14710 gene rpsG 1465 995 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810168.1 protein_id gnl|my_center|LOCUS_14710 1855 1481 gene locus_tag LOCUS_14720 gene rpsL 1855 1481 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357676.1 protein_id gnl|my_center|LOCUS_14720 2256 3266 gene locus_tag LOCUS_14730 2256 3266 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_14730 3323 4621 gene locus_tag LOCUS_14740 3323 4621 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272434.1 protein_id gnl|my_center|LOCUS_14740 5253 5011 gene locus_tag LOCUS_14750 gene rpsR 5253 5011 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_14750 5757 5275 gene locus_tag LOCUS_14760 gene ssb 5757 5275 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831333.1 protein_id gnl|my_center|LOCUS_14760 6064 5780 gene locus_tag LOCUS_14770 gene rpsF 6064 5780 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_14770 >Feature sequence114 31 261 gene locus_tag LOCUS_14780 31 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 415 1149 gene locus_tag LOCUS_14790 415 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 1170 2681 gene locus_tag LOCUS_14800 1170 2681 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423106.1 protein_id gnl|my_center|LOCUS_14800 2820 5018 gene locus_tag LOCUS_14810 gene pbpC 2820 5018 CDS product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227238.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence115 3566 2646 gene locus_tag LOCUS_14820 3566 2646 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102581.1 protein_id gnl|my_center|LOCUS_14820 3926 3726 gene locus_tag LOCUS_14830 3926 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 4545 4375 gene locus_tag LOCUS_14840 4545 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 5310 4600 gene locus_tag LOCUS_14850 5310 4600 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535735.1 protein_id gnl|my_center|LOCUS_14850 5472 7301 gene locus_tag LOCUS_14860 gene glmS 5472 7301 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_14860 >Feature sequence116 1726 1364 gene locus_tag LOCUS_14870 1726 1364 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860652.1 protein_id gnl|my_center|LOCUS_14870 2502 1723 gene locus_tag LOCUS_14880 2502 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 2922 2692 gene locus_tag LOCUS_14890 2922 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 3224 2919 gene locus_tag LOCUS_14900 3224 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262922.1 protein_id gnl|my_center|LOCUS_14900 3907 3722 gene locus_tag LOCUS_14910 3907 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 5024 4092 gene locus_tag LOCUS_14920 5024 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 7275 4951 gene locus_tag LOCUS_14930 7275 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 >Feature sequence117 482 557 gene locus_tag LOCUS_t00240 482 557 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 561 637 gene locus_tag LOCUS_t00250 561 637 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1662 1057 gene locus_tag LOCUS_14940 1662 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 2143 1808 gene locus_tag LOCUS_14950 2143 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 2376 2954 gene locus_tag LOCUS_14960 2376 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 3373 4200 gene locus_tag LOCUS_14970 3373 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 4323 5261 gene locus_tag LOCUS_14980 4323 5261 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583074.1 protein_id gnl|my_center|LOCUS_14980 5261 6334 gene locus_tag LOCUS_14990 5261 6334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 >Feature sequence118 1151 426 gene locus_tag LOCUS_15000 1151 426 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660503.1 protein_id gnl|my_center|LOCUS_15000 1639 1157 gene locus_tag LOCUS_15010 1639 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 2343 1744 gene locus_tag LOCUS_15020 gene yihA 2343 1744 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891775.1 protein_id gnl|my_center|LOCUS_15020 3664 2456 gene locus_tag LOCUS_15030 3664 2456 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681843.1 protein_id gnl|my_center|LOCUS_15030 4624 3674 gene locus_tag LOCUS_15040 4624 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 6061 4652 gene locus_tag LOCUS_15050 gene cysS 6061 4652 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_15050 <7227 6109 gene locus_tag LOCUS_15060 <7227 6109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002212043.1:poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB >Feature sequence119 961 419 gene locus_tag LOCUS_15070 961 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 1626 1003 gene locus_tag LOCUS_15080 1626 1003 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963967.1 protein_id gnl|my_center|LOCUS_15080 2489 1623 gene locus_tag LOCUS_15090 2489 1623 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_15090 2739 3824 gene locus_tag LOCUS_15100 2739 3824 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459550.1 protein_id gnl|my_center|LOCUS_15100 3994 5553 gene locus_tag LOCUS_15110 3994 5553 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459549.1 protein_id gnl|my_center|LOCUS_15110 >Feature sequence120 424 1803 gene locus_tag LOCUS_15120 424 1803 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048439.1 protein_id gnl|my_center|LOCUS_15120 2188 3936 gene locus_tag LOCUS_15130 2188 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 3994 4503 gene locus_tag LOCUS_15140 3994 4503 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_15140 5766 4519 gene locus_tag LOCUS_15150 5766 4519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 6408 5767 gene locus_tag LOCUS_15160 6408 5767 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_15160 >Feature sequence121 <1 805 gene locus_tag LOCUS_15170 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051187.1:MATE family efflux transporter 879 2777 gene locus_tag LOCUS_15180 879 2777 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928975.1 protein_id gnl|my_center|LOCUS_15180 2831 5194 gene locus_tag LOCUS_15190 2831 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 6117 5263 gene locus_tag LOCUS_15200 6117 5263 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583958.1 protein_id gnl|my_center|LOCUS_15200 <6782 6224 gene locus_tag LOCUS_15210 <6782 6224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007054058.1:serpin family protein >Feature sequence122 489 1610 gene locus_tag LOCUS_15220 489 1610 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431793.1 protein_id gnl|my_center|LOCUS_15220 1622 2173 gene locus_tag LOCUS_15230 1622 2173 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867949.1 protein_id gnl|my_center|LOCUS_15230 2944 2222 gene locus_tag LOCUS_15240 2944 2222 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458906.1 protein_id gnl|my_center|LOCUS_15240 5070 2995 gene locus_tag LOCUS_15250 5070 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 5336 6688 gene locus_tag LOCUS_15260 gene glmM 5336 6688 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521474.1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence123 1253 186 gene locus_tag LOCUS_15270 1253 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1773 1309 gene locus_tag LOCUS_15280 1773 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 2862 1831 gene locus_tag LOCUS_15290 gene recA 2862 1831 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_15290 3443 2925 gene locus_tag LOCUS_15300 3443 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 4033 3440 gene locus_tag LOCUS_15310 gene pgsA 4033 3440 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723921.1 protein_id gnl|my_center|LOCUS_15310 5362 4055 gene locus_tag LOCUS_15320 gene rimO 5362 4055 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_15320 <6475 5363 gene locus_tag LOCUS_15330 <6475 5363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272342.1:DNA translocase FtsK >Feature sequence124 996 286 gene locus_tag LOCUS_15340 996 286 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434049.1 protein_id gnl|my_center|LOCUS_15340 2717 1104 gene locus_tag LOCUS_15350 2717 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 5057 2727 gene locus_tag LOCUS_15360 5057 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence125 1214 201 gene locus_tag LOCUS_15370 1214 201 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048235.1 protein_id gnl|my_center|LOCUS_15370 2013 1228 gene locus_tag LOCUS_15380 2013 1228 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888867.1 protein_id gnl|my_center|LOCUS_15380 3165 2026 gene locus_tag LOCUS_15390 3165 2026 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_15390 4586 3705 gene locus_tag