>Feature sequence001 1289 993 gene locus_tag LOCUS_00010 1289 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1564 1292 gene locus_tag LOCUS_00020 1564 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1654 2793 gene locus_tag LOCUS_00030 gene zinU 1654 2793 CDS product zinc metallochaperone ZinU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234625.1 protein_id gnl|my_center|LOCUS_00030 3747 2788 gene locus_tag LOCUS_00040 3747 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5137 3791 gene locus_tag LOCUS_00050 5137 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5250 8087 gene locus_tag LOCUS_00060 5250 8087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 8757 8302 gene locus_tag LOCUS_00070 8757 8302 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080162.1 protein_id gnl|my_center|LOCUS_00070 10445 8769 gene locus_tag LOCUS_00080 gene ettA 10445 8769 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_00080 12132 10468 gene locus_tag LOCUS_00090 12132 10468 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791317.1 protein_id gnl|my_center|LOCUS_00090 12281 14200 gene locus_tag LOCUS_00100 12281 14200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 14223 14381 gene locus_tag LOCUS_00110 14223 14381 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869872.1 protein_id gnl|my_center|LOCUS_00110 14900 14397 gene locus_tag LOCUS_00120 14900 14397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 15969 14932 gene locus_tag LOCUS_00130 15969 14932 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_00130 16052 17140 gene locus_tag LOCUS_00140 16052 17140 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109126.1 protein_id gnl|my_center|LOCUS_00140 17137 17856 gene locus_tag LOCUS_00150 17137 17856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 17879 18679 gene locus_tag LOCUS_00160 17879 18679 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388716.1 protein_id gnl|my_center|LOCUS_00160 18720 19649 gene locus_tag LOCUS_00170 18720 19649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 22508 19653 gene locus_tag LOCUS_00180 22508 19653 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117740.1 protein_id gnl|my_center|LOCUS_00180 22561 23232 gene locus_tag LOCUS_00190 22561 23232 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785068.1 protein_id gnl|my_center|LOCUS_00190 23229 24344 gene locus_tag LOCUS_00200 23229 24344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 26587 24341 gene locus_tag LOCUS_00210 26587 24341 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203339.1 protein_id gnl|my_center|LOCUS_00210 26680 28431 gene locus_tag LOCUS_00220 26680 28431 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_00220 28446 30350 gene locus_tag LOCUS_00230 28446 30350 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_00230 30347 30790 gene locus_tag LOCUS_00240 30347 30790 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107997.1 protein_id gnl|my_center|LOCUS_00240 31611 32093 gene locus_tag LOCUS_00250 31611 32093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 33332 32781 gene locus_tag LOCUS_00260 33332 32781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 35515 33395 gene locus_tag LOCUS_00270 35515 33395 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109251.1 protein_id gnl|my_center|LOCUS_00270 37266 35578 gene locus_tag LOCUS_00280 37266 35578 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762692.1 protein_id gnl|my_center|LOCUS_00280 37433 38353 gene locus_tag LOCUS_00290 37433 38353 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769011.1 protein_id gnl|my_center|LOCUS_00290 38414 41089 gene locus_tag LOCUS_00300 38414 41089 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202547.1 protein_id gnl|my_center|LOCUS_00300 41101 42714 gene locus_tag LOCUS_00310 41101 42714 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107292.1 protein_id gnl|my_center|LOCUS_00310 43832 42711 gene locus_tag LOCUS_00320 43832 42711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 43953 45671 gene locus_tag LOCUS_00330 43953 45671 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838897.1 protein_id gnl|my_center|LOCUS_00330 47336 45672 gene locus_tag LOCUS_00340 47336 45672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 48309 47353 gene locus_tag LOCUS_00350 48309 47353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 49254 48319 gene locus_tag LOCUS_00360 49254 48319 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_00360 50031 49264 gene locus_tag LOCUS_00370 50031 49264 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784850.1 protein_id gnl|my_center|LOCUS_00370 52324 50078 gene locus_tag LOCUS_00380 52324 50078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 52414 53835 gene locus_tag LOCUS_00390 52414 53835 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767194.1 protein_id gnl|my_center|LOCUS_00390 53920 53994 gene locus_tag LOCUS_t00010 53920 53994 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 54107 54880 gene locus_tag LOCUS_00400 54107 54880 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814140.1 protein_id gnl|my_center|LOCUS_00400 55795 54896 gene locus_tag LOCUS_00410 55795 54896 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681345.1 protein_id gnl|my_center|LOCUS_00410 56877 55798 gene locus_tag LOCUS_00420 56877 55798 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_00420 59589 56956 gene locus_tag LOCUS_00430 59589 56956 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_00430 60331 59657 gene locus_tag LOCUS_00440 60331 59657 CDS product MIP family channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841205.1 protein_id gnl|my_center|LOCUS_00440 61352 60414 gene locus_tag LOCUS_00450 61352 60414 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090363.1 protein_id gnl|my_center|LOCUS_00450 61606 64764 gene locus_tag LOCUS_00460 61606 64764 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303104.1 protein_id gnl|my_center|LOCUS_00460 64778 66346 gene locus_tag LOCUS_00470 64778 66346 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108730.1 protein_id gnl|my_center|LOCUS_00470 66343 67110 gene locus_tag LOCUS_00480 66343 67110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 67127 68752 gene locus_tag LOCUS_00490 67127 68752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 68752 71403 gene locus_tag LOCUS_00500 68752 71403 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108733.1 protein_id gnl|my_center|LOCUS_00500 72285 71419 gene locus_tag LOCUS_00510 72285 71419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 72396 75314 gene locus_tag LOCUS_00520 72396 75314 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 protein_id gnl|my_center|LOCUS_00520 76110 75319 gene locus_tag LOCUS_00530 gene ccsA 76110 75319 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107762.1 protein_id gnl|my_center|LOCUS_00530 77315 76107 gene locus_tag LOCUS_00540 77315 76107 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107763.1 protein_id gnl|my_center|LOCUS_00540 79869 77335 gene locus_tag LOCUS_00550 79869 77335 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202101.1 protein_id gnl|my_center|LOCUS_00550 79944 81059 gene locus_tag LOCUS_00560 79944 81059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 81056 82180 gene locus_tag LOCUS_00570 81056 82180 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767707.1 protein_id gnl|my_center|LOCUS_00570 83193 82177 gene locus_tag LOCUS_00580 gene mutY 83193 82177 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303166.1 protein_id gnl|my_center|LOCUS_00580 83945 83193 gene locus_tag LOCUS_00590 83945 83193 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403572.1 protein_id gnl|my_center|LOCUS_00590 84012 85616 gene locus_tag LOCUS_00600 84012 85616 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766069.1 protein_id gnl|my_center|LOCUS_00600 85613 86188 gene locus_tag LOCUS_00610 85613 86188 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786586.1 protein_id gnl|my_center|LOCUS_00610 86172 87494 gene locus_tag LOCUS_00620 86172 87494 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202711.1 protein_id gnl|my_center|LOCUS_00620 87499 88809 gene locus_tag LOCUS_00630 87499 88809 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107332.1 protein_id gnl|my_center|LOCUS_00630 88814 90130 gene locus_tag LOCUS_00640 88814 90130 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760705.1 protein_id gnl|my_center|LOCUS_00640 90154 90582 gene locus_tag LOCUS_00650 90154 90582 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931805.1 protein_id gnl|my_center|LOCUS_00650 92458 90542 gene locus_tag LOCUS_00660 92458 90542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 94168 92525 gene locus_tag LOCUS_00670 94168 92525 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793588.1 protein_id gnl|my_center|LOCUS_00670 94307 95089 gene locus_tag LOCUS_00680 94307 95089 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816946.1 protein_id gnl|my_center|LOCUS_00680 96290 95025 gene locus_tag LOCUS_00690 96290 95025 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948301.1 protein_id gnl|my_center|LOCUS_00690 97251 96292 gene locus_tag LOCUS_00700 97251 96292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 100353 97393 gene locus_tag LOCUS_00710 100353 97393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 104023 100517 gene locus_tag LOCUS_00720 104023 100517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 104621 106408 gene locus_tag LOCUS_00730 gene ilvD 104621 106408 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203429.1 protein_id gnl|my_center|LOCUS_00730 106429 108150 gene locus_tag LOCUS_00740 gene ilvB 106429 108150 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790701.1 protein_id gnl|my_center|LOCUS_00740 108156 108731 gene locus_tag LOCUS_00750 gene ilvN 108156 108731 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761035.1 protein_id gnl|my_center|LOCUS_00750 108763 109806 gene locus_tag LOCUS_00760 gene ilvC 108763 109806 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790693.1 protein_id gnl|my_center|LOCUS_00760 109820 111313 gene locus_tag LOCUS_00770 109820 111313 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763196.1 protein_id gnl|my_center|LOCUS_00770 111325 112719 gene locus_tag LOCUS_00780 gene leuC 111325 112719 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799043.1 protein_id gnl|my_center|LOCUS_00780 112716 113315 gene locus_tag LOCUS_00790 gene leuD 112716 113315 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763198.1 protein_id gnl|my_center|LOCUS_00790 113312 114835 gene locus_tag LOCUS_00800 113312 114835 CDS product alpha-isopropylmalate synthase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789843.1 protein_id gnl|my_center|LOCUS_00800 114832 115881 gene locus_tag LOCUS_00810 gene leuB 114832 115881 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789841.1 protein_id gnl|my_center|LOCUS_00810 115888 116928 gene locus_tag LOCUS_00820 115888 116928 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791729.1 protein_id gnl|my_center|LOCUS_00820 116925 117686 gene locus_tag LOCUS_00830 116925 117686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 118833 117655 gene locus_tag LOCUS_00840 118833 117655 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992045.1 protein_id gnl|my_center|LOCUS_00840 >Feature sequence002 264 1739 gene locus_tag LOCUS_00850 264 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 1899 1720 gene locus_tag LOCUS_00860 1899 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 3257 1896 gene locus_tag LOCUS_00870 gene xseA 3257 1896 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203547.1 protein_id gnl|my_center|LOCUS_00870 3304 3924 gene locus_tag LOCUS_00880 gene yihA 3304 3924 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765852.1 protein_id gnl|my_center|LOCUS_00880 3932 4903 gene locus_tag LOCUS_00890 3932 4903 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_00890 4911 5177 gene locus_tag LOCUS_00900 4911 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 5191 6501 gene locus_tag LOCUS_00910 gene der 5191 6501 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782289.1 protein_id gnl|my_center|LOCUS_00910 6514 7176 gene locus_tag LOCUS_00920 6514 7176 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767802.1 protein_id gnl|my_center|LOCUS_00920 7182 8003 gene locus_tag LOCUS_00930 7182 8003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 8008 9057 gene locus_tag LOCUS_00940 8008 9057 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796526.1 protein_id gnl|my_center|LOCUS_00940 12051 9058 gene locus_tag LOCUS_00950 12051 9058 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_00950 12687 12133 gene locus_tag LOCUS_00960 gene ruvC 12687 12133 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962385.1 protein_id gnl|my_center|LOCUS_00960 13977 12706 gene locus_tag LOCUS_00970 gene serS 13977 12706 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759982.1 protein_id gnl|my_center|LOCUS_00970 14334 14074 gene locus_tag LOCUS_00980 gene rpmA 14334 14074 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759983.1 protein_id gnl|my_center|LOCUS_00980 14663 14352 gene locus_tag LOCUS_00990 gene rplU 14663 14352 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759984.1 protein_id gnl|my_center|LOCUS_00990 16376 16068 gene locus_tag LOCUS_01000 16376 16068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 16903 16415 gene locus_tag LOCUS_01010 16903 16415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 17694 16975 gene locus_tag LOCUS_01020 17694 16975 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108550.1 protein_id gnl|my_center|LOCUS_01020 18845 17691 gene locus_tag LOCUS_01030 18845 17691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 18954 19148 gene locus_tag LOCUS_01040 gene rpsU 18954 19148 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782152.1 protein_id gnl|my_center|LOCUS_01040 19242 22685 gene locus_tag LOCUS_01050 19242 22685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 22682 23419 gene locus_tag LOCUS_01060 22682 23419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 24181 23483 gene locus_tag LOCUS_01070 24181 23483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 24677 24596 gene locus_tag LOCUS_t00020 24677 24596 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 25854 24727 gene locus_tag LOCUS_01080 25854 24727 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039954.1 protein_id gnl|my_center|LOCUS_01080 26792 25851 gene locus_tag LOCUS_01090 26792 25851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 26949 26874 gene locus_tag LOCUS_t00030 26949 26874 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 27035 28015 gene locus_tag LOCUS_01100 27035 28015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 28048 28548 gene locus_tag LOCUS_01110 28048 28548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 30626 28554 gene locus_tag LOCUS_01120 30626 28554 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203461.1 protein_id gnl|my_center|LOCUS_01120 30735 31982 gene locus_tag LOCUS_01130 30735 31982 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761719.1 protein_id gnl|my_center|LOCUS_01130 32788 31952 gene locus_tag LOCUS_01140 gene trmB 32788 31952 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840567.1 protein_id gnl|my_center|LOCUS_01140 33233 32775 gene locus_tag LOCUS_01150 33233 32775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 34409 33237 gene locus_tag LOCUS_01160 34409 33237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 35508 34414 gene locus_tag LOCUS_01170 35508 34414 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799206.1 protein_id gnl|my_center|LOCUS_01170 36510 35521 gene locus_tag LOCUS_01180 36510 35521 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403976.1 protein_id gnl|my_center|LOCUS_01180 36905 36507 gene locus_tag LOCUS_01190 36905 36507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 37721 37053 gene locus_tag LOCUS_01200 37721 37053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 38056 37742 gene locus_tag LOCUS_01210 gene trxA 38056 37742 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784741.1 protein_id gnl|my_center|LOCUS_01210 38409 38116 gene locus_tag LOCUS_01220 38409 38116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 41507 38406 gene locus_tag LOCUS_01230 41507 38406 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804147.1 protein_id gnl|my_center|LOCUS_01230 42570 41521 gene locus_tag LOCUS_01240 42570 41521 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791602.1 protein_id gnl|my_center|LOCUS_01240 44071 42587 gene locus_tag LOCUS_01250 44071 42587 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184492906.1 protein_id gnl|my_center|LOCUS_01250 45109 44219 gene locus_tag LOCUS_01260 gene lgt 45109 44219 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108644.1 protein_id gnl|my_center|LOCUS_01260 46456 45203 gene locus_tag LOCUS_01270 46456 45203 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203214.1 protein_id gnl|my_center|LOCUS_01270 46561 47472 gene locus_tag LOCUS_01280 46561 47472 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_01280 47696 49714 gene locus_tag LOCUS_01290 47696 49714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 52836 49717 gene locus_tag LOCUS_01300 52836 49717 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_01300 52898 53245 gene locus_tag LOCUS_01310 52898 53245 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764143.1 protein_id gnl|my_center|LOCUS_01310 53247 53885 gene locus_tag LOCUS_01320 53247 53885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 53913 54656 gene locus_tag LOCUS_01330 53913 54656 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_01330 54656 55033 gene locus_tag LOCUS_01340 54656 55033 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986822.1 protein_id gnl|my_center|LOCUS_01340 55017 55277 gene locus_tag LOCUS_01350 gene yidD 55017 55277 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032814320.1 protein_id gnl|my_center|LOCUS_01350 55310 55990 gene locus_tag LOCUS_01360 gene ubiE 55310 55990 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764422.1 protein_id gnl|my_center|LOCUS_01360 56427 55987 gene locus_tag LOCUS_01370 56427 55987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 56495 57364 gene locus_tag LOCUS_01380 56495 57364 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764707.1 protein_id gnl|my_center|LOCUS_01380 57784 57377 gene locus_tag LOCUS_01390 57784 57377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 >Feature sequence003 2371 179 gene locus_tag LOCUS_01400 2371 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 3950 2400 gene locus_tag LOCUS_01410 gene purH 3950 2400 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244516.1 protein_id gnl|my_center|LOCUS_01410 4538 3963 gene locus_tag LOCUS_01420 gene purN 4538 3963 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088592.1 protein_id gnl|my_center|LOCUS_01420 5608 4538 gene locus_tag LOCUS_01430 gene purM 5608 4538 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081095.1 protein_id gnl|my_center|LOCUS_01430 7295 5697 gene locus_tag LOCUS_01440 7295 5697 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_01440 7381 8517 gene locus_tag LOCUS_01450 7381 8517 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583627.1 protein_id gnl|my_center|LOCUS_01450 8514 9146 gene locus_tag LOCUS_01460 8514 9146 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108650.1 protein_id gnl|my_center|LOCUS_01460 9130 9783 gene locus_tag LOCUS_01470 9130 9783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 9787 11460 gene locus_tag LOCUS_01480 9787 11460 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108622.1 protein_id gnl|my_center|LOCUS_01480 12453 11443 gene locus_tag LOCUS_01490 12453 11443 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_01490 14153 12450 gene locus_tag LOCUS_01500 14153 12450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 15212 14184 gene locus_tag LOCUS_01510 15212 14184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 17044 15248 gene locus_tag LOCUS_01520 17044 15248 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107216.1 protein_id gnl|my_center|LOCUS_01520 19870 17057 gene locus_tag LOCUS_01530 19870 17057 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767553.1 protein_id gnl|my_center|LOCUS_01530 21722 19887 gene locus_tag LOCUS_01540 21722 19887 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760650.1 protein_id gnl|my_center|LOCUS_01540 24914 21792 gene locus_tag LOCUS_01550 24914 21792 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107218.1 protein_id gnl|my_center|LOCUS_01550 26375 24945 gene locus_tag LOCUS_01560 26375 24945 CDS product BNR-4 repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921364.1 protein_id gnl|my_center|LOCUS_01560 28250 26403 gene locus_tag LOCUS_01570 28250 26403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 29523 28294 gene locus_tag LOCUS_01580 29523 28294 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201856.1 protein_id gnl|my_center|LOCUS_01580 30923 29691 gene locus_tag LOCUS_01590 30923 29691 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767192.1 protein_id gnl|my_center|LOCUS_01590 34233 30961 gene locus_tag LOCUS_01600 34233 30961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 35168 34248 gene locus_tag LOCUS_01610 35168 34248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 36114 