>Feature sequence01 689 156 gene locus_tag LOCUS_00010 gene nrdG 689 156 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576044.1 protein_id gnl|my_center|LOCUS_00010 2853 691 gene locus_tag LOCUS_00020 gene nrdD 2853 691 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693847.1 protein_id gnl|my_center|LOCUS_00020 3215 4156 gene locus_tag LOCUS_00030 gene metA 3215 4156 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462040.1 protein_id gnl|my_center|LOCUS_00030 4632 4192 gene locus_tag LOCUS_00040 4632 4192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5342 4632 gene locus_tag LOCUS_00050 gene thiT 5342 4632 CDS product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228966.1 protein_id gnl|my_center|LOCUS_00050 5996 5565 gene locus_tag LOCUS_00060 5996 5565 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004309783.1 protein_id gnl|my_center|LOCUS_00060 7908 6076 gene locus_tag LOCUS_00070 gene lepA 7908 6076 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288355.1 protein_id gnl|my_center|LOCUS_00070 10433 8025 gene locus_tag LOCUS_00080 10433 8025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 13114 10964 gene locus_tag LOCUS_00090 gene pnp 13114 10964 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722460.1 protein_id gnl|my_center|LOCUS_00090 13509 13243 gene locus_tag LOCUS_00100 gene rpsO 13509 13243 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071437.1 protein_id gnl|my_center|LOCUS_00100 14540 13638 gene locus_tag LOCUS_00110 14540 13638 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438310.1 protein_id gnl|my_center|LOCUS_00110 15397 14549 gene locus_tag LOCUS_00120 gene truB 15397 14549 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016546.1 protein_id gnl|my_center|LOCUS_00120 16010 15399 gene locus_tag LOCUS_00130 16010 15399 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006147.1 protein_id gnl|my_center|LOCUS_00130 18329 16011 gene locus_tag LOCUS_00140 18329 16011 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229541.1 protein_id gnl|my_center|LOCUS_00140 19107 18364 gene locus_tag LOCUS_00150 19107 18364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 19325 19113 gene locus_tag LOCUS_00160 19325 19113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 20109 19294 gene locus_tag LOCUS_00170 20109 19294 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020862806.1 protein_id gnl|my_center|LOCUS_00170 20593 20111 gene locus_tag LOCUS_00180 gene dfrA 20593 20111 CDS product dihydrofolate reductase DfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230799.1 protein_id gnl|my_center|LOCUS_00180 21474 20593 gene locus_tag LOCUS_00190 21474 20593 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874676.1 protein_id gnl|my_center|LOCUS_00190 21928 21575 gene locus_tag LOCUS_00200 21928 21575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 23344 22112 gene locus_tag LOCUS_00210 23344 22112 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832569.1 protein_id gnl|my_center|LOCUS_00210 24536 23334 gene locus_tag LOCUS_00220 24536 23334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 25310 24588 gene locus_tag LOCUS_00230 gene deoD 25310 24588 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020631.1 protein_id gnl|my_center|LOCUS_00230 25959 25303 gene locus_tag LOCUS_00240 gene deoC 25959 25303 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836882.1 protein_id gnl|my_center|LOCUS_00240 26843 25968 gene locus_tag LOCUS_00250 26843 25968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 29628 26917 gene locus_tag LOCUS_00260 gene ileS 29628 26917 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989872.1 protein_id gnl|my_center|LOCUS_00260 31928 29985 gene locus_tag LOCUS_00270 31928 29985 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459544.1 protein_id gnl|my_center|LOCUS_00270 33756 31930 gene locus_tag LOCUS_00280 33756 31930 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681349.1 protein_id gnl|my_center|LOCUS_00280 34192 33761 gene locus_tag LOCUS_00290 34192 33761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 34351 34827 gene locus_tag LOCUS_00300 34351 34827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 35435 34824 gene locus_tag LOCUS_00310 35435 34824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 35627 35552 gene locus_tag LOCUS_t00010 35627 35552 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 35728 35653 gene locus_tag LOCUS_t00020 35728 35653 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 36315 35764 gene locus_tag LOCUS_00320 gene efp 36315 35764 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699839.1 protein_id gnl|my_center|LOCUS_00320 37726 36416 gene locus_tag LOCUS_00330 gene eno 37726 36416 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228333.1 protein_id gnl|my_center|LOCUS_00330 38344 37844 gene locus_tag LOCUS_00340 38344 37844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 39073 38423 gene locus_tag LOCUS_00350 39073 38423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 39108 39257 gene locus_tag LOCUS_00360 39108 39257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 41032 39509 gene locus_tag LOCUS_00370 gene gpmI 41032 39509 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228330.1 protein_id gnl|my_center|LOCUS_00370 42028 41093 gene locus_tag LOCUS_00380 42028 41093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 42117 42971 gene locus_tag LOCUS_00390 42117 42971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 43223 43011 gene locus_tag LOCUS_00400 43223 43011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 44146 43244 gene locus_tag LOCUS_00410 44146 43244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 45227 44133 gene locus_tag LOCUS_00420 gene yqeH 45227 44133 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575406.1 protein_id gnl|my_center|LOCUS_00420 45784 45227 gene locus_tag LOCUS_00430 45784 45227 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475789.1 protein_id gnl|my_center|LOCUS_00430 46384 45878 gene locus_tag LOCUS_00440 46384 45878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 46332 46550 gene locus_tag LOCUS_00450 46332 46550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 48100 46460 gene locus_tag LOCUS_00460 48100 46460 CDS product metalloendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860923.1 protein_id gnl|my_center|LOCUS_00460 49219 48110 gene locus_tag LOCUS_00470 49219 48110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 50689 49355 gene locus_tag LOCUS_00480 50689 49355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 52087 50822 gene locus_tag LOCUS_00490 52087 50822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 52540 52211 gene locus_tag LOCUS_00500 52540 52211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 55778 52542 gene locus_tag LOCUS_00510 55778 52542 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392027.1 protein_id gnl|my_center|LOCUS_00510 56383 55781 gene locus_tag LOCUS_00520 56383 55781 CDS product DUF4194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392026.1 protein_id gnl|my_center|LOCUS_00520 57824 56400 gene locus_tag LOCUS_00530 57824 56400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 59105 58005 gene locus_tag LOCUS_00540 gene ychF 59105 58005 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524657.1 protein_id gnl|my_center|LOCUS_00540 60968 59265 gene locus_tag LOCUS_00550 60968 59265 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104219.1 protein_id gnl|my_center|LOCUS_00550 61634 60987 gene locus_tag LOCUS_00560 gene hisIE 61634 60987 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124735.1 protein_id gnl|my_center|LOCUS_00560 62386 61631 gene locus_tag LOCUS_00570 gene hisF 62386 61631 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_00570 63103 62396 gene locus_tag LOCUS_00580 gene hisA 63103 62396 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263872.1 protein_id gnl|my_center|LOCUS_00580 63713 63105 gene locus_tag LOCUS_00590 gene hisH 63713 63105 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949113.1 protein_id gnl|my_center|LOCUS_00590 64300 63713 gene locus_tag LOCUS_00600 gene hisB 64300 63713 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949112.1 protein_id gnl|my_center|LOCUS_00600 65315 64290 gene locus_tag LOCUS_00610 gene hisC 65315 64290 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889400.1 protein_id gnl|my_center|LOCUS_00610 66610 65321 gene locus_tag LOCUS_00620 gene hisD 66610 65321 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949111.1 protein_id gnl|my_center|LOCUS_00620 67248 66625 gene locus_tag LOCUS_00630 gene hisG 67248 66625 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436683.1 protein_id gnl|my_center|LOCUS_00630 68440 67250 gene locus_tag LOCUS_00640 68440 67250 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949109.1 protein_id gnl|my_center|LOCUS_00640 68592 69332 gene locus_tag LOCUS_00650 68592 69332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 70265 69357 gene locus_tag LOCUS_00660 70265 69357 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475978.1 protein_id gnl|my_center|LOCUS_00660 70776 70246 gene locus_tag LOCUS_00670 gene lspA 70776 70246 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549207.1 protein_id gnl|my_center|LOCUS_00670 71138 70776 gene locus_tag LOCUS_00680 71138 70776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 72163 71135 gene locus_tag LOCUS_00690 72163 71135 CDS product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476281.1 protein_id gnl|my_center|LOCUS_00690 72627 72163 gene locus_tag LOCUS_00700 72627 72163 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_00700 73946 72645 gene locus_tag LOCUS_00710 gene aspS 73946 72645 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868079.1 protein_id gnl|my_center|LOCUS_00710 75254 73959 gene locus_tag LOCUS_00720 gene hisS 75254 73959 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830876.1 protein_id gnl|my_center|LOCUS_00720 75799 75251 gene locus_tag LOCUS_00730 75799 75251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 75968 75789 gene locus_tag LOCUS_00740 75968 75789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 77164 76058 gene locus_tag LOCUS_00750 77164 76058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 77700 77170 gene locus_tag LOCUS_00760 gene rsmD 77700 77170 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015427191.1 protein_id gnl|my_center|LOCUS_00760 79387 77711 gene locus_tag LOCUS_00770 79387 77711 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_00770 80079 79666 gene locus_tag LOCUS_00780 80079 79666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 80582 80163 gene locus_tag LOCUS_00790 gene rplT 80582 80163 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289310.1 protein_id gnl|my_center|LOCUS_00790 80802 80602 gene locus_tag LOCUS_00800 gene rpmI 80802 80602 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808207.1 protein_id gnl|my_center|LOCUS_00800 81295 80819 gene locus_tag LOCUS_00810 gene infC 81295 80819 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705897.1 protein_id gnl|my_center|LOCUS_00810 82313 81582 gene locus_tag LOCUS_00820 82313 81582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 82866 82300 gene locus_tag LOCUS_00830 82866 82300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 83705 82863 gene locus_tag LOCUS_00840 83705 82863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 84340 83702 gene locus_tag LOCUS_00850 84340 83702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 85259 84438 gene locus_tag LOCUS_00860 85259 84438 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680483.1 protein_id gnl|my_center|LOCUS_00860 85630 85274 gene locus_tag LOCUS_00870 gene rbfA 85630 85274 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183270.1 protein_id gnl|my_center|LOCUS_00870 87477 85630 gene locus_tag LOCUS_00880 gene infB 87477 85630 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456223.1 protein_id gnl|my_center|LOCUS_00880 87723 87487 gene locus_tag LOCUS_00890 87723 87487 CDS product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065560.1 protein_id gnl|my_center|LOCUS_00890 88030 87755 gene locus_tag LOCUS_00900 88030 87755 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071128.1 protein_id gnl|my_center|LOCUS_00900 89114 88032 gene locus_tag LOCUS_00910 gene nusA 89114 88032 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082323.1 protein_id gnl|my_center|LOCUS_00910 89581 89132 gene locus_tag LOCUS_00920 gene rimP 89581 89132 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357863.1 protein_id gnl|my_center|LOCUS_00920 90626 89673 gene locus_tag LOCUS_00930 90626 89673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 91012 90737 gene locus_tag LOCUS_00940 91012 90737 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359333.1 protein_id gnl|my_center|LOCUS_00940 91657 91157 gene locus_tag LOCUS_00950 91657 91157 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112265.1 protein_id gnl|my_center|LOCUS_00950 92401 91718 gene locus_tag LOCUS_00960 92401 91718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 93593 92403 gene locus_tag LOCUS_00970 93593 92403 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229802.1 protein_id gnl|my_center|LOCUS_00970 94455 93586 gene locus_tag LOCUS_00980 94455 93586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 95910 94492 gene locus_tag LOCUS_00990 gene ffh 95910 94492 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863468.1 protein_id gnl|my_center|LOCUS_00990 96209 95913 gene locus_tag LOCUS_01000 96209 95913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 97189 96209 gene locus_tag LOCUS_01010 gene ftsY 97189 96209 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007650.1 protein_id gnl|my_center|LOCUS_01010 99786 97276 gene locus_tag LOCUS_01020 gene topA 99786 97276 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583876.1 protein_id gnl|my_center|LOCUS_01020 100626 99931 gene locus_tag LOCUS_01030 gene rnhB 100626 99931 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174721.1 protein_id gnl|my_center|LOCUS_01030 101461 100607 gene locus_tag LOCUS_01040 gene ylqF 101461 100607 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236706.1 protein_id gnl|my_center|LOCUS_01040 102381 101470 gene locus_tag LOCUS_01050 102381 101470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 104893 102398 gene locus_tag LOCUS_01060 104893 102398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 105800 104895 gene locus_tag LOCUS_01070 105800 104895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 105917 106681 gene locus_tag LOCUS_01080 105917 106681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 108361 106655 gene locus_tag LOCUS_01090 108361 106655 CDS product mannonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861961.1 protein_id gnl|my_center|LOCUS_01090 110794 108371 gene locus_tag LOCUS_01100 gene glgP 110794 108371 CDS product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494109.1 protein_id gnl|my_center|LOCUS_01100 112731 110794 gene locus_tag LOCUS_01110 gene glgB 112731 110794 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111383.1 protein_id gnl|my_center|LOCUS_01110 113434 112838 gene locus_tag LOCUS_01120 113434 112838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 114543 113443 gene locus_tag LOCUS_01130 gene prfB 114543 113443 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096807630.1 protein_id gnl|my_center|LOCUS_01130 115800 114637 gene locus_tag LOCUS_01140 115800 114637 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_01140 116294 115800 gene locus_tag LOCUS_01150 116294 115800 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_01150 116979 116308 gene locus_tag LOCUS_01160 116979 116308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 117109 117720 gene locus_tag LOCUS_01170 117109 117720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 118214 117759 gene locus_tag LOCUS_01180 118214 117759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 119684 118299 gene locus_tag LOCUS_01190 119684 118299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 121172 119814 gene locus_tag LOCUS_01200 121172 119814 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475560.1 protein_id gnl|my_center|LOCUS_01200 121456 121187 gene locus_tag LOCUS_01210 121456 121187 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812009.1 protein_id gnl|my_center|LOCUS_01210 122017 121562 gene locus_tag LOCUS_01220 122017 121562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 122931 122131 gene locus_tag LOCUS_01230 122931 122131 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965895.1 protein_id gnl|my_center|LOCUS_01230 123839 123000 gene locus_tag LOCUS_01240 123839 123000 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819176.1 protein_id gnl|my_center|LOCUS_01240 124949 123924 gene locus_tag LOCUS_01250 124949 123924 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_01250 125456 124980 gene locus_tag LOCUS_01260 125456 124980 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003707012.1 protein_id gnl|my_center|LOCUS_01260 126511 125471 gene locus_tag LOCUS_01270 126511 125471 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082562.1 protein_id gnl|my_center|LOCUS_01270 127224 126565 gene locus_tag LOCUS_01280 127224 126565 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906064.1 protein_id gnl|my_center|LOCUS_01280 130278 127390 gene locus_tag LOCUS_01290 gene secA 130278 127390 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262654.1 protein_id gnl|my_center|LOCUS_01290 130978 130436 gene locus_tag LOCUS_01300 gene raiA 130978 130436 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360537.1 protein_id gnl|my_center|LOCUS_01300 131447 131079 gene locus_tag LOCUS_01310 131447 131079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 132664 131513 gene locus_tag LOCUS_01320 gene metK 132664 131513 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947992.1 protein_id gnl|my_center|LOCUS_01320 133009 132749 gene locus_tag LOCUS_01330 133009 132749 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891710.1 protein_id gnl|my_center|LOCUS_01330 134400 133030 gene locus_tag LOCUS_01340 134400 133030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 135362 134451 gene locus_tag LOCUS_01350 gene fmt 135362 134451 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547919.1 protein_id gnl|my_center|LOCUS_01350 137687 135366 gene locus_tag LOCUS_01360 gene priA 137687 135366 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_01360 139272 137878 gene locus_tag LOCUS_01370 139272 137878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 140114 139503 gene locus_tag LOCUS_01380 gene udk 140114 139503 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166734.1 protein_id gnl|my_center|LOCUS_01380 140813 140127 gene locus_tag LOCUS_01390 140813 140127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 142680 140827 gene locus_tag LOCUS_01400 142680 140827 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583043.1 protein_id gnl|my_center|LOCUS_01400 144472 142670 gene locus_tag LOCUS_01410 144472 142670 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583044.1 protein_id gnl|my_center|LOCUS_01410 145341 144496 gene locus_tag LOCUS_01420 145341 144496 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244785.1 protein_id gnl|my_center|LOCUS_01420 146456 145338 gene locus_tag LOCUS_01430 146456 145338 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128974704.1 protein_id gnl|my_center|LOCUS_01430 147081 146425 gene locus_tag LOCUS_01440 147081 146425 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_01440 147278 147790 gene locus_tag LOCUS_01450 147278 147790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 149100 147808 gene locus_tag LOCUS_01460 gene glmM 149100 147808 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722378.1 protein_id gnl|my_center|LOCUS_01460 150458 149109 gene locus_tag LOCUS_01470 gene glmU 150458 149109 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931068.1 protein_id gnl|my_center|LOCUS_01470 151186 150470 gene locus_tag LOCUS_01480 151186 150470 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812980.1 protein_id gnl|my_center|LOCUS_01480 151685 151176 gene locus_tag LOCUS_01490 151685 151176 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272310.1 protein_id gnl|my_center|LOCUS_01490 152533 151700 gene locus_tag LOCUS_01500 152533 151700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 153323 152646 gene locus_tag LOCUS_01510 153323 152646 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948220.1 protein_id gnl|my_center|LOCUS_01510 155335 153389 gene locus_tag LOCUS_01520 155335 153389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 >Feature sequence02 510 806 gene locus_tag LOCUS_01530 510 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 897 1775 gene locus_tag LOCUS_01540 gene kduI 897 1775 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210829.1 protein_id gnl|my_center|LOCUS_01540 1873 2436 gene locus_tag LOCUS_01550 1873 2436 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966864.1 protein_id gnl|my_center|LOCUS_01550 3423 2488 gene locus_tag LOCUS_01560 gene fba 3423 2488 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939420.1 protein_id gnl|my_center|LOCUS_01560 3615 4658 gene locus_tag LOCUS_01570 3615 4658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 4809 5558 gene locus_tag LOCUS_01580 4809 5558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 5681 6748 gene locus_tag LOCUS_01590 5681 6748 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_01590 7575 6799 gene locus_tag LOCUS_01600 7575 6799 CDS product aminoglycoside N(3)-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965495.1 protein_id gnl|my_center|LOCUS_01600 7701 9170 gene locus_tag LOCUS_01610 7701 9170 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051601.1 protein_id gnl|my_center|LOCUS_01610 9240 10274 gene locus_tag LOCUS_01620 9240 10274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 10383 11399 gene locus_tag LOCUS_01630 gene add 10383 11399 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548323.1 protein_id gnl|my_center|LOCUS_01630 11448 12236 gene locus_tag LOCUS_01640 11448 12236 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897160.1 protein_id gnl|my_center|LOCUS_01640 12239 12910 gene locus_tag LOCUS_01650 12239 12910 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183570.1 protein_id gnl|my_center|LOCUS_01650 12967 13131 gene locus_tag LOCUS_01660 12967 13131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 13305 13703 gene locus_tag LOCUS_01670 gene queD 13305 13703 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966887.1 protein_id gnl|my_center|LOCUS_01670 13700 14350 gene locus_tag LOCUS_01680 gene queE 13700 14350 CDS product putative 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966888.1 protein_id gnl|my_center|LOCUS_01680 14352 14900 gene locus_tag LOCUS_01690 gene folE 14352 14900 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966889.1 protein_id gnl|my_center|LOCUS_01690 14900 15589 gene locus_tag LOCUS_01700 gene queC 14900 15589 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877949.1 protein_id gnl|my_center|LOCUS_01700 15589 16071 gene locus_tag LOCUS_01710 gene queF 15589 16071 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832596.1 protein_id gnl|my_center|LOCUS_01710 16149 18314 gene locus_tag LOCUS_01720 16149 18314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 18417 20999 gene locus_tag LOCUS_01730 18417 20999 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861289.1 protein_id gnl|my_center|LOCUS_01730 21056 22360 gene locus_tag LOCUS_01740 21056 22360 CDS product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095195.1 protein_id gnl|my_center|LOCUS_01740 22429 22719 gene locus_tag LOCUS_01750 22429 22719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 23815 22736 gene locus_tag LOCUS_01760 23815 22736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 25738 23939 gene locus_tag LOCUS_01770 25738 23939 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861068.1 protein_id gnl|my_center|LOCUS_01770 27467 25731 gene locus_tag LOCUS_01780 27467 25731 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_01780 27681 28031 gene locus_tag LOCUS_01790 27681 28031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 28081 29070 gene locus_tag LOCUS_01800 gene plsX 28081 29070 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965053.1 protein_id gnl|my_center|LOCUS_01800 29075 29488 gene locus_tag LOCUS_01810 29075 29488 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813566.1 protein_id gnl|my_center|LOCUS_01810 29595 30248 gene locus_tag LOCUS_01820 29595 30248 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_01820 30235 31320 gene locus_tag LOCUS_01830 30235 31320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 31323 31652 gene locus_tag LOCUS_01840 31323 31652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 31939 32448 gene locus_tag LOCUS_01850 gene ilvN 31939 32448 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_01850 32479 33531 gene locus_tag LOCUS_01860 gene ilvC 32479 33531 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921008.1 protein_id