LOCUS_15400 4586 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 5143 4583 gene locus_tag LOCUS_15410 5143 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 5933 5253 gene locus_tag LOCUS_15420 5933 5253 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583839.1 protein_id gnl|my_center|LOCUS_15420 >Feature sequence126 177 1484 gene locus_tag LOCUS_15430 177 1484 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963927.1 protein_id gnl|my_center|LOCUS_15430 4894 1574 gene locus_tag LOCUS_15440 4894 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 5653 5060 gene locus_tag LOCUS_15450 gene plsY 5653 5060 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010494164.1 protein_id gnl|my_center|LOCUS_15450 >Feature sequence127 2252 1455 gene locus_tag LOCUS_15460 2252 1455 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680889.1 protein_id gnl|my_center|LOCUS_15460 3485 2304 gene locus_tag LOCUS_15470 3485 2304 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948371.1 protein_id gnl|my_center|LOCUS_15470 3738 5738 gene locus_tag LOCUS_15480 gene metG 3738 5738 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_15480 >Feature sequence128 <1 1189 gene locus_tag LOCUS_15490 <1 1189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027390899.1:InlB B-repeat-containing protein 1395 4331 gene locus_tag LOCUS_15500 1395 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 >Feature sequence129 <1 2471 gene locus_tag LOCUS_15510 <1 2471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002382239.1:membrane protein 2464 3363 gene locus_tag LOCUS_15520 2464 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 3365 4360 gene locus_tag LOCUS_15530 3365 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 4353 6146 gene locus_tag LOCUS_15540 4353 6146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 >Feature sequence130 1414 185 gene locus_tag LOCUS_15550 1414 185 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948284.1 protein_id gnl|my_center|LOCUS_15550 1694 3550 gene locus_tag LOCUS_15560 gene glgB 1694 3550 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694003.1 protein_id gnl|my_center|LOCUS_15560 3589 4791 gene locus_tag LOCUS_15570 3589 4791 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965535.1 protein_id gnl|my_center|LOCUS_15570 4811 5932 gene locus_tag LOCUS_15580 gene glgD 4811 5932 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082940.1 protein_id gnl|my_center|LOCUS_15580 >Feature sequence131 86 241 gene locus_tag LOCUS_15590 86 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 271 567 gene locus_tag LOCUS_15600 271 567 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176701.1 protein_id gnl|my_center|LOCUS_15600 859 626 gene locus_tag LOCUS_15610 859 626 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721916.1 protein_id gnl|my_center|LOCUS_15610 1472 867 gene locus_tag LOCUS_15620 1472 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 2194 2961 gene locus_tag LOCUS_15630 2194 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 3217 3020 gene locus_tag LOCUS_15640 3217 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 5645 3243 gene locus_tag LOCUS_15650 5645 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 >Feature sequence132 2080 401 gene locus_tag LOCUS_15660 2080 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 2877 2248 gene locus_tag LOCUS_15670 gene pth 2877 2248 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048384.1 protein_id gnl|my_center|LOCUS_15670 4103 3021 gene locus_tag LOCUS_15680 gene buk 4103 3021 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420702.1 protein_id gnl|my_center|LOCUS_15680 5054 4191 gene locus_tag LOCUS_15690 5054 4191 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965994.1 protein_id gnl|my_center|LOCUS_15690 5313 5618 gene locus_tag LOCUS_15700 gene rplU 5313 5618 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460896.1 protein_id gnl|my_center|LOCUS_15700 5631 5966 gene locus_tag LOCUS_15710 5631 5966 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048022.1 protein_id gnl|my_center|LOCUS_15710 >Feature sequence133 109 1302 gene locus_tag LOCUS_15720 109 1302 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_15720 1318 2778 gene locus_tag LOCUS_15730 gene oadA 1318 2778 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545036.1 protein_id gnl|my_center|LOCUS_15730 2868 3653 gene locus_tag LOCUS_15740 gene surE 2868 3653 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812070.1 protein_id gnl|my_center|LOCUS_15740 3650 4876 gene locus_tag LOCUS_15750 3650 4876 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_15750 4892 5572 gene locus_tag LOCUS_15760 gene cmk 4892 5572 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439454.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence134 528 1169 gene locus_tag LOCUS_15770 528 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 1174 4455 gene locus_tag LOCUS_15780 gene addB 1174 4455 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965561.1 protein_id gnl|my_center|LOCUS_15780 5297 4557 gene locus_tag LOCUS_15790 5297 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 >Feature sequence135 296 1228 gene locus_tag LOCUS_15800 296 1228 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917329.1 protein_id gnl|my_center|LOCUS_15800 1579 2385 gene locus_tag LOCUS_15810 1579 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 2414 2914 gene locus_tag LOCUS_15820 2414 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 2916 4100 gene locus_tag LOCUS_15830 2916 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 4321 4860 gene locus_tag LOCUS_15840 gene pyrR 4321 4860 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172875.1 protein_id gnl|my_center|LOCUS_15840 >Feature sequence136 1693 848 gene locus_tag LOCUS_15850 1693 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 1908 2477 gene locus_tag LOCUS_15860 1908 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 2479 3267 gene locus_tag LOCUS_15870 2479 3267 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224329.1 protein_id gnl|my_center|LOCUS_15870 3828 3322 gene locus_tag LOCUS_15880 3828 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 <5944 3875 gene locus_tag LOCUS_15890 <5944 3875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861890.1:valine--tRNA ligase >Feature sequence137 755 9 gene locus_tag LOCUS_15900 755 9 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027810.1 protein_id gnl|my_center|LOCUS_15900 1069 752 gene locus_tag LOCUS_15910 1069 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 1181 3481 gene locus_tag LOCUS_15920 1181 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 4270 3482 gene locus_tag LOCUS_15930 4270 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 5374 4301 gene locus_tag LOCUS_15940 gene buk 5374 4301 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454677.1 protein_id gnl|my_center|LOCUS_15940 >Feature sequence138 475 2049 gene locus_tag LOCUS_15950 475 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 2065 3282 gene locus_tag LOCUS_15960 2065 3282 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498961.1 protein_id gnl|my_center|LOCUS_15960 3322 4308 gene locus_tag LOCUS_15970 3322 4308 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892121.1 protein_id gnl|my_center|LOCUS_15970 4305 4961 gene locus_tag LOCUS_15980 4305 4961 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948285.1 protein_id gnl|my_center|LOCUS_15980 5743 5069 gene locus_tag LOCUS_15990 5743 5069 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454838.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence139 1093 11 gene locus_tag LOCUS_16000 1093 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 1412 1215 gene locus_tag LOCUS_16010 1412 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 1712 1637 gene locus_tag LOCUS_t00260 1712 1637 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1893 2210 gene locus_tag LOCUS_16020 1893 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 2954 2331 gene locus_tag LOCUS_16030 2954 2331 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387199.1 protein_id gnl|my_center|LOCUS_16030 4180 2987 gene locus_tag LOCUS_16040 4180 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 4666 4193 gene locus_tag LOCUS_16050 4666 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 >Feature sequence140 867 556 gene locus_tag LOCUS_16060 867 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 844 1428 gene locus_tag LOCUS_16070 844 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 1415 1621 gene locus_tag LOCUS_16080 1415 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 1708 3411 gene locus_tag LOCUS_16090 1708 3411 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680024.1 protein_id gnl|my_center|LOCUS_16090 4981 3518 gene locus_tag LOCUS_16100 4981 3518 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994262.1 protein_id gnl|my_center|LOCUS_16100 <5714 5051 gene locus_tag LOCUS_16110 <5714 5051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048090.1:YebC/PmpR family DNA-binding transcriptional regulator >Feature sequence141 <1 1659 gene locus_tag LOCUS_16120 <1 1659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458899.