35188 gene locus_tag LOCUS_01620 36114 35188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 37887 36157 gene locus_tag LOCUS_01630 37887 36157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 38056 39165 gene locus_tag LOCUS_01640 38056 39165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 39196 41154 gene locus_tag LOCUS_01650 39196 41154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 41177 42475 gene locus_tag LOCUS_01660 41177 42475 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118023.1 protein_id gnl|my_center|LOCUS_01660 42558 44075 gene locus_tag LOCUS_01670 42558 44075 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082990.1 protein_id gnl|my_center|LOCUS_01670 45036 44050 gene locus_tag LOCUS_01680 45036 44050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 47079 46483 gene locus_tag LOCUS_01690 47079 46483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 49578 47203 gene locus_tag LOCUS_01700 gene feoB 49578 47203 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065727.1 protein_id gnl|my_center|LOCUS_01700 51560 49659 gene locus_tag LOCUS_01710 51560 49659 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_01710 <52111 51565 gene locus_tag LOCUS_01720 <52111 51565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962436.1:deoxynucleoside kinase >Feature sequence004 283 3561 gene locus_tag LOCUS_01730 283 3561 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_01730 3577 5184 gene locus_tag LOCUS_01740 3577 5184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 5305 7281 gene locus_tag LOCUS_01750 5305 7281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 7425 10010 gene locus_tag LOCUS_01760 7425 10010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 10007 11197 gene locus_tag LOCUS_01770 10007 11197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 11232 12281 gene locus_tag LOCUS_01780 11232 12281 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767132.1 protein_id gnl|my_center|LOCUS_01780 12285 15170 gene locus_tag LOCUS_01790 12285 15170 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762511.1 protein_id gnl|my_center|LOCUS_01790 15183 16226 gene locus_tag LOCUS_01800 15183 16226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 17843 16242 gene locus_tag LOCUS_01810 17843 16242 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704217.1 protein_id gnl|my_center|LOCUS_01810 19322 17850 gene locus_tag LOCUS_01820 19322 17850 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203233.1 protein_id gnl|my_center|LOCUS_01820 19377 21341 gene locus_tag LOCUS_01830 19377 21341 CDS product heparinase II/III-family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201967.1 protein_id gnl|my_center|LOCUS_01830 21408 22115 gene locus_tag LOCUS_01840 21408 22115 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582813.1 protein_id gnl|my_center|LOCUS_01840 22148 23341 gene locus_tag LOCUS_01850 gene purT 22148 23341 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092658.1 protein_id gnl|my_center|LOCUS_01850 23368 24294 gene locus_tag LOCUS_01860 23368 24294 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785907.1 protein_id gnl|my_center|LOCUS_01860 24325 25227 gene locus_tag LOCUS_01870 24325 25227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039948.1 protein_id gnl|my_center|LOCUS_01870 25202 25627 gene locus_tag LOCUS_01880 25202 25627 CDS product S24/S26 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107087.1 protein_id gnl|my_center|LOCUS_01880 25624 25893 gene locus_tag LOCUS_01890 25624 25893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 25890 27530 gene locus_tag LOCUS_01900 25890 27530 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107086.1 protein_id gnl|my_center|LOCUS_01900 27583 27912 gene locus_tag LOCUS_01910 27583 27912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 27951 29984 gene locus_tag LOCUS_01920 27951 29984 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962686.1 protein_id gnl|my_center|LOCUS_01920 30378 29995 gene locus_tag LOCUS_01930 30378 29995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 31611 30478 gene locus_tag LOCUS_01940 31611 30478 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005834079.1 protein_id gnl|my_center|LOCUS_01940 31858 32199 gene locus_tag LOCUS_01950 31858 32199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 32475 32390 gene locus_tag LOCUS_t00040 32475 32390 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 33107 32481 gene locus_tag LOCUS_01960 33107 32481 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787678.1 protein_id gnl|my_center|LOCUS_01960 33587 33159 gene locus_tag LOCUS_01970 33587 33159 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777736.1 protein_id gnl|my_center|LOCUS_01970 37054 33608 gene locus_tag LOCUS_01980 gene ileS 37054 33608 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202809.1 protein_id gnl|my_center|LOCUS_01980 37158 37652 gene locus_tag LOCUS_01990 37158 37652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 37790 38344 gene locus_tag LOCUS_02000 gene tsaB 37790 38344 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790587.1 protein_id gnl|my_center|LOCUS_02000 38356 38790 gene locus_tag LOCUS_02010 gene rpiB 38356 38790 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786501.1 protein_id gnl|my_center|LOCUS_02010 38798 39682 gene locus_tag LOCUS_02020 gene truB 38798 39682 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762820.1 protein_id gnl|my_center|LOCUS_02020 40689 39679 gene locus_tag LOCUS_02030 40689 39679 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785727.1 protein_id gnl|my_center|LOCUS_02030 40879 41829 gene locus_tag LOCUS_02040 40879 41829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 42497 41835 gene locus_tag LOCUS_02050 42497 41835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 45014 42537 gene locus_tag LOCUS_02060 45014 42537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 45701 45039 gene locus_tag LOCUS_02070 45701 45039 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964113.1 protein_id gnl|my_center|LOCUS_02070 48893 45777 gene locus_tag LOCUS_02080 48893 45777 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202755.1 protein_id gnl|my_center|LOCUS_02080 <49636 48890 gene locus_tag LOCUS_02090 <49636 48890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202754.1:PD-(D/E)XK nuclease family protein >Feature sequence005 4025 1269 gene locus_tag LOCUS_02100 4025 1269 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203455.1 protein_id gnl|my_center|LOCUS_02100 4065 5195 gene locus_tag LOCUS_02110 4065 5195 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840465.1 protein_id gnl|my_center|LOCUS_02110 5504 6931 gene locus_tag LOCUS_02120 gene dnaA 5504 6931 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099187.1 protein_id gnl|my_center|LOCUS_02120 6984 8411 gene locus_tag LOCUS_02130 6984 8411 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767909.1 protein_id gnl|my_center|LOCUS_02130 8425 9081 gene locus_tag LOCUS_02140 gene rpe 8425 9081 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813194.1 protein_id gnl|my_center|LOCUS_02140 9820 9074 gene locus_tag LOCUS_02150 9820 9074 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016268654.1 protein_id gnl|my_center|LOCUS_02150 9885 10277 gene locus_tag LOCUS_02160 gene rsfS 9885 10277 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_02160 10270 12240 gene locus_tag LOCUS_02170 gene ftsH 10270 12240 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962764.1 protein_id gnl|my_center|LOCUS_02170 12233 13063 gene locus_tag LOCUS_02180 12233 13063 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796208.1 protein_id gnl|my_center|LOCUS_02180 13074 13733 gene locus_tag LOCUS_02190 13074 13733 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_02190 15101 13743 gene locus_tag LOCUS_02200 15101 13743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 15927 15088 gene locus_tag LOCUS_02210 15927 15088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 17730 15934 gene locus_tag LOCUS_02220 17730 15934 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108779.1 protein_id gnl|my_center|LOCUS_02220 19966 17738 gene locus_tag LOCUS_02230 19966 17738 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796220.1 protein_id gnl|my_center|LOCUS_02230 22044 19972 gene locus_tag LOCUS_02240 gene ligA 22044 19972 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765723.1 protein_id gnl|my_center|LOCUS_02240 22152 23381 gene locus_tag LOCUS_02250 gene pfp 22152 23381 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870466.1 protein_id gnl|my_center|LOCUS_02250 24319 23480 gene locus_tag LOCUS_02260 24319 23480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 25032 24325 gene locus_tag LOCUS_02270 25032 24325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 26190 25066 gene locus_tag LOCUS_02280 26190 25066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_02280 26338 27417 gene locus_tag LOCUS_02290 26338 27417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 27410 28684 gene locus_tag LOCUS_02300 gene codB 27410 28684 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986589.1 protein_id gnl|my_center|LOCUS_02300 28696 29364 gene locus_tag LOCUS_02310 28696 29364 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786661.1 protein_id gnl|my_center|LOCUS_02310 29361 30998 gene locus_tag LOCUS_02320 29361 30998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 32365 30995 gene locus_tag LOCUS_02330 32365 30995 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765636.1 protein_id gnl|my_center|LOCUS_02330 35296 32369 gene locus_tag LOCUS_02340 35296 32369 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_02340 36072 35308 gene locus_tag LOCUS_02350 36072 35308 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787685.1 protein_id gnl|my_center|LOCUS_02350 37480 36080 gene locus_tag LOCUS_02360 37480 36080 CDS product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963818.1 protein_id gnl|my_center|LOCUS_02360 37574 39793 gene locus_tag LOCUS_02370 37574 39793 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107463.1 protein_id gnl|my_center|LOCUS_02370 41069 39804 gene locus_tag LOCUS_02380 41069 39804 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765915.1 protein_id gnl|my_center|LOCUS_02380 >Feature sequence006 1128 2135 gene locus_tag LOCUS_02390 1128 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 2143 3993 gene locus_tag LOCUS_02400 2143 3993 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_02400 4006 4653 gene locus_tag LOCUS_02410 4006 4653 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762936.1 protein_id gnl|my_center|LOCUS_02410 4657 7719 gene locus_tag LOCUS_02420 4657 7719 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201996.1 protein_id gnl|my_center|LOCUS_02420 8823 7723 gene locus_tag LOCUS_02430 8823 7723 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794948.1 protein_id gnl|my_center|LOCUS_02430 8934 12176 gene locus_tag LOCUS_02440 8934 12176 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765775.1 protein_id gnl|my_center|LOCUS_02440 12187 12888 gene locus_tag LOCUS_02450 12187 12888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 12892 13962 gene locus_tag LOCUS_02460 12892 13962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 13967 15001 gene locus_tag LOCUS_02470 13967 15001 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880213.1 protein_id gnl|my_center|LOCUS_02470 15001 15336 gene locus_tag LOCUS_02480 15001 15336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 15333 17156 gene locus_tag LOCUS_02490 15333 17156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 17180 19255 gene locus_tag LOCUS_02500 17180 19255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 20409 19243 gene locus_tag LOCUS_02510 20409 19243 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107930.1 protein_id gnl|my_center|LOCUS_02510 20529 21758 gene locus_tag LOCUS_02520 20529 21758 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767198.1 protein_id gnl|my_center|LOCUS_02520 21772 22251 gene locus_tag LOCUS_02530 21772 22251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 22262 22570 gene locus_tag LOCUS_02540 22262 22570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 22616 23608 gene locus_tag LOCUS_02550 gene obgE 22616 23608 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785536.1 protein_id gnl|my_center|LOCUS_02550 23587 24255 gene locus_tag LOCUS_02560 23587 24255 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789818.1 protein_id gnl|my_center|LOCUS_02560 25570 24239 gene locus_tag LOCUS_02570 25570 24239 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108918.1 protein_id gnl|my_center|LOCUS_02570 26011 25577 gene locus_tag LOCUS_02580 gene dut 26011 25577 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767650.1 protein_id gnl|my_center|LOCUS_02580 27155 26001 gene locus_tag LOCUS_02590 27155 26001 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765567.1 protein_id gnl|my_center|LOCUS_02590 28367 27255 gene locus_tag LOCUS_02600 28367 27255 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787732.1 protein_id gnl|my_center|LOCUS_02600 29496 28351 gene locus_tag LOCUS_02610 gene tgt 29496 28351 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202814.1 protein_id gnl|my_center|LOCUS_02610 29581 30906 gene locus_tag LOCUS_02620 29581 30906 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760003.1 protein_id gnl|my_center|LOCUS_02620 31276 30872 gene locus_tag LOCUS_02630 31276 30872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 31510 31857 gene locus_tag LOCUS_02640 gene ssb 31510 31857 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361980.1 protein_id gnl|my_center|LOCUS_02640 33459 32272 gene locus_tag LOCUS_02650 33459 32272 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202847.1 protein_id gnl|my_center|LOCUS_02650 34576 33485 gene locus_tag LOCUS_02660 gene rfbB 34576 33485 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766020.1 protein_id gnl|my_center|LOCUS_02660 35121 34573 gene locus_tag LOCUS_02670 gene rfbC 35121 34573 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107717.1 protein_id gnl|my_center|LOCUS_02670 35993 35124 gene locus_tag LOCUS_02680 gene rfbA 35993 35124 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202141.1 protein_id gnl|my_center|LOCUS_02680 36863 36015 gene locus_tag LOCUS_02690 gene rfbD 36863 36015 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107282.1 protein_id gnl|my_center|LOCUS_02690 36937 37443 gene locus_tag LOCUS_02700 gene rnhA 36937 37443 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937992.1 protein_id gnl|my_center|LOCUS_02700 37471 38520 gene locus_tag LOCUS_02710 gene pdxA 37471 38520 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785465.1 protein_id gnl|my_center|LOCUS_02710 <40487 38530 gene locus_tag LOCUS_02720 <40487 38530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_172726565.1:ATP-dependent DNA helicase RecG >Feature sequence007 1329 151 gene locus_tag LOCUS_02730 1329 151 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949005.1 protein_id gnl|my_center|LOCUS_02730 3037 1370 gene locus_tag LOCUS_02740 3037 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 5137 3047 gene locus_tag LOCUS_02750 5137 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 7221 5134 gene locus_tag LOCUS_02760 7221 5134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 7799 7218 gene locus_tag LOCUS_02770 gene lpcA 7799 7218 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095727.1 protein_id gnl|my_center|LOCUS_02770 8773 7796 gene locus_tag LOCUS_02780 8773 7796 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_02780 11190 8779 gene locus_tag LOCUS_02790 11190 8779 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584148.1 protein_id gnl|my_center|LOCUS_02790 11955 11326 gene locus_tag LOCUS_02800 11955 11326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 12075 13508 gene locus_tag LOCUS_02810 12075 13508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 13511 14341 gene locus_tag LOCUS_02820 13511 14341 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761827.1 protein_id gnl|my_center|LOCUS_02820 15227 14346 gene locus_tag LOCUS_02830 15227 14346 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784150.1 protein_id gnl|my_center|LOCUS_02830 16670 15243 gene locus_tag LOCUS_02840 16670 15243 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108647.1 protein_id gnl|my_center|LOCUS_02840 16824 19661 gene locus_tag LOCUS_02850 16824 19661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 19686 21542 gene locus_tag LOCUS_02860 19686 21542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 21552 23414 gene locus_tag LOCUS_02870 21552 23414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 23435 24622 gene locus_tag LOCUS_02880 23435 24622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 24631 26640 gene locus_tag LOCUS_02890 24631 26640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 27473 26616 gene locus_tag LOCUS_02900 27473 26616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 29380 27470 gene locus_tag LOCUS_02910 29380 27470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 29459 30091 gene locus_tag LOCUS_02920 29459 30091 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802487.1 protein_id gnl|my_center|LOCUS_02920 30252 31433 gene locus_tag LOCUS_02930 30252 31433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 31528 31602 gene locus_tag LOCUS_t00050 31528 31602 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 31698 32171 gene locus_tag LOCUS_02940 31698 32171 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_02940 32714 32181 gene locus_tag LOCUS_02950 32714 32181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 33720 32719 gene locus_tag LOCUS_02960 33720 32719 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108486.1 protein_id gnl|my_center|LOCUS_02960 39425 33804 gene locus_tag LOCUS_02970 39425 33804 CDS product MG2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202408.1 protein_id gnl|my_center|LOCUS_02970 39527 39793 gene locus_tag LOCUS_02980 39527 39793 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964086.1 protein_id gnl|my_center|LOCUS_02980 >Feature sequence008 1009 1545 gene locus_tag LOCUS_02990 1009 1545 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_02990 1591 2010 gene locus_tag LOCUS_03000 1591 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 2026 2514 gene locus_tag LOCUS_03010 2026 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962782.1 protein_id gnl|my_center|LOCUS_03010 3311 2646 gene locus_tag LOCUS_03020 3311 2646 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202004.1 protein_id gnl|my_center|LOCUS_03020 3381 3455 gene locus_tag LOCUS_t00060 3381 3455 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3482 4066 gene locus_tag LOCUS_03030 3482 4066 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812910.1 protein_id gnl|my_center|LOCUS_03030 4063 5718 gene locus_tag LOCUS_03040 4063 5718 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042338789.1 protein_id gnl|my_center|LOCUS_03040 7915 5723 gene locus_tag LOCUS_03050 7915 5723 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_03050 8730 8092 gene locus_tag LOCUS_03060 8730 8092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 9022 10008 gene locus_tag LOCUS_03070 9022 10008 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763609.1 protein_id gnl|my_center|LOCUS_03070 10204 11880 gene locus_tag LOCUS_03080 10204 11880 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108843.1 protein_id gnl|my_center|LOCUS_03080 11877 13079 gene locus_tag LOCUS_03090 11877 13079 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108845.1 protein_id gnl|my_center|LOCUS_03090 13088 13516 gene locus_tag LOCUS_03100 gene tsaE 13088 13516 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784762.1 protein_id gnl|my_center|LOCUS_03100 13509 15059 gene locus_tag LOCUS_03110 13509 15059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 16653 15061 gene locus_tag LOCUS_03120 16653 15061 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761917.1 protein_id gnl|my_center|LOCUS_03120 16805 18535 gene locus_tag LOCUS_03130 16805 18535 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791317.1 protein_id gnl|my_center|LOCUS_03130 21278 18546 gene locus_tag LOCUS_03140 21278 18546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 22004 21306 gene locus_tag LOCUS_03150 22004 21306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 23035 22013 gene locus_tag LOCUS_03160 23035 22013 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_03160 24018 23032 gene locus_tag LOCUS_03170 24018 23032 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_03170 25037 24018 gene locus_tag LOCUS_03180 25037 24018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 25930 25034 gene locus_tag LOCUS_03190 25930 25034 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_03190 26929 25937 gene locus_tag LOCUS_03200 26929 25937 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_03200 26973 27743 gene locus_tag LOCUS_03210 gene truA 26973 27743 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785168.1 protein_id gnl|my_center|LOCUS_03210 27821 28546 gene locus_tag LOCUS_03220 27821 28546 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_03220 28563 28973 gene locus_tag LOCUS_03230 28563 28973 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760840.1 protein_id gnl|my_center|LOCUS_03230 28970 29746 gene