gnl|my_center|LOCUS_01860 33622 35193 gene locus_tag LOCUS_01870 gene cimA 33622 35193 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966451.1 protein_id gnl|my_center|LOCUS_01870 35196 36470 gene locus_tag LOCUS_01880 gene leuC 35196 36470 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_01880 36473 36991 gene locus_tag LOCUS_01890 gene leuD 36473 36991 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966449.1 protein_id gnl|my_center|LOCUS_01890 36993 38099 gene locus_tag LOCUS_01900 gene leuB 36993 38099 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_01900 38152 39819 gene locus_tag LOCUS_01910 gene ilvD 38152 39819 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966447.1 protein_id gnl|my_center|LOCUS_01910 39844 41511 gene locus_tag LOCUS_01920 gene ilvB 39844 41511 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_01920 41659 42210 gene locus_tag LOCUS_01930 41659 42210 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_01930 42223 42624 gene locus_tag LOCUS_01940 42223 42624 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359191.1 protein_id gnl|my_center|LOCUS_01940 42725 43519 gene locus_tag LOCUS_01950 42725 43519 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_01950 44093 43557 gene locus_tag LOCUS_01960 44093 43557 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185961073.1 protein_id gnl|my_center|LOCUS_01960 44249 45100 gene locus_tag LOCUS_01970 44249 45100 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132680.1 protein_id gnl|my_center|LOCUS_01970 45106 45660 gene locus_tag LOCUS_01980 45106 45660 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_01980 45948 46979 gene locus_tag LOCUS_01990 45948 46979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 48691 47021 gene locus_tag LOCUS_02000 48691 47021 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461751.1 protein_id gnl|my_center|LOCUS_02000 48933 50618 gene locus_tag LOCUS_02010 48933 50618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 50644 52200 gene locus_tag LOCUS_02020 50644 52200 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812879.1 protein_id gnl|my_center|LOCUS_02020 52214 53653 gene locus_tag LOCUS_02030 gene rlmD 52214 53653 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147865.1 protein_id gnl|my_center|LOCUS_02030 53709 53888 gene locus_tag LOCUS_02040 53709 53888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 54119 54931 gene locus_tag LOCUS_02050 54119 54931 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259119.1 protein_id gnl|my_center|LOCUS_02050 56429 54969 gene locus_tag LOCUS_02060 gene preA 56429 54969 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987091.1 protein_id gnl|my_center|LOCUS_02060 56600 57916 gene locus_tag LOCUS_02070 56600 57916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 57963 59492 gene locus_tag LOCUS_02080 57963 59492 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_02080 59494 59814 gene locus_tag LOCUS_02090 59494 59814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 59817 60152 gene locus_tag LOCUS_02100 59817 60152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02100 60159 60323 gene locus_tag LOCUS_02110 60159 60323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 60384 61190 gene locus_tag LOCUS_02120 60384 61190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 62781 61234 gene locus_tag LOCUS_02130 62781 61234 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679691.1 protein_id gnl|my_center|LOCUS_02130 63016 63681 gene locus_tag LOCUS_02140 63016 63681 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943969.1 protein_id gnl|my_center|LOCUS_02140 63683 65008 gene locus_tag LOCUS_02150 63683 65008 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814514.1 protein_id gnl|my_center|LOCUS_02150 65008 65265 gene locus_tag LOCUS_02160 65008 65265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 65985 65311 gene locus_tag LOCUS_02170 65985 65311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 66120 66728 gene locus_tag LOCUS_02180 66120 66728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 66840 71330 gene locus_tag LOCUS_02190 66840 71330 CDS product DUF4011 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008363296.1 protein_id gnl|my_center|LOCUS_02190 71395 71916 gene locus_tag LOCUS_02200 71395 71916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 72008 72556 gene locus_tag LOCUS_02210 72008 72556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 <73811 72571 gene locus_tag LOCUS_02220 <73811 72571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964082.1:NAD(P)-dependent oxidoreductase >Feature sequence03 615 154 gene locus_tag LOCUS_02230 615 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 1553 852 gene locus_tag LOCUS_02240 1553 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 3046 1796 gene locus_tag LOCUS_02250 3046 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 3847 3074 gene locus_tag LOCUS_02260 3847 3074 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964197.1 protein_id gnl|my_center|LOCUS_02260 4670 3840 gene locus_tag LOCUS_02270 4670 3840 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255026.1 protein_id gnl|my_center|LOCUS_02270 5554 4700 gene locus_tag LOCUS_02280 5554 4700 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722588.1 protein_id gnl|my_center|LOCUS_02280 5776 5645 gene locus_tag LOCUS_02290 5776 5645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 6584 5922 gene locus_tag LOCUS_02300 6584 5922 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948716.1 protein_id gnl|my_center|LOCUS_02300 7457 6594 gene locus_tag LOCUS_02310 7457 6594 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167888.1 protein_id gnl|my_center|LOCUS_02310 8160 7486 gene locus_tag LOCUS_02320 8160 7486 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504032.1 protein_id gnl|my_center|LOCUS_02320 9590 8157 gene locus_tag LOCUS_02330 9590 8157 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707710.1 protein_id gnl|my_center|LOCUS_02330 10587 9691 gene locus_tag LOCUS_02340 10587 9691 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166859.1 protein_id gnl|my_center|LOCUS_02340 11507 10923 gene locus_tag LOCUS_02350 11507 10923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 12502 11504 gene locus_tag LOCUS_02360 12502 11504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 14259 12499 gene locus_tag LOCUS_02370 14259 12499 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948735.1 protein_id gnl|my_center|LOCUS_02370 15827 14388 gene locus_tag LOCUS_02380 15827 14388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 16728 15949 gene locus_tag LOCUS_02390 16728 15949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 17551 16760 gene locus_tag LOCUS_02400 17551 16760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 20601 17575 gene locus_tag LOCUS_02410 20601 17575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 26900 20628 gene locus_tag LOCUS_02420 26900 20628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 26988 27173 gene locus_tag LOCUS_02430 26988 27173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 28269 27292 gene locus_tag LOCUS_02440 28269 27292 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754206.1 protein_id gnl|my_center|LOCUS_02440 40299 28507 gene locus_tag LOCUS_02450 40299 28507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 41579 40317 gene locus_tag LOCUS_02460 41579 40317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 42374 41607 gene locus_tag LOCUS_02470 42374 41607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 43113 42385 gene locus_tag LOCUS_02480 43113 42385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 43504 45162 gene locus_tag LOCUS_02490 gene rqcH 43504 45162 CDS product tRNA modification protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886504.1 protein_id gnl|my_center|LOCUS_02490 45159 45860 gene locus_tag LOCUS_02500 45159 45860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 45972 46952 gene locus_tag LOCUS_02510 45972 46952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 47880 46993 gene locus_tag LOCUS_02520 47880 46993 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861338.1 protein_id gnl|my_center|LOCUS_02520 50011 47948 gene locus_tag LOCUS_02530 50011 47948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 51021 50083 gene locus_tag LOCUS_02540 51021 50083 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681613.1 protein_id gnl|my_center|LOCUS_02540 51340 51011 gene locus_tag LOCUS_02550 51340 51011 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_02550 51548 51330 gene locus_tag LOCUS_02560 51548 51330 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_02560 52815 51763 gene locus_tag LOCUS_02570 52815 51763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 57544 52832 gene locus_tag LOCUS_02580 57544 52832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 58626 57634 gene locus_tag LOCUS_02590 58626 57634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 60201 58753 gene locus_tag LOCUS_02600 60201 58753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 61436 60324 gene locus_tag LOCUS_02610 61436 60324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 63465 61450 gene locus_tag LOCUS_02620 63465 61450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 64007 63780 gene locus_tag LOCUS_02630 64007 63780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 64215 64012 gene locus_tag LOCUS_02640 64215 64012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 >Feature sequence04 913 365 gene locus_tag LOCUS_02650 913 365 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015966.1 protein_id gnl|my_center|LOCUS_02650 1763 915 gene locus_tag LOCUS_02660 gene prmC 1763 915 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267061.1 protein_id gnl|my_center|LOCUS_02660 2209 1760 gene locus_tag LOCUS_02670 2209 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 2556 2293 gene locus_tag LOCUS_02680 2556 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948527.1 protein_id gnl|my_center|LOCUS_02680 4292 2721 gene locus_tag LOCUS_02690 4292 2721 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002583.1 protein_id gnl|my_center|LOCUS_02690 5341 4898 gene locus_tag LOCUS_02700 5341 4898 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986713.1 protein_id gnl|my_center|LOCUS_02700 5808 5341 gene locus_tag LOCUS_02710 5808 5341 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621142.1 protein_id gnl|my_center|LOCUS_02710 6834 5908 gene locus_tag LOCUS_02720 6834 5908 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965842.1 protein_id gnl|my_center|LOCUS_02720 8506 6965 gene locus_tag LOCUS_02730 gene guaA 8506 6965 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965987.1 protein_id gnl|my_center|LOCUS_02730 9861 8551 gene locus_tag LOCUS_02740 gene purB 9861 8551 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233955.1 protein_id gnl|my_center|LOCUS_02740 10726 9863 gene locus_tag LOCUS_02750 gene folD 10726 9863 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226720.1 protein_id gnl|my_center|LOCUS_02750 11992 10745 gene locus_tag LOCUS_02760 gene purD 11992 10745 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101936.1 protein_id gnl|my_center|LOCUS_02760 13561 12008 gene locus_tag LOCUS_02770 gene purH 13561 12008 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548356.1 protein_id gnl|my_center|LOCUS_02770 14133 13564 gene locus_tag LOCUS_02780 gene purN 14133 13564 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088592.1 protein_id gnl|my_center|LOCUS_02780 15169 14135 gene locus_tag LOCUS_02790 gene purM 15169 14135 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933235.1 protein_id gnl|my_center|LOCUS_02790 15956 15189 gene locus_tag LOCUS_02800 15956 15189 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016809.1 protein_id gnl|my_center|LOCUS_02800 19683 15943 gene locus_tag LOCUS_02810 19683 15943 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494805.1 protein_id gnl|my_center|LOCUS_02810 20768 19683 gene locus_tag LOCUS_02820 gene purK 20768 19683 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697988.1 protein_id gnl|my_center|LOCUS_02820 21531 21055 gene locus_tag LOCUS_02830 gene purE 21531 21055 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244134.1 protein_id gnl|my_center|LOCUS_02830 23266 21533 gene locus_tag LOCUS_02840 23266 21533 CDS product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948795.1 protein_id gnl|my_center|LOCUS_02840 24961 23297 gene locus_tag LOCUS_02850 24961 23297 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001985392.1 protein_id gnl|my_center|LOCUS_02850 25928 25188 gene locus_tag LOCUS_02860 25928 25188 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464874.1 protein_id gnl|my_center|LOCUS_02860 26930 26079 gene locus_tag LOCUS_02870 26930 26079 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948024.1 protein_id gnl|my_center|LOCUS_02870 27050 28309 gene locus_tag LOCUS_02880 gene hflX 27050 28309 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391877.1 protein_id gnl|my_center|LOCUS_02880 30281 28341 gene locus_tag LOCUS_02890 gene metG 30281 28341 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_02890 31205 30375 gene locus_tag LOCUS_02900 31205 30375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 31779 31249 gene locus_tag LOCUS_02910 31779 31249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 32633 31782 gene locus_tag LOCUS_02920 gene rsmI 32633 31782 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263897.1 protein_id gnl|my_center|LOCUS_02920 33042 32635 gene locus_tag LOCUS_02930 33042 32635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 33773 33048 gene locus_tag LOCUS_02940 33773 33048 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055361.1 protein_id gnl|my_center|LOCUS_02940 34603 33776 gene locus_tag LOCUS_02950 34603 33776 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_02950 35573 34611 gene locus_tag LOCUS_02960 gene holB 35573 34611 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244417.1 protein_id gnl|my_center|LOCUS_02960 36213 35563 gene locus_tag LOCUS_02970 gene tmk 36213 35563 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677216.1 protein_id gnl|my_center|LOCUS_02970 36757 36299 gene locus_tag LOCUS_02980 36757 36299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 37505 36774 gene locus_tag LOCUS_02990 gene truA 37505 36774 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211477893.1 protein_id gnl|my_center|LOCUS_02990 38542 37505 gene locus_tag LOCUS_03000 38542 37505 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_03000 39401 38535 gene locus_tag LOCUS_03010 39401 38535 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476334.1 protein_id gnl|my_center|LOCUS_03010 40186 39377 gene locus_tag LOCUS_03020 40186 39377 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399689.1 protein_id gnl|my_center|LOCUS_03020 40436 40317 gene locus_tag LOCUS_03030 40436 40317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 40728 40654 gene locus_tag LOCUS_t00030 40728 40654 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 41925 40852 gene locus_tag LOCUS_03040 41925 40852 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949069.1 protein_id gnl|my_center|LOCUS_03040 44621 42123 gene locus_tag LOCUS_03050 44621 42123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 45016 44624 gene locus_tag LOCUS_03060 45016 44624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 48280 45149 gene locus_tag LOCUS_03070 48280 45149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 50127 48319 gene locus_tag LOCUS_03080 50127 48319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 51030 50302 gene locus_tag LOCUS_03090 51030 50302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 52382 51144 gene locus_tag LOCUS_03100 52382 51144 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987074.1 protein_id gnl|my_center|LOCUS_03100 53614 52376 gene locus_tag LOCUS_03110 53614 52376 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948284.1 protein_id gnl|my_center|LOCUS_03110 54155 53679 gene locus_tag LOCUS_03120 54155 53679 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460302.1 protein_id gnl|my_center|LOCUS_03120 54967 54269 gene locus_tag LOCUS_03130 54967 54269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 55838 54972 gene locus_tag LOCUS_03140 55838 54972 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_03140 56244 55840 gene locus_tag LOCUS_03150 56244 55840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 56996 56349 gene locus_tag LOCUS_03160 56996 56349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 57541 57005 gene locus_tag LOCUS_03170 57541 57005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 57656 58630 gene locus_tag LOCUS_03180 57656 58630 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963616.1 protein_id gnl|my_center|LOCUS_03180 60023 58680 gene locus_tag LOCUS_03190 gene mnmE 60023 58680 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131240.1 protein_id gnl|my_center|LOCUS_03190 61577 60063 gene locus_tag LOCUS_03200 61577 60063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 62772 61711 gene locus_tag LOCUS_03210 62772 61711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 >Feature sequence05 404 150 gene locus_tag LOCUS_03220 404 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 1401 487 gene locus_tag LOCUS_03230 gene argF 1401 487 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_03230 2589 1405 gene locus_tag LOCUS_03240 2589 1405 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861434.1 protein_id gnl|my_center|LOCUS_03240 3458 2604 gene locus_tag LOCUS_03250 gene argB 3458 2604 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459300.1 protein_id gnl|my_center|LOCUS_03250 4687 3464 gene locus_tag LOCUS_03260 gene argJ 4687 3464 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435168.1 protein_id gnl|my_center|LOCUS_03260 5652 4699 gene locus_tag LOCUS_03270 gene argC 5652 4699 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975053.1 protein_id gnl|my_center|LOCUS_03270 7021 5657 gene locus_tag LOCUS_03280 gene argH 7021 5657 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_03280 8329 7094 gene locus_tag LOCUS_03290 8329 7094 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_03290 9496 9017 gene locus_tag LOCUS_03300 9496 9017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 10050 9553 gene locus_tag LOCUS_03310 10050 9553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 10255 11130 gene locus_tag LOCUS_03320 gene hslO 10255 11130 CDS product redox-regulated molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226695.1 protein_id gnl|my_center|LOCUS_03320 11873 11178 gene locus_tag LOCUS_03330 11873 11178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 12922 12137 gene locus_tag LOCUS_03340 12922 12137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 13083 12946 gene locus_tag LOCUS_03350 13083 12946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 14124 13231 gene locus_tag LOCUS_03360 14124 13231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 14748 14140 gene locus_tag LOCUS_03370 14748 14140 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389102.1 protein_id gnl|my_center|LOCUS_03370 15067 14738 gene locus_tag LOCUS_03380 15067 14738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 15505 15077 gene locus_tag LOCUS_03390 gene ruvX 15505 15077 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939059.1 protein_id gnl|my_center|LOCUS_03390 18117 15505 gene locus_tag LOCUS_03400 gene alaS 18117 15505 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811825.1 protein_id gnl|my_center|LOCUS_03400 19234 18272 gene locus_tag LOCUS_03410 19234 18272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 19428 19667 gene locus_tag LOCUS_03420 19428 19667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 21937 19664 gene locus_tag LOCUS_03430 21937 19664 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398511.1 protein_id gnl|my_center|LOCUS_03430 22115 22909 gene locus_tag LOCUS_03440 22115 22909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 23064 23139 gene locus_tag LOCUS_t00040 23064 23139 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 23239 23658 gene locus_tag LOCUS_03450 23239 23658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 24200 23676 gene locus_tag LOCUS_03460 24200 23676 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868691.1 protein_id gnl|my_center|LOCUS_03460 25402 24209 gene locus_tag LOCUS_03470 gene pncB 25402 24209 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010358295.1 protein_id gnl|my_center|LOCUS_03470 26134 25418 gene locus_tag LOCUS_03480 gene nadE 26134 25418 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496806.1 protein_id gnl|my_center|LOCUS_03480 27351 26230 gene locus_tag LOCUS_03490 27351 26230 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986767.1 protein_id gnl|my_center|LOCUS_03490 28187 27378 gene locus_tag LOCUS_03500 28187 27378 CDS product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430012.1 protein_id gnl|my_center|LOCUS_03500 28869 28180 gene locus_tag LOCUS_03510 28869 28180 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289136.1 protein_id gnl|my_center|LOCUS_03510 29361 28876 gene locus_tag LOCUS_03520 29361 28876 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262000.1 protein_id gnl|my_center|LOCUS_03520 29786 29361 gene locus_tag LOCUS_03530 29786 29361 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081070.1 protein_id gnl|my_center|LOCUS_03530 29970 30413 gene locus_tag LOCUS_03540 29970 30413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 31284 30481 gene locus_tag LOCUS_03550 31284 30481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 35872 31376 gene locus_tag LOCUS_03560 35872 31376 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288497.1 protein_id gnl|my_center|LOCUS_03560 36734 35895 gene locus_tag LOCUS_03570 36734 35895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 36997 37932 gene locus_tag LOCUS_03580 36997 37932 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048393.1 protein_id gnl|my_center|LOCUS_03580 38379 37957 gene locus_tag LOCUS_03590 38379 37957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 40449 38440 gene locus_tag LOCUS_03600 gene leuS 40449 38440 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599464.1 protein_id gnl|my_center|LOCUS_03600 40756 40517 gene locus_tag LOCUS_03610 gene acpP 40756 40517 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631656.1 protein_id gnl|my_center|LOCUS_03610 41228 40800 gene locus_tag LOCUS_03620 41228 40800 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964547.1 protein_id gnl|my_center|LOCUS_03620 42100 41228 gene locus_tag LOCUS_03630 gene thrB 42100 41228 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897262.1 protein_id gnl|my_center|LOCUS_03630 43506 42088 gene locus_tag LOCUS_03640 gene thrC 43506 42088 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986278.1 protein_id gnl|my_center|LOCUS_03640 44223 43645 gene locus_tag LOCUS_03650 44223 43645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 46238 44280 gene locus_tag LOCUS_03660 46238 44280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 46872 46222 gene locus_tag LOCUS_03670 46872 46222 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_159184734.1 protein_id gnl|my_center|LOCUS_03670 47809 46865 gene locus_tag LOCUS_03680 47809 46865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 47930 49258 gene locus_tag LOCUS_03690 47930 49258 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017170.1 protein_id gnl|my_center|LOCUS_03690 50544 49288 gene locus_tag LOCUS_03700 50544 49288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 50667 50742 gene locus_tag LOCUS_t00050 50667 50742 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 50844 50918 gene locus_tag LOCUS_t00060 50844 50918 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence06 1255 155 gene locus_tag LOCUS_03710 1255 155 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 protein_id gnl|my_center|LOCUS_03710 2058 1363 gene locus_tag LOCUS_03720 2058 1363 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_03720 2776 2069 gene locus_tag LOCUS_03730 2776 2069 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814520.1 protein_id gnl|my_center|LOCUS_03730 5166 2920 gene locus_tag LOCUS_03740 5166 2920 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965638.1 protein_id gnl|my_center|LOCUS_03740 7311 5311 gene locus_tag LOCUS_03750 7311 5311 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379416.1 protein_id gnl|my_center|LOCUS_03750 7601 7392 gene locus_tag LOCUS_03760 7601 7392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 7933 7616 gene locus_tag LOCUS_03770 7933 7616 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 protein_id gnl|my_center|LOCUS_03770 9292 8045 gene locus_tag LOCUS_03780 gene trpB 9292 8045 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482634.1 protein_id gnl|my_center|LOCUS_03780 11237 9345 gene locus_tag LOCUS_03790 11237 9345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 12258 11260 gene locus_tag LOCUS_03800 12258 11260 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_03800 13416 