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase 1747 2598 gene locus_tag LOCUS_16130 1747 2598 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490772.1 protein_id gnl|my_center|LOCUS_16130 2615 3025 gene locus_tag LOCUS_16140 2615 3025 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942019.1 protein_id gnl|my_center|LOCUS_16140 3202 3053 gene locus_tag LOCUS_16150 3202 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 3379 3224 gene locus_tag LOCUS_16160 3379 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 3582 4610 gene locus_tag LOCUS_16170 3582 4610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 <5712 4665 gene locus_tag LOCUS_16180 <5712 4665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454751.1:molecular chaperone DnaJ >Feature sequence142 874 1284 gene locus_tag LOCUS_16190 874 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 1395 1613 gene locus_tag LOCUS_16200 1395 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 3097 1667 gene locus_tag LOCUS_16210 3097 1667 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_16210 <5696 3362 gene locus_tag LOCUS_16220 <5696 3362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010774229.1:DEAD/DEAH box helicase family protein >Feature sequence143 1453 185 gene locus_tag LOCUS_16230 1453 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 1763 1446 gene locus_tag LOCUS_16240 1763 1446 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669619.1 protein_id gnl|my_center|LOCUS_16240 1975 2775 gene locus_tag LOCUS_16250 1975 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 3131 3421 gene locus_tag LOCUS_16260 3131 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 3436 3789 gene locus_tag LOCUS_16270 3436 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 <5688 3865 gene locus_tag LOCUS_16280 <5688 3865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002289238.1:collagen-binding MSCRAMM adhesin Acm >Feature sequence144 2500 1949 gene locus_tag LOCUS_16290 2500 1949 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459411.1 protein_id gnl|my_center|LOCUS_16290 3061 2648 gene locus_tag LOCUS_16300 3061 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 3612 3061 gene locus_tag LOCUS_16310 3612 3061 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_16310 4450 4377 gene locus_tag LOCUS_t00270 4450 4377 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence145 836 339 gene locus_tag LOCUS_16320 gene ruvC 836 339 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861695.1 protein_id gnl|my_center|LOCUS_16320 943 1665 gene locus_tag LOCUS_16330 943 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 1574 2017 gene locus_tag LOCUS_16340 1574 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 2014 3147 gene locus_tag LOCUS_16350 2014 3147 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_16350 3169 3876 gene locus_tag LOCUS_16360 3169 3876 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544927.1 protein_id gnl|my_center|LOCUS_16360 4024 4491 gene locus_tag LOCUS_16370 4024 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 4538 4882 gene locus_tag LOCUS_16380 4538 4882 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_16380 >Feature sequence146 2300 261 gene locus_tag LOCUS_16390 2300 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 4851 2482 gene locus_tag LOCUS_16400 4851 2482 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678883.1 protein_id gnl|my_center|LOCUS_16400 >Feature sequence147 <1 703 gene locus_tag LOCUS_16410 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949032.1:redox-regulated ATPase YchF 716 1690 gene locus_tag LOCUS_16420 716 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 1707 2180 gene locus_tag LOCUS_16430 1707 2180 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_16430 2180 2782 gene locus_tag LOCUS_16440 2180 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 3058 4677 gene locus_tag LOCUS_16450 3058 4677 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_16450 4674 5423 gene locus_tag LOCUS_16460 4674 5423 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002327792.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence148 1424 288 gene locus_tag LOCUS_16470 gene dnaJ 1424 288 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142730484.1 protein_id gnl|my_center|LOCUS_16470 3403 1562 gene locus_tag LOCUS_16480 gene dnaK 3403 1562 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_16480 4045 3464 gene locus_tag LOCUS_16490 gene grpE 4045 3464 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964593.1 protein_id gnl|my_center|LOCUS_16490 5127 4090 gene locus_tag LOCUS_16500 gene hrcA 5127 4090 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392120.1 protein_id gnl|my_center|LOCUS_16500 >Feature sequence149 2028 886 gene locus_tag LOCUS_16510 2028 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 2351 2007 gene locus_tag LOCUS_16520 2351 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 3426 2332 gene locus_tag LOCUS_16530 3426 2332 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_16530 3617 3426 gene locus_tag LOCUS_16540 3617 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395994.1 protein_id gnl|my_center|LOCUS_16540 >Feature sequence150 2111 444 gene locus_tag LOCUS_16550 gene tndX 2111 444 CDS product site-specific resolvase TndX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324544.1 protein_id gnl|my_center|LOCUS_16550 2381 2187 gene locus_tag LOCUS_16560 2381 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 3261 2368 gene locus_tag LOCUS_16570 3261 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 4775 3399 gene locus_tag LOCUS_16580 4775 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 5086 4766 gene locus_tag LOCUS_16590 5086 4766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 >Feature sequence151 1545 154 gene locus_tag LOCUS_16600 1545 154 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051187.1 protein_id gnl|my_center|LOCUS_16600 2662 1550 gene locus_tag LOCUS_16610 2662 1550 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948736.1 protein_id gnl|my_center|LOCUS_16610 2574 2759 gene locus_tag LOCUS_16620 2574 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 3627 2968 gene locus_tag LOCUS_16630 3627 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 4328 4047 gene locus_tag LOCUS_16640 4328 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 4451 5269 gene locus_tag LOCUS_16650 4451 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 >Feature sequence152 689 2353 gene locus_tag LOCUS_16660 689 2353 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436982.1 protein_id gnl|my_center|LOCUS_16660 2407 3159 gene locus_tag LOCUS_16670 2407 3159 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462044.1 protein_id gnl|my_center|LOCUS_16670 3938 3210 gene locus_tag LOCUS_16680 gene radC 3938 3210 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328269.1 protein_id gnl|my_center|LOCUS_16680 4062 5024 gene locus_tag LOCUS_16690 4062 5024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 >Feature sequence153 643 1155 gene locus_tag LOCUS_16700 643 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 1173 1571 gene locus_tag LOCUS_16710 1173 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 1621 1953 gene locus_tag LOCUS_16720 1621 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 2096 2698 gene locus_tag LOCUS_16730 2096 2698 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020862546.1 protein_id gnl|my_center|LOCUS_16730 2691 3542 gene locus_tag LOCUS_16740 2691 3542 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203382.1 protein_id gnl|my_center|LOCUS_16740 4075 3602 gene locus_tag LOCUS_16750 4075 3602 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226319392.1 protein_id gnl|my_center|LOCUS_16750 4512 4075 gene locus_tag LOCUS_16760 4512 4075 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922703.1 protein_id gnl|my_center|LOCUS_16760 >Feature sequence154 422 174 gene locus_tag LOCUS_16770 422 174 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966486.1 protein_id gnl|my_center|LOCUS_16770 1861 425 gene locus_tag LOCUS_16780 1861 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 2068 3756 gene locus_tag LOCUS_16790 2068 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 4446 3829 gene locus_tag LOCUS_16800 4446 3829 