locus_tag LOCUS_03240 28970 29746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 29794 31212 gene locus_tag LOCUS_03250 29794 31212 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791757.1 protein_id gnl|my_center|LOCUS_03250 31205 32107 gene locus_tag LOCUS_03260 gene era 31205 32107 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203581.1 protein_id gnl|my_center|LOCUS_03260 32140 35055 gene locus_tag LOCUS_03270 32140 35055 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696320.1 protein_id gnl|my_center|LOCUS_03270 35067 35612 gene locus_tag LOCUS_03280 35067 35612 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632876.1 protein_id gnl|my_center|LOCUS_03280 37530 35626 gene locus_tag LOCUS_03290 37530 35626 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_03290 <38231 37544 gene locus_tag LOCUS_03300 <38231 37544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203525.1:single-stranded-DNA-specific exonuclease RecJ >Feature sequence009 3930 1336 gene locus_tag LOCUS_03310 3930 1336 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108733.1 protein_id gnl|my_center|LOCUS_03310 5468 3939 gene locus_tag LOCUS_03320 5468 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 6292 5495 gene locus_tag LOCUS_03330 6292 5495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 7845 6298 gene locus_tag LOCUS_03340 7845 6298 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108730.1 protein_id gnl|my_center|LOCUS_03340 10954 7859 gene locus_tag LOCUS_03350 10954 7859 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303104.1 protein_id gnl|my_center|LOCUS_03350 12172 11087 gene locus_tag LOCUS_03360 12172 11087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 12396 12169 gene locus_tag LOCUS_03370 12396 12169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 12804 13685 gene locus_tag LOCUS_03380 12804 13685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 13708 13848 gene locus_tag LOCUS_03390 13708 13848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 14367 15827 gene locus_tag LOCUS_03400 14367 15827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 15847 17283 gene locus_tag LOCUS_03410 15847 17283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 17299 18915 gene locus_tag LOCUS_03420 17299 18915 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084146450.1 protein_id gnl|my_center|LOCUS_03420 18977 19285 gene locus_tag LOCUS_03430 18977 19285 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871778.1 protein_id gnl|my_center|LOCUS_03430 19282 20373 gene locus_tag LOCUS_03440 19282 20373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 20381 21043 gene locus_tag LOCUS_03450 20381 21043 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_03450 21036 22454 gene locus_tag LOCUS_03460 21036 22454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 22467 24650 gene locus_tag LOCUS_03470 22467 24650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 26537 24657 gene locus_tag LOCUS_03480 26537 24657 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681492.1 protein_id gnl|my_center|LOCUS_03480 26638 28761 gene locus_tag LOCUS_03490 26638 28761 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962553.1 protein_id gnl|my_center|LOCUS_03490 29791 28754 gene locus_tag LOCUS_03500 29791 28754 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791729.1 protein_id gnl|my_center|LOCUS_03500 30866 29805 gene locus_tag LOCUS_03510 gene leuB 30866 29805 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789841.1 protein_id gnl|my_center|LOCUS_03510 >Feature sequence010 <1 1063 gene locus_tag LOCUS_03520 <1 1063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764424.1:flotillin family protein 1068 1271 gene locus_tag LOCUS_03530 1068 1271 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231396.1 protein_id gnl|my_center|LOCUS_03530 1275 2222 gene locus_tag LOCUS_03540 1275 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 2227 4311 gene locus_tag LOCUS_03550 2227 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 4318 5961 gene locus_tag LOCUS_03560 4318 5961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 7050 5962 gene locus_tag LOCUS_03570 7050 5962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 7897 7058 gene locus_tag LOCUS_03580 7897 7058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 8009 8272 gene locus_tag LOCUS_03590 8009 8272 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974619.1 protein_id gnl|my_center|LOCUS_03590 8295 11102 gene locus_tag LOCUS_03600 8295 11102 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109196.1 protein_id gnl|my_center|LOCUS_03600 11340 11170 gene locus_tag LOCUS_03610 11340 11170 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784522.1 protein_id gnl|my_center|LOCUS_03610 12492 11413 gene locus_tag LOCUS_03620 12492 11413 CDS product putative manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263666.1 protein_id gnl|my_center|LOCUS_03620 13690 12503 gene locus_tag LOCUS_03630 13690 12503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 13832 15766 gene locus_tag LOCUS_03640 13832 15766 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783474.1 protein_id gnl|my_center|LOCUS_03640 15772 16329 gene locus_tag LOCUS_03650 15772 16329 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766193.1 protein_id gnl|my_center|LOCUS_03650 16342 18018 gene locus_tag LOCUS_03660 16342 18018 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680032.1 protein_id gnl|my_center|LOCUS_03660 18011 20203 gene locus_tag LOCUS_03670 18011 20203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 20724 20281 gene locus_tag LOCUS_03680 gene rplI 20724 20281 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933786.1 protein_id gnl|my_center|LOCUS_03680 21017 20739 gene locus_tag LOCUS_03690 gene rpsR 21017 20739 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759740.1 protein_id gnl|my_center|LOCUS_03690 21466 21035 gene locus_tag LOCUS_03700 21466 21035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 23030 21576 gene locus_tag LOCUS_03710 23030 21576 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784872.1 protein_id gnl|my_center|LOCUS_03710 24086 23052 gene locus_tag LOCUS_03720 24086 23052 CDS product DUF4831 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202253.1 protein_id gnl|my_center|LOCUS_03720 25015 24110 gene locus_tag LOCUS_03730 25015 24110 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759751.1 protein_id gnl|my_center|LOCUS_03730 25148 26830 gene locus_tag LOCUS_03740 25148 26830 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788185.1 protein_id gnl|my_center|LOCUS_03740 26838 27443 gene locus_tag LOCUS_03750 26838 27443 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_03750 27443 28885 gene locus_tag LOCUS_03760 27443 28885 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767052.1 protein_id gnl|my_center|LOCUS_03760 28882 30246 gene locus_tag LOCUS_03770 28882 30246 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762594.1 protein_id gnl|my_center|LOCUS_03770 30284 30880 gene locus_tag LOCUS_03780 30284 30880 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790721.1 protein_id gnl|my_center|LOCUS_03780 >Feature sequence011 2357 855 gene locus_tag LOCUS_03790 2357 855 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202802.1 protein_id gnl|my_center|LOCUS_03790 3086 2364 gene locus_tag LOCUS_03800 3086 2364 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787639.1 protein_id gnl|my_center|LOCUS_03800 3555 4001 gene locus_tag LOCUS_03810 3555 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 4251 4637 gene locus_tag LOCUS_03820 4251 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 7343 4926 gene locus_tag LOCUS_03830 7343 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 9229 7346 gene locus_tag LOCUS_03840 9229 7346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 9354 11219 gene locus_tag LOCUS_03850 9354 11219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 11227 11763 gene locus_tag LOCUS_03860 11227 11763 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802804.1 protein_id gnl|my_center|LOCUS_03860 11772 12374 gene locus_tag LOCUS_03870 11772 12374 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_03870 12392 14047 gene locus_tag LOCUS_03880 12392 14047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 14059 14757 gene locus_tag LOCUS_03890 14059 14757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 17901 14905 gene locus_tag LOCUS_03900 17901 14905 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_03900 18966 17998 gene locus_tag LOCUS_03910 18966 17998 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763623.1 protein_id gnl|my_center|LOCUS_03910 20235 18973 gene locus_tag LOCUS_03920 20235 18973 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760657.1 protein_id gnl|my_center|LOCUS_03920 21463 20552 gene locus_tag LOCUS_03930 21463 20552 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789684.1 protein_id gnl|my_center|LOCUS_03930 21639 23159 gene locus_tag LOCUS_03940 21639 23159 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791704.1 protein_id gnl|my_center|LOCUS_03940 23176 24165 gene locus_tag LOCUS_03950 23176 24165 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109013.1 protein_id gnl|my_center|LOCUS_03950 24190 25359 gene locus_tag LOCUS_03960 24190 25359 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791708.1 protein_id gnl|my_center|LOCUS_03960 25364 26638 gene locus_tag LOCUS_03970 25364 26638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 >Feature sequence012 1866 985 gene locus_tag LOCUS_03980 1866 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 1940 3073 gene locus_tag LOCUS_03990 1940 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 3740 3078 gene locus_tag LOCUS_04000 3740 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 3884 3813 gene locus_tag LOCUS_t00070 3884 3813 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 4101 7118 gene locus_tag LOCUS_04010 4101 7118 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202212.1 protein_id gnl|my_center|LOCUS_04010 7125 8714 gene locus_tag LOCUS_04020 7125 8714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 8719 9201 gene locus_tag LOCUS_04030 8719 9201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 9228 10790 gene locus_tag LOCUS_04040 9228 10790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 10891 12102 gene locus_tag LOCUS_04050 10891 12102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 12115 13377 gene locus_tag LOCUS_04060 12115 13377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 14577 13381 gene locus_tag LOCUS_04070 14577 13381 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_04070 15175 14549 gene locus_tag LOCUS_04080 15175 14549 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785374.1 protein_id gnl|my_center|LOCUS_04080 16070 15195 gene locus_tag LOCUS_04090 16070 15195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 16190 17362 gene locus_tag LOCUS_04100 16190 17362 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963806.1 protein_id gnl|my_center|LOCUS_04100 18858 17878 gene locus_tag LOCUS_04110 18858 17878 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944030.1 protein_id gnl|my_center|LOCUS_04110 19482 18877 gene locus_tag LOCUS_04120 19482 18877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 20240 19518 gene locus_tag LOCUS_04130 20240 19518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 21410 20241 gene locus_tag LOCUS_04140 21410 20241 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789686.1 protein_id gnl|my_center|LOCUS_04140 21969 21430 gene locus_tag LOCUS_04150 21969 21430 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_04150 22022 22885 gene locus_tag LOCUS_04160 22022 22885 CDS product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788900.1 protein_id gnl|my_center|LOCUS_04160 23960 22815 gene locus_tag LOCUS_04170 23960 22815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 25129 23957 gene locus_tag LOCUS_04180 gene lpxB 25129 23957 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764238.1 protein_id gnl|my_center|LOCUS_04180 25911 25126 gene locus_tag LOCUS_04190 gene surE 25911 25126 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764237.1 protein_id gnl|my_center|LOCUS_04190 >Feature sequence013 153 1442 gene locus_tag LOCUS_04200 153 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 3354 1462 gene locus_tag LOCUS_04210 3354 1462 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202069.1 protein_id gnl|my_center|LOCUS_04210 4289 3354 gene locus_tag LOCUS_04220 4289 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 4459 6927 gene locus_tag LOCUS_04230 4459 6927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 6914 7525 gene locus_tag LOCUS_04240 6914 7525 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783983.1 protein_id gnl|my_center|LOCUS_04240 7698 7477 gene locus_tag LOCUS_04250 7698 7477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 8214 7711 gene locus_tag LOCUS_04260 8214 7711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 8365 9282 gene locus_tag LOCUS_04270 8365 9282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 9292 10431 gene locus_tag LOCUS_04280 gene hemW 9292 10431 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460876.1 protein_id gnl|my_center|LOCUS_04280 11484 10585 gene locus_tag LOCUS_04290 gene prmC 11484 10585 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202032.1 protein_id gnl|my_center|LOCUS_04290 12516 11500 gene locus_tag LOCUS_04300 12516 11500 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762649.1 protein_id gnl|my_center|LOCUS_04300 14879 12522 gene locus_tag LOCUS_04310 14879 12522 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107425.1 protein_id gnl|my_center|LOCUS_04310 14999 17317 gene locus_tag LOCUS_04320 gene topA 14999 17317 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791192.1 protein_id gnl|my_center|LOCUS_04320 17372 17896 gene locus_tag LOCUS_04330 17372 17896 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964461.1 protein_id gnl|my_center|LOCUS_04330 18952 17903 gene locus_tag LOCUS_04340 18952 17903 CDS product 2-dehydropantoate 2-reductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066908.1 protein_id gnl|my_center|LOCUS_04340 21071 18957 gene locus_tag LOCUS_04350 21071 18957 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201873.1 protein_id gnl|my_center|LOCUS_04350 22813 21077 gene locus_tag LOCUS_04360 22813 21077 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767963.1 protein_id gnl|my_center|LOCUS_04360 22863 23324 gene locus_tag LOCUS_04370 22863 23324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 23356 24390 gene locus_tag LOCUS_04380 gene pheS 23356 24390 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763378.1 protein_id gnl|my_center|LOCUS_04380 24523 24596 gene locus_tag LOCUS_t00080 24523 24596 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 24910 25338 gene locus_tag LOCUS_04390 24910 25338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 <26245 25433 gene locus_tag LOCUS_04400 <26245 25433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783522.1:cation diffusion facilitator family transporter >Feature sequence014 2082 1123 gene locus_tag LOCUS_04410 2082 1123 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762406.1 protein_id gnl|my_center|LOCUS_04410 4760 2079 gene locus_tag LOCUS_04420 4760 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 6161 4770 gene locus_tag LOCUS_04430 6161 4770 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933914.1 protein_id gnl|my_center|LOCUS_04430 7021 6158 gene locus_tag LOCUS_04440 7021 6158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 8501 7032 gene locus_tag LOCUS_04450 gene guaB 8501 7032 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791859.1 protein_id gnl|my_center|LOCUS_04450 8572 9678 gene locus_tag LOCUS_04460 8572 9678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 11225 9675 gene locus_tag LOCUS_04470 gene dacB 11225 9675 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839168.1 protein_id gnl|my_center|LOCUS_04470 11272 12300 gene locus_tag LOCUS_04480 gene galE 11272 12300 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788150.1 protein_id gnl|my_center|LOCUS_04480 12668 12297 gene locus_tag LOCUS_04490 12668 12297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 13671 12709 gene locus_tag LOCUS_04500 13671 12709 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962688.1 protein_id gnl|my_center|LOCUS_04500 14090 13806 gene locus_tag LOCUS_04510 14090 13806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 15259 14165 gene locus_tag LOCUS_04520 15259 14165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 15357 16244 gene locus_tag LOCUS_04530 15357 16244 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761007.1 protein_id gnl|my_center|LOCUS_04530 16295 16450 gene locus_tag LOCUS_04540 16295 16450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 16457 20026 gene locus_tag LOCUS_04550 16457 20026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 21966 20047 gene locus_tag LOCUS_04560 21966 20047 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109250.1 protein_id gnl|my_center|LOCUS_04560 23200 21986 gene locus_tag LOCUS_04570 23200 21986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 23757 23212 gene locus_tag LOCUS_04580 23757 23212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 24425 23799 gene locus_tag LOCUS_04590 gene def 24425 23799 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116243.1 protein_id gnl|my_center|LOCUS_04590 <25675 24439 gene locus_tag LOCUS_04600 <25675 24439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784538.1:DNA repair protein RadA >Feature sequence015 343 891 gene locus_tag LOCUS_04610 343 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107174.1 protein_id gnl|my_center|LOCUS_04610 1835 888 gene locus_tag LOCUS_04620 1835 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 1904 3304 gene locus_tag LOCUS_04630 1904 3304 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195154.1 protein_id gnl|my_center|LOCUS_04630 3683 3312 gene locus_tag LOCUS_04640 3683 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 4605 3691 gene locus_tag LOCUS_04650 4605 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 4978 4616 gene locus_tag LOCUS_04660 4978 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 5437 6279 gene locus_tag LOCUS_04670 5437 6279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 6272 6829 gene locus_tag LOCUS_04680 6272 6829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 7752 6823 gene locus_tag LOCUS_04690 7752 6823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 7784 8794 gene locus_tag LOCUS_04700 7784 8794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 8855 9562 gene locus_tag LOCUS_04710 gene pyrH 8855 9562 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759596.1 protein_id gnl|my_center|LOCUS_04710 9582 10151 gene locus_tag LOCUS_04720 gene frr 9582 10151 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942563.1 protein_id gnl|my_center|LOCUS_04720 10348 11190 gene locus_tag LOCUS_04730 10348 11190 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760856.1 protein_id gnl|my_center|LOCUS_04730 11195 12388 gene locus_tag LOCUS_04740 11195 12388 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760855.1 protein_id gnl|my_center|LOCUS_04740 12401 13288 gene locus_tag LOCUS_04750 12401 13288 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179240768.1 protein_id gnl|my_center|LOCUS_04750 13310 14404 gene locus_tag LOCUS_04760 13310 14404 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_04760 14682 17669 gene locus_tag LOCUS_04770 14682 17669 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108199.1 protein_id gnl|my_center|LOCUS_04770 17683 19131 gene locus_tag LOCUS_04780 17683 19131 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291422.1 protein_id gnl|my_center|LOCUS_04780 19150 20079 gene locus_tag LOCUS_04790 19150 20079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 20095 21894 gene locus_tag LOCUS_04800 20095 21894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 21980 22636 gene locus_tag LOCUS_04810 21980 22636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 22650 25313 gene locus_tag LOCUS_04820 22650 25313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 >Feature sequence016 515 5803 gene locus_tag LOCUS_04830 515 5803 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072066367.1 protein_id gnl|my_center|LOCUS_04830 5882 5957 gene locus_tag LOCUS_t00090 5882 5957 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6622 6059 gene locus_tag LOCUS_04840 6622 6059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 7333 6812 gene locus_tag LOCUS_04850 7333 6812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 7948 7337 gene locus_tag LOCUS_04860 7948 7337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 8101 10890 gene locus_tag LOCUS_04870 8101 10890 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_04870 10918 11106 gene locus_tag LOCUS_04880 10918 11106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 11160 11480 gene locus_tag LOCUS_04890 11160 11480 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359266.1 protein_id gnl|my_center|LOCUS_04890 11485 12018 gene locus_tag LOCUS_04900 11485 12018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 12023 12442 gene locus_tag LOCUS_04910 12023 12442 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766716.1 protein_id gnl|my_center|LOCUS_04910 12439 