12403 gene locus_tag LOCUS_03810 gene galE 13416 12403 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861656.1 protein_id gnl|my_center|LOCUS_03810 13595 14458 gene locus_tag LOCUS_03820 13595 14458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 15431 14472 gene locus_tag LOCUS_03830 15431 14472 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765521.1 protein_id gnl|my_center|LOCUS_03830 16918 15440 gene locus_tag LOCUS_03840 16918 15440 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964345.1 protein_id gnl|my_center|LOCUS_03840 17249 16923 gene locus_tag LOCUS_03850 17249 16923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 17943 17242 gene locus_tag LOCUS_03860 17943 17242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 19317 17995 gene locus_tag LOCUS_03870 19317 17995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 20983 19460 gene locus_tag LOCUS_03880 20983 19460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 26982 21202 gene locus_tag LOCUS_03890 26982 21202 CDS product DUF4011 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008363296.1 protein_id gnl|my_center|LOCUS_03890 27204 28253 gene locus_tag LOCUS_03900 27204 28253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 29065 28250 gene locus_tag LOCUS_03910 29065 28250 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259031.1 protein_id gnl|my_center|LOCUS_03910 30443 29247 gene locus_tag LOCUS_03920 30443 29247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 33167 30654 gene locus_tag LOCUS_03930 33167 30654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 34639 33167 gene locus_tag LOCUS_03940 34639 33167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 35742 34639 gene locus_tag LOCUS_03950 35742 34639 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918104.1 protein_id gnl|my_center|LOCUS_03950 35859 36827 gene locus_tag LOCUS_03960 35859 36827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 36820 37680 gene locus_tag LOCUS_03970 36820 37680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 38663 37695 gene locus_tag LOCUS_03980 38663 37695 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_03980 40096 38663 gene locus_tag LOCUS_03990 40096 38663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 41733 40096 gene locus_tag LOCUS_04000 41733 40096 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_04000 42994 41822 gene locus_tag LOCUS_04010 42994 41822 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389655.1 protein_id gnl|my_center|LOCUS_04010 43563 43174 gene locus_tag LOCUS_04020 43563 43174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 44803 43547 gene locus_tag LOCUS_04030 44803 43547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 46716 44800 gene locus_tag LOCUS_04040 46716 44800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 47285 46704 gene locus_tag LOCUS_04050 47285 46704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 48919 47279 gene locus_tag LOCUS_04060 gene fakA 48919 47279 CDS product fatty acid kinase catalytic subunit FakA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830116.1 protein_id gnl|my_center|LOCUS_04060 49068 50000 gene locus_tag LOCUS_04070 49068 50000 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_04070 >Feature sequence07 1996 608 gene locus_tag LOCUS_04080 1996 608 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_04080 2097 2960 gene locus_tag LOCUS_04090 2097 2960 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207887.1 protein_id gnl|my_center|LOCUS_04090 4265 2973 gene locus_tag LOCUS_04100 4265 2973 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963553.1 protein_id gnl|my_center|LOCUS_04100 5644 4244 gene locus_tag LOCUS_04110 5644 4244 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963552.1 protein_id gnl|my_center|LOCUS_04110 6613 5663 gene locus_tag LOCUS_04120 gene fabK 6613 5663 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419125.1 protein_id gnl|my_center|LOCUS_04120 7423 6626 gene locus_tag LOCUS_04130 7423 6626 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646328.1 protein_id gnl|my_center|LOCUS_04130 8756 7437 gene locus_tag LOCUS_04140 8756 7437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 8967 8761 gene locus_tag LOCUS_04150 8967 8761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 9284 8979 gene locus_tag LOCUS_04160 9284 8979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 10449 9370 gene locus_tag LOCUS_04170 10449 9370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 11563 10475 gene locus_tag LOCUS_04180 11563 10475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 13562 11748 gene locus_tag LOCUS_04190 13562 11748 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 protein_id gnl|my_center|LOCUS_04190 15381 13564 gene locus_tag LOCUS_04200 15381 13564 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680842.1 protein_id gnl|my_center|LOCUS_04200 17170 15497 gene locus_tag LOCUS_04210 17170 15497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 19586 17250 gene locus_tag LOCUS_04220 19586 17250 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254507.1 protein_id gnl|my_center|LOCUS_04220 20646 19588 gene locus_tag LOCUS_04230 20646 19588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 21394 20759 gene locus_tag LOCUS_04240 21394 20759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 22524 21394 gene locus_tag LOCUS_04250 22524 21394 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_04250 22894 22517 gene locus_tag LOCUS_04260 22894 22517 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359335.1 protein_id gnl|my_center|LOCUS_04260 24622 23015 gene locus_tag LOCUS_04270 gene groL 24622 23015 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362559.1 protein_id gnl|my_center|LOCUS_04270 24922 24641 gene locus_tag LOCUS_04280 gene groES 24922 24641 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258595.1 protein_id gnl|my_center|LOCUS_04280 25654 25058 gene locus_tag LOCUS_04290 25654 25058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 27092 25656 gene locus_tag LOCUS_04300 27092 25656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 27976 27101 gene locus_tag LOCUS_04310 27976 27101 CDS product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062847.1 protein_id gnl|my_center|LOCUS_04310 28931 28056 gene locus_tag LOCUS_04320 28931 28056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 30100 29468 gene locus_tag LOCUS_04330 30100 29468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 30683 30093 gene locus_tag LOCUS_04340 30683 30093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 30839 33418 gene locus_tag LOCUS_04350 30839 33418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 33415 34812 gene locus_tag LOCUS_04360 33415 34812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 35804 34884 gene locus_tag LOCUS_04370 35804 34884 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_04370 37050 35899 gene locus_tag LOCUS_04380 37050 35899 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227054.1 protein_id gnl|my_center|LOCUS_04380 37577 37080 gene locus_tag LOCUS_04390 37577 37080 CDS product DNA topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965776.1 protein_id gnl|my_center|LOCUS_04390 38290 37748 gene locus_tag LOCUS_04400 38290 37748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 39319 38450 gene locus_tag LOCUS_04410 gene aguB 39319 38450 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464341.1 protein_id gnl|my_center|LOCUS_04410 40397 39321 gene locus_tag LOCUS_04420 gene aguA 40397 39321 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009911777.1 protein_id gnl|my_center|LOCUS_04420 41883 40390 gene locus_tag LOCUS_04430 41883 40390 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048125.1 protein_id gnl|my_center|LOCUS_04430 42543 42112 gene locus_tag LOCUS_04440 42543 42112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 43106 42585 gene locus_tag LOCUS_04450 43106 42585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 43711 43199 gene locus_tag LOCUS_04460 43711 43199 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564583.1 protein_id gnl|my_center|LOCUS_04460 44495 44019 gene locus_tag LOCUS_04470 44495 44019 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_04470 45303 44512 gene locus_tag LOCUS_04480 45303 44512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 46173 45523 gene locus_tag LOCUS_04490 46173 45523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 47938 46394 gene locus_tag LOCUS_04500 47938 46394 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682243.1 protein_id gnl|my_center|LOCUS_04500 48153 47935 gene locus_tag LOCUS_04510 48153 47935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 49504 48155 gene locus_tag LOCUS_04520 49504 48155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 >Feature sequence08 1185 787 gene locus_tag LOCUS_04530 gene rpsI 1185 787 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079986.1 protein_id gnl|my_center|LOCUS_04530 1637 1200 gene locus_tag LOCUS_04540 gene rplM 1637 1200 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638098.1 protein_id gnl|my_center|LOCUS_04540 2279 1827 gene locus_tag LOCUS_04550 2279 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 2582 4861 gene locus_tag LOCUS_04560 2582 4861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 5552 4941 gene locus_tag LOCUS_04570 5552 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 6146 5661 gene locus_tag LOCUS_04580 6146 5661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 6776 6204 gene locus_tag LOCUS_04590 6776 6204 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134946.1 protein_id gnl|my_center|LOCUS_04590 7459 6773 gene locus_tag LOCUS_04600 7459 6773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 8439 7459 gene locus_tag LOCUS_04610 gene dusB 8439 7459 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290055.1 protein_id gnl|my_center|LOCUS_04610 8995 8423 gene locus_tag LOCUS_04620 8995 8423 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_04620 9401 8967 gene locus_tag LOCUS_04630 9401 8967 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289317.1 protein_id gnl|my_center|LOCUS_04630 9573 11135 gene locus_tag LOCUS_04640 gene lysS 9573 11135 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905307.1 protein_id gnl|my_center|LOCUS_04640 11137 11778 gene locus_tag LOCUS_04650 11137 11778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 13599 11809 gene locus_tag LOCUS_04660 13599 11809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 14710 13691 gene locus_tag LOCUS_04670 14710 13691 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287604.1 protein_id gnl|my_center|LOCUS_04670 15641 14808 gene locus_tag LOCUS_04680 15641 14808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 17383 15707 gene locus_tag LOCUS_04690 17383 15707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 18284 17394 gene locus_tag LOCUS_04700 18284 17394 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355144.1 protein_id gnl|my_center|LOCUS_04700 19194 18298 gene locus_tag LOCUS_04710 19194 18298 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550063.1 protein_id gnl|my_center|LOCUS_04710 19636 19316 gene locus_tag LOCUS_04720 19636 19316 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082953.1 protein_id gnl|my_center|LOCUS_04720 19863 19636 gene locus_tag LOCUS_04730 19863 19636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 20447 19863 gene locus_tag LOCUS_04740 gene rsxA 20447 19863 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_04740 21226 20444 gene locus_tag LOCUS_04750 21226 20444 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761246.1 protein_id gnl|my_center|LOCUS_04750 21818 21237 gene locus_tag LOCUS_04760 21818 21237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 22912 21818 gene locus_tag LOCUS_04770 22912 21818 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428487.1 protein_id gnl|my_center|LOCUS_04770 24218 22923 gene locus_tag LOCUS_04780 gene rsxC 24218 22923 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869095.1 protein_id gnl|my_center|LOCUS_04780 25508 24258 gene locus_tag LOCUS_04790 gene glyA 25508 24258 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227669.1 protein_id gnl|my_center|LOCUS_04790 26747 25620 gene locus_tag LOCUS_04800 26747 25620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 27663 26896 gene locus_tag LOCUS_04810 gene kduD 27663 26896 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097013.1 protein_id gnl|my_center|LOCUS_04810 28394 28035 gene locus_tag LOCUS_04820 gene rplQ 28394 28035 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331490.1 protein_id gnl|my_center|LOCUS_04820 29398 28415 gene locus_tag LOCUS_04830 gene rpoA 29398 28415 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569643.1 protein_id gnl|my_center|LOCUS_04830 29867 29484 gene locus_tag LOCUS_04840 gene rpsK 29867 29484 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183046.1 protein_id gnl|my_center|LOCUS_04840 30252 29887 gene locus_tag LOCUS_04850 gene rpsM 30252 29887 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235095.1 protein_id gnl|my_center|LOCUS_04850 30625 30404 gene locus_tag LOCUS_04860 gene infA 30625 30404 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118443.1 protein_id gnl|my_center|LOCUS_04860 31563 30922 gene locus_tag LOCUS_04870 31563 30922 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810125.1 protein_id gnl|my_center|LOCUS_04870 32890 31577 gene locus_tag LOCUS_04880 gene secY 32890 31577 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490114.1 protein_id gnl|my_center|LOCUS_04880 33331 32891 gene locus_tag LOCUS_04890 gene rplO 33331 32891 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225819.1 protein_id gnl|my_center|LOCUS_04890 33522 33349 gene locus_tag LOCUS_04900 gene rpmD 33522 33349 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288686.1 protein_id gnl|my_center|LOCUS_04900 34049 33528 gene locus_tag LOCUS_04910 gene rpsE 34049 33528 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003328273.1 protein_id gnl|my_center|LOCUS_04910 34426 34064 gene locus_tag LOCUS_04920 gene rplR 34426 34064 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225816.1 protein_id gnl|my_center|LOCUS_04920 34989 34447 gene locus_tag LOCUS_04930 gene rplF 34989 34447 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183035.1 protein_id gnl|my_center|LOCUS_04930 35469 35083 gene locus_tag LOCUS_04940 gene rpsH 35469 35083 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638074.1 protein_id gnl|my_center|LOCUS_04940 35687 35502 gene locus_tag LOCUS_04950 35687 35502 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140799.1 protein_id gnl|my_center|LOCUS_04950 36243 35704 gene locus_tag LOCUS_04960 gene rplE 36243 35704 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080824.1 protein_id gnl|my_center|LOCUS_04960 36617 36264 gene locus_tag LOCUS_04970 gene rplX 36617 36264 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547687.1 protein_id gnl|my_center|LOCUS_04970 37000 36632 gene locus_tag LOCUS_04980 gene rplN 37000 36632 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616546.1 protein_id gnl|my_center|LOCUS_04980 37286 37026 gene locus_tag LOCUS_04990 gene rpsQ 37286 37026 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004106.1 protein_id gnl|my_center|LOCUS_04990 37517 37302 gene locus_tag LOCUS_05000 gene rpmC 37517 37302 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869921.1 protein_id gnl|my_center|LOCUS_05000 37936 37517 gene locus_tag LOCUS_05010 gene rplP 37936 37517 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183027.1 protein_id gnl|my_center|LOCUS_05010 38709 37939 gene locus_tag LOCUS_05020 gene rpsC 38709 37939 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720944.1 protein_id gnl|my_center|LOCUS_05020 39075 38713 gene locus_tag LOCUS_05030 gene rplV 39075 38713 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727697.1 protein_id gnl|my_center|LOCUS_05030 39355 39077 gene locus_tag LOCUS_05040 gene rpsS 39355 39077 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124353.1 protein_id gnl|my_center|LOCUS_05040 40204 39371 gene locus_tag LOCUS_05050 gene rplB 40204 39371 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511580.1 protein_id gnl|my_center|LOCUS_05050 40510 40223 gene locus_tag LOCUS_05060 gene rplW 40510 40223 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_05060 41149 40514 gene locus_tag LOCUS_05070 gene rplD 41149 40514 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727695.1 protein_id gnl|my_center|LOCUS_05070 41808 41164 gene locus_tag LOCUS_05080 gene rplC 41808 41164 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399671.1 protein_id gnl|my_center|LOCUS_05080 42151 41843 gene locus_tag LOCUS_05090 gene rpsJ 42151 41843 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393938.1 protein_id gnl|my_center|LOCUS_05090 43903 42416 gene locus_tag LOCUS_05100 43903 42416 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865220.1 protein_id gnl|my_center|LOCUS_05100 44883 43921 gene locus_tag LOCUS_05110 44883 43921 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_05110 45521 44976 gene locus_tag LOCUS_05120 45521 44976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 49062 45613 gene locus_tag LOCUS_05130 gene mfd 49062 45613 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243453.1 protein_id gnl|my_center|LOCUS_05130 <49725 49138 gene locus_tag LOCUS_05140 <49725 49138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016314.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme >Feature sequence09 <1 3541 gene locus_tag LOCUS_05150 <1 3541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964122.1:polysaccharide lyase family 1 protein 3803 7396 gene locus_tag LOCUS_05160 gene nifJ 3803 7396 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016958.1 protein_id gnl|my_center|LOCUS_05160 7488 7919 gene locus_tag LOCUS_05170 7488 7919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 7919 8461 gene locus_tag LOCUS_05180 gene yfcE 7919 8461 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_05180 8505 9110 gene locus_tag LOCUS_05190 8505 9110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 9319 11181 gene locus_tag LOCUS_05200 9319 11181 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083241703.1 protein_id gnl|my_center|LOCUS_05200 11214 12428 gene locus_tag LOCUS_05210 11214 12428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 12449 13819 gene locus_tag LOCUS_05220 12449 13819 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202606.1 protein_id gnl|my_center|LOCUS_05220 13868 14362 gene locus_tag LOCUS_05230 13868 14362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 14467 14877 gene locus_tag LOCUS_05240 14467 14877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 14987 16300 gene locus_tag LOCUS_05250 14987 16300 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948764.1 protein_id gnl|my_center|LOCUS_05250 16589 16314 gene locus_tag LOCUS_05260 16589 16314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 17115 16579 gene locus_tag LOCUS_05270 17115 16579 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_05270 17270 18847 gene locus_tag LOCUS_05280 17270 18847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 18875 21430 gene locus_tag LOCUS_05290 gene mutS 18875 21430 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196026.1 protein_id gnl|my_center|LOCUS_05290 21434 23323 gene locus_tag LOCUS_05300 gene mutL 21434 23323 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476177.1 protein_id gnl|my_center|LOCUS_05300 23323 24210 gene locus_tag LOCUS_05310 gene miaA 23323 24210 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289405.1 protein_id gnl|my_center|LOCUS_05310 24213 24692 gene locus_tag LOCUS_05320 24213 24692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 24692 25126 gene locus_tag LOCUS_05330 gene aroQ 24692 25126 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016972.1 protein_id gnl|my_center|LOCUS_05330 25231 25788 gene locus_tag LOCUS_05340 gene efp 25231 25788 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485096.1 protein_id gnl|my_center|LOCUS_05340 25836 27218 gene locus_tag LOCUS_05350 25836 27218 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080781.1 protein_id gnl|my_center|LOCUS_05350 27401 28714 gene locus_tag LOCUS_05360 27401 28714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 30404 28788 gene locus_tag LOCUS_05370 30404 28788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 33766 30407 gene locus_tag LOCUS_05380 33766 30407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 33928 34488 gene locus_tag LOCUS_05390 gene ruvA 33928 34488 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290528.1 protein_id gnl|my_center|LOCUS_05390 34490 35509 gene locus_tag LOCUS_05400 gene ruvB 34490 35509 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344449.1 protein_id gnl|my_center|LOCUS_05400 35509 36540 gene locus_tag LOCUS_05410 gene queA 35509 36540 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095273.1 protein_id gnl|my_center|LOCUS_05410 36559 37071 gene locus_tag LOCUS_05420 36559 37071 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198805.1 protein_id gnl|my_center|LOCUS_05420 37071 38195 gene locus_tag LOCUS_05430 gene tgt 37071 38195 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830840.1 protein_id gnl|my_center|LOCUS_05430 38331 38696 gene locus_tag LOCUS_05440 38331 38696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 38713 38985 gene locus_tag LOCUS_05450 38713 38985 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154654.1 protein_id gnl|my_center|LOCUS_05450 39055 40407 gene locus_tag LOCUS_05460 gene pepV 39055 40407 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294157.1 protein_id gnl|my_center|LOCUS_05460 40407 41054 gene locus_tag LOCUS_05470 gene trmB 40407 41054 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266024.1 protein_id gnl|my_center|LOCUS_05470 41054 41770 gene locus_tag LOCUS_05480 41054 41770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 41742 42608 gene locus_tag LOCUS_05490 41742 42608 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963541.1 protein_id gnl|my_center|LOCUS_05490 42652 43947 gene locus_tag LOCUS_05500 42652 43947 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289207.1 protein_id gnl|my_center|LOCUS_05500 44067 44303 gene locus_tag LOCUS_05510 44067 44303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 44360 46663 gene locus_tag LOCUS_05520 gene rnr 44360 46663 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289014.1 protein_id gnl|my_center|LOCUS_05520 46641 47087 gene locus_tag LOCUS_05530 gene smpB 46641 47087 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545050.1 protein_id gnl|my_center|LOCUS_05530 47140 47544 gene locus_tag LOCUS_tm00010 47140 47544 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence10 11 87 gene locus_tag LOCUS_t00070 11 87 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 125 200 gene locus_tag LOCUS_t00080 125 200 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 216 291 gene locus_tag LOCUS_t00090 216 291 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 483 1280 gene locus_tag LOCUS_05540 gene cdaA 483 1280 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350949.1 protein_id gnl|my_center|LOCUS_05540 1296 1472 gene locus_tag LOCUS_05550 1296 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 1487 3073 gene locus_tag LOCUS_05560 1487 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 3073 3582 gene locus_tag LOCUS_05570 3073 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 3587 4237 gene locus_tag LOCUS_05580 gene ispD 3587 4237 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048363.1 protein_id gnl|my_center|LOCUS_05580 4230 4706 gene locus_tag LOCUS_05590 gene ispF 4230 4706 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963756.1 protein_id gnl|my_center|LOCUS_05590 4699 5148 gene locus_tag LOCUS_05600 4699 5148 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_05600 5197 5997 gene locus_tag LOCUS_05610 5197 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 6000 6257 gene locus_tag LOCUS_05620 6000 6257 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015102.1 protein_id gnl|my_center|LOCUS_05620 6286 7947 gene locus_tag LOCUS_05630 6286 7947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 7974 9308 gene locus_tag LOCUS_05640 7974 9308 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103654.1 protein_id gnl|my_center|LOCUS_05640 9323 9832 gene locus_tag LOCUS_05650 9323 9832 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939955.1 protein_id gnl|my_center|LOCUS_05650 9981 10598 gene locus_tag LOCUS_05660 9981 10598 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903683.1 protein_id gnl|my_center|LOCUS_05660 10610 12001 gene locus_tag LOCUS_05670 10610 12001 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109116.1 protein_id gnl|my_center|LOCUS_05670 12115 12387 gene locus_tag LOCUS_05680 12115 12387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 12415 12639 gene locus_tag LOCUS_05690 12415 12639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 12812 13168 gene locus_tag LOCUS_05700 gene rplS 12812 13168 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220825.1 