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947917.1 protein_id gnl|my_center|LOCUS_16800 4647 4817 gene locus_tag LOCUS_16810 4647 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 4884 5051 gene locus_tag LOCUS_16820 4884 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 >Feature sequence155 1719 673 gene locus_tag LOCUS_16830 1719 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 2216 1731 gene locus_tag LOCUS_16840 2216 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 2955 2266 gene locus_tag LOCUS_16850 2955 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 3798 2980 gene locus_tag LOCUS_16860 3798 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 4960 3986 gene locus_tag LOCUS_16870 4960 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 >Feature sequence156 <1 692 gene locus_tag LOCUS_16880 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003419074.1:TIGR03960 family B12-binding radical SAM protein 693 1364 gene locus_tag LOCUS_16890 693 1364 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438070.1 protein_id gnl|my_center|LOCUS_16890 1389 2876 gene locus_tag LOCUS_16900 1389 2876 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392093.1 protein_id gnl|my_center|LOCUS_16900 3040 3471 gene locus_tag LOCUS_16910 gene rplM 3040 3471 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003494906.1 protein_id gnl|my_center|LOCUS_16910 3492 3887 gene locus_tag LOCUS_16920 gene rpsI 3492 3887 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_16920 3986 4627 gene locus_tag LOCUS_16930 3986 4627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 >Feature sequence157 1018 317 gene locus_tag LOCUS_16940 1018 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 1343 1633 gene locus_tag LOCUS_16950 1343 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 1753 2184 gene locus_tag LOCUS_16960 1753 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 2216 2413 gene locus_tag LOCUS_16970 2216 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 3070 2570 gene locus_tag LOCUS_16980 3070 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 3463 4218 gene locus_tag LOCUS_16990 3463 4218 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966927.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence158 488 201 gene locus_tag LOCUS_17000 488 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 2212 506 gene locus_tag LOCUS_17010 2212 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 2747 2199 gene locus_tag LOCUS_17020 2747 2199 CDS product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905713.1 protein_id gnl|my_center|LOCUS_17020 3925 2747 gene locus_tag LOCUS_17030 3925 2747 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905712.1 protein_id gnl|my_center|LOCUS_17030 4694 3939 gene locus_tag LOCUS_17040 4694 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence159 1264 836 gene locus_tag LOCUS_17050 1264 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 1858 1328 gene locus_tag LOCUS_17060 1858 1328 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428667.1 protein_id gnl|my_center|LOCUS_17060 1999 2745 gene locus_tag LOCUS_17070 1999 2745 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462031.1 protein_id gnl|my_center|LOCUS_17070 2759 3124 gene locus_tag LOCUS_17080 2759 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 3173 4744 gene locus_tag LOCUS_17090 3173 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 >Feature sequence160 490 59 gene locus_tag LOCUS_17100 490 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 1425 721 gene locus_tag LOCUS_17110 gene pyrF 1425 721 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083510.1 protein_id gnl|my_center|LOCUS_17110 2348 1437 gene locus_tag LOCUS_17120 2348 1437 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245610.1 protein_id gnl|my_center|LOCUS_17120 3067 2342 gene locus_tag LOCUS_17130 3067 2342 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016380.1 protein_id gnl|my_center|LOCUS_17130 4260 3064 gene locus_tag LOCUS_17140 gene pyrC 4260 3064 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108367.1 protein_id gnl|my_center|LOCUS_17140 >Feature sequence161 1083 184 gene locus_tag LOCUS_17150 1083 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 1865 1080 gene locus_tag LOCUS_17160 1865 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 3343 1883 gene locus_tag LOCUS_17170 3343 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 4486 3791 gene locus_tag LOCUS_17180 4486 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 >Feature sequence162 397 1611 gene locus_tag LOCUS_17190 397 1611 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_17190 1691 2197 gene locus_tag LOCUS_17200 1691 2197 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966802.1 protein_id gnl|my_center|LOCUS_17200 3221 2259 gene locus_tag LOCUS_17210 3221 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 3985 3326 gene locus_tag LOCUS_17220 gene deoC 3985 3326 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933101.1 protein_id gnl|my_center|LOCUS_17220 <4832 4012 gene locus_tag LOCUS_17230 <4832 4012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011837714.1:tRNA 2-thiouridine(34) synthase MnmA >Feature sequence163 395 1063 gene locus_tag LOCUS_17240 395 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1834 1184 gene locus_tag LOCUS_17250 1834 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 3558 1903 gene locus_tag LOCUS_17260 3558 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 4178 4651 gene locus_tag LOCUS_17270 4178 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 >Feature sequence164 4169 834 gene locus_tag LOCUS_17280 4169 834 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143843.1 protein_id gnl|my_center|LOCUS_17280 4719 4171 gene locus_tag LOCUS_17290 4719 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 >Feature sequence165 423 674 gene locus_tag LOCUS_17300 423 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 677 1282 gene locus_tag LOCUS_17310 677 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 1167 1400 gene locus_tag LOCUS_17320 1167 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 3157 1661 gene locus_tag LOCUS_17330 3157 1661 CDS product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198991.1 protein_id gnl|my_center|LOCUS_17330 4099 3353 gene locus_tag LOCUS_17340 4099 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 4593 4195 gene locus_tag LOCUS_17350 4593 4195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 >Feature sequence166 315 803 gene locus_tag LOCUS_17360 315 803 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459411.1 protein_id gnl|my_center|LOCUS_17360 800 2296 gene locus_tag LOCUS_17370 800 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 2724 2518 gene locus_tag LOCUS_17380 2724 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 3062 2721 gene locus_tag LOCUS_17390 3062 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 3366 3208 gene locus_tag LOCUS_17400 3366 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 4305 3451 gene locus_tag LOCUS_17410 4305 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 >Feature sequence167 338 958 gene locus_tag LOCUS_17420 338 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 1053 1466 gene locus_tag LOCUS_17430 1053 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 2231 1545 gene locus_tag LOCUS_17440 2231 1545 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_17440 2453 3619 gene locus_tag LOCUS_17450 2453 3619 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583069.1 protein_id gnl|my_center|LOCUS_17450 3740 4525 gene locus_tag LOCUS_17460 3740 4525 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681896.1 protein_id gnl|my_center|LOCUS_17460 >Feature sequence168 1263 289 gene locus_tag LOCUS_17470 gene glsA 1263 289 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417962.1 protein_id gnl|my_center|LOCUS_17470 1891 1286 gene locus_tag LOCUS_17480 1891 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 1996 2069 gene locus_tag LOCUS_t00280 1996 2069 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 2297 2662 gene locus_tag LOCUS_17490 2297 2662 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_17490 3152 2733 gene locus_tag LOCUS_17500 3152 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 3594 3166 gene locus_tag LOCUS_17510 3594 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 3617 4405 gene locus_tag LOCUS_17520 3617 4405 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_17520 >Feature sequence169 424 1716 gene locus_tag LOCUS_17530 424 1716 CDS product alcohol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930145.1 protein_id gnl|my_center|LOCUS_17530 1804 2508 gene locus_tag LOCUS_17540 1804 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 2668 4185 gene locus_tag LOCUS_17550 2668 4185 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837092.