13371 gene locus_tag LOCUS_04920 12439 13371 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784893.1 protein_id gnl|my_center|LOCUS_04920 13894 13358 gene locus_tag LOCUS_04930 13894 13358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 14204 13899 gene locus_tag LOCUS_04940 14204 13899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 14740 14204 gene locus_tag LOCUS_04950 14740 14204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 18094 15092 gene locus_tag LOCUS_04960 18094 15092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 18187 18567 gene locus_tag LOCUS_04970 18187 18567 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764760.1 protein_id gnl|my_center|LOCUS_04970 19366 18578 gene locus_tag LOCUS_04980 19366 18578 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938969.1 protein_id gnl|my_center|LOCUS_04980 19478 20278 gene locus_tag LOCUS_04990 19478 20278 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098638.1 protein_id gnl|my_center|LOCUS_04990 20288 21418 gene locus_tag LOCUS_05000 20288 21418 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770127.1 protein_id gnl|my_center|LOCUS_05000 21429 22232 gene locus_tag LOCUS_05010 21429 22232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 22815 22261 gene locus_tag LOCUS_05020 22815 22261 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780311.1 protein_id gnl|my_center|LOCUS_05020 >Feature sequence017 <1 578 gene locus_tag LOCUS_05030 <1 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005782223.1:preprotein translocase subunit SecY 602 1375 gene locus_tag LOCUS_05040 gene map 602 1375 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791569.1 protein_id gnl|my_center|LOCUS_05040 1775 2152 gene locus_tag LOCUS_05050 gene rpsM 1775 2152 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558050.1 protein_id gnl|my_center|LOCUS_05050 2166 2552 gene locus_tag LOCUS_05060 gene rpsK 2166 2552 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963447.1 protein_id gnl|my_center|LOCUS_05060 2573 3175 gene locus_tag LOCUS_05070 gene rpsD 2573 3175 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963446.1 protein_id gnl|my_center|LOCUS_05070 3201 4208 gene locus_tag LOCUS_05080 3201 4208 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963445.1 protein_id gnl|my_center|LOCUS_05080 4271 4684 gene locus_tag LOCUS_05090 4271 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 4775 6967 gene locus_tag LOCUS_05100 4775 6967 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767612.1 protein_id gnl|my_center|LOCUS_05100 7025 8044 gene locus_tag LOCUS_05110 7025 8044 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969874.1 protein_id gnl|my_center|LOCUS_05110 8367 10379 gene locus_tag LOCUS_05120 8367 10379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 11907 10339 gene locus_tag LOCUS_05130 gene cysS 11907 10339 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762954.1 protein_id gnl|my_center|LOCUS_05130 15663 11911 gene locus_tag LOCUS_05140 15663 11911 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775466.1 protein_id gnl|my_center|LOCUS_05140 15912 17327 gene locus_tag LOCUS_05150 15912 17327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 17361 19133 gene locus_tag LOCUS_05160 17361 19133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 19178 22270 gene locus_tag LOCUS_05170 19178 22270 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107780.1 protein_id gnl|my_center|LOCUS_05170 22295 23917 gene locus_tag LOCUS_05180 22295 23917 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768282.1 protein_id gnl|my_center|LOCUS_05180 23918 24799 gene locus_tag LOCUS_05190 23918 24799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 >Feature sequence018 1342 551 gene locus_tag LOCUS_05200 1342 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 1386 2252 gene locus_tag LOCUS_05210 1386 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 3906 2263 gene locus_tag LOCUS_05220 3906 2263 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_05220 3977 5248 gene locus_tag LOCUS_05230 3977 5248 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_05230 7687 5252 gene locus_tag LOCUS_05240 7687 5252 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203147.1 protein_id gnl|my_center|LOCUS_05240 7769 9505 gene locus_tag LOCUS_05250 7769 9505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 10966 9647 gene locus_tag LOCUS_05260 10966 9647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 12336 10999 gene locus_tag LOCUS_05270 12336 10999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 12492 13652 gene locus_tag LOCUS_05280 12492 13652 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203242.1 protein_id gnl|my_center|LOCUS_05280 13657 14634 gene locus_tag LOCUS_05290 13657 14634 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468316.1 protein_id gnl|my_center|LOCUS_05290 14627 15106 gene locus_tag LOCUS_05300 14627 15106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 15145 16317 gene locus_tag LOCUS_05310 gene prfB 15145 16317 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108912216.1 protein_id gnl|my_center|LOCUS_05310 16342 17988 gene locus_tag LOCUS_05320 16342 17988 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813403.1 protein_id gnl|my_center|LOCUS_05320 18045 18347 gene locus_tag LOCUS_05330 18045 18347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 20041 18413 gene locus_tag LOCUS_05340 20041 18413 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766031.1 protein_id gnl|my_center|LOCUS_05340 20169 20819 gene locus_tag LOCUS_05350 20169 20819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 20819 21157 gene locus_tag LOCUS_05360 20819 21157 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813353.1 protein_id gnl|my_center|LOCUS_05360 21154 22194 gene locus_tag LOCUS_05370 21154 22194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 23117 22197 gene locus_tag LOCUS_05380 23117 22197 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109171.1 protein_id gnl|my_center|LOCUS_05380 24161 23124 gene locus_tag LOCUS_05390 gene asnA 24161 23124 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790904.1 protein_id gnl|my_center|LOCUS_05390 >Feature sequence019 2225 897 gene locus_tag LOCUS_05400 gene gcvPA 2225 897 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393441.1 protein_id gnl|my_center|LOCUS_05400 2613 2233 gene locus_tag LOCUS_05410 gene gcvH 2613 2233 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290491.1 protein_id gnl|my_center|LOCUS_05410 3739 2636 gene locus_tag LOCUS_05420 gene gcvT 3739 2636 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_05420 5203 3752 gene locus_tag LOCUS_05430 5203 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 5978 5196 gene locus_tag LOCUS_05440 5978 5196 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295276.1 protein_id gnl|my_center|LOCUS_05440 6458 6051 gene locus_tag LOCUS_05450 6458 6051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 7014 6541 gene locus_tag LOCUS_05460 7014 6541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 7179 8261 gene locus_tag LOCUS_05470 7179 8261 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763724.1 protein_id gnl|my_center|LOCUS_05470 10190 8265 gene locus_tag LOCUS_05480 gene htpG 10190 8265 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765725.1 protein_id gnl|my_center|LOCUS_05480 11037 10309 gene locus_tag LOCUS_05490 11037 10309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 11671 11051 gene locus_tag LOCUS_05500 11671 11051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 13316 11673 gene locus_tag LOCUS_05510 13316 11673 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798215.1 protein_id gnl|my_center|LOCUS_05510 13445 14275 gene locus_tag LOCUS_05520 13445 14275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 15167 14283 gene locus_tag LOCUS_05530 15167 14283 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 protein_id gnl|my_center|LOCUS_05530 16215 15190 gene locus_tag LOCUS_05540 16215 15190 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202849.1 protein_id gnl|my_center|LOCUS_05540 16305 18482 gene locus_tag LOCUS_05550 gene uvrB 16305 18482 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202946.1 protein_id gnl|my_center|LOCUS_05550 18488 19816 gene locus_tag LOCUS_05560 18488 19816 CDS product glycosyl hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109139.1 protein_id gnl|my_center|LOCUS_05560 21003 19810 gene locus_tag LOCUS_05570 21003 19810 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776370.1 protein_id gnl|my_center|LOCUS_05570 22554 21052 gene locus_tag LOCUS_05580 22554 21052 CDS product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180983106.1 protein_id gnl|my_center|LOCUS_05580 23673 22579 gene locus_tag LOCUS_05590 23673 22579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 <24207 23658 gene locus_tag LOCUS_05600 <24207 23658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107233.1:UDP-N-acetyl glucosamine 2-epimerase >Feature sequence020 2029 50 gene locus_tag LOCUS_05610 2029 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 3366 2041 gene locus_tag LOCUS_05620 3366 2041 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767711.1 protein_id gnl|my_center|LOCUS_05620 4574 3381 gene locus_tag LOCUS_05630 gene uxuA 4574 3381 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050396645.1 protein_id gnl|my_center|LOCUS_05630 5403 4579 gene locus_tag LOCUS_05640 5403 4579 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762343.1 protein_id gnl|my_center|LOCUS_05640 6144 5407 gene locus_tag LOCUS_05650 6144 5407 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767111.1 protein_id gnl|my_center|LOCUS_05650 6268 7590 gene locus_tag LOCUS_05660 6268 7590 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767112.1 protein_id gnl|my_center|LOCUS_05660 7599 7856 gene locus_tag LOCUS_05670 7599 7856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055269074.1 protein_id gnl|my_center|LOCUS_05670 8601 7822 gene locus_tag LOCUS_05680 8601 7822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 9892 8615 gene locus_tag LOCUS_05690 9892 8615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 10459 9911 gene locus_tag LOCUS_05700 10459 9911 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760894.1 protein_id gnl|my_center|LOCUS_05700 11061 10456 gene locus_tag LOCUS_05710 11061 10456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 11852 11160 gene locus_tag LOCUS_05720 11852 11160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760896.1 protein_id gnl|my_center|LOCUS_05720 11953 12984 gene locus_tag LOCUS_05730 11953 12984 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760868.1 protein_id gnl|my_center|LOCUS_05730 12981 13535 gene locus_tag LOCUS_05740 12981 13535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 13552 14595 gene locus_tag LOCUS_05750 13552 14595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 14605 15999 gene locus_tag LOCUS_05760 14605 15999 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798170.1 protein_id gnl|my_center|LOCUS_05760 16006 16620 gene locus_tag LOCUS_05770 16006 16620 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_05770 16617 17912 gene locus_tag LOCUS_05780 16617 17912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 19021 17909 gene locus_tag LOCUS_05790 19021 17909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 19878 19027 gene locus_tag LOCUS_05800 gene ptb 19878 19027 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966357.1 protein_id gnl|my_center|LOCUS_05800 21128 19971 gene locus_tag LOCUS_05810 21128 19971 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583303.1 protein_id gnl|my_center|LOCUS_05810 21266 22387 gene locus_tag LOCUS_05820 21266 22387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 23061 22396 gene locus_tag LOCUS_05830 23061 22396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 <24118 23069 gene locus_tag LOCUS_05840 <24118 23069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765513.1:translation elongation factor 4 >Feature sequence021 2274 928 gene locus_tag LOCUS_05850 2274 928 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765874.1 protein_id gnl|my_center|LOCUS_05850 2349 4787 gene locus_tag LOCUS_05860 2349 4787 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202910.1 protein_id gnl|my_center|LOCUS_05860 5001 6101 gene locus_tag LOCUS_05870 5001 6101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 6124 7353 gene locus_tag LOCUS_05880 6124 7353 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659719.1 protein_id gnl|my_center|LOCUS_05880 7397 10540 gene locus_tag LOCUS_05890 7397 10540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 10602 11165 gene locus_tag LOCUS_05900 10602 11165 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022159.1 protein_id gnl|my_center|LOCUS_05900 11688 11224 gene locus_tag LOCUS_05910 11688 11224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 13812 11758 gene locus_tag LOCUS_05920 13812 11758 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555778.1 protein_id gnl|my_center|LOCUS_05920 14215 13817 gene locus_tag LOCUS_05930 14215 13817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 15776 14256 gene locus_tag LOCUS_05940 15776 14256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 15994 15920 gene locus_tag LOCUS_t00100 15994 15920 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 16351 16100 gene locus_tag LOCUS_05950 16351 16100 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963273.1 protein_id gnl|my_center|LOCUS_05950 17487 16423 gene locus_tag LOCUS_05960 17487 16423 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128545.1 protein_id gnl|my_center|LOCUS_05960 18942 17500 gene locus_tag LOCUS_05970 gene glmM 18942 17500 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791020.1 protein_id gnl|my_center|LOCUS_05970 19445 19092 gene locus_tag LOCUS_05980 19445 19092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 19740 19540 gene locus_tag LOCUS_05990 19740 19540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 20506 20066 gene locus_tag LOCUS_06000 20506 20066 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675599.1 protein_id gnl|my_center|LOCUS_06000 22352 20514 gene locus_tag LOCUS_06010 22352 20514 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660668.1 protein_id gnl|my_center|LOCUS_06010 22963 22349 gene locus_tag LOCUS_06020 22963 22349 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788431.1 protein_id gnl|my_center|LOCUS_06020 <23648 22963 gene locus_tag LOCUS_06030 <23648 22963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788433.1:V-type ATP synthase subunit B >Feature sequence022 836 231 gene locus_tag LOCUS_06040 836 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 1784 1074 gene locus_tag LOCUS_06050 1784 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 2163 1942 gene locus_tag LOCUS_06060 2163 1942 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_06060 2332 2919 gene locus_tag LOCUS_06070 gene folE 2332 2919 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932463.1 protein_id gnl|my_center|LOCUS_06070 3042 4040 gene locus_tag LOCUS_06080 gene trpS 3042 4040 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760790.1 protein_id gnl|my_center|LOCUS_06080 4052 4768 gene locus_tag LOCUS_06090 4052 4768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 4794 5456 gene locus_tag LOCUS_06100 4794 5456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789206.1 protein_id gnl|my_center|LOCUS_06100 5458 6582 gene locus_tag LOCUS_06110 5458 6582 CDS product DUF4857 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767083.1 protein_id gnl|my_center|LOCUS_06110 6741 9377 gene locus_tag LOCUS_06120 6741 9377 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203196.1 protein_id gnl|my_center|LOCUS_06120 9374 9766 gene locus_tag LOCUS_06130 9374 9766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 9763 11229 gene locus_tag LOCUS_06140 9763 11229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555797.1 protein_id gnl|my_center|LOCUS_06140 11264 12703 gene locus_tag LOCUS_06150 11264 12703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 12828 13427 gene locus_tag LOCUS_06160 gene upp 12828 13427 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360558.1 protein_id gnl|my_center|LOCUS_06160 13841 13431 gene locus_tag LOCUS_06170 13841 13431 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795574.1 protein_id gnl|my_center|LOCUS_06170 13878 14711 gene locus_tag LOCUS_06180 13878 14711 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765762.1 protein_id gnl|my_center|LOCUS_06180 16121 14718 gene locus_tag LOCUS_06190 16121 14718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 16194 17366 gene locus_tag LOCUS_06200 16194 17366 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808836.1 protein_id gnl|my_center|LOCUS_06200 19408 17363 gene locus_tag LOCUS_06210 19408 17363 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_06210 19640 19413 gene locus_tag LOCUS_06220 19640 19413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 20481 19654 gene locus_tag LOCUS_06230 20481 19654 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789915.1 protein_id gnl|my_center|LOCUS_06230 21769 20489 gene locus_tag LOCUS_06240 21769 20489 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878057.1 protein_id gnl|my_center|LOCUS_06240 22314 21811 gene locus_tag LOCUS_06250 22314 21811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 22434 23336 gene locus_tag LOCUS_06260 22434 23336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 >Feature sequence023 1338 2171 gene locus_tag LOCUS_06270 1338 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 2171 3403 gene locus_tag LOCUS_06280 2171 3403 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769163.1 protein_id gnl|my_center|LOCUS_06280 3493 4878 gene locus_tag LOCUS_06290 3493 4878 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759920.1 protein_id gnl|my_center|LOCUS_06290 4888 6000 gene locus_tag LOCUS_06300 4888 6000 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_06300 6005 7384 gene locus_tag LOCUS_06310 6005 7384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 9404 7425 gene locus_tag LOCUS_06320 9404 7425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 9716 9632 gene locus_tag LOCUS_t00110 9716 9632 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9859 10422 gene locus_tag LOCUS_06330 9859 10422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 10429 10950 gene locus_tag LOCUS_06340 10429 10950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 11734 10958 gene locus_tag LOCUS_06350 11734 10958 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760815.1 protein_id gnl|my_center|LOCUS_06350 12588 11746 gene locus_tag LOCUS_06360 gene dapF 12588 11746 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927135.1 protein_id gnl|my_center|LOCUS_06360 13358 12585 gene locus_tag LOCUS_06370 13358 12585 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933909.1 protein_id gnl|my_center|LOCUS_06370 14256 13360 gene locus_tag LOCUS_06380 gene dapA 14256 13360 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081879.1 protein_id gnl|my_center|LOCUS_06380 14933 14253 gene locus_tag LOCUS_06390 gene dapB 14933 14253 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783772.1 protein_id gnl|my_center|LOCUS_06390 16282 14930 gene locus_tag LOCUS_06400 gene lysC 16282 14930 CDS product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931789.1 protein_id gnl|my_center|LOCUS_06400 17377 16295 gene locus_tag LOCUS_06410 17377 16295 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974707.1 protein_id gnl|my_center|LOCUS_06410 17447 18091 gene locus_tag LOCUS_06420 17447 18091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 18108 19451 gene locus_tag LOCUS_06430 18108 19451 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596611.1 protein_id gnl|my_center|LOCUS_06430 19448 19729 gene locus_tag LOCUS_06440 19448 19729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 20933 19731 gene locus_tag LOCUS_06450 20933 19731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 22279 20930 gene locus_tag LOCUS_06460 22279 20930 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109228.1 protein_id gnl|my_center|LOCUS_06460 <23254 22284 gene locus_tag LOCUS_06470 <23254 22284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109228.1:MFS transporter >Feature sequence024 584 1252 gene locus_tag LOCUS_06480 584 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 1801 1343 gene locus_tag LOCUS_06490 1801 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 1890 2816 gene locus_tag LOCUS_06500 gene trxB 1890 2816 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109204.1 protein_id gnl|my_center|LOCUS_06500 2861 3733 gene locus_tag LOCUS_06510 2861 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 3759 4124 gene locus_tag LOCUS_06520 3759 4124 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788198.1 protein_id gnl|my_center|LOCUS_06520 4137 5846 gene locus_tag LOCUS_06530 gene recN 4137 5846 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107738.1 protein_id gnl|my_center|LOCUS_06530 7825 5810 gene locus_tag LOCUS_06540 7825 5810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 8952 7822 gene locus_tag LOCUS_06550 8952 7822 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_06550 9591 8965 gene locus_tag LOCUS_06560 9591 8965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 10360 9644 gene locus_tag LOCUS_06570 10360 