protein_id gnl|my_center|LOCUS_05700 13315 14736 gene locus_tag LOCUS_05710 13315 14736 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_05710 14736 15257 gene locus_tag LOCUS_05720 14736 15257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 15271 16035 gene locus_tag LOCUS_05730 15271 16035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 16093 17871 gene locus_tag LOCUS_05740 gene glmS 16093 17871 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334164.1 protein_id gnl|my_center|LOCUS_05740 17966 18646 gene locus_tag LOCUS_05750 17966 18646 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851996.1 protein_id gnl|my_center|LOCUS_05750 18788 21181 gene locus_tag LOCUS_05760 18788 21181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 22632 21265 gene locus_tag LOCUS_05770 gene gdhA 22632 21265 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051757.1 protein_id gnl|my_center|LOCUS_05770 22909 23544 gene locus_tag LOCUS_05780 22909 23544 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_05780 23604 24548 gene locus_tag LOCUS_05790 23604 24548 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229346.1 protein_id gnl|my_center|LOCUS_05790 24563 25786 gene locus_tag LOCUS_05800 gene ackA 24563 25786 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034575.1 protein_id gnl|my_center|LOCUS_05800 25896 26777 gene locus_tag LOCUS_05810 25896 26777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 26864 27709 gene locus_tag LOCUS_05820 26864 27709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 27838 28656 gene locus_tag LOCUS_05830 27838 28656 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 protein_id gnl|my_center|LOCUS_05830 28661 29689 gene locus_tag LOCUS_05840 gene aroB 28661 29689 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964212.1 protein_id gnl|my_center|LOCUS_05840 29689 30960 gene locus_tag LOCUS_05850 gene aroA 29689 30960 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861345.1 protein_id gnl|my_center|LOCUS_05850 30950 31240 gene locus_tag LOCUS_05860 30950 31240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 31242 32006 gene locus_tag LOCUS_05870 gene aroE 31242 32006 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439416.1 protein_id gnl|my_center|LOCUS_05870 32003 32995 gene locus_tag LOCUS_05880 gene aroC 32003 32995 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016764.1 protein_id gnl|my_center|LOCUS_05880 33028 33990 gene locus_tag LOCUS_05890 33028 33990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 34016 34711 gene locus_tag LOCUS_05900 34016 34711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 35541 34750 gene locus_tag LOCUS_05910 35541 34750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 35632 36141 gene locus_tag LOCUS_05920 35632 36141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 36153 37097 gene locus_tag LOCUS_05930 36153 37097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 37791 37189 gene locus_tag LOCUS_05940 gene rpsD 37791 37189 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294265.1 protein_id gnl|my_center|LOCUS_05940 38114 39388 gene locus_tag LOCUS_05950 gene thiI 38114 39388 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989282.1 protein_id gnl|my_center|LOCUS_05950 39369 40103 gene locus_tag LOCUS_05960 39369 40103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 40116 40670 gene locus_tag LOCUS_05970 40116 40670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 40752 41912 gene locus_tag LOCUS_05980 gene ugpC 40752 41912 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818946.1 protein_id gnl|my_center|LOCUS_05980 42068 45130 gene locus_tag LOCUS_05990 42068 45130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 45249 46397 gene locus_tag LOCUS_06000 gene fucO 45249 46397 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288246.1 protein_id gnl|my_center|LOCUS_06000 46618 47319 gene locus_tag LOCUS_06010 46618 47319 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965964.1 protein_id gnl|my_center|LOCUS_06010 >Feature sequence11 1141 197 gene locus_tag LOCUS_06020 1141 197 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357629.1 protein_id gnl|my_center|LOCUS_06020 1282 4314 gene locus_tag LOCUS_06030 1282 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 4314 5261 gene locus_tag LOCUS_06040 4314 5261 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547856.1 protein_id gnl|my_center|LOCUS_06040 5245 5796 gene locus_tag LOCUS_06050 5245 5796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 6514 5897 gene locus_tag LOCUS_06060 6514 5897 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640953.1 protein_id gnl|my_center|LOCUS_06060 6966 6592 gene locus_tag LOCUS_06070 gene rplL 6966 6592 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215374.1 protein_id gnl|my_center|LOCUS_06070 7546 7013 gene locus_tag LOCUS_06080 gene rplJ 7546 7013 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356426.1 protein_id gnl|my_center|LOCUS_06080 8391 7702 gene locus_tag LOCUS_06090 gene rplA 8391 7702 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235040.1 protein_id gnl|my_center|LOCUS_06090 8902 8477 gene locus_tag LOCUS_06100 gene rplK 8902 8477 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085792.1 protein_id gnl|my_center|LOCUS_06100 10251 9085 gene locus_tag LOCUS_06110 10251 9085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 14194 10382 gene locus_tag LOCUS_06120 gene rpoC 14194 10382 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399688.1 protein_id gnl|my_center|LOCUS_06120 17946 14212 gene locus_tag LOCUS_06130 gene rpoB 17946 14212 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295964.1 protein_id gnl|my_center|LOCUS_06130 18309 19247 gene locus_tag LOCUS_06140 18309 19247 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459799.1 protein_id gnl|my_center|LOCUS_06140 19714 19244 gene locus_tag LOCUS_06150 19714 19244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 20353 19718 gene locus_tag LOCUS_06160 20353 19718 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922043.1 protein_id gnl|my_center|LOCUS_06160 21344 20475 gene locus_tag LOCUS_06170 gene fba 21344 20475 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_06170 24368 21432 gene locus_tag LOCUS_06180 gene dnaE 24368 21432 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673740.1 protein_id gnl|my_center|LOCUS_06180 25906 24440 gene locus_tag LOCUS_06190 25906 24440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 27053 25911 gene locus_tag LOCUS_06200 27053 25911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 27919 27287 gene locus_tag LOCUS_06210 gene nth 27919 27287 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922193.1 protein_id gnl|my_center|LOCUS_06210 28524 27919 gene locus_tag LOCUS_06220 28524 27919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 29206 28538 gene locus_tag LOCUS_06230 gene rnc 29206 28538 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989817.1 protein_id gnl|my_center|LOCUS_06230 30244 29213 gene locus_tag LOCUS_06240 gene plsX 30244 29213 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684092.1 protein_id gnl|my_center|LOCUS_06240 32298 30304 gene locus_tag LOCUS_06250 gene recG 32298 30304 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989820.1 protein_id gnl|my_center|LOCUS_06250 33982 32366 gene locus_tag LOCUS_06260 33982 32366 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027130.1 protein_id gnl|my_center|LOCUS_06260 34427 34615 gene locus_tag LOCUS_06270 gene rpmB 34427 34615 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221548.1 protein_id gnl|my_center|LOCUS_06270 35346 34708 gene locus_tag LOCUS_06280 gene rpe 35346 34708 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957271.1 protein_id gnl|my_center|LOCUS_06280 36257 35343 gene locus_tag LOCUS_06290 gene rsgA 36257 35343 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113932.1 protein_id gnl|my_center|LOCUS_06290 37291 36257 gene locus_tag LOCUS_06300 gene rlmN 37291 36257 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293986.1 protein_id gnl|my_center|LOCUS_06300 39767 37383 gene locus_tag LOCUS_06310 gene pheT 39767 37383 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498186.1 protein_id gnl|my_center|LOCUS_06310 40806 39769 gene locus_tag LOCUS_06320 gene pheS 40806 39769 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398818.1 protein_id gnl|my_center|LOCUS_06320 42037 41159 gene locus_tag LOCUS_06330 gene yhaM 42037 41159 CDS product 3'-5' exoribonuclease YhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726638.1 protein_id gnl|my_center|LOCUS_06330 44106 42037 gene locus_tag LOCUS_06340 gene pulA 44106 42037 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229246.1 protein_id gnl|my_center|LOCUS_06340 45196 44108 gene locus_tag LOCUS_06350 45196 44108 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475877.1 protein_id gnl|my_center|LOCUS_06350 45294 45902 gene locus_tag LOCUS_06360 45294 45902 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905752.1 protein_id gnl|my_center|LOCUS_06360 46134 45904 gene locus_tag LOCUS_06370 46134 45904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 46578 46186 gene locus_tag LOCUS_06380 46578 46186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 <47581 46578 gene locus_tag LOCUS_06390 <47581 46578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003699945.1:F0F1 ATP synthase subunit beta >Feature sequence12 349 657 gene locus_tag LOCUS_06400 349 657 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812923.1 protein_id gnl|my_center|LOCUS_06400 660 1118 gene locus_tag LOCUS_06410 660 1118 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358219.1 protein_id gnl|my_center|LOCUS_06410 1213 2277 gene locus_tag LOCUS_06420 1213 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 2398 3111 gene locus_tag LOCUS_06430 2398 3111 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681925.1 protein_id gnl|my_center|LOCUS_06430 3111 3911 gene locus_tag LOCUS_06440 3111 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 3944 4375 gene locus_tag LOCUS_06450 3944 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 4350 4811 gene locus_tag LOCUS_06460 4350 4811 CDS product DUF3021 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549798.1 protein_id gnl|my_center|LOCUS_06460 5578 6192 gene locus_tag LOCUS_06470 5578 6192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 6307 6981 gene locus_tag LOCUS_06480 6307 6981 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963644.1 protein_id gnl|my_center|LOCUS_06480 6978 8225 gene locus_tag LOCUS_06490 6978 8225 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024933635.1 protein_id gnl|my_center|LOCUS_06490 8291 9052 gene locus_tag LOCUS_06500 8291 9052 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721684.1 protein_id gnl|my_center|LOCUS_06500 9054 11390 gene locus_tag LOCUS_06510 9054 11390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 11537 15829 gene locus_tag LOCUS_06520 11537 15829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 15934 18381 gene locus_tag LOCUS_06530 15934 18381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 18394 19554 gene locus_tag LOCUS_06540 18394 19554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 19663 20121 gene locus_tag LOCUS_06550 19663 20121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 20364 21176 gene locus_tag LOCUS_06560 gene thiM 20364 21176 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_06560 21157 22425 gene locus_tag LOCUS_06570 21157 22425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 22427 23224 gene locus_tag LOCUS_06580 gene thiD 22427 23224 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_06580 23217 23891 gene locus_tag LOCUS_06590 gene tenA 23217 23891 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864183.1 protein_id gnl|my_center|LOCUS_06590 23954 25303 gene locus_tag LOCUS_06600 23954 25303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 25701 27161 gene locus_tag LOCUS_06610 gene trpE 25701 27161 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880347.1 protein_id gnl|my_center|LOCUS_06610 27158 27721 gene locus_tag LOCUS_06620 27158 27721 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966439.1 protein_id gnl|my_center|LOCUS_06620 27723 28733 gene locus_tag LOCUS_06630 gene trpD 27723 28733 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673966.1 protein_id gnl|my_center|LOCUS_06630 28733 29503 gene locus_tag LOCUS_06640 gene trpC 28733 29503 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592589.1 protein_id gnl|my_center|LOCUS_06640 29496 30062 gene locus_tag LOCUS_06650 29496 30062 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966436.1 protein_id gnl|my_center|LOCUS_06650 30055 31239 gene locus_tag LOCUS_06660 gene trpB 30055 31239 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562635.1 protein_id gnl|my_center|LOCUS_06660 31232 32008 gene locus_tag LOCUS_06670 gene trpA 31232 32008 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 protein_id gnl|my_center|LOCUS_06670 32137 34602 gene locus_tag LOCUS_06680 gene gdpP 32137 34602 CDS product cyclic-di-AMP phosphodiesterase GdpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242517.1 protein_id gnl|my_center|LOCUS_06680 34670 35110 gene locus_tag LOCUS_06690 gene rplI 34670 35110 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226915.1 protein_id gnl|my_center|LOCUS_06690 35132 36496 gene locus_tag LOCUS_06700 gene dnaB 35132 36496 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_06700 36503 37579 gene locus_tag LOCUS_06710 gene prfA 36503 37579 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932325.1 protein_id gnl|my_center|LOCUS_06710 37615 37815 gene locus_tag LOCUS_06720 37615 37815 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111744.1 protein_id gnl|my_center|LOCUS_06720 37815 38294 gene locus_tag LOCUS_06730 37815 38294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 38311 39345 gene locus_tag LOCUS_06740 38311 39345 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897671.1 protein_id gnl|my_center|LOCUS_06740 39335 39673 gene locus_tag LOCUS_06750 39335 39673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 39670 40197 gene locus_tag LOCUS_06760 39670 40197 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817206.1 protein_id gnl|my_center|LOCUS_06760 40292 41653 gene locus_tag LOCUS_06770 gene glnA 40292 41653 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231737.1 protein_id gnl|my_center|LOCUS_06770 42168 43262 gene locus_tag LOCUS_06780 gene serC 42168 43262 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_06780 43264 44412 gene locus_tag LOCUS_06790 43264 44412 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_06790 44414 45184 gene locus_tag LOCUS_06800 44414 45184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 >Feature sequence13 205 534 gene locus_tag LOCUS_06810 205 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 545 937 gene locus_tag LOCUS_06820 545 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 951 1565 gene locus_tag LOCUS_06830 gene gmk 951 1565 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830096.1 protein_id gnl|my_center|LOCUS_06830 1631 1882 gene locus_tag LOCUS_06840 1631 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 1934 3700 gene locus_tag LOCUS_06850 gene uvrC 1934 3700 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837033.1 protein_id gnl|my_center|LOCUS_06850 3815 4153 gene locus_tag LOCUS_06860 3815 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 5660 4221 gene locus_tag LOCUS_06870 gene purF 5660 4221 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964701.1 protein_id gnl|my_center|LOCUS_06870 7259 5676 gene locus_tag LOCUS_06880 gene asnB 7259 5676 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905297.1 protein_id gnl|my_center|LOCUS_06880 9138 7330 gene locus_tag LOCUS_06890 9138 7330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 11257 9173 gene locus_tag LOCUS_06900 11257 9173 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_06900 11633 12727 gene locus_tag LOCUS_06910 11633 12727 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392807.1 protein_id gnl|my_center|LOCUS_06910 12727 14238 gene locus_tag LOCUS_06920 12727 14238 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392806.1 protein_id gnl|my_center|LOCUS_06920 14249 14971 gene locus_tag LOCUS_06930 14249 14971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083223.1 protein_id gnl|my_center|LOCUS_06930 15034 16221 gene locus_tag LOCUS_06940 gene glnA 15034 16221 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807771.1 protein_id gnl|my_center|LOCUS_06940 16255 16857 gene locus_tag LOCUS_06950 16255 16857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 16854 18464 gene locus_tag LOCUS_06960 16854 18464 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_06960 18466 19311 gene locus_tag LOCUS_06970 gene dapF 18466 19311 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_06970 19301 20488 gene locus_tag LOCUS_06980 19301 20488 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765060.1 protein_id gnl|my_center|LOCUS_06980 20747 21817 gene locus_tag LOCUS_06990 gene carA 20747 21817 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429883.1 protein_id gnl|my_center|LOCUS_06990 21819 25046 gene locus_tag LOCUS_07000 gene carB 21819 25046 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_07000 25147 25554 gene locus_tag LOCUS_07010 25147 25554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 25709 29257 gene locus_tag LOCUS_07020 25709 29257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 29484 30461 gene locus_tag LOCUS_07030 29484 30461 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_07030 30577 31842 gene locus_tag LOCUS_07040 30577 31842 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_07040 31817 32170 gene locus_tag LOCUS_07050 31817 32170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 32206 33096 gene locus_tag LOCUS_07060 32206 33096 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147263.1 protein_id gnl|my_center|LOCUS_07060 33184 36060 gene locus_tag LOCUS_07070 33184 36060 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966288.1 protein_id gnl|my_center|LOCUS_07070 37222 36140 gene locus_tag LOCUS_07080 37222 36140 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_07080 37399 37665 gene locus_tag LOCUS_07090 37399 37665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 37693 38640 gene locus_tag LOCUS_07100 37693 38640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 38686 39114 gene locus_tag LOCUS_07110 38686 39114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 39319 39243 gene locus_tag LOCUS_t00100 39319 39243 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 39480 40868 gene locus_tag LOCUS_07120 gene mgtE 39480 40868 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829287.1 protein_id gnl|my_center|LOCUS_07120 40877 41647 gene locus_tag LOCUS_07130 40877 41647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 >Feature sequence14 274 1008 gene locus_tag LOCUS_07140 274 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 1372 1082 gene locus_tag LOCUS_07150 1372 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 2367 1372 gene locus_tag LOCUS_07160 gene trpS 2367 1372 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245134.1 protein_id gnl|my_center|LOCUS_07160 2937 2575 gene locus_tag LOCUS_07170 2937 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 3093 3248 gene locus_tag LOCUS_07180 3093 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 3302 5527 gene locus_tag LOCUS_07190 3302 5527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 5762 7366 gene locus_tag LOCUS_07200 5762 7366 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921891.1 protein_id gnl|my_center|LOCUS_07200 7368 8390 gene locus_tag LOCUS_07210 7368 8390 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921892.1 protein_id gnl|my_center|LOCUS_07210 8404 10236 gene locus_tag LOCUS_07220 8404 10236 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166384.1 protein_id gnl|my_center|LOCUS_07220 10238 11893 gene locus_tag LOCUS_07230 10238 11893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 11905 13068 gene locus_tag LOCUS_07240 11905 13068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 13061 13399 gene locus_tag LOCUS_07250 13061 13399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 13417 13827 gene locus_tag LOCUS_07260 13417 13827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 14401 13859 gene locus_tag LOCUS_07270 14401 13859 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191121.1 protein_id gnl|my_center|LOCUS_07270 14542 15318 gene locus_tag LOCUS_07280 14542 15318 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270834.1 protein_id gnl|my_center|LOCUS_07280 15464 16504 gene locus_tag LOCUS_07290 gene gap 15464 16504 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_07290 16592 17266 gene locus_tag LOCUS_07300 16592 17266 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016997.1 protein_id gnl|my_center|LOCUS_07300 17396 18283 gene locus_tag LOCUS_07310 17396 18283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 18442 21066 gene locus_tag LOCUS_07320 gene adhE 18442 21066 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763967.1 protein_id gnl|my_center|LOCUS_07320 21071 21364 gene locus_tag LOCUS_07330 gene yhbY 21071 21364 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699799.1 protein_id gnl|my_center|LOCUS_07330 21474 23243 gene locus_tag LOCUS_07340 21474 23243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 23388 23969 gene locus_tag LOCUS_07350 23388 23969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 24014 24769 gene locus_tag LOCUS_07360 24014 24769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 25875 24784 gene locus_tag LOCUS_07370 25875 24784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 26077 28695 gene locus_tag LOCUS_07380 gene polA 26077 28695 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398870.1 protein_id gnl|my_center|LOCUS_07380 28698 29210 gene locus_tag LOCUS_07390 28698 29210 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986565.1 protein_id gnl|my_center|LOCUS_07390 29222 30046 gene locus_tag LOCUS_07400 gene mutM 29222 30046 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114617.1 protein_id gnl|my_center|LOCUS_07400 30048 30641 gene locus_tag LOCUS_07410 gene coaE 30048 30641 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398928.1 protein_id gnl|my_center|LOCUS_07410 30647 31000 gene locus_tag LOCUS_07420 30647 31000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 31004 32179 gene locus_tag LOCUS_07430 31004 32179 CDS product replication initiation and membrane attachment family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989742.1 protein_id gnl|my_center|LOCUS_07430 32179 33045 gene locus_tag LOCUS_07440 gene dnaI 32179 33045 CDS product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400112.1 protein_id gnl|my_center|LOCUS_07440 33175 33600 gene locus_tag LOCUS_07450 33175 33600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 33597 34409 gene locus_tag LOCUS_07460 33597 34409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 34412 34756 gene locus_tag LOCUS_07470 34412 34756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 34859 36181 gene locus_tag LOCUS_07480 34859 36181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 36471 38390 gene locus_tag LOCUS_07490 gene thrS 36471 38390 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435143.1 protein_id gnl|my_center|LOCUS_07490 38448 39986 gene locus_tag LOCUS_07500 38448 39986 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166322.1 protein_id gnl|my_center|LOCUS_07500 40199 40657 gene locus_tag LOCUS_07510 40199 40657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 40670 40867 gene locus_tag LOCUS_07520 gene rpmF 40670 40867 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154457.1 protein_id gnl|my_center|LOCUS_07520 40933 41856 gene locus_tag LOCUS_07530 gene rsmH 40933 41856 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481788.1 protein_id gnl|my_center|LOCUS_07530 41928 42224 gene locus_tag LOCUS_07540 41928 42224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 >Feature sequence15 1626 118 gene locus_tag LOCUS_07550 gene ptsP 1626 118 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966368.1 protein_id gnl|my_center|LOCUS_07550 2465 1638 gene locus_tag LOCUS_07560 2465 1638 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785236.1 protein_id gnl|my_center|LOCUS_07560 2800 2474 gene locus_tag LOCUS_07570 2800 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 3333 2878 gene locus_tag LOCUS_07580 3333 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 3792 3376 gene locus_tag LOCUS_07590 3792 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 5606 3807 gene locus_tag LOCUS_07600 5606 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 8364 5581 gene locus_tag LOCUS_07610 8364 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 9526 8369 gene locus_tag LOCUS_07620 9526 8369 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706213.1 protein_id gnl|my_center|LOCUS_07620 10830 9667 gene locus_tag LOCUS_07630 10830 9667 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_07630 14073 