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence170 <1 971 gene locus_tag LOCUS_17560 <1 971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003395264.1:acyltransferase 2006 2410 gene locus_tag LOCUS_17570 2006 2410 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434285.1 protein_id gnl|my_center|LOCUS_17570 2432 3283 gene locus_tag LOCUS_17580 2432 3283 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906177.1 protein_id gnl|my_center|LOCUS_17580 3300 3839 gene locus_tag LOCUS_17590 3300 3839 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434284.1 protein_id gnl|my_center|LOCUS_17590 3855 4472 gene locus_tag LOCUS_17600 3855 4472 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986495.1 protein_id gnl|my_center|LOCUS_17600 >Feature sequence171 443 129 gene locus_tag LOCUS_17610 443 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 1330 599 gene locus_tag LOCUS_17620 1330 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 3645 1876 gene locus_tag LOCUS_17630 3645 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 4211 3642 gene locus_tag LOCUS_17640 4211 3642 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259574.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence172 263 745 gene locus_tag LOCUS_17650 263 745 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_17650 791 1159 gene locus_tag LOCUS_17660 791 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 1308 1742 gene locus_tag LOCUS_17670 1308 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 1739 2302 gene locus_tag LOCUS_17680 1739 2302 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_17680 3081 2428 gene locus_tag LOCUS_17690 3081 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 3411 3085 gene locus_tag LOCUS_17700 3411 3085 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355924.1 protein_id gnl|my_center|LOCUS_17700 4166 3408 gene locus_tag LOCUS_17710 4166 3408 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_17710 >Feature sequence173 662 222 gene locus_tag LOCUS_17720 662 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 764 2140 gene locus_tag LOCUS_17730 764 2140 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_17730 2318 3523 gene locus_tag LOCUS_17740 gene rodA 2318 3523 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence174 335 1087 gene locus_tag LOCUS_17750 335 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 3333 1351 gene locus_tag LOCUS_17760 3333 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 3434 3760 gene locus_tag LOCUS_17770 3434 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 3768 4253 gene locus_tag LOCUS_17780 3768 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675099.1 protein_id gnl|my_center|LOCUS_17780 >Feature sequence175 >Feature sequence176 1642 212 gene locus_tag LOCUS_17790 1642 212 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682416.1 protein_id gnl|my_center|LOCUS_17790 2355 1723 gene locus_tag LOCUS_17800 2355 1723 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679462.1 protein_id gnl|my_center|LOCUS_17800 2963 2352 gene locus_tag LOCUS_17810 2963 2352 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679463.1 protein_id gnl|my_center|LOCUS_17810 3834 2956 gene locus_tag LOCUS_17820 3834 2956 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942386.1 protein_id gnl|my_center|LOCUS_17820 4132 3827 gene locus_tag LOCUS_17830 4132 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 4330 4405 gene locus_tag LOCUS_t00290 4330 4405 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence177 588 1115 gene locus_tag LOCUS_17840 588 1115 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393839.1 protein_id gnl|my_center|LOCUS_17840 1105 2025 gene locus_tag LOCUS_17850 1105 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 2505 2086 gene locus_tag LOCUS_17860 2505 2086 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012359.1 protein_id gnl|my_center|LOCUS_17860 3065 2502 gene locus_tag LOCUS_17870 3065 2502 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705703.1 protein_id gnl|my_center|LOCUS_17870 4256 3207 gene locus_tag LOCUS_17880 4256 3207 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459548.1 protein_id gnl|my_center|LOCUS_17880 >Feature sequence178 <1 1279 gene locus_tag LOCUS_17890 <1 1279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003246161.1:GTPase ObgE 2042 1302 gene locus_tag LOCUS_17900 2042 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 2296 3369 gene locus_tag LOCUS_17910 2296 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 3359 3757 gene locus_tag LOCUS_17920 gene rsfS 3359 3757 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645187.1 protein_id gnl|my_center|LOCUS_17920 >Feature sequence179 1395 511 gene locus_tag LOCUS_17930 gene sdaAA 1395 511 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393444.1 protein_id gnl|my_center|LOCUS_17930 2086 1421 gene locus_tag LOCUS_17940 gene sdaAB 2086 1421 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460514.1 protein_id gnl|my_center|LOCUS_17940 2298 3068 gene locus_tag LOCUS_17950 2298 3068 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048188.1 protein_id gnl|my_center|LOCUS_17950 3116 3958 gene locus_tag LOCUS_17960 3116 3958 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_17960 >Feature sequence180 4226 2460 gene locus_tag LOCUS_17970 4226 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 >Feature sequence181 518 1093 gene locus_tag LOCUS_17980 518 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 1096 1362 gene locus_tag LOCUS_17990 1096 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 2705 1680 gene locus_tag LOCUS_18000 gene aroB 2705 1680 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002920829.1 protein_id gnl|my_center|LOCUS_18000 2858 3172 gene locus_tag LOCUS_18010 gene spoIIAA 2858 3172 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357811.1 protein_id gnl|my_center|LOCUS_18010 3169 3594 gene locus_tag LOCUS_18020 gene spoIIAB 3169 3594 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357714.1 protein_id gnl|my_center|LOCUS_18020 >Feature sequence182 155 505 gene locus_tag LOCUS_18030 155 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 502 1344 gene locus_tag LOCUS_18040 502 1344 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148335055.1 protein_id gnl|my_center|LOCUS_18040 1803 1411 gene locus_tag LOCUS_18050 1803 1411 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814175.1 protein_id gnl|my_center|LOCUS_18050 2733 1819 gene locus_tag LOCUS_18060 2733 1819 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948816.1 protein_id gnl|my_center|LOCUS_18060 2994 2788 gene locus_tag LOCUS_18070 2994 2788 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964076.1 protein_id gnl|my_center|LOCUS_18070 4100 3099 gene locus_tag LOCUS_18080 4100 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 >Feature sequence183 1235 591 gene locus_tag LOCUS_18090 1235 591 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357697.1 protein_id gnl|my_center|LOCUS_18090 2689 1337 gene locus_tag LOCUS_18100 gene secY 2689 1337 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_18100 3129 2686 gene locus_tag LOCUS_18110 gene rplO 3129 2686 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421135.1 protein_id gnl|my_center|LOCUS_18110 3326 3141 gene locus_tag LOCUS_18120 gene rpmD 3326 3141 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356220.1 protein_id gnl|my_center|LOCUS_18120 3853 3341 gene locus_tag LOCUS_18130 gene rpsE 3853 3341 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966395.1 protein_id gnl|my_center|LOCUS_18130 >Feature sequence184 2 766 gene locus_tag LOCUS_18140 2 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 801 2540 gene locus_tag LOCUS_18150 801 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 2576 3940 gene locus_tag LOCUS_18160 2576 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 >Feature sequence185 <1 561 gene locus_tag LOCUS_18170 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009911193.1:GNAT family N-acetyltransferase 724 1617 gene locus_tag LOCUS_18180 724 1617 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458873.1 protein_id gnl|my_center|LOCUS_18180 <4064 1824 gene locus_tag LOCUS_18190 <4064 1824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548280.1:S8 family serine peptidase >Feature sequence186 <1 1284 gene locus_tag LOCUS_18200 <1 1284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393940.1:elongation factor G 1365 2576 gene locus_tag LOCUS_18210 gene tuf 1365 2576 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393939.1 protein_id gnl|my_center|LOCUS_18210 2922 3200 gene locus_tag LOCUS_18220 2922 3200 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043860.1 protein_id gnl|my_center|LOCUS_18220 3309 3479 gene locus_tag LOCUS_18230 3309 3479 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363046.