9644 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791132.1 protein_id gnl|my_center|LOCUS_06570 10459 11304 gene locus_tag LOCUS_06580 10459 11304 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203537.1 protein_id gnl|my_center|LOCUS_06580 11313 12044 gene locus_tag LOCUS_06590 gene uppS 11313 12044 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527291.1 protein_id gnl|my_center|LOCUS_06590 12056 14695 gene locus_tag LOCUS_06600 12056 14695 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784370.1 protein_id gnl|my_center|LOCUS_06600 14781 15335 gene locus_tag LOCUS_06610 14781 15335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 15468 17303 gene locus_tag LOCUS_06620 15468 17303 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107821429.1 protein_id gnl|my_center|LOCUS_06620 17315 18334 gene locus_tag LOCUS_06630 17315 18334 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108506.1 protein_id gnl|my_center|LOCUS_06630 18377 19702 gene locus_tag LOCUS_06640 gene gdhA 18377 19702 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203378.1 protein_id gnl|my_center|LOCUS_06640 19837 21435 gene locus_tag LOCUS_06650 19837 21435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 >Feature sequence025 1137 115 gene locus_tag LOCUS_06660 1137 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 1828 1223 gene locus_tag LOCUS_06670 1828 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 2096 2608 gene locus_tag LOCUS_06680 2096 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 3801 2629 gene locus_tag LOCUS_06690 3801 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 4250 3936 gene locus_tag LOCUS_06700 4250 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 5189 4410 gene locus_tag LOCUS_06710 5189 4410 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681613.1 protein_id gnl|my_center|LOCUS_06710 5697 5374 gene locus_tag LOCUS_06720 5697 5374 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_06720 5894 5694 gene locus_tag LOCUS_06730 5894 5694 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_06730 6400 7017 gene locus_tag LOCUS_06740 6400 7017 CDS product murein L,D-transpeptidase catalytic domain family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107703.1 protein_id gnl|my_center|LOCUS_06740 7337 7250 gene locus_tag LOCUS_t00120 7337 7250 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10064 7407 gene locus_tag LOCUS_06750 10064 7407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 12409 10085 gene locus_tag LOCUS_06760 12409 10085 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405547.1 protein_id gnl|my_center|LOCUS_06760 13652 12399 gene locus_tag LOCUS_06770 13652 12399 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840118.1 protein_id gnl|my_center|LOCUS_06770 13747 16140 gene locus_tag LOCUS_06780 13747 16140 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_06780 16145 17182 gene locus_tag LOCUS_06790 16145 17182 CDS product DUF4249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203490.1 protein_id gnl|my_center|LOCUS_06790 17196 17726 gene locus_tag LOCUS_06800 17196 17726 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203222.1 protein_id gnl|my_center|LOCUS_06800 17728 18426 gene locus_tag LOCUS_06810 gene tsaA 17728 18426 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_06810 19896 18430 gene locus_tag LOCUS_06820 19896 18430 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696793.1 protein_id gnl|my_center|LOCUS_06820 21123 19918 gene locus_tag LOCUS_06830 21123 19918 CDS product anaerobic sulfatase-maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789094.1 protein_id gnl|my_center|LOCUS_06830 21271 22113 gene locus_tag LOCUS_06840 21271 22113 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048249.1 protein_id gnl|my_center|LOCUS_06840 >Feature sequence026 <1 1004 gene locus_tag LOCUS_06850 <1 1004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963885.1:tRNA 2-thiouridine(34) synthase MnmA 1654 1157 gene locus_tag LOCUS_06860 1654 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 2734 1685 gene locus_tag LOCUS_06870 2734 1685 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793311.1 protein_id gnl|my_center|LOCUS_06870 2910 4361 gene locus_tag LOCUS_06880 2910 4361 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109116.1 protein_id gnl|my_center|LOCUS_06880 4358 6031 gene locus_tag LOCUS_06890 4358 6031 CDS product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061474328.1 protein_id gnl|my_center|LOCUS_06890 6028 7182 gene locus_tag LOCUS_06900 6028 7182 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760990.1 protein_id gnl|my_center|LOCUS_06900 7184 9073 gene locus_tag LOCUS_06910 7184 9073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 9101 12328 gene locus_tag LOCUS_06920 9101 12328 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109108.1 protein_id gnl|my_center|LOCUS_06920 12342 14186 gene locus_tag LOCUS_06930 12342 14186 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109107.1 protein_id gnl|my_center|LOCUS_06930 14192 17557 gene locus_tag LOCUS_06940 14192 17557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 17578 18993 gene locus_tag LOCUS_06950 gene uxaC 17578 18993 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_06950 18993 20468 gene locus_tag LOCUS_06960 18993 20468 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763047.1 protein_id gnl|my_center|LOCUS_06960 20492 21931 gene locus_tag LOCUS_06970 20492 21931 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761512.1 protein_id gnl|my_center|LOCUS_06970 >Feature sequence027 744 1046 gene locus_tag LOCUS_06980 744 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 1053 2861 gene locus_tag LOCUS_06990 gene mutL 1053 2861 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993641.1 protein_id gnl|my_center|LOCUS_06990 2867 3574 gene locus_tag LOCUS_07000 2867 3574 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765306.1 protein_id gnl|my_center|LOCUS_07000 3576 4664 gene locus_tag LOCUS_07010 3576 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 5287 4661 gene locus_tag LOCUS_07020 5287 4661 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109029.1 protein_id gnl|my_center|LOCUS_07020 6026 5268 gene locus_tag LOCUS_07030 6026 5268 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963729.1 protein_id gnl|my_center|LOCUS_07030 9937 6059 gene locus_tag LOCUS_07040 9937 6059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 10977 9946 gene locus_tag LOCUS_07050 10977 9946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 11123 12082 gene locus_tag LOCUS_07060 11123 12082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 12874 12086 gene locus_tag LOCUS_07070 12874 12086 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791347.1 protein_id gnl|my_center|LOCUS_07070 15116 12891 gene locus_tag LOCUS_07080 15116 12891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 16657 15116 gene locus_tag LOCUS_07090 16657 15116 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082990.1 protein_id gnl|my_center|LOCUS_07090 19186 16703 gene locus_tag LOCUS_07100 19186 16703 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108750.1 protein_id gnl|my_center|LOCUS_07100 19523 19197 gene locus_tag LOCUS_07110 19523 19197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 20710 19523 gene locus_tag LOCUS_07120 20710 19523 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767192.1 protein_id gnl|my_center|LOCUS_07120 <21748 20735 gene locus_tag LOCUS_07130 <21748 20735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_175483653.1:family 43 glycosylhydrolase >Feature sequence028 1443 919 gene locus_tag LOCUS_07140 1443 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 2743 1463 gene locus_tag LOCUS_07150 2743 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 5454 2743 gene locus_tag LOCUS_07160 5454 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 5541 7730 gene locus_tag LOCUS_07170 5541 7730 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948404.1 protein_id gnl|my_center|LOCUS_07170 7743 9755 gene locus_tag LOCUS_07180 7743 9755 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787605.1 protein_id gnl|my_center|LOCUS_07180 9818 11779 gene locus_tag LOCUS_07190 9818 11779 CDS product glycogen debranching enzyme N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109193.1 protein_id gnl|my_center|LOCUS_07190 11788 13080 gene locus_tag LOCUS_07200 11788 13080 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759975.1 protein_id gnl|my_center|LOCUS_07200 13080 14282 gene locus_tag LOCUS_07210 13080 14282 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_07210 14290 18531 gene locus_tag LOCUS_07220 14290 18531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 18522 19421 gene locus_tag LOCUS_07230 18522 19421 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931936.1 protein_id gnl|my_center|LOCUS_07230 >Feature sequence029 127 1743 gene locus_tag LOCUS_07240 gene glpA 127 1743 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815350.1 protein_id gnl|my_center|LOCUS_07240 1740 3008 gene locus_tag LOCUS_07250 gene glpB 1740 3008 CDS product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176408.1 protein_id gnl|my_center|LOCUS_07250 2995 4236 gene locus_tag LOCUS_07260 gene glpC 2995 4236 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098021.1 protein_id gnl|my_center|LOCUS_07260 4744 5550 gene locus_tag LOCUS_07270 4744 5550 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211996.1 protein_id gnl|my_center|LOCUS_07270 5766 8054 gene locus_tag LOCUS_07280 5766 8054 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108276.1 protein_id gnl|my_center|LOCUS_07280 9160 8051 gene locus_tag LOCUS_07290 9160 8051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 11357 9162 gene locus_tag LOCUS_07300 11357 9162 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108964.1 protein_id gnl|my_center|LOCUS_07300 12683 11373 gene locus_tag LOCUS_07310 12683 11373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 12789 15527 gene locus_tag LOCUS_07320 12789 15527 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201960.1 protein_id gnl|my_center|LOCUS_07320 15533 16996 gene locus_tag LOCUS_07330 gene preA 15533 16996 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987091.1 protein_id gnl|my_center|LOCUS_07330 17080 17535 gene locus_tag LOCUS_07340 17080 17535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 17538 18014 gene locus_tag LOCUS_07350 17538 18014 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983897.1 protein_id gnl|my_center|LOCUS_07350 18014 18463 gene locus_tag LOCUS_07360 18014 18463 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224812.1 protein_id gnl|my_center|LOCUS_07360 19056 18460 gene locus_tag LOCUS_07370 19056 18460 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203220.1 protein_id gnl|my_center|LOCUS_07370 19586 19059 gene locus_tag LOCUS_07380 19586 19059 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767850.1 protein_id gnl|my_center|LOCUS_07380 19925 19590 gene locus_tag LOCUS_07390 19925 19590 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762031.1 protein_id gnl|my_center|LOCUS_07390 >Feature sequence030 <1 1227 gene locus_tag LOCUS_07400 <1 1227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109217.1:valine--tRNA ligase 1261 1671 gene locus_tag LOCUS_07410 1261 1671 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_07410 1682 1930 gene locus_tag LOCUS_07420 1682 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 1973 2737 gene locus_tag LOCUS_07430 gene tatC 1973 2737 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760986.1 protein_id gnl|my_center|LOCUS_07430 2734 4662 gene locus_tag LOCUS_07440 2734 4662 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_07440 4698 5579 gene locus_tag LOCUS_07450 4698 5579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 5636 6622 gene locus_tag LOCUS_07460 5636 6622 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403681.1 protein_id gnl|my_center|LOCUS_07460 7953 6676 gene locus_tag LOCUS_07470 7953 6676 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963555.1 protein_id gnl|my_center|LOCUS_07470 9008 7950 gene locus_tag LOCUS_07480 9008 7950 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963929.1 protein_id gnl|my_center|LOCUS_07480 9435 9064 gene locus_tag LOCUS_07490 9435 9064 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962997.1 protein_id gnl|my_center|LOCUS_07490 9885 11105 gene locus_tag LOCUS_07500 9885 11105 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760889.1 protein_id gnl|my_center|LOCUS_07500 11197 12309 gene locus_tag LOCUS_07510 11197 12309 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964380.1 protein_id gnl|my_center|LOCUS_07510 13597 12314 gene locus_tag LOCUS_07520 13597 12314 CDS product cysteate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066469.1 protein_id gnl|my_center|LOCUS_07520 14602 13625 gene locus_tag LOCUS_07530 14602 13625 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767297.1 protein_id gnl|my_center|LOCUS_07530 14636 17995 gene locus_tag LOCUS_07540 14636 17995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 19426 17999 gene locus_tag LOCUS_07550 gene rlmD 19426 17999 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_07550 <20226 19467 gene locus_tag LOCUS_07560 <20226 19467 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005795977.1:FprA family A-type flavoprotein >Feature sequence031 304 2511 gene locus_tag LOCUS_07570 304 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 3829 2519 gene locus_tag LOCUS_07580 3829 2519 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440000.1 protein_id gnl|my_center|LOCUS_07580 3908 4879 gene locus_tag LOCUS_07590 3908 4879 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108350.1 protein_id gnl|my_center|LOCUS_07590 6213 4894 gene locus_tag LOCUS_07600 6213 4894 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796464.1 protein_id gnl|my_center|LOCUS_07600 7316 6216 gene locus_tag LOCUS_07610 7316 6216 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763619.1 protein_id gnl|my_center|LOCUS_07610 8595 7339 gene locus_tag LOCUS_07620 8595 7339 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108314.1 protein_id gnl|my_center|LOCUS_07620 9909 8602 gene locus_tag LOCUS_07630 9909 8602 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_07630 10628 9906 gene locus_tag LOCUS_07640 10628 9906 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_07640 10710 11363 gene locus_tag LOCUS_07650 10710 11363 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810571.1 protein_id gnl|my_center|LOCUS_07650 11389 12462 gene locus_tag LOCUS_07660 11389 12462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 12483 14663 gene locus_tag LOCUS_07670 12483 14663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 15763 14666 gene locus_tag LOCUS_07680 15763 14666 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878480.1 protein_id gnl|my_center|LOCUS_07680 16529 15777 gene locus_tag LOCUS_07690 16529 15777 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438367.1 protein_id gnl|my_center|LOCUS_07690 17605 16526 gene locus_tag LOCUS_07700 17605 16526 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878480.1 protein_id gnl|my_center|LOCUS_07700 18821 17616 gene locus_tag LOCUS_07710 18821 17616 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767192.1 protein_id gnl|my_center|LOCUS_07710 19607 19008 gene locus_tag LOCUS_07720 19607 19008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 >Feature sequence032 2 345 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq caaaggtacaaaatctgaaagcaaatcacaac 1395 388 gene locus_tag LOCUS_07730 1395 388 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667016.1 protein_id gnl|my_center|LOCUS_07730 2635 1478 gene locus_tag LOCUS_07740 2635 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 2776 4512 gene locus_tag LOCUS_07750 2776 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 4518 5906 gene locus_tag LOCUS_07760 4518 5906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 5930 6562 gene locus_tag LOCUS_07770 5930 6562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 6570 7274 gene locus_tag LOCUS_07780 6570 7274 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783729.1 protein_id gnl|my_center|LOCUS_07780 7892 7281 gene locus_tag LOCUS_07790 7892 7281 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117778.1 protein_id gnl|my_center|LOCUS_07790 8259 7921 gene locus_tag LOCUS_07800 8259 7921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 8968 8279 gene locus_tag LOCUS_07810 8968 8279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 10316 8985 gene locus_tag LOCUS_07820 10316 8985 CDS product DUF5723 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767614.1 protein_id gnl|my_center|LOCUS_07820 10959 10327 gene locus_tag LOCUS_07830 10959 10327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 11028 11513 gene locus_tag LOCUS_07840 11028 11513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 11687 12085 gene locus_tag LOCUS_07850 11687 12085 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763145.1 protein_id gnl|my_center|LOCUS_07850 12194 12403 gene locus_tag LOCUS_07860 12194 12403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 12400 13485 gene locus_tag LOCUS_07870 12400 13485 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272581.1 protein_id gnl|my_center|LOCUS_07870 13988 13494 gene locus_tag LOCUS_07880 13988 13494 CDS product 3'-5' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762345.1 protein_id gnl|my_center|LOCUS_07880 14406 13993 gene locus_tag LOCUS_07890 14406 13993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 14772 14422 gene locus_tag LOCUS_07900 14772 14422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 15721 14834 gene locus_tag LOCUS_07910 15721 14834 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769713.1 protein_id gnl|my_center|LOCUS_07910 16793 15834 gene locus_tag LOCUS_07920 16793 15834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 17674 16796 gene locus_tag LOCUS_07930 17674 16796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 18061 17681 gene locus_tag LOCUS_07940 18061 17681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 18167 18784 gene locus_tag LOCUS_07950 18167 18784 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089828.1 protein_id gnl|my_center|LOCUS_07950 19646 18741 gene locus_tag LOCUS_07960 19646 18741 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295301.1 protein_id gnl|my_center|LOCUS_07960 >Feature sequence033 <1 540 gene locus_tag LOCUS_07970 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107424.1:serine hydroxymethyltransferase 698 1555 gene locus_tag LOCUS_07980 698 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 4704 1552 gene locus_tag LOCUS_07990 4704 1552 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108778.1 protein_id gnl|my_center|LOCUS_07990 6592 4721 gene locus_tag LOCUS_08000 6592 4721 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066403458.1 protein_id gnl|my_center|LOCUS_08000 6678 6932 gene locus_tag LOCUS_08010 6678 6932 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014761069.1 protein_id gnl|my_center|LOCUS_08010 7005 8087 gene locus_tag LOCUS_08020 7005 8087 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107704.1 protein_id gnl|my_center|LOCUS_08020 8092 9492 gene locus_tag LOCUS_08030 8092 9492 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788556.1 protein_id gnl|my_center|LOCUS_08030 9498 10556 gene locus_tag LOCUS_08040 gene ftcD 9498 10556 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922735.1 protein_id gnl|my_center|LOCUS_08040 11248 10553 gene locus_tag LOCUS_08050 11248 10553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 11641 11273 gene locus_tag LOCUS_08060 11641 11273 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785723.1 protein_id gnl|my_center|LOCUS_08060 12658 11717 gene locus_tag LOCUS_08070 12658 11717 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940211.1 protein_id gnl|my_center|LOCUS_08070 13723 12677 gene locus_tag LOCUS_08080 13723 12677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 15700 13730 gene locus_tag LOCUS_08090 15700 13730 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765170.1 protein_id gnl|my_center|LOCUS_08090 15870 17000 gene locus_tag LOCUS_08100 15870 17000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 17127 17054 gene locus_tag LOCUS_t00130 17127 17054 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 18624 17248 gene locus_tag LOCUS_08110 18624 17248 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_08110 <19558 18635 gene locus_tag LOCUS_08120 <19558 18635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861288.1:aminomethyl-transferring glycine dehydrogenase subunit GcvPB >Feature sequence034 <1 638 gene locus_tag LOCUS_08130 <1 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763483.1:3-phosphoserine/phosphohydroxythreonine transaminase 645 1565 gene locus_tag LOCUS_08140 645 1565 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765870.1 protein_id gnl|my_center|LOCUS_08140 1579 2829 gene locus_tag LOCUS_08150 1579 2829 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763485.1 protein_id gnl|my_center|LOCUS_08150 2826 3518 gene locus_tag LOCUS_08160 2826 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 3508 3894 gene locus_tag LOCUS_08170 3508 3894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 5354 3939 gene locus_tag LOCUS_08180 5354 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 