10915 gene locus_tag LOCUS_07640 14073 10915 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858356.1 protein_id gnl|my_center|LOCUS_07640 15169 14075 gene locus_tag LOCUS_07650 15169 14075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 16739 15156 gene locus_tag LOCUS_07660 16739 15156 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851467.1 protein_id gnl|my_center|LOCUS_07660 18060 16750 gene locus_tag LOCUS_07670 18060 16750 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874698.1 protein_id gnl|my_center|LOCUS_07670 18622 18053 gene locus_tag LOCUS_07680 18622 18053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 19040 18612 gene locus_tag LOCUS_07690 19040 18612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 21626 19224 gene locus_tag LOCUS_07700 21626 19224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 22015 21725 gene locus_tag LOCUS_07710 22015 21725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 23123 22197 gene locus_tag LOCUS_07720 23123 22197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 24163 23201 gene locus_tag LOCUS_07730 24163 23201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 24939 24160 gene locus_tag LOCUS_07740 24939 24160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 25543 24911 gene locus_tag LOCUS_07750 25543 24911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 26355 25546 gene locus_tag LOCUS_07760 26355 25546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 27044 26373 gene locus_tag LOCUS_07770 27044 26373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 27190 27651 gene locus_tag LOCUS_07780 27190 27651 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830812.1 protein_id gnl|my_center|LOCUS_07780 28230 27697 gene locus_tag LOCUS_07790 28230 27697 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837194.1 protein_id gnl|my_center|LOCUS_07790 28559 28254 gene locus_tag LOCUS_07800 gene trxA 28559 28254 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874620.1 protein_id gnl|my_center|LOCUS_07800 29561 28692 gene locus_tag LOCUS_07810 29561 28692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 30113 29673 gene locus_tag LOCUS_07820 gene ohrR 30113 29673 CDS product organic hydroperoxide resistance transcriptional regulator OhrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245653.1 protein_id gnl|my_center|LOCUS_07820 31635 30175 gene locus_tag LOCUS_07830 31635 30175 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963681.1 protein_id gnl|my_center|LOCUS_07830 32114 31632 gene locus_tag LOCUS_07840 32114 31632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 34337 33051 gene locus_tag LOCUS_07850 gene serS 34337 33051 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_07850 35584 34664 gene locus_tag LOCUS_07860 35584 34664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 36620 35577 gene locus_tag LOCUS_07870 36620 35577 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004846624.1 protein_id gnl|my_center|LOCUS_07870 36930 36676 gene locus_tag LOCUS_07880 36930 36676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 37183 36947 gene locus_tag LOCUS_07890 37183 36947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 38463 37243 gene locus_tag LOCUS_07900 38463 37243 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115768.1 protein_id gnl|my_center|LOCUS_07900 >Feature sequence16 1113 130 gene locus_tag LOCUS_07910 1113 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 1669 2772 gene locus_tag LOCUS_07920 gene hemW 1669 2772 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352330.1 protein_id gnl|my_center|LOCUS_07920 2772 3716 gene locus_tag LOCUS_07930 gene xerD 2772 3716 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700300.1 protein_id gnl|my_center|LOCUS_07930 3706 4887 gene locus_tag LOCUS_07940 gene deoB 3706 4887 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046067.1 protein_id gnl|my_center|LOCUS_07940 9586 8501 gene locus_tag LOCUS_07950 9586 8501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 11457 9805 gene locus_tag LOCUS_07960 11457 9805 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436982.1 protein_id gnl|my_center|LOCUS_07960 13294 12140 gene locus_tag LOCUS_07970 13294 12140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 16277 13548 gene locus_tag LOCUS_07980 gene parC 16277 13548 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989723.1 protein_id gnl|my_center|LOCUS_07980 18205 16277 gene locus_tag LOCUS_07990 gene parE 18205 16277 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138821006.1 protein_id gnl|my_center|LOCUS_07990 18409 19221 gene locus_tag LOCUS_08000 gene plsY 18409 19221 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296995.1 protein_id gnl|my_center|LOCUS_08000 19469 19299 gene locus_tag LOCUS_08010 19469 19299 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363046.1 protein_id gnl|my_center|LOCUS_08010 19637 19885 gene locus_tag LOCUS_08020 19637 19885 CDS product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294955.1 protein_id gnl|my_center|LOCUS_08020 20405 20019 gene locus_tag LOCUS_08030 20405 20019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 20727 20395 gene locus_tag LOCUS_08040 20727 20395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 22829 20781 gene locus_tag LOCUS_08050 gene fusA 22829 20781 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627021.1 protein_id gnl|my_center|LOCUS_08050 23974 22946 gene locus_tag LOCUS_08060 23974 22946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 24700 24017 gene locus_tag LOCUS_08070 gene radC 24700 24017 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545736.1 protein_id gnl|my_center|LOCUS_08070 26088 24850 gene locus_tag LOCUS_08080 26088 24850 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254253.1 protein_id gnl|my_center|LOCUS_08080 28684 26081 gene locus_tag LOCUS_08090 28684 26081 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425353.1 protein_id gnl|my_center|LOCUS_08090 29219 28677 gene locus_tag LOCUS_08100 29219 28677 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017046.1 protein_id gnl|my_center|LOCUS_08100 30161 29499 gene locus_tag LOCUS_08110 30161 29499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 31078 30161 gene locus_tag LOCUS_08120 gene era 31078 30161 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230051.1 protein_id gnl|my_center|LOCUS_08120 31479 31081 gene locus_tag LOCUS_08130 31479 31081 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086294.1 protein_id gnl|my_center|LOCUS_08130 31901 31476 gene locus_tag LOCUS_08140 31901 31476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 32758 31904 gene locus_tag LOCUS_08150 32758 31904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 34225 32768 gene locus_tag LOCUS_08160 34225 32768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 35619 34342 gene locus_tag LOCUS_08170 gene obgE 35619 34342 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246161.1 protein_id gnl|my_center|LOCUS_08170 35971 35684 gene locus_tag LOCUS_08180 gene rpmA 35971 35684 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222623.1 protein_id gnl|my_center|LOCUS_08180 36289 35984 gene locus_tag LOCUS_08190 36289 35984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 36603 36292 gene locus_tag LOCUS_08200 gene rplU 36603 36292 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457386.1 protein_id gnl|my_center|LOCUS_08200 37329 36781 gene locus_tag LOCUS_08210 37329 36781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 38318 37434 gene locus_tag LOCUS_08220 38318 37434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 >Feature sequence17 204 344 gene locus_tag LOCUS_08230 204 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 3196 569 gene locus_tag LOCUS_08240 3196 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 4361 3405 gene locus_tag LOCUS_08250 4361 3405 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262770.1 protein_id gnl|my_center|LOCUS_08250 5007 4351 gene locus_tag LOCUS_08260 5007 4351 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_08260 5887 5000 gene locus_tag LOCUS_08270 5887 5000 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262369.1 protein_id gnl|my_center|LOCUS_08270 8336 6003 gene locus_tag LOCUS_08280 gene lon 8336 6003 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229618.1 protein_id gnl|my_center|LOCUS_08280 10097 8568 gene locus_tag LOCUS_08290 gene tig 10097 8568 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127573.1 protein_id gnl|my_center|LOCUS_08290 11381 10293 gene locus_tag LOCUS_08300 11381 10293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 11502 12692 gene locus_tag LOCUS_08310 11502 12692 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 protein_id gnl|my_center|LOCUS_08310 13805 12729 gene locus_tag LOCUS_08320 13805 12729 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861865.1 protein_id gnl|my_center|LOCUS_08320 15229 13919 gene locus_tag LOCUS_08330 15229 13919 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286872.1 protein_id gnl|my_center|LOCUS_08330 16283 15240 gene locus_tag LOCUS_08340 16283 15240 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460383.1 protein_id gnl|my_center|LOCUS_08340 17155 16439 gene locus_tag LOCUS_08350 gene dapB 17155 16439 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965675.1 protein_id gnl|my_center|LOCUS_08350 18036 17155 gene locus_tag LOCUS_08360 gene dapA 18036 17155 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438799.1 protein_id gnl|my_center|LOCUS_08360 18854 18039 gene locus_tag LOCUS_08370 gene dapF 18854 18039 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870630.1 protein_id gnl|my_center|LOCUS_08370 20089 18854 gene locus_tag LOCUS_08380 gene lysA 20089 18854 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286883.1 protein_id gnl|my_center|LOCUS_08380 21465 20464 gene locus_tag LOCUS_08390 gene gpsA 21465 20464 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161776.1 protein_id gnl|my_center|LOCUS_08390 22777 21470 gene locus_tag LOCUS_08400 gene der 22777 21470 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165530.1 protein_id gnl|my_center|LOCUS_08400 24189 22813 gene locus_tag LOCUS_08410 24189 22813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 24851 24192 gene locus_tag LOCUS_08420 gene cmk 24851 24192 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700259.1 protein_id gnl|my_center|LOCUS_08420 25643 24912 gene locus_tag LOCUS_08430 25643 24912 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640595.1 protein_id gnl|my_center|LOCUS_08430 25789 27165 gene locus_tag LOCUS_08440 25789 27165 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964406.1 protein_id gnl|my_center|LOCUS_08440 27514 27281 gene locus_tag LOCUS_08450 27514 27281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08450 29599 27569 gene locus_tag LOCUS_08460 gene pflB 29599 27569 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195472.1 protein_id gnl|my_center|LOCUS_08460 30234 29902 gene locus_tag LOCUS_08470 30234 29902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 30964 30221 gene locus_tag LOCUS_08480 gene pflA 30964 30221 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289264.1 protein_id gnl|my_center|LOCUS_08480 32470 31070 gene locus_tag LOCUS_08490 32470 31070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 33707 32472 gene locus_tag LOCUS_08500 gene rpoD 33707 32472 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935555.1 protein_id gnl|my_center|LOCUS_08500 35565 33721 gene locus_tag LOCUS_08510 35565 33721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 36985 35594 gene locus_tag LOCUS_08520 36985 35594 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_08520 >Feature sequence18 2445 2047 gene locus_tag LOCUS_08530 2445 2047 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700685.1 protein_id gnl|my_center|LOCUS_08530 3773 2445 gene locus_tag LOCUS_08540 gene cysS 3773 2445 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399682.1 protein_id gnl|my_center|LOCUS_08540 5560 3830 gene locus_tag LOCUS_08550 5560 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 6219 5854 gene locus_tag LOCUS_08560 6219 5854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 6353 6234 gene locus_tag LOCUS_08570 6353 6234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 6609 6355 gene locus_tag LOCUS_08580 6609 6355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 6837 9767 gene locus_tag LOCUS_08590 6837 9767 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016931.1 protein_id gnl|my_center|LOCUS_08590 9754 11088 gene locus_tag LOCUS_08600 9754 11088 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016932.1 protein_id gnl|my_center|LOCUS_08600 11091 11735 gene locus_tag LOCUS_08610 11091 11735 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903942.1 protein_id gnl|my_center|LOCUS_08610 12363 11776 gene locus_tag LOCUS_08620 gene cbrC 12363 11776 CDS product PF03691 family colicin E2 tolerance protein CbrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193070.1 protein_id gnl|my_center|LOCUS_08620 13550 12630 gene locus_tag LOCUS_08630 13550 12630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 14803 13634 gene locus_tag LOCUS_08640 14803 13634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 15422 14793 gene locus_tag LOCUS_08650 gene gmhA2 15422 14793 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857991.1 protein_id gnl|my_center|LOCUS_08650 16446 15412 gene locus_tag LOCUS_08660 gene hddA 16446 15412 CDS product D-glycero-D-manno-heptose 7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858413.1 protein_id gnl|my_center|LOCUS_08660 17705 16575 gene locus_tag LOCUS_08670 17705 16575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 18748 17723 gene locus_tag LOCUS_08680 18748 17723 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966351.1 protein_id gnl|my_center|LOCUS_08680 19878 18748 gene locus_tag LOCUS_08690 19878 18748 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765279.1 protein_id gnl|my_center|LOCUS_08690 21095 20016 gene locus_tag LOCUS_08700 21095 20016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 22794 21298 gene locus_tag LOCUS_08710 22794 21298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 23018 24616 gene locus_tag LOCUS_08720 23018 24616 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549892.1 protein_id gnl|my_center|LOCUS_08720 24639 25616 gene locus_tag LOCUS_08730 24639 25616 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908873.1 protein_id gnl|my_center|LOCUS_08730 26351 25683 gene locus_tag LOCUS_08740 26351 25683 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986980.1 protein_id gnl|my_center|LOCUS_08740 28447 26684 gene locus_tag LOCUS_08750 gene pepF 28447 26684 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903691.1 protein_id gnl|my_center|LOCUS_08750 29561 28569 gene locus_tag LOCUS_08760 29561 28569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 30279 29656 gene locus_tag LOCUS_08770 30279 29656 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764720.1 protein_id gnl|my_center|LOCUS_08770 31046 30291 gene locus_tag LOCUS_08780 31046 30291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 33295 31235 gene locus_tag LOCUS_08790 33295 31235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 33518 33384 gene locus_tag LOCUS_08800 33518 33384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 33966 33520 gene locus_tag LOCUS_08810 33966 33520 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966687.1 protein_id gnl|my_center|LOCUS_08810 34065 34337 gene locus_tag LOCUS_08820 34065 34337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 >Feature sequence19 1433 297 gene locus_tag LOCUS_08830 gene dnaN 1433 297 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831813.1 protein_id gnl|my_center|LOCUS_08830 2911 1586 gene locus_tag LOCUS_08840 gene dnaA 2911 1586 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_08840 3490 3624 gene locus_tag LOCUS_08850 gene rpmH 3490 3624 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131818.1 protein_id gnl|my_center|LOCUS_08850 3713 4063 gene locus_tag LOCUS_08860 gene rnpA 3713 4063 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726628.1 protein_id gnl|my_center|LOCUS_08860 4060 5046 gene locus_tag LOCUS_08870 4060 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 5057 5665 gene locus_tag LOCUS_08880 5057 5665 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256032.1 protein_id gnl|my_center|LOCUS_08880 5752 6564 gene locus_tag LOCUS_08890 5752 6564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 6582 8498 gene locus_tag LOCUS_08900 6582 8498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 8503 8796 gene locus_tag LOCUS_08910 8503 8796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 8798 9400 gene locus_tag LOCUS_08920 gene recR 8798 9400 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296223.1 protein_id gnl|my_center|LOCUS_08920 9400 9762 gene locus_tag LOCUS_08930 9400 9762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 9829 10374 gene locus_tag LOCUS_08940 9829 10374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 10536 11207 gene locus_tag LOCUS_08950 gene cssR 10536 11207 CDS product secretion stress-responsive two-component system response regulator CssR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228529.1 protein_id gnl|my_center|LOCUS_08950 11204 12601 gene locus_tag LOCUS_08960 11204 12601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 16774 12761 gene locus_tag LOCUS_08970 16774 12761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 20017 16997 gene locus_tag LOCUS_08980 20017 16997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 20328 21548 gene locus_tag LOCUS_08990 20328 21548 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243873.1 protein_id gnl|my_center|LOCUS_08990 21550 22089 gene locus_tag LOCUS_09000 gene rnmV 21550 22089 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548877.1 protein_id gnl|my_center|LOCUS_09000 22074 22937 gene locus_tag LOCUS_09010 gene rsmA 22074 22937 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651552.1 protein_id gnl|my_center|LOCUS_09010 22942 23760 gene locus_tag LOCUS_09020 gene ispE 22942 23760 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947969.1 protein_id gnl|my_center|LOCUS_09020 23945 25576 gene locus_tag LOCUS_09030 23945 25576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 25587 29501 gene locus_tag LOCUS_09040 25587 29501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 29661 30971 gene locus_tag LOCUS_09050 gene tilS 29661 30971 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379219.1 protein_id gnl|my_center|LOCUS_09050 30964 31494 gene locus_tag LOCUS_09060 gene hpt 30964 31494 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892188.1 protein_id gnl|my_center|LOCUS_09060 31508 33667 gene locus_tag LOCUS_09070 gene ftsH 31508 33667 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243881.1 protein_id gnl|my_center|LOCUS_09070 >Feature sequence20 1290 256 gene locus_tag LOCUS_09080 1290 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 1412 2137 gene locus_tag LOCUS_09090 1412 2137 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_09090 2732 2190 gene locus_tag LOCUS_09100 2732 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 3505 2795 gene locus_tag LOCUS_09110 3505 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 3649 5553 gene locus_tag LOCUS_09120 gene htpG 3649 5553 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966587.1 protein_id gnl|my_center|LOCUS_09120 6158 5595 gene locus_tag LOCUS_09130 6158 5595 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087631.1 protein_id gnl|my_center|LOCUS_09130 6301 6963 gene locus_tag LOCUS_09140 6301 6963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 7073 8653 gene locus_tag LOCUS_09150 7073 8653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 8727 9272 gene locus_tag LOCUS_09160 8727 9272 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_09160 9348 10484 gene locus_tag LOCUS_09170 9348 10484 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775662.1 protein_id gnl|my_center|LOCUS_09170 10477 13071 gene locus_tag LOCUS_09180 10477 13071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 13234 15159 gene locus_tag LOCUS_09190 13234 15159 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860962.1 protein_id gnl|my_center|LOCUS_09190 16209 15163 gene locus_tag LOCUS_09200 16209 15163 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902445.1 protein_id gnl|my_center|LOCUS_09200 16575 17447 gene locus_tag LOCUS_09210 16575 17447 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830068.1 protein_id gnl|my_center|LOCUS_09210 17456 18661 gene locus_tag LOCUS_09220 17456 18661 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016377.1 protein_id gnl|my_center|LOCUS_09220 18698 19426 gene locus_tag LOCUS_09230 gene pyrK 18698 19426 CDS product dihydroorotate oxidase B electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232111.1 protein_id gnl|my_center|LOCUS_09230 19426 20334 gene locus_tag LOCUS_09240 19426 20334 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245610.1 protein_id gnl|my_center|LOCUS_09240 20334 21029 gene locus_tag LOCUS_09250 gene pyrF 20334 21029 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083510.1 protein_id gnl|my_center|LOCUS_09250 21031 21678 gene locus_tag LOCUS_09260 gene pyrE 21031 21678 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711440.1 protein_id gnl|my_center|LOCUS_09260 22491 22342 gene locus_tag LOCUS_09270 22491 22342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 23312 23833 gene locus_tag LOCUS_09280 23312 23833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 23811 24098 gene locus_tag LOCUS_09290 23811 24098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 24192 26093 gene locus_tag LOCUS_09300 24192 26093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 26095 27147 gene locus_tag LOCUS_09310 26095 27147 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426511.1 protein_id gnl|my_center|LOCUS_09310 27429 28520 gene locus_tag LOCUS_09320 27429 28520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 28533 28679 gene locus_tag LOCUS_09330 28533 28679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 28745 28954 gene locus_tag LOCUS_09340 28745 28954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 28967 30634 gene locus_tag LOCUS_09350 28967 30634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 >Feature sequence21 2576 3151 gene locus_tag LOCUS_09360 2576 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 5003 3174 gene locus_tag LOCUS_09370 5003 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 6094 5114 gene locus_tag LOCUS_09380 6094 5114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 12588 6196 gene locus_tag LOCUS_09390 12588 6196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 14677 12593 gene locus_tag LOCUS_09400 14677 12593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 19144 14690 gene locus_tag LOCUS_09410 19144 14690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 19830 19303 gene locus_tag LOCUS_09420 19830 19303 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103131.1 protein_id gnl|my_center|LOCUS_09420 20260 19841 gene locus_tag LOCUS_09430 20260 19841 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837262.1 protein_id gnl|my_center|LOCUS_09430 21503 20280 gene locus_tag LOCUS_09440 21503 20280 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785925.1 protein_id gnl|my_center|LOCUS_09440 22698 21670 gene locus_tag LOCUS_09450 22698 21670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 22904 24040 gene locus_tag LOCUS_09460 22904 24040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 24715 24182 gene locus_tag LOCUS_09470 24715 24182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 24865 24737 gene locus_tag LOCUS_09480 24865 24737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 26452 25043 gene locus_tag LOCUS_09490 26452 25043 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891654.1 protein_id gnl|my_center|LOCUS_09490 >Feature sequence22 268 1542 gene locus_tag LOCUS_09500 268 1542 CDS product PTS transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903941.1 protein_id gnl|my_center|LOCUS_09500 1720 3420 gene locus_tag LOCUS_09510 1720 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 3549 4070 gene locus_tag LOCUS_09520 3549 4070 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902332.1 protein_id gnl|my_center|LOCUS_09520 4145 4609 gene locus_tag LOCUS_09530 4145 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 4804 4986 gene locus_tag LOCUS_09540 4804 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 5004 6494 gene locus_tag LOCUS_09550 5004 6494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 6494 7198 gene locus_tag LOCUS_09560 6494 7198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 7211 9547 gene locus_tag LOCUS_09570 7211 9547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 9610 10827 gene locus_tag LOCUS_09580 9610 10827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 10913 10996 gene locus_tag LOCUS_t00110 10913 10996 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11232 11933 gene locus_tag LOCUS_09590 11232 11933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 