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence187 565 489 gene locus_tag LOCUS_t00300 565 489 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 647 1174 gene locus_tag LOCUS_18240 647 1174 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027813.1 protein_id gnl|my_center|LOCUS_18240 1189 1848 gene locus_tag LOCUS_18250 1189 1848 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678955.1 protein_id gnl|my_center|LOCUS_18250 2020 2865 gene locus_tag LOCUS_18260 2020 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 2879 3520 gene locus_tag LOCUS_18270 2879 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 >Feature sequence188 1203 2291 gene locus_tag LOCUS_18280 1203 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 2333 3673 gene locus_tag LOCUS_18290 2333 3673 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243737.1 protein_id gnl|my_center|LOCUS_18290 >Feature sequence189 1148 375 gene locus_tag LOCUS_18300 1148 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 2778 1282 gene locus_tag LOCUS_18310 2778 1282 CDS product DUF2779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846383.1 protein_id gnl|my_center|LOCUS_18310 2951 2778 gene locus_tag LOCUS_18320 2951 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 3392 2964 gene locus_tag LOCUS_18330 3392 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 3447 3572 gene locus_tag LOCUS_18340 3447 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 >Feature sequence190 1219 386 gene locus_tag LOCUS_18350 gene rsmA 1219 386 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814989.1 protein_id gnl|my_center|LOCUS_18350 2548 1226 gene locus_tag LOCUS_18360 gene rsmF 2548 1226 CDS product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228642.1 protein_id gnl|my_center|LOCUS_18360 3792 2545 gene locus_tag LOCUS_18370 3792 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 >Feature sequence191 1567 569 gene locus_tag LOCUS_18380 1567 569 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_18380 2265 1573 gene locus_tag LOCUS_18390 2265 1573 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_18390 2473 3207 gene locus_tag LOCUS_18400 2473 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 3220 3690 gene locus_tag LOCUS_18410 3220 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 >Feature sequence192 1095 715 gene locus_tag LOCUS_18420 1095 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 2390 1116 gene locus_tag LOCUS_18430 2390 1116 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 protein_id gnl|my_center|LOCUS_18430 3855 2857 gene locus_tag LOCUS_18440 3855 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 >Feature sequence193 1403 831 gene locus_tag LOCUS_18450 1403 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 1644 1396 gene locus_tag LOCUS_18460 1644 1396 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761253.1 protein_id gnl|my_center|LOCUS_18460 2499 1657 gene locus_tag LOCUS_18470 gene dapF 2499 1657 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897787.1 protein_id gnl|my_center|LOCUS_18470 3593 2742 gene locus_tag LOCUS_18480 3593 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 >Feature sequence194 <1 950 gene locus_tag LOCUS_18490 <1 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836512.1:urocanate hydratase 980 1906 gene locus_tag LOCUS_18500 gene ftcD 980 1906 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836511.1 protein_id gnl|my_center|LOCUS_18500 1912 3135 gene locus_tag LOCUS_18510 gene hutI 1912 3135 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887529.1 protein_id gnl|my_center|LOCUS_18510 3132 3758 gene locus_tag LOCUS_18520 3132 3758 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922736.1 protein_id gnl|my_center|LOCUS_18520 >Feature sequence195 1825 638 gene locus_tag LOCUS_18530 1825 638 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_18530 2538 1885 gene locus_tag LOCUS_18540 2538 1885 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897858.1 protein_id gnl|my_center|LOCUS_18540 3211 2552 gene locus_tag LOCUS_18550 3211 2552 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921820.1 protein_id gnl|my_center|LOCUS_18550 >Feature sequence196 282 857 gene locus_tag LOCUS_18560 282 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 1829 2548 gene locus_tag LOCUS_18570 1829 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 2538 3299 gene locus_tag LOCUS_18580 2538 3299 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964615.1 protein_id gnl|my_center|LOCUS_18580 >Feature sequence197 >Feature sequence198 872 87 gene locus_tag LOCUS_18590 872 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 2506 1073 gene locus_tag LOCUS_18600 2506 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 3343 2816 gene locus_tag LOCUS_18610 3343 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 >Feature sequence199 1070 210 gene locus_tag LOCUS_18620 1070 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 1848 1099 gene locus_tag LOCUS_18630 1848 1099 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966326.1 protein_id gnl|my_center|LOCUS_18630 3651 1861 gene locus_tag LOCUS_18640 3651 1861 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459511.1 protein_id gnl|my_center|LOCUS_18640 >Feature sequence200 856 1845 gene locus_tag LOCUS_18650 856 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367345.1 protein_id gnl|my_center|LOCUS_18650 1838 3268 gene locus_tag LOCUS_18660 1838 3268 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015882.1 protein_id gnl|my_center|LOCUS_18660 >Feature sequence201 278 712 gene locus_tag LOCUS_18670 278 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 823 1377 gene locus_tag LOCUS_18680 823 1377 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092482714.1 protein_id gnl|my_center|LOCUS_18680 1727 2863 gene locus_tag LOCUS_18690 1727 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 2892 3458 gene locus_tag LOCUS_18700 2892 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 >Feature sequence202 1382 249 gene locus_tag LOCUS_18710 1382 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 1538 3481 gene locus_tag LOCUS_18720 1538 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 >Feature sequence203 412 2241 gene locus_tag LOCUS_18730 412 2241 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965170.1 protein_id gnl|my_center|LOCUS_18730 2201 2554 gene locus_tag LOCUS_18740 2201 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 >Feature sequence204 444 133 gene locus_tag LOCUS_18750 444 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 1942 461 gene locus_tag LOCUS_18760 1942 461 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_18760 2142 2228 gene locus_tag LOCUS_t00310 2142 2228 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence205 559 2589 gene locus_tag LOCUS_18770 gene lysS 559 2589 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558598.1 protein_id gnl|my_center|LOCUS_18770 >Feature sequence206 369 1778 gene locus_tag LOCUS_18780 369 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 1775 2962 gene locus_tag LOCUS_18790 1775 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 >Feature sequence207 1338 469 gene locus_tag LOCUS_18800 1338 469 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861296.1 protein_id gnl|my_center|LOCUS_18800 3415 1340 gene locus_tag LOCUS_18810 3415 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 >Feature sequence208 1775 333 gene locus_tag LOCUS_18820 1775 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 <3436 1788 gene locus_tag LOCUS_18830 <3436 1788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068650.1:MFS transporter >Feature sequence209 64 753 gene locus_tag LOCUS_18840 64 753 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475832.1 protein_id gnl|my_center|LOCUS_18840 933 1259 gene locus_tag LOCUS_18850 933 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 3271 1760 gene locus_tag LOCUS_18860 3271 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 >Feature sequence210 1855 1259 gene locus_tag LOCUS_18870 1855 1259 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678780.1 protein_id gnl|my_center|LOCUS_18870 2054 3079 gene locus_tag LOCUS_18880 gene mutY 2054 3079 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522857.1 protein_id gnl|my_center|LOCUS_18880 >Feature sequence211 485 3130 gene locus_tag LOCUS_18890 485 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 3292 3367 gene locus_tag LOCUS_t00320 3292 3367 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence212 273 743 gene locus_tag LOCUS_18900 