8025 5380 gene locus_tag LOCUS_08190 8025 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 10037 8040 gene locus_tag LOCUS_08200 10037 8040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 10192 11442 gene locus_tag LOCUS_08210 10192 11442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 12230 12562 gene locus_tag LOCUS_08220 12230 12562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 12581 13135 gene locus_tag LOCUS_08230 12581 13135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 13125 13328 gene locus_tag LOCUS_08240 13125 13328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 13237 13725 gene locus_tag LOCUS_08250 13237 13725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 14407 13703 gene locus_tag LOCUS_08260 14407 13703 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687323.1 protein_id gnl|my_center|LOCUS_08260 17162 14418 gene locus_tag LOCUS_08270 17162 14418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 18025 17165 gene locus_tag LOCUS_08280 18025 17165 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192079.1 protein_id gnl|my_center|LOCUS_08280 19294 18041 gene locus_tag LOCUS_08290 gene purD 19294 18041 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101936.1 protein_id gnl|my_center|LOCUS_08290 >Feature sequence035 1056 601 gene locus_tag LOCUS_08300 gene queF 1056 601 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786209.1 protein_id gnl|my_center|LOCUS_08300 1737 1060 gene locus_tag LOCUS_08310 1737 1060 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762200.1 protein_id gnl|my_center|LOCUS_08310 2892 1798 gene locus_tag LOCUS_08320 gene prfA 2892 1798 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785133.1 protein_id gnl|my_center|LOCUS_08320 3973 2897 gene locus_tag LOCUS_08330 3973 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_08330 4866 4066 gene locus_tag LOCUS_08340 gene mazG 4866 4066 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785408.1 protein_id gnl|my_center|LOCUS_08340 4949 6250 gene locus_tag LOCUS_08350 4949 6250 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211395.1 protein_id gnl|my_center|LOCUS_08350 6264 7175 gene locus_tag LOCUS_08360 6264 7175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 7345 9765 gene locus_tag LOCUS_08370 7345 9765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 11164 9770 gene locus_tag LOCUS_08380 11164 9770 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107160.1 protein_id gnl|my_center|LOCUS_08380 11203 12276 gene locus_tag LOCUS_08390 11203 12276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 12289 13782 gene locus_tag LOCUS_08400 12289 13782 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108742.1 protein_id gnl|my_center|LOCUS_08400 13769 15103 gene locus_tag LOCUS_08410 13769 15103 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784716.1 protein_id gnl|my_center|LOCUS_08410 16064 15114 gene locus_tag LOCUS_08420 gene rsgA 16064 15114 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202106.1 protein_id gnl|my_center|LOCUS_08420 16133 17116 gene locus_tag LOCUS_08430 16133 17116 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203421.1 protein_id gnl|my_center|LOCUS_08430 17652 17113 gene locus_tag LOCUS_08440 17652 17113 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782842.1 protein_id gnl|my_center|LOCUS_08440 >Feature sequence036 804 367 gene locus_tag LOCUS_08450 804 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 3038 825 gene locus_tag LOCUS_08460 3038 825 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202070.1 protein_id gnl|my_center|LOCUS_08460 3929 3111 gene locus_tag LOCUS_08470 3929 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 4713 3949 gene locus_tag LOCUS_08480 4713 3949 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_08480 4806 4883 gene locus_tag LOCUS_t00140 4806 4883 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4974 6161 gene locus_tag LOCUS_08490 4974 6161 CDS product fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795164.1 protein_id gnl|my_center|LOCUS_08490 8246 6147 gene locus_tag LOCUS_08500 8246 6147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 11137 8255 gene locus_tag LOCUS_08510 11137 8255 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303123.1 protein_id gnl|my_center|LOCUS_08510 11202 11909 gene locus_tag LOCUS_08520 11202 11909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 12432 12971 gene locus_tag LOCUS_08530 12432 12971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 15002 13050 gene locus_tag LOCUS_08540 15002 13050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 15894 15013 gene locus_tag LOCUS_08550 15894 15013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 16665 15970 gene locus_tag LOCUS_08560 16665 15970 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943875.1 protein_id gnl|my_center|LOCUS_08560 16782 17576 gene locus_tag LOCUS_08570 16782 17576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 >Feature sequence037 1196 60 gene locus_tag LOCUS_08580 1196 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 2054 1293 gene locus_tag LOCUS_08590 2054 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 2934 2068 gene locus_tag LOCUS_08600 2934 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 4453 2927 gene locus_tag LOCUS_08610 4453 2927 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_08610 4594 5439 gene locus_tag LOCUS_08620 4594 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 7904 5436 gene locus_tag LOCUS_08630 7904 5436 CDS product excinuclease ABC subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389901.1 protein_id gnl|my_center|LOCUS_08630 8070 9092 gene locus_tag LOCUS_08640 8070 9092 CDS product DUF6528 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332817.1 protein_id gnl|my_center|LOCUS_08640 9101 9937 gene locus_tag LOCUS_08650 9101 9937 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905879.1 protein_id gnl|my_center|LOCUS_08650 9951 11213 gene locus_tag LOCUS_08660 9951 11213 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784237.1 protein_id gnl|my_center|LOCUS_08660 11234 12421 gene locus_tag LOCUS_08670 11234 12421 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201992.1 protein_id gnl|my_center|LOCUS_08670 13136 12513 gene locus_tag LOCUS_08680 13136 12513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 13198 14016 gene locus_tag LOCUS_08690 13198 14016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 14133 15548 gene locus_tag LOCUS_08700 14133 15548 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107905.1 protein_id gnl|my_center|LOCUS_08700 15550 16299 gene locus_tag LOCUS_08710 15550 16299 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767893.1 protein_id gnl|my_center|LOCUS_08710 16313 16747 gene locus_tag LOCUS_08720 gene mscL 16313 16747 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759941.1 protein_id gnl|my_center|LOCUS_08720 <17834 16731 gene locus_tag LOCUS_08730 <17834 16731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760476.1:Na+/H+ antiporter NhaC family protein >Feature sequence038 1 255 gene locus_tag LOCUS_08740 1 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 390 317 gene locus_tag LOCUS_t00150 390 317 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 497 1528 gene locus_tag LOCUS_08750 gene metX 497 1528 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932292.1 protein_id gnl|my_center|LOCUS_08750 1551 2159 gene locus_tag LOCUS_08760 1551 2159 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_08760 3267 2170 gene locus_tag LOCUS_08770 3267 2170 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259711.1 protein_id gnl|my_center|LOCUS_08770 3300 4985 gene locus_tag LOCUS_08780 3300 4985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 5883 4993 gene locus_tag LOCUS_08790 5883 4993 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790351.1 protein_id gnl|my_center|LOCUS_08790 6722 5880 gene locus_tag LOCUS_08800 6722 5880 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764890.1 protein_id gnl|my_center|LOCUS_08800 8106 6727 gene locus_tag LOCUS_08810 8106 6727 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202731.1 protein_id gnl|my_center|LOCUS_08810 9370 8303 gene locus_tag LOCUS_08820 9370 8303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 10304 9381 gene locus_tag LOCUS_08830 10304 9381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 11529 10306 gene locus_tag LOCUS_08840 11529 10306 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 protein_id gnl|my_center|LOCUS_08840 12545 11526 gene locus_tag LOCUS_08850 12545 11526 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810429.1 protein_id gnl|my_center|LOCUS_08850 12609 13673 gene locus_tag LOCUS_08860 12609 13673 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201939.1 protein_id gnl|my_center|LOCUS_08860 15014 13695 gene locus_tag LOCUS_08870 15014 13695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 16257 15016 gene locus_tag LOCUS_08880 16257 15016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 17212 16259 gene locus_tag LOCUS_08890 17212 16259 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_08890 >Feature sequence039 1461 130 gene locus_tag LOCUS_08900 gene argH 1461 130 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784384.1 protein_id gnl|my_center|LOCUS_08900 2508 1471 gene locus_tag LOCUS_08910 2508 1471 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_08910 3298 2513 gene locus_tag LOCUS_08920 gene argB 3298 2513 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767599.1 protein_id gnl|my_center|LOCUS_08920 4242 3295 gene locus_tag LOCUS_08930 4242 3295 CDS product acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762653.1 protein_id gnl|my_center|LOCUS_08930 5375 4254 gene locus_tag LOCUS_08940 5375 4254 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762695.1 protein_id gnl|my_center|LOCUS_08940 6366 5386 gene locus_tag LOCUS_08950 gene argC 6366 5386 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796494.1 protein_id gnl|my_center|LOCUS_08950 8116 6368 gene locus_tag LOCUS_08960 8116 6368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 8600 8133 gene locus_tag LOCUS_08970 8600 8133 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762699.1 protein_id gnl|my_center|LOCUS_08970 8698 10281 gene locus_tag LOCUS_08980 gene guaA 8698 10281 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764459.1 protein_id gnl|my_center|LOCUS_08980 11179 10571 gene locus_tag LOCUS_08990 gene hisIE 11179 10571 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762399.1 protein_id gnl|my_center|LOCUS_08990 11952 11191 gene locus_tag LOCUS_09000 gene hisF 11952 11191 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203119.1 protein_id gnl|my_center|LOCUS_09000 12668 11946 gene locus_tag LOCUS_09010 gene hisA 12668 11946 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764911.1 protein_id gnl|my_center|LOCUS_09010 13279 12674 gene locus_tag LOCUS_09020 gene hisH 13279 12674 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803062.1 protein_id gnl|my_center|LOCUS_09020 14925 13276 gene locus_tag LOCUS_09030 14925 13276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 16258 14957 gene locus_tag LOCUS_09040 gene hisD 16258 14957 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203178.1 protein_id gnl|my_center|LOCUS_09040 17126 16275 gene locus_tag LOCUS_09050 gene hisG 17126 16275 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789131.1 protein_id gnl|my_center|LOCUS_09050 >Feature sequence040 180 1025 gene locus_tag LOCUS_09060 180 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 1052 1984 gene locus_tag LOCUS_09070 1052 1984 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038545.1 protein_id gnl|my_center|LOCUS_09070 2771 1986 gene locus_tag LOCUS_09080 2771 1986 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788251.1 protein_id gnl|my_center|LOCUS_09080 2898 4232 gene locus_tag LOCUS_09090 2898 4232 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790898.1 protein_id gnl|my_center|LOCUS_09090 5692 4193 gene locus_tag LOCUS_09100 5692 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 5952 5689 gene locus_tag LOCUS_09110 gene ptsH 5952 5689 CDS product phosphocarrier protein Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487600.1 protein_id gnl|my_center|LOCUS_09110 7703 5949 gene locus_tag LOCUS_09120 7703 5949 CDS product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175076.1 protein_id gnl|my_center|LOCUS_09120 8629 7700 gene locus_tag LOCUS_09130 8629 7700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 8747 8824 gene locus_tag LOCUS_t00160 8747 8824 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 9848 12772 gene locus_tag LOCUS_09140 gene uvrA 9848 12772 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107958.1 protein_id gnl|my_center|LOCUS_09140 12748 13623 gene locus_tag LOCUS_09150 12748 13623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 13971 14609 gene locus_tag LOCUS_09160 13971 14609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 <17607 14602 gene locus_tag LOCUS_09170 <17607 14602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767197.1:glycosyl hydrolase >Feature sequence041 <1 909 gene locus_tag LOCUS_09180 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005802230.1:lysine--tRNA ligase 914 1717 gene locus_tag LOCUS_09190 914 1717 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_09190 1714 2664 gene locus_tag LOCUS_09200 1714 2664 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_09200 2700 3212 gene locus_tag LOCUS_09210 2700 3212 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_09210 3245 4510 gene locus_tag LOCUS_09220 3245 4510 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763215.1 protein_id gnl|my_center|LOCUS_09220 5053 4592 gene locus_tag LOCUS_09230 5053 4592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 5693 5091 gene locus_tag LOCUS_09240 gene rsxA 5693 5091 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761247.1 protein_id gnl|my_center|LOCUS_09240 6282 5698 gene locus_tag LOCUS_09250 6282 5698 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_09250 6849 6286 gene locus_tag LOCUS_09260 6849 6286 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202941.1 protein_id gnl|my_center|LOCUS_09260 7835 6852 gene locus_tag LOCUS_09270 7835 6852 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_09270 9224 7863 gene locus_tag LOCUS_09280 gene rsxC 9224 7863 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107360.1 protein_id gnl|my_center|LOCUS_09280 10168 9227 gene locus_tag LOCUS_09290 10168 9227 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761242.1 protein_id gnl|my_center|LOCUS_09290 10596 10165 gene locus_tag LOCUS_09300 10596 10165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 11461 10598 gene locus_tag LOCUS_09310 11461 10598 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_09310 12843 11461 gene locus_tag LOCUS_09320 gene dnaB 12843 11461 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788141.1 protein_id gnl|my_center|LOCUS_09320 13802 12990 gene locus_tag LOCUS_09330 13802 12990 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761550.1 protein_id gnl|my_center|LOCUS_09330 14593 13808 gene locus_tag LOCUS_09340 14593 13808 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964615.1 protein_id gnl|my_center|LOCUS_09340 14912 14595 gene locus_tag LOCUS_09350 14912 14595 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784840.1 protein_id gnl|my_center|LOCUS_09350 15877 14930 gene locus_tag LOCUS_09360 15877 14930 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760911.1 protein_id gnl|my_center|LOCUS_09360 16893 15886 gene locus_tag LOCUS_09370 16893 15886 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760911.1 protein_id gnl|my_center|LOCUS_09370 >Feature sequence042 <1 936 gene locus_tag LOCUS_09380 <1 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797413.1:protein translocase subunit SecDF 1023 2207 gene locus_tag LOCUS_09390 1023 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 2228 3727 gene locus_tag LOCUS_09400 2228 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 3724 4284 gene locus_tag LOCUS_09410 3724 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 4284 6242 gene locus_tag LOCUS_09420 4284 6242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 6827 6246 gene locus_tag LOCUS_09430 6827 6246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 6906 8720 gene locus_tag LOCUS_09440 6906 8720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 9950 8742 gene locus_tag LOCUS_09450 9950 8742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 10114 10329 gene locus_tag LOCUS_09460 10114 10329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 10342 11634 gene locus_tag LOCUS_09470 10342 11634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 12971 11646 gene locus_tag LOCUS_09480 12971 11646 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797467.1 protein_id gnl|my_center|LOCUS_09480 15037 12968 gene locus_tag LOCUS_09490 15037 12968 CDS product pyruvate formate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797468.1 protein_id gnl|my_center|LOCUS_09490 15786 15034 gene locus_tag LOCUS_09500 15786 15034 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203682.1 protein_id gnl|my_center|LOCUS_09500 15856 16134 gene locus_tag LOCUS_09510 15856 16134 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788894.1 protein_id gnl|my_center|LOCUS_09510 16183 16551 gene locus_tag LOCUS_09520 16183 16551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 16726 16884 gene locus_tag LOCUS_09530 16726 16884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 >Feature sequence043 459 1691 gene locus_tag LOCUS_09540 459 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 1691 3556 gene locus_tag LOCUS_09550 1691 3556 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804150.1 protein_id gnl|my_center|LOCUS_09550 3561 4037 gene locus_tag LOCUS_09560 3561 4037 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108881.1 protein_id gnl|my_center|LOCUS_09560 6744 4060 gene locus_tag LOCUS_09570 6744 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 9013 6755 gene locus_tag LOCUS_09580 gene rnr 9013 6755 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964576.1 protein_id gnl|my_center|LOCUS_09580 9054 10085 gene locus_tag LOCUS_09590 9054 10085 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786511.1 protein_id gnl|my_center|LOCUS_09590 12340 10088 gene locus_tag LOCUS_09600 12340 10088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 12936 12343 gene locus_tag LOCUS_09610 12936 12343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 14972 12966 gene locus_tag LOCUS_09620 14972 12966 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765304.1 protein_id gnl|my_center|LOCUS_09620 16097 15018 gene locus_tag LOCUS_09630 16097 15018 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767132.1 protein_id gnl|my_center|LOCUS_09630 >Feature sequence044 2392 1634 gene locus_tag LOCUS_09640 2392 1634 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761252.1 protein_id gnl|my_center|LOCUS_09640 3086 2394 gene locus_tag LOCUS_09650 3086 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 3193 4290 gene locus_tag LOCUS_09660 gene recF 3193 4290 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759932.1 protein_id gnl|my_center|LOCUS_09660 4298 4645 gene locus_tag LOCUS_09670 4298 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 4648 5694 gene locus_tag LOCUS_09680 gene pdxB 4648 5694 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201894.1 protein_id gnl|my_center|LOCUS_09680 6458 5691 gene locus_tag LOCUS_09690 6458 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 7416 6442 gene locus_tag LOCUS_09700 7416 6442 CDS product deoxyhypusine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963819.1 protein_id gnl|my_center|LOCUS_09700 7548 8762 gene locus_tag LOCUS_09710 gene lysA 7548 8762 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788814.1 protein_id gnl|my_center|LOCUS_09710 8812 10137 gene locus_tag LOCUS_09720 gene ffh 8812 10137 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789195.1 protein_id gnl|my_center|LOCUS_09720 11003 10134 gene locus_tag LOCUS_09730 11003 10134 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764326.1 protein_id gnl|my_center|LOCUS_09730 11060 12283 gene locus_tag LOCUS_09740 11060 12283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 12288 14033 gene locus_tag LOCUS_09750 12288 14033 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202604.1 protein_id gnl|my_center|LOCUS_09750 14235 15680 gene locus_tag LOCUS_09760 gene rhaB 14235 15680 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108961.1 protein_id gnl|my_center|LOCUS_09760 >Feature sequence045 791 1822 gene locus_tag LOCUS_09770 gene murB 791 1822 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788761.1 protein_id gnl|my_center|LOCUS_09770 1832 3139 gene locus_tag LOCUS_09780 gene murA 1832 3139 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108085.1 protein_id gnl|my_center|LOCUS_09780 3150 3923 gene locus_tag LOCUS_09790 3150 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 5682 3868 gene locus_tag LOCUS_09800 5682 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 8330 5679 gene locus_tag LOCUS_09810 8330 5679 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202068.1 protein_id gnl|my_center|LOCUS_09810 8517 8771 gene locus_tag LOCUS_09820 8517 8771 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779510.1 protein_id gnl|my_center|LOCUS_09820 10460 