11991 13874 gene locus_tag LOCUS_09600 11991 13874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 14111 14275 gene locus_tag LOCUS_09610 14111 14275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 14272 15351 gene locus_tag LOCUS_09620 14272 15351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 15594 16502 gene locus_tag LOCUS_09630 15594 16502 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166451.1 protein_id gnl|my_center|LOCUS_09630 16527 16673 gene locus_tag LOCUS_09640 16527 16673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 16842 17714 gene locus_tag LOCUS_09650 16842 17714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 17689 18390 gene locus_tag LOCUS_09660 17689 18390 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286289.1 protein_id gnl|my_center|LOCUS_09660 18390 20744 gene locus_tag LOCUS_09670 18390 20744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 20816 21745 gene locus_tag LOCUS_09680 20816 21745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 22112 22777 gene locus_tag LOCUS_09690 22112 22777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 22912 23994 gene locus_tag LOCUS_09700 22912 23994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 >Feature sequence23 <1 677 gene locus_tag LOCUS_09710 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003700208.1:pyruvate kinase 773 1606 gene locus_tag LOCUS_09720 773 1606 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_09720 1609 2232 gene locus_tag LOCUS_09730 1609 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 2277 3572 gene locus_tag LOCUS_09740 gene trmFO 2277 3572 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001991958.1 protein_id gnl|my_center|LOCUS_09740 3565 4518 gene locus_tag LOCUS_09750 gene xerC 3565 4518 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231988.1 protein_id gnl|my_center|LOCUS_09750 4607 5662 gene locus_tag LOCUS_09760 4607 5662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 5818 8718 gene locus_tag LOCUS_09770 5818 8718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 9107 9994 gene locus_tag LOCUS_09780 gene rpsB 9107 9994 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220918.1 protein_id gnl|my_center|LOCUS_09780 10009 10914 gene locus_tag LOCUS_09790 gene tsf 10009 10914 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231929.1 protein_id gnl|my_center|LOCUS_09790 11024 11731 gene locus_tag LOCUS_09800 gene pyrH 11024 11731 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254400.1 protein_id gnl|my_center|LOCUS_09800 11745 12299 gene locus_tag LOCUS_09810 gene frr 11745 12299 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231927.1 protein_id gnl|my_center|LOCUS_09810 12404 13354 gene locus_tag LOCUS_09820 12404 13354 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640734.1 protein_id gnl|my_center|LOCUS_09820 13365 14504 gene locus_tag LOCUS_09830 gene dxr 13365 14504 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790356.1 protein_id gnl|my_center|LOCUS_09830 14504 16207 gene locus_tag LOCUS_09840 14504 16207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 16224 17705 gene locus_tag LOCUS_09850 16224 17705 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055228983.1 protein_id gnl|my_center|LOCUS_09850 17695 19044 gene locus_tag LOCUS_09860 gene rlmD 17695 19044 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475720.1 protein_id gnl|my_center|LOCUS_09860 19353 21767 gene locus_tag LOCUS_09870 19353 21767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 21822 22439 gene locus_tag LOCUS_09880 21822 22439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 22577 23956 gene locus_tag LOCUS_09890 22577 23956 CDS product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198738.1 protein_id gnl|my_center|LOCUS_09890 >Feature sequence24 <1 745 gene locus_tag LOCUS_09900 <1 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011475828.1:molecular chaperone DnaK 810 1940 gene locus_tag LOCUS_09910 gene dnaJ 810 1940 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990134.1 protein_id gnl|my_center|LOCUS_09910 2084 2752 gene locus_tag LOCUS_09920 2084 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 2754 3488 gene locus_tag LOCUS_09930 2754 3488 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230015.1 protein_id gnl|my_center|LOCUS_09930 3488 4792 gene locus_tag LOCUS_09940 gene mtaB 3488 4792 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108686.1 protein_id gnl|my_center|LOCUS_09940 4890 5696 gene locus_tag LOCUS_09950 4890 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 5833 6006 gene locus_tag LOCUS_09960 gene rpsU 5833 6006 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003152957.1 protein_id gnl|my_center|LOCUS_09960 6107 6430 gene locus_tag LOCUS_09970 6107 6430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 6451 7167 gene locus_tag LOCUS_09980 6451 7167 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454770.1 protein_id gnl|my_center|LOCUS_09980 7273 7680 gene locus_tag LOCUS_09990 7273 7680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 7697 8524 gene locus_tag LOCUS_10000 7697 8524 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811618.1 protein_id gnl|my_center|LOCUS_10000 8678 9673 gene locus_tag LOCUS_10010 gene ccpA 8678 9673 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229285.1 protein_id gnl|my_center|LOCUS_10010 9909 11135 gene locus_tag LOCUS_10020 gene tyrS 9909 11135 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701368.1 protein_id gnl|my_center|LOCUS_10020 11317 12363 gene locus_tag LOCUS_10030 11317 12363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 12382 17328 gene locus_tag LOCUS_10040 12382 17328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 17325 17834 gene locus_tag LOCUS_10050 17325 17834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 18250 18396 gene locus_tag LOCUS_10060 18250 18396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 18578 19102 gene locus_tag LOCUS_10070 18578 19102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 19095 19574 gene locus_tag LOCUS_10080 19095 19574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 20500 19808 gene locus_tag LOCUS_10090 20500 19808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 20709 22577 gene locus_tag LOCUS_10100 20709 22577 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948184.1 protein_id gnl|my_center|LOCUS_10100 22609 23937 gene locus_tag LOCUS_10110 22609 23937 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_10110 >Feature sequence25 581 495 gene locus_tag LOCUS_t00120 581 495 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1864 638 gene locus_tag LOCUS_10120 1864 638 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724023.1 protein_id gnl|my_center|LOCUS_10120 3061 1886 gene locus_tag LOCUS_10130 3061 1886 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704264.1 protein_id gnl|my_center|LOCUS_10130 4766 3066 gene locus_tag LOCUS_10140 gene argS 4766 3066 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288432.1 protein_id gnl|my_center|LOCUS_10140 5550 4828 gene locus_tag LOCUS_10150 5550 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 5812 7236 gene locus_tag LOCUS_10160 gene glgA 5812 7236 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965537.1 protein_id gnl|my_center|LOCUS_10160 7247 8491 gene locus_tag LOCUS_10170 7247 8491 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258382.1 protein_id gnl|my_center|LOCUS_10170 9849 8545 gene locus_tag LOCUS_10180 9849 8545 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121678890.1 protein_id gnl|my_center|LOCUS_10180 11097 9901 gene locus_tag LOCUS_10190 11097 9901 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208858.1 protein_id gnl|my_center|LOCUS_10190 11183 11380 gene locus_tag LOCUS_10200 11183 11380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 11438 12268 gene locus_tag LOCUS_10210 gene yidA 11438 12268 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963948.1 protein_id gnl|my_center|LOCUS_10210 12961 12281 gene locus_tag LOCUS_10220 12961 12281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 13745 12954 gene locus_tag LOCUS_10230 13745 12954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 14326 13829 gene locus_tag LOCUS_10240 14326 13829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 16007 14316 gene locus_tag LOCUS_10250 gene recN 16007 14316 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830981.1 protein_id gnl|my_center|LOCUS_10250 16764 16012 gene locus_tag LOCUS_10260 16764 16012 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880470.1 protein_id gnl|my_center|LOCUS_10260 16988 16767 gene locus_tag LOCUS_10270 16988 16767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 18321 16978 gene locus_tag LOCUS_10280 gene xseA 18321 16978 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415260.1 protein_id gnl|my_center|LOCUS_10280 18758 18336 gene locus_tag LOCUS_10290 gene nusB 18758 18336 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358828.1 protein_id gnl|my_center|LOCUS_10290 18975 19715 gene locus_tag LOCUS_10300 18975 19715 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640735.1 protein_id gnl|my_center|LOCUS_10300 19699 20565 gene locus_tag LOCUS_10310 gene ispH 19699 20565 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706669.1 protein_id gnl|my_center|LOCUS_10310 20591 20667 gene locus_tag LOCUS_t00130 20591 20667 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 22299 20944 gene locus_tag LOCUS_10320 22299 20944 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068386.1 protein_id gnl|my_center|LOCUS_10320 22782 22498 gene locus_tag LOCUS_10330 22782 22498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 23059 22748 gene locus_tag LOCUS_10340 23059 22748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 23191 23532 gene locus_tag LOCUS_10350 23191 23532 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476531.1 protein_id gnl|my_center|LOCUS_10350 >Feature sequence26 315 1496 gene locus_tag LOCUS_10360 315 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 1516 2454 gene locus_tag LOCUS_10370 1516 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 2551 3000 gene locus_tag LOCUS_10380 gene tsaE 2551 3000 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049642.1 protein_id gnl|my_center|LOCUS_10380 3000 3575 gene locus_tag LOCUS_10390 gene tsaB 3000 3575 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476225.1 protein_id gnl|my_center|LOCUS_10390 3575 4006 gene locus_tag LOCUS_10400 gene rimI 3575 4006 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880336.1 protein_id gnl|my_center|LOCUS_10400 4020 4493 gene locus_tag LOCUS_10410 gene ybaK 4020 4493 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437064.1 protein_id gnl|my_center|LOCUS_10410 4499 5500 gene locus_tag LOCUS_10420 gene tsaD 4499 5500 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244138.1 protein_id gnl|my_center|LOCUS_10420 5721 6551 gene locus_tag LOCUS_10430 5721 6551 CDS product Rossmann-like and DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002349114.1 protein_id gnl|my_center|LOCUS_10430 6544 7386 gene locus_tag LOCUS_10440 gene panB 6544 7386 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287874.1 protein_id gnl|my_center|LOCUS_10440 7388 8239 gene locus_tag LOCUS_10450 gene panC 7388 8239 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966198.1 protein_id gnl|my_center|LOCUS_10450 8239 8631 gene locus_tag LOCUS_10460 8239 8631 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287876.1 protein_id gnl|my_center|LOCUS_10460 8644 9828 gene locus_tag LOCUS_10470 gene coaBC 8644 9828 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861611.1 protein_id gnl|my_center|LOCUS_10470 9831 10595 gene locus_tag LOCUS_10480 9831 10595 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_10480 11209 12864 gene locus_tag LOCUS_10490 11209 12864 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945515.1 protein_id gnl|my_center|LOCUS_10490 12941 14521 gene locus_tag LOCUS_10500 12941 14521 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232344.1 protein_id gnl|my_center|LOCUS_10500 14524 16656 gene locus_tag LOCUS_10510 gene pcrA 14524 16656 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163769.1 protein_id gnl|my_center|LOCUS_10510 16760 18733 gene locus_tag LOCUS_10520 gene ligA 16760 18733 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774556.1 protein_id gnl|my_center|LOCUS_10520 18738 21554 gene locus_tag LOCUS_10530 gene uvrA 18738 21554 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228057.1 protein_id gnl|my_center|LOCUS_10530 21690 22709 gene locus_tag LOCUS_10540 21690 22709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 22709 23356 gene locus_tag LOCUS_10550 22709 23356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 >Feature sequence27 144 482 gene locus_tag LOCUS_10560 144 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1651 776 gene locus_tag LOCUS_10570 gene rhuM 1651 776 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648596.1 protein_id gnl|my_center|LOCUS_10570 1943 3052 gene locus_tag LOCUS_10580 1943 3052 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978530.1 protein_id gnl|my_center|LOCUS_10580 3138 3305 gene locus_tag LOCUS_10590 3138 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 3387 3803 gene locus_tag LOCUS_10600 3387 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 7066 3836 gene locus_tag LOCUS_10610 7066 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 7188 7595 gene locus_tag LOCUS_10620 7188 7595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 7709 8611 gene locus_tag LOCUS_10630 gene gyaR 7709 8611 CDS product glyoxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868561.1 protein_id gnl|my_center|LOCUS_10630 8672 9247 gene locus_tag LOCUS_10640 8672 9247 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948791.1 protein_id gnl|my_center|LOCUS_10640 9344 11341 gene locus_tag LOCUS_10650 9344 11341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 11353 11952 gene locus_tag LOCUS_10660 11353 11952 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005627.1 protein_id gnl|my_center|LOCUS_10660 12596 11958 gene locus_tag LOCUS_10670 12596 11958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 12711 13874 gene locus_tag LOCUS_10680 12711 13874 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949005.1 protein_id gnl|my_center|LOCUS_10680 13968 15485 gene locus_tag LOCUS_10690 13968 15485 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138361510.1 protein_id gnl|my_center|LOCUS_10690 15475 16935 gene locus_tag LOCUS_10700 15475 16935 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256247.1 protein_id gnl|my_center|LOCUS_10700 17048 17605 gene locus_tag LOCUS_10710 17048 17605 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223119.1 protein_id gnl|my_center|LOCUS_10710 18121 17717 gene locus_tag LOCUS_10720 18121 17717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 19494 18121 gene locus_tag LOCUS_10730 19494 18121 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674482.1 protein_id gnl|my_center|LOCUS_10730 >Feature sequence28 818 111 gene locus_tag LOCUS_10740 818 111 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082910.1 protein_id gnl|my_center|LOCUS_10740 1731 820 gene locus_tag LOCUS_10750 gene fabD 1731 820 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_10750 2849 1746 gene locus_tag LOCUS_10760 2849 1746 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459186.1 protein_id gnl|my_center|LOCUS_10760 3779 2859 gene locus_tag LOCUS_10770 gene accA 3779 2859 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818803.1 protein_id gnl|my_center|LOCUS_10770 4648 3779 gene locus_tag LOCUS_10780 gene accD 4648 3779 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966832.1 protein_id gnl|my_center|LOCUS_10780 5996 4629 gene locus_tag LOCUS_10790 5996 4629 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048423.1 protein_id gnl|my_center|LOCUS_10790 6454 5999 gene locus_tag LOCUS_10800 gene accB 6454 5999 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428740.1 protein_id gnl|my_center|LOCUS_10800 6690 6454 gene locus_tag LOCUS_10810 6690 6454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 7448 6708 gene locus_tag LOCUS_10820 7448 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 7911 7468 gene locus_tag LOCUS_10830 gene fabZ 7911 7468 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942905.1 protein_id gnl|my_center|LOCUS_10830 8642 7911 gene locus_tag LOCUS_10840 gene fabG 8642 7911 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_10840 11047 8660 gene locus_tag LOCUS_10850 11047 8660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 11386 11141 gene locus_tag LOCUS_10860 11386 11141 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964357.1 protein_id gnl|my_center|LOCUS_10860 11926 11594 gene locus_tag LOCUS_10870 11926 11594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 13361 11916 gene locus_tag LOCUS_10880 gene miaB 13361 11916 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244831.1 protein_id gnl|my_center|LOCUS_10880 14174 13404 gene locus_tag LOCUS_10890 14174 13404 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732288.1 protein_id gnl|my_center|LOCUS_10890 15800 14226 gene locus_tag LOCUS_10900 gene rny 15800 14226 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287336.1 protein_id gnl|my_center|LOCUS_10900 16029 16730 gene locus_tag LOCUS_10910 16029 16730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 17634 16798 gene locus_tag LOCUS_10920 17634 16798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 17774 18364 gene locus_tag LOCUS_10930 17774 18364 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963535.1 protein_id gnl|my_center|LOCUS_10930 18899 18384 gene locus_tag LOCUS_10940 18899 18384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 >Feature sequence29 538 1389 gene locus_tag LOCUS_10950 538 1389 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494586.1 protein_id gnl|my_center|LOCUS_10950 2002 1415 gene locus_tag LOCUS_10960 2002 1415 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865105.1 protein_id gnl|my_center|LOCUS_10960 2497 2012 gene locus_tag LOCUS_10970 gene coaD 2497 2012 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416314.1 protein_id gnl|my_center|LOCUS_10970 2617 3141 gene locus_tag LOCUS_10980 2617 3141 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586895.1 protein_id gnl|my_center|LOCUS_10980 3201 3794 gene locus_tag LOCUS_10990 3201 3794 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357527.1 protein_id gnl|my_center|LOCUS_10990 3865 4218 gene locus_tag LOCUS_11000 3865 4218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 4223 7381 gene locus_tag LOCUS_11010 4223 7381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 7452 8606 gene locus_tag LOCUS_11020 gene proB 7452 8606 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_11020 8572 9810 gene locus_tag LOCUS_11030 8572 9810 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583659.1 protein_id gnl|my_center|LOCUS_11030 9812 10603 gene locus_tag LOCUS_11040 gene proC 9812 10603 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966526.1 protein_id gnl|my_center|LOCUS_11040 11310 10633 gene locus_tag LOCUS_11050 11310 10633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 11855 13486 gene locus_tag LOCUS_11060 11855 13486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 13581 14624 gene locus_tag LOCUS_11070 13581 14624 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048436.1 protein_id gnl|my_center|LOCUS_11070 14621 16186 gene locus_tag LOCUS_11080 14621 16186 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048336.1 protein_id gnl|my_center|LOCUS_11080 16176 17663 gene locus_tag LOCUS_11090 16176 17663 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016113.1 protein_id gnl|my_center|LOCUS_11090 17720 18172 gene locus_tag LOCUS_11100 17720 18172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 18189 18791 gene locus_tag LOCUS_11110 gene yihA 18189 18791 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229621.1 protein_id gnl|my_center|LOCUS_11110 >Feature sequence30 657 788 gene locus_tag LOCUS_11120 657 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 910 1707 gene locus_tag LOCUS_11130 910 1707 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_11130 1727 2287 gene locus_tag LOCUS_11140 1727 2287 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861585.1 protein_id gnl|my_center|LOCUS_11140 2641 3309 gene locus_tag LOCUS_11150 2641 3309 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461591.1 protein_id gnl|my_center|LOCUS_11150 3749 3919 gene locus_tag LOCUS_11160 3749 3919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 4054 4593 gene locus_tag LOCUS_11170 4054 4593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 4895 6976 gene locus_tag LOCUS_11180 4895 6976 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681239.1 protein_id gnl|my_center|LOCUS_11180 7242 7487 gene locus_tag LOCUS_11190 7242 7487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 7681 9324 gene locus_tag LOCUS_11200 7681 9324 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002635.1 protein_id gnl|my_center|LOCUS_11200 9351 10994 gene locus_tag LOCUS_11210 9351 10994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 11007 12791 gene locus_tag LOCUS_11220 11007 12791 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918506.1 protein_id gnl|my_center|LOCUS_11220 12794 13417 gene locus_tag LOCUS_11230 12794 13417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11230 13417 14367 gene locus_tag LOCUS_11240 13417 14367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 14369 17425 gene locus_tag LOCUS_11250 14369 17425 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 protein_id gnl|my_center|LOCUS_11250 17437 17748 gene locus_tag LOCUS_11260 17437 17748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 >Feature sequence31 1391 141 gene locus_tag LOCUS_11270 1391 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 1658 1497 gene locus_tag LOCUS_11280 1658 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 2968 1703 gene locus_tag LOCUS_11290 2968 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 3837 3052 gene locus_tag LOCUS_11300 3837 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 5262 3838 gene locus_tag LOCUS_11310 5262 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 6142 5390 gene locus_tag LOCUS_11320 6142 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 6671 6135 gene locus_tag LOCUS_11330 6671 6135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 8512 6764 gene locus_tag LOCUS_11340 8512 6764 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640800.1 protein_id gnl|my_center|LOCUS_11340 8962 8660 gene locus_tag LOCUS_11350 8962 8660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 9076 9729 gene locus_tag LOCUS_11360 gene recU 9076 9729 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155598.1 protein_id gnl|my_center|LOCUS_11360 10822 9800 gene locus_tag LOCUS_11370 gene pta 10822 9800 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067221.1 protein_id gnl|my_center|LOCUS_11370 12739 10964 gene locus_tag LOCUS_11380 12739 10964 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461397.1 protein_id gnl|my_center|LOCUS_11380 14543 12741 gene locus_tag LOCUS_11390 14543 12741 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461398.1 protein_id gnl|my_center|LOCUS_11390 14944 14537 gene locus_tag LOCUS_11400 14944 14537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 >Feature sequence32 1625 744 gene locus_tag LOCUS_11410 gene atpG 1625 744 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244388.1 protein_id gnl|my_center|LOCUS_11410 3145 1637 gene locus_tag LOCUS_11420 gene atpA 3145 1637 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723464.1 protein_id gnl|my_center|LOCUS_11420 3680 3159 gene locus_tag LOCUS_11430 gene atpH 3680 3159 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064683.1 protein_id gnl|my_center|LOCUS_11430 4240 3680 gene locus_tag LOCUS_11440 gene atpF 4240 3680 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005629246.1 protein_id gnl|my_center|LOCUS_11440 4579 4304 gene locus_tag LOCUS_11450 4579 4304 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082074.1 protein_id gnl|my_center|LOCUS_11450 5354 4602 gene locus_tag LOCUS_11460 5354 4602 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356899.1 protein_id gnl|my_center|LOCUS_11460 5941 5351 gene locus_tag LOCUS_11470 5941 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 6179 5913 gene locus_tag LOCUS_11480 6179 5913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 6640 6194 gene locus_tag LOCUS_11490 gene rpiB 6640 6194 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947986.1 protein_id gnl|my_center|LOCUS_11490 8335 6788 gene locus_tag LOCUS_11500 8335 6788 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963677.1 protein_id gnl|my_center|LOCUS_11500 8933 8328 gene locus_tag LOCUS_11510 8933 8328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 9685 8936 gene locus_tag LOCUS_11520 9685 8936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 10806 9703 gene locus_tag LOCUS_11530 gene ugpC 10806 9703 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861561.1 protein_id gnl|my_center|LOCUS_11530 11494 10823 gene locus_tag LOCUS_11540 11494 10823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 12293 11487 gene locus_tag LOCUS_11550 12293 11487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 14905 12374 gene locus_tag LOCUS_11560 14905 12374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 15810 14941 gene locus_tag LOCUS_11570 15810 14941 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003517572.1 protein_id gnl|my_center|LOCUS_11570 16917 15829 gene locus_tag LOCUS_11580 16917 15829 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972692.1 protein_id gnl|my_center|LOCUS_11580 17647 16895 gene locus_tag LOCUS_11590 17647 16895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 >Feature sequence33 184 2520 gene locus_tag LOCUS_11600 184 2520 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964979.1 protein_id gnl|my_center|LOCUS_11600 2603 4393 gene locus_tag LOCUS_11610 2603 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 4396 6399 gene locus_tag LOCUS_11620 4396 6399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 6492 7337 gene locus_tag LOCUS_11630 6492 7337 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891824.1 protein_id gnl|my_center|LOCUS_11630 7775 7371 gene locus_tag LOCUS_11640 7775 7371 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278301.1 protein_id gnl|my_center|LOCUS_11640 7880 8878 gene locus_tag LOCUS_11650 7880 8878 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476646.1 protein_id gnl|my_center|LOCUS_11650 9096 12842 gene locus_tag LOCUS_11660 9096 12842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 12842 13753 gene locus_tag LOCUS_11670 gene cas1 12842 13753 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681291.1 protein_id gnl|my_center|LOCUS_11670 13740 14072 gene locus_tag LOCUS_11680 gene cas2 13740 14072 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475522.1 protein_id gnl|my_center|LOCUS_11680 15062 14052 gene locus_tag LOCUS_11690 15062 14052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 15151 15780 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gattcaaacccctatagaattagaatagttaatgac 16171 17550 gene locus_tag LOCUS_11700 gene asnS 16171 17550 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948326.