gene greA 273 743 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966474.1 protein_id gnl|my_center|LOCUS_18900 1362 793 gene locus_tag LOCUS_18910 1362 793 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358515.1 protein_id gnl|my_center|LOCUS_18910 1870 1454 gene locus_tag LOCUS_18920 1870 1454 CDS product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003029036.1 protein_id gnl|my_center|LOCUS_18920 2547 2029 gene locus_tag LOCUS_18930 2547 2029 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435609.1 protein_id gnl|my_center|LOCUS_18930 3154 2549 gene locus_tag LOCUS_18940 3154 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 >Feature sequence213 421 945 gene locus_tag LOCUS_18950 421 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 1008 2405 gene locus_tag LOCUS_18960 1008 2405 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681807.1 protein_id gnl|my_center|LOCUS_18960 2471 3226 gene locus_tag LOCUS_18970 2471 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 >Feature sequence214 698 1831 gene locus_tag LOCUS_18980 698 1831 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963546.1 protein_id gnl|my_center|LOCUS_18980 2091 1822 gene locus_tag LOCUS_18990 2091 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 2233 2610 gene locus_tag LOCUS_19000 2233 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 2648 3307 gene locus_tag LOCUS_19010 gene nth 2648 3307 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964008.1 protein_id gnl|my_center|LOCUS_19010 >Feature sequence215 794 1336 gene locus_tag LOCUS_19020 794 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 1336 1989 gene locus_tag LOCUS_19030 gene sleB 1336 1989 CDS product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964005.1 protein_id gnl|my_center|LOCUS_19030 1997 3319 gene locus_tag LOCUS_19040 gene ypeB 1997 3319 CDS product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966179.1 protein_id gnl|my_center|LOCUS_19040 >Feature sequence216 362 1561 gene locus_tag LOCUS_19050 362 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 1899 2174 gene locus_tag LOCUS_19060 1899 2174 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815560.1 protein_id gnl|my_center|LOCUS_19060 2528 2262 gene locus_tag LOCUS_19070 2528 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 3203 2571 gene locus_tag LOCUS_19080 3203 2571 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence217 1647 646 gene locus_tag LOCUS_19090 1647 646 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_19090 1878 1663 gene locus_tag LOCUS_19100 1878 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 1989 2885 gene locus_tag LOCUS_19110 1989 2885 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_19110 3084 3275 gene locus_tag LOCUS_19120 3084 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 >Feature sequence218 1968 1090 gene locus_tag LOCUS_19130 1968 1090 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_19130 2759 1962 gene locus_tag LOCUS_19140 2759 1962 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964157.1 protein_id gnl|my_center|LOCUS_19140 >Feature sequence219 559 1110 gene locus_tag LOCUS_19150 559 1110 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_19150 1196 2314 gene locus_tag LOCUS_19160 1196 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 2377 2907 gene locus_tag LOCUS_19170 2377 2907 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229892.1 protein_id gnl|my_center|LOCUS_19170 >Feature sequence220 138 2597 gene locus_tag LOCUS_19180 138 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 2723 2799 gene locus_tag LOCUS_t00330 2723 2799 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2955 3028 gene locus_tag LOCUS_t00340 2955 3028 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence221 1445 456 gene locus_tag LOCUS_19190 1445 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 2159 2935 gene locus_tag LOCUS_19200 2159 2935 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966758.1 protein_id gnl|my_center|LOCUS_19200 >Feature sequence222 587 159 gene locus_tag LOCUS_19210 587 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 882 1919 gene locus_tag LOCUS_19220 882 1919 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721423.1 protein_id gnl|my_center|LOCUS_19220 >Feature sequence223 1372 272 gene locus_tag LOCUS_19230 1372 272 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_19230 1585 1394 gene locus_tag LOCUS_19240 1585 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 1929 2480 gene locus_tag LOCUS_19250 1929 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 3078 2617 gene locus_tag LOCUS_19260 3078 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 >Feature sequence224 >Feature sequence225 370 933 gene locus_tag LOCUS_19270 370 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 930 1472 gene locus_tag LOCUS_19280 930 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 1488 2783 gene locus_tag LOCUS_19290 1488 2783 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810397.1 protein_id gnl|my_center|LOCUS_19290 >Feature sequence226 2598 802 gene locus_tag LOCUS_19300 gene dnaG 2598 802 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_19300 2841 2999 gene locus_tag LOCUS_19310 2841 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 >Feature sequence227 1778 825 gene locus_tag LOCUS_19320 1778 825 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893618.1 protein_id gnl|my_center|LOCUS_19320 <3010 1791 gene locus_tag LOCUS_19330 <3010 1791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921893.1:ABC transporter ATP-binding protein >Feature sequence228 428 1042 gene locus_tag LOCUS_19340 428 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 2266 1229 gene locus_tag LOCUS_19350 2266 1229 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405202.1 protein_id gnl|my_center|LOCUS_19350 >Feature sequence229 1144 1068 gene locus_tag LOCUS_t00350 1144 1068 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1990 1214 gene locus_tag LOCUS_19360 1990 1214 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681078.1 protein_id gnl|my_center|LOCUS_19360 2092 2571 gene locus_tag LOCUS_19370 2092 2571 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944439.1 protein_id gnl|my_center|LOCUS_19370 >Feature sequence230 1778 1122 gene locus_tag LOCUS_19380 gene rpe 1778 1122 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589959.1 protein_id gnl|my_center|LOCUS_19380 2658 1771 gene locus_tag LOCUS_19390 gene rsgA 2658 1771 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986840.1 protein_id gnl|my_center|LOCUS_19390 >Feature sequence231 487 2214 gene locus_tag LOCUS_19400 487 2214 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012914013.1 protein_id gnl|my_center|LOCUS_19400 >Feature sequence232 885 136 gene locus_tag LOCUS_19410 885 136 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994066.1 protein_id gnl|my_center|LOCUS_19410 1057 1132 gene locus_tag LOCUS_t00360 1057 1132 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1212 1288 gene locus_tag LOCUS_t00370 1212 1288 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2437 1382 gene locus_tag LOCUS_19420 2437 1382 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028858.1 protein_id gnl|my_center|LOCUS_19420 2761 2564 gene locus_tag LOCUS_19430 2761 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 >Feature sequence233 2265 1171 gene locus_tag LOCUS_19440 2265 1171 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057184.1 protein_id gnl|my_center|LOCUS_19440 >Feature sequence234 >Feature sequence235 1494 598 gene locus_tag LOCUS_19450 1494 598 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_19450 1757 1494 gene locus_tag LOCUS_19460 1757 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 <2731 1765 gene locus_tag LOCUS_19470 <2731 1765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272417.1:exodeoxyribonuclease VII large subunit >Feature sequence236 544 843 gene locus_tag LOCUS_19480 gene ortA 544 843 CDS product 2-amino-4-oxopentanoate thiolase subunit OrtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860811.1 protein_id gnl|my_center|LOCUS_19480 843 2237 gene locus_tag LOCUS_19490 gene ortB 843 2237 CDS product 2-amino-4-oxopentanoate thiolase subunit OrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032507361.1 protein_id gnl|my_center|LOCUS_19490 2269 2634 gene locus_tag LOCUS_19500 2269 2634 CDS product ornithine aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434665.1 protein_id gnl|my_center|LOCUS_19500 >Feature sequence237 1378 260 gene locus_tag LOCUS_19510 1378 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 1765 1415 gene locus_tag LOCUS_19520 1765 1415 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027987.1 protein_id gnl|my_center|LOCUS_19520 2335 1847 gene