8844 gene locus_tag LOCUS_09830 10460 8844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 11282 10464 gene locus_tag LOCUS_09840 11282 10464 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767986.1 protein_id gnl|my_center|LOCUS_09840 11388 12266 gene locus_tag LOCUS_09850 11388 12266 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779718.1 protein_id gnl|my_center|LOCUS_09850 12273 12536 gene locus_tag LOCUS_09860 12273 12536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 12533 13360 gene locus_tag LOCUS_09870 12533 13360 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_09870 13365 14120 gene locus_tag LOCUS_09880 13365 14120 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784332.1 protein_id gnl|my_center|LOCUS_09880 14731 14063 gene locus_tag LOCUS_09890 14731 14063 CDS product DUF4294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201836.1 protein_id gnl|my_center|LOCUS_09890 15092 15463 gene locus_tag LOCUS_09900 gene rplP 15092 15463 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791549.1 protein_id gnl|my_center|LOCUS_09900 15509 15682 gene locus_tag LOCUS_09910 gene rpmC 15509 15682 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782204.1 protein_id gnl|my_center|LOCUS_09910 15695 15949 gene locus_tag LOCUS_09920 gene rpsQ 15695 15949 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770213.1 protein_id gnl|my_center|LOCUS_09920 >Feature sequence046 163 3363 gene locus_tag LOCUS_09930 163 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 3360 5432 gene locus_tag LOCUS_09940 3360 5432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 5564 6847 gene locus_tag LOCUS_09950 5564 6847 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250733.1 protein_id gnl|my_center|LOCUS_09950 6972 6899 gene locus_tag LOCUS_t00170 6972 6899 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7788 7039 gene locus_tag LOCUS_09960 gene gpmA 7788 7039 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295282.1 protein_id gnl|my_center|LOCUS_09960 8497 7856 gene locus_tag LOCUS_09970 gene nth 8497 7856 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203213.1 protein_id gnl|my_center|LOCUS_09970 9237 8503 gene locus_tag LOCUS_09980 9237 8503 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_09980 9321 12311 gene locus_tag LOCUS_09990 9321 12311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 12324 14063 gene locus_tag LOCUS_10000 12324 14063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 >Feature sequence047 <1 778 gene locus_tag LOCUS_10010 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786570.1:threonine--tRNA ligase 826 1455 gene locus_tag LOCUS_10020 gene infC 826 1455 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695168.1 protein_id gnl|my_center|LOCUS_10020 1505 1699 gene locus_tag LOCUS_10030 gene rpmI 1505 1699 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786574.1 protein_id gnl|my_center|LOCUS_10030 1801 2124 gene locus_tag LOCUS_10040 gene rplT 1801 2124 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297540.1 protein_id gnl|my_center|LOCUS_10040 2140 3480 gene locus_tag LOCUS_10050 2140 3480 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783769.1 protein_id gnl|my_center|LOCUS_10050 3560 3802 gene locus_tag LOCUS_10060 gene rpmB 3560 3802 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765736.1 protein_id gnl|my_center|LOCUS_10060 3815 4003 gene locus_tag LOCUS_10070 gene rpmG 3815 4003 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761579.1 protein_id gnl|my_center|LOCUS_10070 4016 4177 gene locus_tag LOCUS_10080 4016 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 4280 5212 gene locus_tag LOCUS_10090 gene ftsY 4280 5212 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963551.1 protein_id gnl|my_center|LOCUS_10090 5227 7668 gene locus_tag LOCUS_10100 gene pheT 5227 7668 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202920.1 protein_id gnl|my_center|LOCUS_10100 7675 8316 gene locus_tag LOCUS_10110 7675 8316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 8318 9505 gene locus_tag LOCUS_10120 8318 9505 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940160.1 protein_id gnl|my_center|LOCUS_10120 9502 10257 gene locus_tag LOCUS_10130 9502 10257 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797101.1 protein_id gnl|my_center|LOCUS_10130 10272 11165 gene locus_tag LOCUS_10140 gene deoC 10272 11165 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762870.1 protein_id gnl|my_center|LOCUS_10140 12518 11169 gene locus_tag LOCUS_10150 12518 11169 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 protein_id gnl|my_center|LOCUS_10150 12687 14249 gene locus_tag LOCUS_10160 12687 14249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 14323 14406 gene locus_tag LOCUS_t00180 14323 14406 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence048 2372 771 gene locus_tag LOCUS_10170 2372 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 5046 2401 gene locus_tag LOCUS_10180 gene mutS 5046 2401 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203750.1 protein_id gnl|my_center|LOCUS_10180 7307 5166 gene locus_tag LOCUS_10190 7307 5166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 7488 7354 gene locus_tag LOCUS_10200 7488 7354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 7623 10178 gene locus_tag LOCUS_10210 7623 10178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 10294 11505 gene locus_tag LOCUS_10220 10294 11505 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107346.1 protein_id gnl|my_center|LOCUS_10220 11512 12669 gene locus_tag LOCUS_10230 gene wecB 11512 12669 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799504.1 protein_id gnl|my_center|LOCUS_10230 12666 13955 gene locus_tag LOCUS_10240 12666 13955 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_10240 >Feature sequence049 465 1181 gene locus_tag LOCUS_10250 465 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 1189 3357 gene locus_tag LOCUS_10260 1189 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 3375 5045 gene locus_tag LOCUS_10270 3375 5045 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786798.1 protein_id gnl|my_center|LOCUS_10270 5045 5452 gene locus_tag LOCUS_10280 5045 5452 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785242.1 protein_id gnl|my_center|LOCUS_10280 5449 7026 gene locus_tag LOCUS_10290 5449 7026 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764456.1 protein_id gnl|my_center|LOCUS_10290 9861 7033 gene locus_tag LOCUS_10300 9861 7033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 11050 9893 gene locus_tag LOCUS_10310 11050 9893 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_10310 11118 11813 gene locus_tag LOCUS_10320 gene cmk 11118 11813 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761050.1 protein_id gnl|my_center|LOCUS_10320 11814 12710 gene locus_tag LOCUS_10330 11814 12710 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797949.1 protein_id gnl|my_center|LOCUS_10330 12804 13370 gene locus_tag LOCUS_10340 gene efp 12804 13370 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963122.1 protein_id gnl|my_center|LOCUS_10340 14309 13479 gene locus_tag LOCUS_10350 gene lptB 14309 13479 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760767.1 protein_id gnl|my_center|LOCUS_10350 >Feature sequence050 1518 2480 gene locus_tag LOCUS_10360 1518 2480 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790916.1 protein_id gnl|my_center|LOCUS_10360 3401 2487 gene locus_tag LOCUS_10370 3401 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 4745 3438 gene locus_tag LOCUS_10380 4745 3438 CDS product rRNA cytosine-C5-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108106.1 protein_id gnl|my_center|LOCUS_10380 5241 4759 gene locus_tag LOCUS_10390 5241 4759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 5908 5267 gene locus_tag LOCUS_10400 gene pyrE 5908 5267 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762667.1 protein_id gnl|my_center|LOCUS_10400 5962 6576 gene locus_tag LOCUS_10410 5962 6576 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097944.1 protein_id gnl|my_center|LOCUS_10410 6648 7697 gene locus_tag LOCUS_10420 gene queA 6648 7697 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783637.1 protein_id gnl|my_center|LOCUS_10420 7824 8960 gene locus_tag LOCUS_10430 gene dprA 7824 8960 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769083.1 protein_id gnl|my_center|LOCUS_10430 8963 9739 gene locus_tag LOCUS_10440 8963 9739 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108111.1 protein_id gnl|my_center|LOCUS_10440 9768 10784 gene locus_tag LOCUS_10450 9768 10784 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765045.1 protein_id gnl|my_center|LOCUS_10450 10909 11706 gene locus_tag LOCUS_10460 10909 11706 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766463.1 protein_id gnl|my_center|LOCUS_10460 11737 12159 gene locus_tag LOCUS_10470 11737 12159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 12169 12747 gene locus_tag LOCUS_10480 12169 12747 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790648.1 protein_id gnl|my_center|LOCUS_10480 12798 13229 gene locus_tag LOCUS_10490 12798 13229 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_10490 >Feature sequence051 472 942 gene locus_tag LOCUS_10500 gene greA 472 942 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964455.1 protein_id gnl|my_center|LOCUS_10500 947 1351 gene locus_tag LOCUS_10510 947 1351 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791382.1 protein_id gnl|my_center|LOCUS_10510 1359 2450 gene locus_tag LOCUS_10520 1359 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 4296 2539 gene locus_tag LOCUS_10530 gene gltX 4296 2539 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791502.1 protein_id gnl|my_center|LOCUS_10530 5583 4309 gene locus_tag LOCUS_10540 5583 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 7178 5598 gene locus_tag LOCUS_10550 gene ftsA 7178 5598 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098846.1 protein_id gnl|my_center|LOCUS_10550 7964 7191 gene locus_tag LOCUS_10560 7964 7191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 9299 7968 gene locus_tag LOCUS_10570 gene murC 9299 7968 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784002.1 protein_id gnl|my_center|LOCUS_10570 10482 9334 gene locus_tag LOCUS_10580 gene murG 10482 9334 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784003.1 protein_id gnl|my_center|LOCUS_10580 11905 10496 gene locus_tag LOCUS_10590 11905 10496 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784004.1 protein_id gnl|my_center|LOCUS_10590 13250 11910 gene locus_tag LOCUS_10600 gene murD 13250 11910 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763714.1 protein_id gnl|my_center|LOCUS_10600 <14253 13272 gene locus_tag LOCUS_10610 <14253 13272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964159.1:phospho-N-acetylmuramoyl-pentapeptide-transferase >Feature sequence052 1907 15 gene locus_tag LOCUS_10620 1907 15 CDS product DUF3857 and transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037137.1 protein_id gnl|my_center|LOCUS_10620 3741 1915 gene locus_tag LOCUS_10630 3741 1915 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767207.1 protein_id gnl|my_center|LOCUS_10630 4477 3974 gene locus_tag LOCUS_10640 4477 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 4905 4474 gene locus_tag LOCUS_10650 4905 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 5387 4902 gene locus_tag LOCUS_10660 5387 4902 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785783.1 protein_id gnl|my_center|LOCUS_10660 5901 5377 gene locus_tag LOCUS_10670 5901 5377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 7812 6091 gene locus_tag LOCUS_10680 7812 6091 CDS product Acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763249.1 protein_id gnl|my_center|LOCUS_10680 8850 7828 gene locus_tag LOCUS_10690 8850 7828 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798976.1 protein_id gnl|my_center|LOCUS_10690 9724 8855 gene locus_tag LOCUS_10700 9724 8855 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763252.1 protein_id gnl|my_center|LOCUS_10700 9858 12041 gene locus_tag LOCUS_10710 9858 12041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 12463 12038 gene locus_tag LOCUS_10720 12463 12038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 >Feature sequence053 2303 813 gene locus_tag LOCUS_10730 2303 813 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201929.1 protein_id gnl|my_center|LOCUS_10730 4399 2306 gene locus_tag LOCUS_10740 4399 2306 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_10740 4792 4421 gene locus_tag LOCUS_10750 4792 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 5742 4789 gene locus_tag LOCUS_10760 gene rsmH 5742 4789 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784016.1 protein_id gnl|my_center|LOCUS_10760 6207 5755 gene locus_tag LOCUS_10770 gene mraZ 6207 5755 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763721.1 protein_id gnl|my_center|LOCUS_10770 6548 7477 gene locus_tag LOCUS_10780 gene cysK 6548 7477 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_10780 7474 8211 gene locus_tag LOCUS_10790 7474 8211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 8297 10231 gene locus_tag LOCUS_10800 8297 10231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 10302 11078 gene locus_tag LOCUS_10810 10302 11078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 11089 12333 gene locus_tag LOCUS_10820 11089 12333 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992045.1 protein_id gnl|my_center|LOCUS_10820 12330 13115 gene locus_tag LOCUS_10830 gene proC 12330 13115 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762694.1 protein_id gnl|my_center|LOCUS_10830 >Feature sequence054 3369 157 gene locus_tag LOCUS_10840 gene mfd 3369 157 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962369.1 protein_id gnl|my_center|LOCUS_10840 3600 4640 gene locus_tag LOCUS_10850 gene ruvB 3600 4640 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762892.1 protein_id gnl|my_center|LOCUS_10850 4651 5757 gene locus_tag LOCUS_10860 4651 5757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 5876 7783 gene locus_tag LOCUS_10870 5876 7783 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783490.1 protein_id gnl|my_center|LOCUS_10870 7786 8565 gene locus_tag LOCUS_10880 7786 8565 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761731.1 protein_id gnl|my_center|LOCUS_10880 8650 11631 gene locus_tag LOCUS_10890 8650 11631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 13829 11634 gene locus_tag LOCUS_10900 13829 11634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 >Feature sequence055 853 464 gene locus_tag LOCUS_10910 gene rpsI 853 464 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390000.1 protein_id gnl|my_center|LOCUS_10910 1314 862 gene locus_tag LOCUS_10920 gene rplM 1314 862 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782434.1 protein_id gnl|my_center|LOCUS_10920 2724 1402 gene locus_tag LOCUS_10930 2724 1402 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810397.1 protein_id gnl|my_center|LOCUS_10930 2847 3779 gene locus_tag LOCUS_10940 2847 3779 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762907.1 protein_id gnl|my_center|LOCUS_10940 3804 7103 gene locus_tag LOCUS_10950 3804 7103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 7148 8464 gene locus_tag LOCUS_10960 7148 8464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 10111 8471 gene locus_tag LOCUS_10970 10111 8471 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695757.1 protein_id gnl|my_center|LOCUS_10970 10719 10123 gene locus_tag LOCUS_10980 10719 10123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 10762 11877 gene locus_tag LOCUS_10990 gene buk 10762 11877 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048334.1 protein_id gnl|my_center|LOCUS_10990 11908 12876 gene locus_tag LOCUS_11000 11908 12876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 13004 13618 gene locus_tag LOCUS_11010 13004 13618 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965803.1 protein_id gnl|my_center|LOCUS_11010 >Feature sequence056 1354 62 gene locus_tag LOCUS_11020 1354 62 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790315.1 protein_id gnl|my_center|LOCUS_11020 4497 1351 gene locus_tag LOCUS_11030 4497 1351 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108069.1 protein_id gnl|my_center|LOCUS_11030 5582 4494 gene locus_tag LOCUS_11040 5582 4494 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797794.1 protein_id gnl|my_center|LOCUS_11040 6468 5656 gene locus_tag LOCUS_11050 gene rsmA 6468 5656 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760928.1 protein_id gnl|my_center|LOCUS_11050 6880 6479 gene locus_tag LOCUS_11060 gene mutT 6880 6479 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681243.1 protein_id gnl|my_center|LOCUS_11060 7779 6877 gene locus_tag LOCUS_11070 gene ispE 7779 6877 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793430.1 protein_id gnl|my_center|LOCUS_11070 8519 7776 gene locus_tag LOCUS_11080 8519 7776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 9234 8500 gene locus_tag LOCUS_11090 gene sufC 9234 8500 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783928.1 protein_id gnl|my_center|LOCUS_11090 9889 9245 gene locus_tag LOCUS_11100 gene pnuC 9889 9245 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013360.1 protein_id gnl|my_center|LOCUS_11100 11353 9905 gene locus_tag LOCUS_11110 gene sufB 11353 9905 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783924.1 protein_id gnl|my_center|LOCUS_11110 11426 12394 gene locus_tag LOCUS_11120 gene aroC 11426 12394 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918467.1 protein_id gnl|my_center|LOCUS_11120 12408 13943 gene locus_tag LOCUS_11130 12408 13943 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860915.1 protein_id gnl|my_center|LOCUS_11130 >Feature sequence057 <1 648 gene locus_tag LOCUS_11140 <1 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764765.1:molecular chaperone DnaK 1820 771 gene locus_tag LOCUS_11150 1820 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 1900 4062 gene locus_tag LOCUS_11160 1900 4062 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765859.1 protein_id gnl|my_center|LOCUS_11160 4696 4067 gene locus_tag LOCUS_11170 gene nadD 4696 4067 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797930.1 protein_id gnl|my_center|LOCUS_11170 5300 4710 gene locus_tag LOCUS_11180 gene gmk 5300 4710 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790592.1 protein_id gnl|my_center|LOCUS_11180 5371 5607 gene locus_tag LOCUS_11190 5371 5607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 6275 5604 gene locus_tag LOCUS_11200 6275 5604 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763217.1 protein_id gnl|my_center|LOCUS_11200 6368 7483 gene locus_tag LOCUS_11210 6368 7483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 8063 7500 gene locus_tag LOCUS_11220 8063 7500 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_11220 8119 9087 gene locus_tag LOCUS_11230 8119 9087 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658092.1 protein_id gnl|my_center|LOCUS_11230 9162 9090 gene locus_tag LOCUS_t00190 9162 9090 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 9587 9204 gene locus_tag LOCUS_11240 9587 9204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 9883 10383 gene locus_tag LOCUS_11250 9883 10383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 10829 10392 gene locus_tag LOCUS_11260 10829 10392 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759603.1 protein_id gnl|my_center|LOCUS_11260 11811 11146 gene locus_tag LOCUS_11270 gene rsmG 11811 11146 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817853.1 protein_id gnl|my_center|LOCUS_11270 12404 11808 gene locus_tag LOCUS_11280 12404 11808 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259574.1 protein_id gnl|my_center|LOCUS_11280 <13999 12391 gene locus_tag LOCUS_11290 <13999 12391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108723.1:DNA polymerase I >Feature sequence058 <1 538 gene locus_tag LOCUS_11300 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108455.1:DNA-directed RNA polymerase subunit beta' 674 1891 gene locus_tag LOCUS_11310 674 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 2044 2565 gene locus_tag LOCUS_11320 2044 2565 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766891.1 protein_id gnl|my_center|LOCUS_11320 2584 3822 gene locus_tag LOCUS_11330 2584 3822 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203444.1 protein_id gnl|my_center|LOCUS_11330 3865 7263 gene locus_tag LOCUS_11340 3865 7263 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765284.1 protein_id gnl|my_center|LOCUS_11340 4788 4706 gene locus_tag LOCUS_t00200 4788 4706 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 7263 9203 gene locus_tag LOCUS_11350 7263 9203 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767204.1 protein_id gnl|my_center|LOCUS_11350 9222 10547 gene locus_tag LOCUS_11360 9222 10547 CDS product DUF5000 domain-containing lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767203.1 protein_id gnl|my_center|LOCUS_11360 10564 11856 gene locus_tag LOCUS_11370 10564 11856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 11965 12570 gene locus_tag LOCUS_11380 11965 12570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 >Feature sequence059 174 623 gene locus_tag LOCUS_11390 gene dtd 174 623 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108726.1 protein_id gnl|my_center|LOCUS_11390 629 1282 gene locus_tag LOCUS_11400 629 