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence34 <1 660 gene locus_tag LOCUS_11710 <1 660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011101955.1:DUF3737 family protein 663 1820 gene locus_tag LOCUS_11720 663 1820 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201247498.1 protein_id gnl|my_center|LOCUS_11720 2482 1838 gene locus_tag LOCUS_11730 2482 1838 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082968.1 protein_id gnl|my_center|LOCUS_11730 2572 2868 gene locus_tag LOCUS_11740 gene csoR 2572 2868 CDS product copper-sensing transcriptional repressor CsoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723408.1 protein_id gnl|my_center|LOCUS_11740 2865 5495 gene locus_tag LOCUS_11750 2865 5495 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_11750 5497 5697 gene locus_tag LOCUS_11760 5497 5697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 5817 6719 gene locus_tag LOCUS_11770 5817 6719 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902661.1 protein_id gnl|my_center|LOCUS_11770 6794 7162 gene locus_tag LOCUS_11780 6794 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 7162 11505 gene locus_tag LOCUS_11790 7162 11505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 11507 11896 gene locus_tag LOCUS_11800 11507 11896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 11982 12875 gene locus_tag LOCUS_11810 11982 12875 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775137.1 protein_id gnl|my_center|LOCUS_11810 12993 13862 gene locus_tag LOCUS_11820 gene metF 12993 13862 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_11820 13840 14454 gene locus_tag LOCUS_11830 13840 14454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 14442 16808 gene locus_tag LOCUS_11840 14442 16808 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_11840 >Feature sequence35 1913 141 gene locus_tag LOCUS_11850 1913 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 2745 1906 gene locus_tag LOCUS_11860 2745 1906 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254021.1 protein_id gnl|my_center|LOCUS_11860 3522 2752 gene locus_tag LOCUS_11870 3522 2752 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674361.1 protein_id gnl|my_center|LOCUS_11870 4249 3893 gene locus_tag LOCUS_11880 4249 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 4328 4939 gene locus_tag LOCUS_11890 gene def 4328 4939 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831696.1 protein_id gnl|my_center|LOCUS_11890 6090 4963 gene locus_tag LOCUS_11900 6090 4963 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016775.1 protein_id gnl|my_center|LOCUS_11900 6823 6116 gene locus_tag LOCUS_11910 6823 6116 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166692.1 protein_id gnl|my_center|LOCUS_11910 8315 6873 gene locus_tag LOCUS_11920 gene sufB 8315 6873 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228608.1 protein_id gnl|my_center|LOCUS_11920 8754 8302 gene locus_tag LOCUS_11930 8754 8302 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831954.1 protein_id gnl|my_center|LOCUS_11930 9978 8773 gene locus_tag LOCUS_11940 gene sufS 9978 8773 CDS product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020767.1 protein_id gnl|my_center|LOCUS_11940 10771 9980 gene locus_tag LOCUS_11950 10771 9980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 11590 10781 gene locus_tag LOCUS_11960 gene sufC 11590 10781 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702968.1 protein_id gnl|my_center|LOCUS_11960 14068 11657 gene locus_tag LOCUS_11970 gene leuS 14068 11657 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285916.1 protein_id gnl|my_center|LOCUS_11970 14695 14261 gene locus_tag LOCUS_11980 14695 14261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 15167 14679 gene locus_tag LOCUS_11990 15167 14679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 15499 15179 gene locus_tag LOCUS_12000 15499 15179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 >Feature sequence36 1362 121 gene locus_tag LOCUS_12010 1362 121 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398500.1 protein_id gnl|my_center|LOCUS_12010 1531 3729 gene locus_tag LOCUS_12020 1531 3729 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832683.1 protein_id gnl|my_center|LOCUS_12020 3731 4177 gene locus_tag LOCUS_12030 gene dtd 3731 4177 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475975.1 protein_id gnl|my_center|LOCUS_12030 4186 6183 gene locus_tag LOCUS_12040 4186 6183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 6200 7504 gene locus_tag LOCUS_12050 gene rimO 6200 7504 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_12050 7518 8087 gene locus_tag LOCUS_12060 gene trmL 7518 8087 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538147.1 protein_id gnl|my_center|LOCUS_12060 8147 8458 gene locus_tag LOCUS_12070 gene trxA 8147 8458 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329897.1 protein_id gnl|my_center|LOCUS_12070 8477 9484 gene locus_tag LOCUS_12080 8477 9484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 9481 10554 gene locus_tag LOCUS_12090 9481 10554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 10646 11857 gene locus_tag LOCUS_12100 10646 11857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 12115 13929 gene locus_tag LOCUS_12110 12115 13929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 14408 15292 gene locus_tag LOCUS_12120 14408 15292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 >Feature sequence37 <1 1505 gene locus_tag LOCUS_12130 <1 1505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015942796.1:InlB B-repeat-containing protein 1507 1647 gene locus_tag LOCUS_12140 1507 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 1737 2066 gene locus_tag LOCUS_12150 1737 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 2063 2887 gene locus_tag LOCUS_12160 2063 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 2878 3144 gene locus_tag LOCUS_12170 2878 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 3125 3562 gene locus_tag LOCUS_12180 3125 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 3916 4188 gene locus_tag LOCUS_12190 3916 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 4175 5275 gene locus_tag LOCUS_12200 4175 5275 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816638.1 protein_id gnl|my_center|LOCUS_12200 5354 6943 gene locus_tag LOCUS_12210 5354 6943 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225971127.1 protein_id gnl|my_center|LOCUS_12210 6946 8025 gene locus_tag LOCUS_12220 6946 8025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 8103 9497 gene locus_tag LOCUS_12230 8103 9497 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068360.1 protein_id gnl|my_center|LOCUS_12230 9551 10216 gene locus_tag LOCUS_12240 gene cps4B 9551 10216 CDS product capsular polysaccharide biosynthesis protein Cps4B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922734.1 protein_id gnl|my_center|LOCUS_12240 10229 12058 gene locus_tag LOCUS_12250 gene dxs 10229 12058 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366447.1 protein_id gnl|my_center|LOCUS_12250 12214 13158 gene locus_tag LOCUS_12260 12214 13158 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047035641.1 protein_id gnl|my_center|LOCUS_12260 >Feature sequence38 210 1871 gene locus_tag LOCUS_12270 210 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 2525 1920 gene locus_tag LOCUS_12280 2525 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 2678 5788 gene locus_tag LOCUS_12290 2678 5788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 8070 5827 gene locus_tag LOCUS_12300 gene metE 8070 5827 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108255.1 protein_id gnl|my_center|LOCUS_12300 8271 8723 gene locus_tag LOCUS_12310 gene bcp 8271 8723 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439443.1 protein_id gnl|my_center|LOCUS_12310 8735 9550 gene locus_tag LOCUS_12320 8735 9550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 9783 11384 gene locus_tag LOCUS_12330 9783 11384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 11410 12141 gene locus_tag LOCUS_12340 11410 12141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 12225 13244 gene locus_tag LOCUS_12350 12225 13244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 13441 13878 gene locus_tag LOCUS_12360 13441 13878 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972158.1 protein_id gnl|my_center|LOCUS_12360 >Feature sequence39 587 781 gene locus_tag LOCUS_12370 587 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 787 2556 gene locus_tag LOCUS_12380 787 2556 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968694.1 protein_id gnl|my_center|LOCUS_12380 2558 3769 gene locus_tag LOCUS_12390 2558 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 3771 6992 gene locus_tag LOCUS_12400 3771 6992 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968692.1 protein_id gnl|my_center|LOCUS_12400 7048 7317 gene locus_tag LOCUS_12410 7048 7317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 7325 7714 gene locus_tag LOCUS_12420 7325 7714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 7741 9186 gene locus_tag LOCUS_12430 7741 9186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 9335 9691 gene locus_tag LOCUS_12440 9335 9691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 9839 10681 gene locus_tag LOCUS_12450 9839 10681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 10703 11491 gene locus_tag LOCUS_12460 10703 11491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 11513 12163 gene locus_tag LOCUS_12470 11513 12163 CDS product TIR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183217.1 protein_id gnl|my_center|LOCUS_12470 12163 12642 gene locus_tag LOCUS_12480 12163 12642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 12670 13707 gene locus_tag LOCUS_12490 12670 13707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 >Feature sequence40 185 934 gene locus_tag LOCUS_12500 185 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 927 2237 gene locus_tag LOCUS_12510 927 2237 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963927.1 protein_id gnl|my_center|LOCUS_12510 3127 2273 gene locus_tag LOCUS_12520 3127 2273 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475716.1 protein_id gnl|my_center|LOCUS_12520 3229 4416 gene locus_tag LOCUS_12530 3229 4416 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966536.1 protein_id gnl|my_center|LOCUS_12530 4419 5504 gene locus_tag LOCUS_12540 4419 5504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 5585 7435 gene locus_tag LOCUS_12550 gene typA 5585 7435 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722695.1 protein_id gnl|my_center|LOCUS_12550 8773 7499 gene locus_tag LOCUS_12560 8773 7499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 8940 9824 gene locus_tag LOCUS_12570 8940 9824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 10671 9856 gene locus_tag LOCUS_12580 10671 9856 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_12580 11285 10758 gene locus_tag LOCUS_12590 11285 10758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 12579 11371 gene locus_tag LOCUS_12600 gene pepT 12579 11371 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460034.1 protein_id gnl|my_center|LOCUS_12600 12838 13038 gene locus_tag LOCUS_12610 12838 13038 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905424.1 protein_id gnl|my_center|LOCUS_12610 >Feature sequence41 344 1339 gene locus_tag LOCUS_12620 344 1339 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127350626.1 protein_id gnl|my_center|LOCUS_12620 1601 2056 gene locus_tag LOCUS_12630 1601 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 2013 2159 gene locus_tag LOCUS_12640 2013 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 2156 3001 gene locus_tag LOCUS_12650 2156 3001 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016856.1 protein_id gnl|my_center|LOCUS_12650 3024 3308 gene locus_tag LOCUS_12660 3024 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 3394 3469 gene locus_tag LOCUS_t00140 3394 3469 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 3482 3558 gene locus_tag LOCUS_t00150 3482 3558 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3740 3955 gene locus_tag LOCUS_12670 3740 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 3969 4211 gene locus_tag LOCUS_12680 3969 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12680 4211 6781 gene locus_tag LOCUS_12690 4211 6781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 6781 6984 gene locus_tag LOCUS_12700 6781 6984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 7102 8073 gene locus_tag LOCUS_12710 7102 8073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 8249 9106 gene locus_tag LOCUS_12720 8249 9106 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357673.1 protein_id gnl|my_center|LOCUS_12720 10460 9207 gene locus_tag LOCUS_12730 10460 9207 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_12730 10643 11560 gene locus_tag LOCUS_12740 10643 11560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 11679 12632 gene locus_tag LOCUS_12750 gene pfkA 11679 12632 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421189.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence42 995 201 gene locus_tag LOCUS_12760 995 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 2917 995 gene locus_tag LOCUS_12770 2917 995 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129655.1 protein_id gnl|my_center|LOCUS_12770 4368 3577 gene locus_tag LOCUS_12780 4368 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 5309 4449 gene locus_tag LOCUS_12790 5309 4449 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416734.1 protein_id gnl|my_center|LOCUS_12790 6468 5443 gene locus_tag LOCUS_12800 6468 5443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 >Feature sequence43 377 2281 gene locus_tag LOCUS_12810 377 2281 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766176.1 protein_id gnl|my_center|LOCUS_12810 2271 3998 gene locus_tag LOCUS_12820 2271 3998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 4075 4479 gene locus_tag LOCUS_12830 4075 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 4500 5111 gene locus_tag LOCUS_12840 4500 5111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 5125 5811 gene locus_tag LOCUS_12850 5125 5811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 5897 6100 gene locus_tag LOCUS_12860 5897 6100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 6207 7010 gene locus_tag LOCUS_12870 6207 7010 CDS product viperin family antiviral radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957056.1 protein_id gnl|my_center|LOCUS_12870 7036 7347 gene locus_tag LOCUS_12880 7036 7347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 7443 7616 gene locus_tag LOCUS_12890 7443 7616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 7810 7986 gene locus_tag LOCUS_12900 7810 7986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 8189 8590 gene locus_tag LOCUS_12910 8189 8590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 8592 10184 gene locus_tag LOCUS_12920 8592 10184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 10177 11307 gene locus_tag LOCUS_12930 10177 11307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 >Feature sequence44 285 989 gene locus_tag LOCUS_12940 gene rlmB 285 989 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887855.1 protein_id gnl|my_center|LOCUS_12940 989 1519 gene locus_tag LOCUS_12950 989 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 1556 3199 gene locus_tag LOCUS_12960 1556 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 3313 3462 gene locus_tag LOCUS_12970 gene rpmG 3313 3462 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966428.1 protein_id gnl|my_center|LOCUS_12970 3476 4021 gene locus_tag LOCUS_12980 3476 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 4039 4593 gene locus_tag LOCUS_12990 gene nusG 4039 4593 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726896.1 protein_id gnl|my_center|LOCUS_12990 4788 7409 gene locus_tag LOCUS_13000 4788 7409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 7426 9195 gene locus_tag LOCUS_13010 7426 9195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 9539 10564 gene locus_tag LOCUS_13020 9539 10564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 10661 11734 gene locus_tag LOCUS_13030 10661 11734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 >Feature sequence45 20 391 gene locus_tag LOCUS_13040 20 391 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812106.1 protein_id gnl|my_center|LOCUS_13040 712 1653 gene locus_tag LOCUS_13050 712 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 1734 2378 gene locus_tag LOCUS_13060 1734 2378 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989878.1 protein_id gnl|my_center|LOCUS_13060 2360 3097 gene locus_tag LOCUS_13070 2360 3097 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355903.1 protein_id gnl|my_center|LOCUS_13070 3111 3809 gene locus_tag LOCUS_13080 gene mtnN 3111 3809 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967881.1 protein_id gnl|my_center|LOCUS_13080 3802 4392 gene locus_tag LOCUS_13090 3802 4392 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183373.1 protein_id gnl|my_center|LOCUS_13090 4404 5096 gene locus_tag LOCUS_13100 4404 5096 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286756.1 protein_id gnl|my_center|LOCUS_13100 5242 6969 gene locus_tag LOCUS_13110 5242 6969 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989585.1 protein_id gnl|my_center|LOCUS_13110 7148 9136 gene locus_tag LOCUS_13120 gene uvrB 7148 9136 CDS product excinuclease ABC subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000441064.1 protein_id gnl|my_center|LOCUS_13120 9123 10469 gene locus_tag LOCUS_13130 gene rlmD 9123 10469 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495280.1 protein_id gnl|my_center|LOCUS_13130 10830 11537 gene locus_tag LOCUS_13140 10830 11537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 >Feature sequence46 239 1522 gene locus_tag LOCUS_13150 239 1522 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_13150 1684 2664 gene locus_tag LOCUS_13160 1684 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 2733 3956 gene locus_tag LOCUS_13170 2733 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 3990 5087 gene locus_tag LOCUS_13180 3990 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 5102 6028 gene locus_tag LOCUS_13190 gene cysK 5102 6028 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356610.1 protein_id gnl|my_center|LOCUS_13190 6039 6839 gene locus_tag LOCUS_13200 6039 6839 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_13200 6836 7828 gene locus_tag LOCUS_13210 6836 7828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 7831 8766 gene locus_tag LOCUS_13220 gene cysK 7831 8766 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_13220 8769 9779 gene locus_tag LOCUS_13230 8769 9779 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079769.1 protein_id gnl|my_center|LOCUS_13230 9798 10934 gene locus_tag LOCUS_13240 9798 10934 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963712.1 protein_id gnl|my_center|LOCUS_13240 >Feature sequence47 116 724 gene locus_tag LOCUS_13250 116 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 1924 767 gene locus_tag LOCUS_13260 1924 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 2929 2054 gene locus_tag LOCUS_13270 2929 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 5320 3065 gene locus_tag LOCUS_13280 5320 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 6015 5317 gene locus_tag LOCUS_13290 6015 5317 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461283.1 protein_id gnl|my_center|LOCUS_13290 7684 6305 gene locus_tag LOCUS_13300 7684 6305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 10837 7808 gene locus_tag LOCUS_13310 10837 7808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 >Feature sequence48 701 3196 gene locus_tag LOCUS_13320 701 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 3246 4280 gene locus_tag LOCUS_13330 3246 4280 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964009.1 protein_id gnl|my_center|LOCUS_13330 4352 5089 gene locus_tag LOCUS_13340 4352 5089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 5214 5747 gene locus_tag LOCUS_13350 5214 5747 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267874.1 protein_id gnl|my_center|LOCUS_13350 6645 5764 gene locus_tag LOCUS_13360 6645 5764 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_13360 7307 6648 gene locus_tag LOCUS_13370 7307 6648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 8318 7320 gene locus_tag LOCUS_13380 8318 7320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 8740 8333 gene locus_tag LOCUS_13390 8740 8333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 9799 8900 gene locus_tag LOCUS_13400 9799 8900 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_13400 >Feature sequence49 154 1488 gene locus_tag LOCUS_13410 154 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 2228 1536 gene locus_tag LOCUS_13420 2228 1536 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423213.1 protein_id gnl|my_center|LOCUS_13420 2448 3203 gene locus_tag LOCUS_13430 2448 3203 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913203.1 protein_id gnl|my_center|LOCUS_13430 3287 3919 gene locus_tag LOCUS_13440 3287 3919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 3983 5056 gene locus_tag LOCUS_13450 3983 5056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 6155 5115 gene locus_tag LOCUS_13460 gene ispG 6155 5115 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194540.1 protein_id gnl|my_center|LOCUS_13460 6294 6629 gene locus_tag LOCUS_13470 6294 6629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 6784 6933 gene locus_tag LOCUS_13480 gene rpmG 6784 6933 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357626.1 protein_id gnl|my_center|LOCUS_13480 7017 7616 gene locus_tag LOCUS_13490 7017 7616 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016953.1 protein_id gnl|my_center|LOCUS_13490 7956 8963 gene locus_tag LOCUS_13500 gene asnA 7956 8963 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284917.1 protein_id gnl|my_center|LOCUS_13500 >Feature sequence50 80 188 gene locus_tag LOCUS_r00010 80 188 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 331 1605 gene locus_tag LOCUS_13510 331 1605 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_13510 1696 1804 gene locus_tag LOCUS_r00020 1696 1804 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1857 2702 gene locus_tag LOCUS_13520 1857 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 2836 2911 gene locus_tag LOCUS_t00160 2836 2911 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2914 2989 gene locus_tag LOCUS_t00170 2914 2989 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3851 3030 gene locus_tag LOCUS_13530 3851 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 3990 6170 gene locus_tag LOCUS_13540 3990 6170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 6347 7765 gene locus_tag LOCUS_13550 