locus_tag LOCUS_19530 2335 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 >Feature sequence238 <1 731 gene locus_tag LOCUS_19540 <1 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009891672.1:class I SAM-dependent methyltransferase 731 1642 gene locus_tag LOCUS_19550 gene hslO 731 1642 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965667.1 protein_id gnl|my_center|LOCUS_19550 >Feature sequence239 1478 1320 gene locus_tag LOCUS_19560 1478 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 2347 1481 gene locus_tag LOCUS_19570 2347 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 >Feature sequence240 643 1920 gene locus_tag LOCUS_19580 643 1920 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731178.1 protein_id gnl|my_center|LOCUS_19580 >Feature sequence241 368 1231 gene locus_tag LOCUS_19590 368 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 1248 2483 gene locus_tag LOCUS_19600 1248 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 >Feature sequence242 <1 505 gene locus_tag LOCUS_19610 <1 505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002361333.1:GNAT family N-acetyltransferase 656 1582 gene locus_tag LOCUS_19620 656 1582 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223913.1 protein_id gnl|my_center|LOCUS_19620 >Feature sequence243 419 1129 gene locus_tag LOCUS_19630 419 1129 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966072.1 protein_id gnl|my_center|LOCUS_19630 1203 2264 gene locus_tag LOCUS_19640 1203 2264 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389640.1 protein_id gnl|my_center|LOCUS_19640 >Feature sequence244 739 344 gene locus_tag LOCUS_19650 739 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 1366 755 gene locus_tag LOCUS_19660 gene thyX 1366 755 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393959.1 protein_id gnl|my_center|LOCUS_19660 1863 1393 gene locus_tag LOCUS_19670 1863 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 2352 1912 gene locus_tag LOCUS_19680 2352 1912 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966160.1 protein_id gnl|my_center|LOCUS_19680 >Feature sequence245 264 1295 gene locus_tag LOCUS_19690 gene ruvB 264 1295 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_19690 1317 2360 gene locus_tag LOCUS_19700 1317 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 >Feature sequence246 479 279 gene locus_tag LOCUS_19710 479 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 632 2470 gene locus_tag LOCUS_19720 632 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 >Feature sequence247 <1 1628 gene locus_tag LOCUS_19730 <1 1628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880188.1:proline--tRNA ligase 1754 2233 gene locus_tag LOCUS_19740 1754 2233 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771878.1 protein_id gnl|my_center|LOCUS_19740 >Feature sequence248 <1 1022 gene locus_tag LOCUS_19750 <1 1022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003421622.1:DNA polymerase III subunit gamma/tau 1050 2309 gene locus_tag LOCUS_19760 gene hisS 1050 2309 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048076.1 protein_id gnl|my_center|LOCUS_19760 >Feature sequence249 1980 640 gene locus_tag LOCUS_19770 gene gcvPA 1980 640 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460675.1 protein_id gnl|my_center|LOCUS_19770 2433 2056 gene locus_tag LOCUS_19780 gene gcvH 2433 2056 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583866.1 protein_id gnl|my_center|LOCUS_19780 >Feature sequence250 127 684 gene locus_tag LOCUS_19790 127 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 681 1820 gene locus_tag LOCUS_19800 681 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 1935 2324 gene locus_tag LOCUS_19810 1935 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 >Feature sequence251 2464 1493 gene locus_tag LOCUS_19820 2464 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 >Feature sequence252 <1 927 gene locus_tag LOCUS_19830 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436795.1:phenylalanine--tRNA ligase subunit alpha >Feature sequence253 238 621 gene locus_tag LOCUS_19840 238 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 >Feature sequence254 <2459 573 gene locus_tag LOCUS_19850 <2459 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002285916.1:leucine--tRNA ligase >Feature sequence255 1082 771 gene locus_tag LOCUS_19860 1082 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 1512 1111 gene locus_tag LOCUS_19870 1512 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 2110 1517 gene locus_tag LOCUS_19880 2110 1517 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228180.1 protein_id gnl|my_center|LOCUS_19880 >Feature sequence256 120 28 gene locus_tag LOCUS_t00380 120 28 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 215 127 gene locus_tag LOCUS_t00390 215 127 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 395 694 gene locus_tag LOCUS_19890 395 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 1673 756 gene locus_tag LOCUS_19900 1673 756 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948783.1 protein_id gnl|my_center|LOCUS_19900 2369 1953 gene locus_tag LOCUS_19910 2369 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 >Feature sequence257 1548 784 gene locus_tag LOCUS_19920 1548 784 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436810.1 protein_id gnl|my_center|LOCUS_19920 <2364 1637 gene locus_tag LOCUS_19930 <2364 1637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047993.1:pyruvate, phosphate dikinase >Feature sequence258 <1 909 gene locus_tag LOCUS_19940 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_114980448.1:IS1182 family transposase 1844 945 gene locus_tag LOCUS_19950 1844 945 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964846.1 protein_id gnl|my_center|LOCUS_19950 2129 1926 gene locus_tag LOCUS_19960 2129 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 >Feature sequence259 >Feature sequence260 <2240 835 gene locus_tag LOCUS_19970 <2240 835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860739.1:DUF4132 domain-containing protein >Feature sequence261 2149 218 gene locus_tag LOCUS_19980 2149 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 >Feature sequence262 1748 333 gene locus_tag LOCUS_19990 gene purB 1748 333 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_19990 >Feature sequence263 >Feature sequence264 1871 1179 gene locus_tag LOCUS_20000 gene sigK 1871 1179 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047887.1 protein_id gnl|my_center|LOCUS_20000 >Feature sequence265 764 174 gene locus_tag LOCUS_20010 764 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 1735 761 gene locus_tag LOCUS_20020 1735 761 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389640.1 protein_id gnl|my_center|LOCUS_20020 >Feature sequence266 73 1089 gene locus_tag LOCUS_20030 73 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 1376 1119 gene locus_tag LOCUS_20040 1376 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 >Feature sequence267 <1 1273 gene locus_tag LOCUS_20050 <1 1273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227893.1:ABC transporter substrate-binding protein >Feature sequence268 1824 1699 gene locus_tag LOCUS_20060 1824 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 >Feature sequence269 414 226 gene locus_tag LOCUS_20070 gene rpmB 414 226 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395976.1 protein_id gnl|my_center|LOCUS_20070 522 1493 gene locus_tag LOCUS_20080 522 1493 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_20080 >Feature sequence270 886 299 gene locus_tag LOCUS_20090 886 299 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947937.1 protein_id gnl|my_center|LOCUS_20090 2051 888 gene locus_tag LOCUS_20100 gene alr 2051 888 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963814.1 protein_id gnl|my_center|LOCUS_20100 >Feature sequence271 1698 1219 gene locus_tag LOCUS_20110 1698 1219 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665857.1 protein_id gnl|my_center|LOCUS_20110 >Feature sequence272 447 1145 gene locus_tag LOCUS_20120 447 1145 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861637.1 protein_id gnl|my_center|LOCUS_20120 1145 1801 gene locus_tag LOCUS_20130 1145 1801 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902990.1 protein_id gnl|my_center|LOCUS_20130 >Feature sequence273 <2037 1390 gene locus_tag LOCUS_20140 <2037 1390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459687.1:RNA-splicing ligase RtcB >Feature sequence274 607 897 gene locus_tag LOCUS_20150 607 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 >Feature sequence275 100 369 gene locus_tag LOCUS_20160 100 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 446 1282 gene locus_tag LOCUS_20170 446 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170