gene pyk 6347 7765 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963840.1 protein_id gnl|my_center|LOCUS_13550 7850 8215 gene locus_tag LOCUS_13560 7850 8215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 8304 9167 gene locus_tag LOCUS_13570 8304 9167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 >Feature sequence51 237 482 gene locus_tag LOCUS_13580 gene rpsP 237 482 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965062.1 protein_id gnl|my_center|LOCUS_13580 494 739 gene locus_tag LOCUS_13590 494 739 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728421.1 protein_id gnl|my_center|LOCUS_13590 820 1308 gene locus_tag LOCUS_13600 gene rimM 820 1308 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699991.1 protein_id gnl|my_center|LOCUS_13600 1305 2036 gene locus_tag LOCUS_13610 gene trmD 1305 2036 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016280.1 protein_id gnl|my_center|LOCUS_13610 2023 3474 gene locus_tag LOCUS_13620 gene malQ 2023 3474 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016706.1 protein_id gnl|my_center|LOCUS_13620 3474 4397 gene locus_tag LOCUS_13630 3474 4397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 4732 4469 gene locus_tag LOCUS_13640 gene rpsT 4732 4469 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895949.1 protein_id gnl|my_center|LOCUS_13640 4861 6159 gene locus_tag LOCUS_13650 4861 6159 CDS product glycosyl hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703154.1 protein_id gnl|my_center|LOCUS_13650 6238 6858 gene locus_tag LOCUS_13660 gene pgsA 6238 6858 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365382.1 protein_id gnl|my_center|LOCUS_13660 6924 7907 gene locus_tag LOCUS_13670 gene recA 6924 7907 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732286.1 protein_id gnl|my_center|LOCUS_13670 7999 8089 gene locus_tag LOCUS_t00180 7999 8089 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8503 9429 gene locus_tag LOCUS_13680 8503 9429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 9466 9669 gene locus_tag LOCUS_13690 9466 9669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 9627 10073 gene locus_tag LOCUS_13700 9627 10073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 >Feature sequence52 234 950 gene locus_tag LOCUS_13710 234 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 1021 1734 gene locus_tag LOCUS_13720 1021 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 1731 2480 gene locus_tag LOCUS_13730 1731 2480 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966274.1 protein_id gnl|my_center|LOCUS_13730 2517 4319 gene locus_tag LOCUS_13740 2517 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 4388 4996 gene locus_tag LOCUS_13750 4388 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 5122 8181 gene locus_tag LOCUS_13760 5122 8181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 8355 9008 gene locus_tag LOCUS_13770 8355 9008 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986312.1 protein_id gnl|my_center|LOCUS_13770 >Feature sequence53 1440 310 gene locus_tag LOCUS_13780 gene mnmA 1440 310 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565200.1 protein_id gnl|my_center|LOCUS_13780 2627 1437 gene locus_tag LOCUS_13790 2627 1437 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966253.1 protein_id gnl|my_center|LOCUS_13790 3756 2620 gene locus_tag LOCUS_13800 3756 2620 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963712.1 protein_id gnl|my_center|LOCUS_13800 4369 3758 gene locus_tag LOCUS_13810 4369 3758 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170003.1 protein_id gnl|my_center|LOCUS_13810 5310 4375 gene locus_tag LOCUS_13820 5310 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 6555 5326 gene locus_tag LOCUS_13830 6555 5326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 8687 7155 gene locus_tag LOCUS_13840 8687 7155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 9225 9434 gene locus_tag LOCUS_13850 9225 9434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 >Feature sequence54 983 1759 gene locus_tag LOCUS_13860 983 1759 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436797.1 protein_id gnl|my_center|LOCUS_13860 2561 1797 gene locus_tag LOCUS_13870 gene tpiA 2561 1797 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243394.1 protein_id gnl|my_center|LOCUS_13870 2875 2627 gene locus_tag LOCUS_13880 2875 2627 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719221.1 protein_id gnl|my_center|LOCUS_13880 4149 2929 gene locus_tag LOCUS_13890 4149 2929 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989997.1 protein_id gnl|my_center|LOCUS_13890 5874 4372 gene locus_tag LOCUS_13900 5874 4372 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423106.1 protein_id gnl|my_center|LOCUS_13900 6605 6072 gene locus_tag LOCUS_13910 6605 6072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 7217 6960 gene locus_tag LOCUS_13920 7217 6960 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681231.1 protein_id gnl|my_center|LOCUS_13920 8191 7328 gene locus_tag LOCUS_13930 8191 7328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 >Feature sequence55 52 747 gene locus_tag LOCUS_13940 52 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 2104 911 gene locus_tag LOCUS_13950 gene maeB 2104 911 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229415.1 protein_id gnl|my_center|LOCUS_13950 2640 2116 gene locus_tag LOCUS_13960 2640 2116 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545215.1 protein_id gnl|my_center|LOCUS_13960 3473 2637 gene locus_tag LOCUS_13970 3473 2637 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519031.1 protein_id gnl|my_center|LOCUS_13970 3600 4418 gene locus_tag LOCUS_13980 3600 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 4721 5905 gene locus_tag LOCUS_13990 4721 5905 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320739.1 protein_id gnl|my_center|LOCUS_13990 5878 6738 gene locus_tag LOCUS_14000 5878 6738 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964157.1 protein_id gnl|my_center|LOCUS_14000 6738 7685 gene locus_tag LOCUS_14010 6738 7685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 7660 9102 gene locus_tag LOCUS_14020 7660 9102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 >Feature sequence56 291 863 gene locus_tag LOCUS_14030 291 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 874 1806 gene locus_tag LOCUS_14040 gene hprK 874 1806 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228097.1 protein_id gnl|my_center|LOCUS_14040 1815 3389 gene locus_tag LOCUS_14050 1815 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 3392 4321 gene locus_tag LOCUS_14060 gene whiA 3392 4321 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006551.1 protein_id gnl|my_center|LOCUS_14060 4440 5657 gene locus_tag LOCUS_14070 4440 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 >Feature sequence57 188 2863 gene locus_tag LOCUS_14080 188 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 3602 2895 gene locus_tag LOCUS_14090 3602 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 3773 3697 gene locus_tag LOCUS_t00190 3773 3697 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5189 4002 gene locus_tag LOCUS_14100 5189 4002 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948693.1 protein_id gnl|my_center|LOCUS_14100 5537 5953 gene locus_tag LOCUS_14110 gene rpsL 5537 5953 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142341.1 protein_id gnl|my_center|LOCUS_14110 6037 6507 gene locus_tag LOCUS_14120 gene rpsG 6037 6507 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225784.1 protein_id gnl|my_center|LOCUS_14120 6530 8596 gene locus_tag LOCUS_14130 gene fusA 6530 8596 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724965.1 protein_id gnl|my_center|LOCUS_14130 >Feature sequence58 403 1314 gene locus_tag LOCUS_14140 403 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 1425 2078 gene locus_tag LOCUS_14150 1425 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 2080 2568 gene locus_tag LOCUS_14160 2080 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 2620 3153 gene locus_tag LOCUS_14170 2620 3153 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233562.1 protein_id gnl|my_center|LOCUS_14170 3254 3733 gene locus_tag LOCUS_14180 3254 3733 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905907.1 protein_id gnl|my_center|LOCUS_14180 3736 4128 gene locus_tag LOCUS_14190 3736 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 4349 6979 gene locus_tag LOCUS_14200 gene ppdK 4349 6979 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_14200 7064 7687 gene locus_tag LOCUS_14210 7064 7687 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736935.1 protein_id gnl|my_center|LOCUS_14210 7706 8599 gene locus_tag LOCUS_14220 7706 8599 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949052.1 protein_id gnl|my_center|LOCUS_14220 >Feature sequence59 224 300 gene locus_tag LOCUS_t00200 224 300 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 738 361 gene locus_tag LOCUS_14230 738 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 2071 1250 gene locus_tag LOCUS_14240 2071 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 2397 2074 gene locus_tag LOCUS_14250 2397 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 3090 2554 gene locus_tag LOCUS_14260 3090 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 3447 5660 gene locus_tag LOCUS_14270 3447 5660 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048131.1 protein_id gnl|my_center|LOCUS_14270 6116 5778 gene locus_tag LOCUS_14280 6116 5778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 6497 7540 gene locus_tag LOCUS_14290 6497 7540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 >Feature sequence60 2277 3110 gene locus_tag LOCUS_14300 2277 3110 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475475.1 protein_id gnl|my_center|LOCUS_14300 3110 3589 gene locus_tag LOCUS_14310 gene rlmH 3110 3589 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966801.1 protein_id gnl|my_center|LOCUS_14310 3840 5360 gene locus_tag LOCUS_14320 3840 5360 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964014.1 protein_id gnl|my_center|LOCUS_14320 5443 6921 gene locus_tag LOCUS_14330 5443 6921 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703566.1 protein_id gnl|my_center|LOCUS_14330 >Feature sequence61 897 319 gene locus_tag LOCUS_14340 897 319 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890731.1 protein_id gnl|my_center|LOCUS_14340 1429 1635 gene locus_tag LOCUS_14350 gene yaaA 1429 1635 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254000.1 protein_id gnl|my_center|LOCUS_14350 1632 2687 gene locus_tag LOCUS_14360 gene recF 1632 2687 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243515.1 protein_id gnl|my_center|LOCUS_14360 2674 4689 gene locus_tag LOCUS_14370 gene gyrB 2674 4689 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_14370 4701 7268 gene locus_tag LOCUS_14380 gene gyrA 4701 7268 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282864.1 protein_id gnl|my_center|LOCUS_14380 >Feature sequence62 2252 891 gene locus_tag LOCUS_14390 2252 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 3658 2405 gene locus_tag LOCUS_14400 3658 2405 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846674.1 protein_id gnl|my_center|LOCUS_14400 3858 3785 gene locus_tag LOCUS_t00210 3858 3785 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3944 3868 gene locus_tag LOCUS_t00220 3944 3868 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4791 4045 gene locus_tag LOCUS_14410 4791 4045 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890403.1 protein_id gnl|my_center|LOCUS_14410 5133 4909 gene locus_tag LOCUS_14420 5133 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 5597 5151 gene locus_tag LOCUS_14430 5597 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 6153 5704 gene locus_tag LOCUS_14440 6153 5704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 6986 6219 gene locus_tag LOCUS_14450 6986 6219 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681345.1 protein_id gnl|my_center|LOCUS_14450 7206 6988 gene locus_tag LOCUS_14460 7206 6988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 >Feature sequence63 995 138 gene locus_tag LOCUS_14470 995 138 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254320.1 protein_id gnl|my_center|LOCUS_14470 1293 1592 gene locus_tag LOCUS_14480 1293 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 2345 3607 gene locus_tag LOCUS_14490 2345 3607 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088780.1 protein_id gnl|my_center|LOCUS_14490 3609 4811 gene locus_tag LOCUS_14500 gene nspC 3609 4811 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764364.1 protein_id gnl|my_center|LOCUS_14500 5716 4856 gene locus_tag LOCUS_14510 5716 4856 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860980.1 protein_id gnl|my_center|LOCUS_14510 5820 6497 gene locus_tag LOCUS_14520 5820 6497 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001788648.1 protein_id gnl|my_center|LOCUS_14520 6520 6747 gene locus_tag LOCUS_14530 6520 6747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 >Feature sequence64 452 216 gene locus_tag LOCUS_14540 gene rpsR 452 216 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831354.1 protein_id gnl|my_center|LOCUS_14540 973 470 gene locus_tag LOCUS_14550 gene ssb 973 470 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981966.1 protein_id gnl|my_center|LOCUS_14550 1275 988 gene locus_tag LOCUS_14560 gene rpsF 1275 988 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233779.1 protein_id gnl|my_center|LOCUS_14560 1880 1437 gene locus_tag LOCUS_14570 1880 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 3144 1939 gene locus_tag LOCUS_14580 3144 1939 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048277.1 protein_id gnl|my_center|LOCUS_14580 3915 3157 gene locus_tag LOCUS_14590 3915 3157 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895823.1 protein_id gnl|my_center|LOCUS_14590 4080 4793 gene locus_tag LOCUS_14600 4080 4793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 4911 5498 gene locus_tag LOCUS_14610 gene mscL 4911 5498 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759941.1 protein_id gnl|my_center|LOCUS_14610 5969 5526 gene locus_tag LOCUS_14620 5969 5526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 <6922 6076 gene locus_tag LOCUS_14630 <6922 6076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003235058.1:elongation factor Tu >Feature sequence65 679 314 gene locus_tag LOCUS_14640 679 314 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365398.1 protein_id gnl|my_center|LOCUS_14640 3517 737 gene locus_tag LOCUS_14650 3517 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 3685 5574 gene locus_tag LOCUS_14660 gene mnmG 3685 5574 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000541039.1 protein_id gnl|my_center|LOCUS_14660 5574 6266 gene locus_tag LOCUS_14670 gene rsmG 5574 6266 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355977.1 protein_id gnl|my_center|LOCUS_14670 6268 6435 gene locus_tag LOCUS_14680 6268 6435 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815177.1 protein_id gnl|my_center|LOCUS_14680 6655 6739 gene locus_tag LOCUS_t00230 6655 6739 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence66 237 485 gene locus_tag LOCUS_14690 237 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 487 1002 gene locus_tag LOCUS_14700 487 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 1012 1440 gene locus_tag LOCUS_14710 1012 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 1590 1763 gene locus_tag LOCUS_14720 1590 1763 CDS product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405297.1 protein_id gnl|my_center|LOCUS_14720 1860 4373 gene locus_tag LOCUS_14730 1860 4373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 >Feature sequence67 294 1454 gene locus_tag LOCUS_14740 294 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 1660 3144 gene locus_tag LOCUS_14750 1660 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 3213 4757 gene locus_tag LOCUS_14760 3213 4757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 >Feature sequence68 312 707 gene locus_tag LOCUS_14770 312 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 2453 762 gene locus_tag LOCUS_14780 2453 762 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831649.1 protein_id gnl|my_center|LOCUS_14780 2621 4339 gene locus_tag LOCUS_14790 2621 4339 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966455.1 protein_id gnl|my_center|LOCUS_14790 4366 5454 gene locus_tag LOCUS_14800 4366 5454 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066908.1 protein_id gnl|my_center|LOCUS_14800 >Feature sequence69 177 1148 gene locus_tag LOCUS_14810 177 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 1519 3018 gene locus_tag LOCUS_14820 1519 3018 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896230.1 protein_id gnl|my_center|LOCUS_14820 5180 3057 gene locus_tag LOCUS_14830 gene clpB 5180 3057 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723824.1 protein_id gnl|my_center|LOCUS_14830 >Feature sequence70 1257 220 gene locus_tag LOCUS_14840 1257 220 CDS product beta-eliminating lyase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235899614.1 protein_id gnl|my_center|LOCUS_14840 4388 1308 gene locus_tag LOCUS_14850 4388 1308 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373559.1 protein_id gnl|my_center|LOCUS_14850 4593 4967 gene locus_tag LOCUS_14860 4593 4967 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_14860 5157 5082 gene locus_tag LOCUS_t00240 5157 5082 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 5240 5164 gene locus_tag LOCUS_t00250 5240 5164 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 5375 5267 gene locus_tag LOCUS_r00030 5375 5267 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence71 252 1781 gene locus_tag LOCUS_14870 252 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 1804 2385 gene locus_tag LOCUS_14880 1804 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 2399 3493 gene locus_tag LOCUS_14890 2399 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 3584 4075 gene locus_tag LOCUS_14900 3584 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 4185 4397 gene locus_tag LOCUS_14910 4185 4397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 4425 4613 gene locus_tag LOCUS_14920 4425 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 >Feature sequence72 242 169 gene locus_tag LOCUS_t00260 242 169 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1065 343 gene locus_tag LOCUS_14930 1065 343 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021804.1 protein_id gnl|my_center|LOCUS_14930 2828 1065 gene locus_tag LOCUS_14940 2828 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 3446 2907 gene locus_tag LOCUS_14950 3446 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 3598 5088 gene locus_tag LOCUS_14960 3598 5088 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015055963.1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence73 139 1434 gene locus_tag LOCUS_14970 139 1434 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205044.1 protein_id gnl|my_center|LOCUS_14970 1438 1869 gene locus_tag LOCUS_14980 1438 1869 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965636.1 protein_id gnl|my_center|LOCUS_14980 1971 2678 gene locus_tag LOCUS_14990 1971 2678 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889773.1 protein_id gnl|my_center|LOCUS_14990 2671 4305 gene locus_tag LOCUS_15000 2671 4305 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836516.1 protein_id gnl|my_center|LOCUS_15000 4489 4878 gene locus_tag LOCUS_15010 4489 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 >Feature sequence74 729 2501 gene locus_tag LOCUS_15020 729 2501 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897431.1 protein_id gnl|my_center|LOCUS_15020 3129 2656 gene locus_tag LOCUS_15030 gene tadA 3129 2656 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832295.1 protein_id gnl|my_center|LOCUS_15030 3707 3129 gene locus_tag LOCUS_15040 3707 3129 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243018.1 protein_id gnl|my_center|LOCUS_15040 4027 3821 gene locus_tag LOCUS_15050 gene rpmE 4027 3821 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_15050 <4784 4134 gene locus_tag LOCUS_15060 <4784 4134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000572038.1:formate/nitrite transporter family protein >Feature sequence75 235 840 gene locus_tag LOCUS_15070 235 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 827 1732 gene locus_tag LOCUS_15080 827 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 2146 3171 gene locus_tag LOCUS_15090 2146 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 3175 4383 gene locus_tag LOCUS_15100 3175 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 >Feature sequence76 365 751 gene locus_tag LOCUS_15110 365 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 1524 2177 gene locus_tag LOCUS_15120 1524 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 2307 3830 gene locus_tag LOCUS_15130 2307 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 >Feature sequence77 <1 1236 gene locus_tag LOCUS_15140 <1 1236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272299.1:cation-translocating P-type ATPase 1531 2547 gene locus_tag LOCUS_15150 gene hrcA 1531 2547 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246126.1 protein_id gnl|my_center|LOCUS_15150 2557 3243 gene locus_tag LOCUS_15160 gene grpE 2557 3243 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230005.1 protein_id gnl|my_center|LOCUS_15160 >Feature sequence78 710 588 gene locus_tag LOCUS_15170 710 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 1648 743 gene locus_tag LOCUS_15180 1648 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 2277 3569 gene locus_tag LOCUS_15190 2277 3569 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775212.1 protein_id gnl|my_center|LOCUS_15190 >Feature sequence79 208 1149 gene locus_tag LOCUS_15200 208 1149 CDS product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966644.1 protein_id gnl|my_center|LOCUS_15200 2321 1197 gene locus_tag LOCUS_15210 2321 1197 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016645.1 protein_id gnl|my_center|LOCUS_15210 >Feature sequence80 714 1748 gene locus_tag LOCUS_15220 gene mnmA 714 1748 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_15220 1766 2278 gene locus_tag LOCUS_15230 1766 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 2301 2825 gene locus_tag LOCUS_15240 2301 2825 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656744.1 protein_id gnl|my_center|LOCUS_15240 2966 3457 gene locus_tag LOCUS_15250 2966 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence81 209 134 gene locus_tag LOCUS_t00270 209 134 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1971 280 gene locus_tag LOCUS_15260 1971 280 CDS product glutamate--tRNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225984.1 protein_id gnl|my_center|LOCUS_15260 2292 2110 gene locus_tag LOCUS_15270 2292 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 2972 2418 gene locus_tag LOCUS_15280 2972 2418 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419930.1 protein_id gnl|my_center|LOCUS_15280 3380 2991 gene locus_tag LOCUS_15290 3380 2991 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082322.1 protein_id gnl|my_center|LOCUS_15290 >Feature sequence82 358 1080 gene locus_tag LOCUS_15300 358 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 1067 1561 gene locus_tag LOCUS_15310 1067 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 1849 3261 gene locus_tag LOCUS_15320 1849 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 >Feature sequence83 2707 1880 gene locus_tag LOCUS_15330 2707 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 >Feature sequence84 328 95 gene locus_tag LOCUS_15340 328 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 1398 469 gene locus_tag LOCUS_15350 gene cysK 1398 469 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_15350 1846 1412 gene locus_tag LOCUS_15360 gene iscR 1846 1412 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688879.1 protein_id gnl|my_center|LOCUS_15360 3053 1926 gene locus_tag LOCUS_15370 3053 1926 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861987.1 protein_id gnl|my_center|LOCUS_15370 >Feature sequence85 2866 1931 gene locus_tag LOCUS_15380 2866 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 >Feature sequence86 1762 920 gene locus_tag LOCUS_15390 1762 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 2348 1755 gene locus_tag LOCUS_15400 2348 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 2659 2354 gene locus_tag LOCUS_15410 2659 2354 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669619.1 protein_id gnl|my_center|LOCUS_15410 >Feature sequence87 1367 2035 gene locus_tag LOCUS_15420 1367 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 2087 2755 gene locus_tag LOCUS_15430 2087 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 >Feature sequence88 696 475 gene locus_tag LOCUS_15440 696 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 1127 696 gene locus_tag LOCUS_15450 1127 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 1904 1140 gene locus_tag LOCUS_15460 1904 1140 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966274.1 protein_id gnl|my_center|LOCUS_15460