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 1288 2460 gene locus_tag LOCUS_11410 1288 2460 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461101.1 protein_id gnl|my_center|LOCUS_11410 4626 2467 gene locus_tag LOCUS_11420 4626 2467 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202602.1 protein_id gnl|my_center|LOCUS_11420 6405 4633 gene locus_tag LOCUS_11430 6405 4633 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029327287.1 protein_id gnl|my_center|LOCUS_11430 6491 7114 gene locus_tag LOCUS_11440 6491 7114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 7126 8184 gene locus_tag LOCUS_11450 gene iolU 7126 8184 CDS product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228926.1 protein_id gnl|my_center|LOCUS_11450 9183 8191 gene locus_tag LOCUS_11460 9183 8191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 9260 10360 gene locus_tag LOCUS_11470 9260 10360 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785173.1 protein_id gnl|my_center|LOCUS_11470 10373 10954 gene locus_tag LOCUS_11480 10373 10954 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107376.1 protein_id gnl|my_center|LOCUS_11480 11541 10942 gene locus_tag LOCUS_11490 11541 10942 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840622.1 protein_id gnl|my_center|LOCUS_11490 12282 11545 gene locus_tag LOCUS_11500 12282 11545 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987068.1 protein_id gnl|my_center|LOCUS_11500 <12858 12301 gene locus_tag LOCUS_11510 <12858 12301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888563.1:glycerol kinase GlpK >Feature sequence060 <1 1181 gene locus_tag LOCUS_11520 <1 1181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_062695721.1:ATP-dependent zinc metalloprotease FtsH 1174 2004 gene locus_tag LOCUS_11530 1174 2004 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796208.1 protein_id gnl|my_center|LOCUS_11530 2001 2654 gene locus_tag LOCUS_11540 2001 2654 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_11540 3269 2655 gene locus_tag LOCUS_11550 3269 2655 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186915.1 protein_id gnl|my_center|LOCUS_11550 3697 3266 gene locus_tag LOCUS_11560 3697 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 3839 3910 gene locus_tag LOCUS_t00210 3839 3910 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 4324 5457 gene locus_tag LOCUS_11570 4324 5457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 5454 5843 gene locus_tag LOCUS_11580 5454 5843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 6108 6680 gene locus_tag LOCUS_11590 6108 6680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 9323 6735 gene locus_tag LOCUS_11600 9323 6735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 10425 9334 gene locus_tag LOCUS_11610 10425 9334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 10517 11539 gene locus_tag LOCUS_11620 10517 11539 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_11620 11661 12488 gene locus_tag LOCUS_11630 11661 12488 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972784.1 protein_id gnl|my_center|LOCUS_11630 >Feature sequence061 <1 1951 gene locus_tag LOCUS_11640 <1 1951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870178.1:glycyl radical protein 1964 3145 gene locus_tag LOCUS_11650 1964 3145 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202122.1 protein_id gnl|my_center|LOCUS_11650 4022 3135 gene locus_tag LOCUS_11660 4022 3135 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942747.1 protein_id gnl|my_center|LOCUS_11660 4069 5112 gene locus_tag LOCUS_11670 4069 5112 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615657.1 protein_id gnl|my_center|LOCUS_11670 6965 5109 gene locus_tag LOCUS_11680 6965 5109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 7030 7707 gene locus_tag LOCUS_11690 7030 7707 CDS product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139327955.1 protein_id gnl|my_center|LOCUS_11690 7692 8150 gene locus_tag LOCUS_11700 7692 8150 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_11700 9668 8154 gene locus_tag LOCUS_11710 9668 8154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 10489 9683 gene locus_tag LOCUS_11720 gene pyrF 10489 9683 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202194.1 protein_id gnl|my_center|LOCUS_11720 11885 10497 gene locus_tag LOCUS_11730 11885 10497 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203446.1 protein_id gnl|my_center|LOCUS_11730 <12522 11889 gene locus_tag LOCUS_11740 <12522 11889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764111.1:ATP-dependent Clp protease ATP-binding subunit ClpX >Feature sequence062 514 1671 gene locus_tag LOCUS_11750 514 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1735 3147 gene locus_tag LOCUS_11760 gene dnaB 1735 3147 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761250.1 protein_id gnl|my_center|LOCUS_11760 3152 3871 gene locus_tag LOCUS_11770 3152 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 5221 5146 gene locus_tag LOCUS_t00220 5221 5146 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5315 5242 gene locus_tag LOCUS_t00230 5315 5242 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 6463 5396 gene locus_tag LOCUS_11780 6463 5396 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048692555.1 protein_id gnl|my_center|LOCUS_11780 6580 7425 gene locus_tag LOCUS_11790 6580 7425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 7440 8399 gene locus_tag LOCUS_11800 7440 8399 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764421.1 protein_id gnl|my_center|LOCUS_11800 8411 9730 gene locus_tag LOCUS_11810 8411 9730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 10818 9727 gene locus_tag LOCUS_11820 10818 9727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 >Feature sequence063 1707 466 gene locus_tag LOCUS_11830 1707 466 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991765.1 protein_id gnl|my_center|LOCUS_11830 1760 2548 gene locus_tag LOCUS_11840 1760 2548 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265727.1 protein_id gnl|my_center|LOCUS_11840 3297 2752 gene locus_tag LOCUS_11850 3297 2752 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894834.1 protein_id gnl|my_center|LOCUS_11850 6552 3313 gene locus_tag LOCUS_11860 6552 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 8379 6559 gene locus_tag LOCUS_11870 8379 6559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 10690 8432 gene locus_tag LOCUS_11880 10690 8432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 11181 10687 gene locus_tag LOCUS_11890 11181 10687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 <12048 11185 gene locus_tag LOCUS_11900 <12048 11185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203671.1:aminopeptidase P family protein >Feature sequence064 115 639 gene locus_tag LOCUS_11910 115 639 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784663.1 protein_id gnl|my_center|LOCUS_11910 1686 658 gene locus_tag LOCUS_11920 gene recA 1686 658 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964335.1 protein_id gnl|my_center|LOCUS_11920 1811 2905 gene locus_tag LOCUS_11930 gene rlmN 1811 2905 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202252.1 protein_id gnl|my_center|LOCUS_11930 2892 5312 gene locus_tag LOCUS_11940 2892 5312 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203147.1 protein_id gnl|my_center|LOCUS_11940 5317 5811 gene locus_tag LOCUS_11950 5317 5811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 5820 6758 gene locus_tag LOCUS_11960 5820 6758 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785154.1 protein_id gnl|my_center|LOCUS_11960 6771 7760 gene locus_tag LOCUS_11970 6771 7760 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804212.1 protein_id gnl|my_center|LOCUS_11970 7765 9312 gene locus_tag LOCUS_11980 7765 9312 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267807.1 protein_id gnl|my_center|LOCUS_11980 9597 10469 gene locus_tag LOCUS_11990 9597 10469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 10460 11572 gene locus_tag LOCUS_12000 10460 11572 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039963.1 protein_id gnl|my_center|LOCUS_12000 >Feature sequence065 376 303 gene locus_tag LOCUS_t00240 376 303 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 482 934 gene locus_tag LOCUS_12010 482 934 CDS product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460334.1 protein_id gnl|my_center|LOCUS_12010 1647 1162 gene locus_tag LOCUS_12020 1647 1162 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_12020 2181 1735 gene locus_tag LOCUS_12030 2181 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 2229 2465 gene locus_tag LOCUS_12040 2229 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 2595 2521 gene locus_tag LOCUS_t00250 2595 2521 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3012 2620 gene locus_tag LOCUS_12050 gene rplS 3012 2620 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778830.1 protein_id gnl|my_center|LOCUS_12050 4083 3163 gene locus_tag LOCUS_12060 gene kduI 4083 3163 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109101.1 protein_id gnl|my_center|LOCUS_12060 5489 4080 gene locus_tag LOCUS_12070 5489 4080 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109102.1 protein_id gnl|my_center|LOCUS_12070 6317 5511 gene locus_tag LOCUS_12080 6317 5511 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762840.1 protein_id gnl|my_center|LOCUS_12080 6938 6399 gene locus_tag LOCUS_12090 6938 6399 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763367.1 protein_id gnl|my_center|LOCUS_12090 7065 10178 gene locus_tag LOCUS_12100 7065 10178 CDS product DUF6067 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203707.1 protein_id gnl|my_center|LOCUS_12100 10184 11122 gene locus_tag LOCUS_12110 10184 11122 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785907.1 protein_id gnl|my_center|LOCUS_12110 <11867 11129 gene locus_tag LOCUS_12120 <11867 11129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763399.1:molecular chaperone DnaJ >Feature sequence066 <1 814 gene locus_tag LOCUS_12130 <1 814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028721.1:phosphomannomutase/phosphoglucomutase 828 1880 gene locus_tag LOCUS_12140 828 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 1946 3340 gene locus_tag LOCUS_12150 1946 3340 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269382.1 protein_id gnl|my_center|LOCUS_12150 3352 4701 gene locus_tag LOCUS_12160 3352 4701 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767657.1 protein_id gnl|my_center|LOCUS_12160 7033 4739 gene locus_tag LOCUS_12170 7033 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 7623 7033 gene locus_tag LOCUS_12180 7623 7033 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203496.1 protein_id gnl|my_center|LOCUS_12180 9322 7628 gene locus_tag LOCUS_12190 9322 7628 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793588.1 protein_id gnl|my_center|LOCUS_12190 10104 9319 gene locus_tag LOCUS_12200 10104 9319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 10927 10109 gene locus_tag LOCUS_12210 10927 10109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 11042 11118 gene locus_tag LOCUS_t00260 11042 11118 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence067 <1 867 gene locus_tag LOCUS_12220 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791861.1:DNA helicase RecQ 1605 871 gene locus_tag LOCUS_12230 1605 871 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798966.1 protein_id gnl|my_center|LOCUS_12230 2762 1602 gene locus_tag LOCUS_12240 2762 1602 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769569.1 protein_id gnl|my_center|LOCUS_12240 3026 4816 gene locus_tag LOCUS_12250 3026 4816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 4884 5300 gene locus_tag LOCUS_12260 4884 5300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 5293 6090 gene locus_tag LOCUS_12270 5293 6090 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767683.1 protein_id gnl|my_center|LOCUS_12270 6087 6854 gene locus_tag LOCUS_12280 6087 6854 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767684.1 protein_id gnl|my_center|LOCUS_12280 6865 7656 gene locus_tag LOCUS_12290 6865 7656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 8521 7664 gene locus_tag LOCUS_12300 8521 7664 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896027.1 protein_id gnl|my_center|LOCUS_12300 8580 9224 gene locus_tag LOCUS_12310 8580 9224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 9240 11216 gene locus_tag LOCUS_12320 gene dnaG 9240 11216 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802118.1 protein_id gnl|my_center|LOCUS_12320 >Feature sequence068 1342 65 gene locus_tag LOCUS_12330 1342 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 1587 1402 gene locus_tag LOCUS_12340 1587 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 1729 3150 gene locus_tag LOCUS_12350 1729 3150 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764741.1 protein_id gnl|my_center|LOCUS_12350 3167 5713 gene locus_tag LOCUS_12360 3167 5713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 6171 6344 gene locus_tag LOCUS_12370 6171 6344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 6431 7627 gene locus_tag LOCUS_12380 6431 7627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 7692 7892 gene locus_tag LOCUS_12390 7692 7892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 9025 8096 gene locus_tag LOCUS_12400 9025 8096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 10655 9405 gene locus_tag LOCUS_12410 10655 9405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 11230 10661 gene locus_tag LOCUS_12420 11230 10661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 >Feature sequence069 420 1268 gene locus_tag LOCUS_12430 420 1268 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_12430 1282 2235 gene locus_tag LOCUS_12440 1282 2235 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_12440 2335 3030 gene locus_tag LOCUS_12450 gene radC 2335 3030 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801604.1 protein_id gnl|my_center|LOCUS_12450 3095 3748 gene locus_tag LOCUS_12460 gene upp 3095 3748 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791972.1 protein_id gnl|my_center|LOCUS_12460 5158 3743 gene locus_tag LOCUS_12470 gene rpoN 5158 3743 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203672.1 protein_id gnl|my_center|LOCUS_12470 5695 5165 gene locus_tag LOCUS_12480 5695 5165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 6165 5692 gene locus_tag LOCUS_12490 6165 5692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 6249 7526 gene locus_tag LOCUS_12500 6249 7526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 7523 8842 gene locus_tag LOCUS_12510 gene miaB 7523 8842 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767433.1 protein_id gnl|my_center|LOCUS_12510 8859 10373 gene locus_tag LOCUS_12520 gene cls 8859 10373 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243311.1 protein_id gnl|my_center|LOCUS_12520 <11582 10377 gene locus_tag LOCUS_12530 <11582 10377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765057.1:glutamine synthetase III >Feature sequence070 1661 906 gene locus_tag LOCUS_12540 1661 906 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393651.1 protein_id gnl|my_center|LOCUS_12540 3406 4656 gene locus_tag LOCUS_12550 gene gltS 3406 4656 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903453.1 protein_id gnl|my_center|LOCUS_12550 5529 4666 gene locus_tag LOCUS_12560 gene folP 5529 4666 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796563.1 protein_id gnl|my_center|LOCUS_12560 5595 6149 gene locus_tag LOCUS_12570 5595 6149 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948788.1 protein_id gnl|my_center|LOCUS_12570 6146 6850 gene locus_tag LOCUS_12580 6146 6850 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229736.1 protein_id gnl|my_center|LOCUS_12580 6847 8070 gene locus_tag LOCUS_12590 6847 8070 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105100232.1 protein_id gnl|my_center|LOCUS_12590 10883 8067 gene locus_tag LOCUS_12600 10883 8067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 11332 10928 gene locus_tag LOCUS_12610 11332 10928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 >Feature sequence071 214 141 gene locus_tag LOCUS_t00270 214 141 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1672 266 gene locus_tag LOCUS_12620 gene hisS 1672 266 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203280.1 protein_id gnl|my_center|LOCUS_12620 1759 3585 gene locus_tag LOCUS_12630 gene sppA 1759 3585 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203293.1 protein_id gnl|my_center|LOCUS_12630 4963 3578 gene locus_tag LOCUS_12640 gene tilS 4963 3578 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107882.1 protein_id gnl|my_center|LOCUS_12640 6073 4970 gene locus_tag LOCUS_12650 6073 4970 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_12650 7570 6092 gene locus_tag LOCUS_12660 gene proS 7570 6092 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107525.1 protein_id gnl|my_center|LOCUS_12660 7761 9113 gene locus_tag LOCUS_12670 7761 9113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 9174 10856 gene locus_tag LOCUS_12680 9174 10856 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760612.1 protein_id gnl|my_center|LOCUS_12680 >Feature sequence072 <1 655 gene locus_tag LOCUS_12690 <1 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839992.1:DPP IV N-terminal domain-containing protein 658 1242 gene locus_tag LOCUS_12700 658 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 2944 1214 gene locus_tag LOCUS_12710 2944 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 3967 2957 gene locus_tag LOCUS_12720 gene thiL 3967 2957 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964415.1 protein_id gnl|my_center|LOCUS_12720 4043 4891 gene locus_tag LOCUS_12730 4043 4891 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 protein_id gnl|my_center|LOCUS_12730 4902 6122 gene locus_tag LOCUS_12740 4902 6122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 6235 8025 gene locus_tag LOCUS_12750 6235 8025 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038270.1 protein_id gnl|my_center|LOCUS_12750 <11065 8145 gene locus_tag LOCUS_12760 <11065 8145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108651.1:GH92 family glycosyl hydrolase >Feature sequence073 20 745 gene locus_tag LOCUS_12770 20 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 726 2045 gene locus_tag LOCUS_12780 726 2045 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760037.1 protein_id gnl|my_center|LOCUS_12780 2077 3402 gene locus_tag LOCUS_12790 2077 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 3433 4050 gene locus_tag LOCUS_12800 3433 4050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 4123 6219 gene locus_tag LOCUS_12810 4123 6219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 6315 10250 gene locus_tag LOCUS_12820 6315 10250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 <11036 10254 gene locus_tag LOCUS_12830 <11036 10254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108642.1:redox-regulated ATPase YchF >Feature sequence074 2036 3895 gene locus_tag LOCUS_12840 2036 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 5718 3892 gene locus_tag LOCUS_12850 gene uvrC 5718 3892 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783702.1 protein_id gnl|my_center|LOCUS_12850 6805 5723 gene locus_tag LOCUS_12860 6805 5723 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203190.1 protein_id gnl|my_center|LOCUS_12860 9598 6821 gene locus_tag LOCUS_12870 9598 6821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 10933 9626 gene locus_tag LOCUS_12880 10933 9626 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118279.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence075 191 1363 gene locus_tag LOCUS_12890 gene uxuA 191 1363 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766742.1 protein_id gnl|my_center|LOCUS_12890 2165 1350 gene locus_tag LOCUS_12900 2165 1350 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766741.1 protein_id gnl|my_center|LOCUS_12900 3507 2176 gene locus_tag LOCUS_12910 3507 2176 CDS product putative oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108896.1 protein_id gnl|my_center|LOCUS_12910 4414 3512 gene locus_tag LOCUS_12920 4414 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 5413 4427 gene locus_tag LOCUS_12930 5413 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 6818 5418 gene locus_tag LOCUS_12940 6818 5418 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_12940 6944 8086 gene locus_tag LOCUS_12950 6944 8086 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767092.1 protein_id gnl|my_center|LOCUS_12950 8508 9272 gene locus_tag LOCUS_12960 8508 9272 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921844.1 protein_id gnl|my_center|LOCUS_12960 9369 10640 gene locus_tag LOCUS_12970 9369 10640 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141968.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence076 956 12 gene locus_tag LOCUS_12980 956 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 2294 966 gene locus_tag LOCUS_12990 gene rimO 2294 966 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787933.1 protein_id gnl|my_center|LOCUS_12990 2754 2299 gene locus_tag LOCUS_13000 2754 2299 CDS product DUF5606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760341.1 protein_id gnl|my_center|LOCUS_13000 3393 2791 gene locus_tag LOCUS_13010 gene coaE 3393 2791 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764748.1 protein_id gnl|my_center|LOCUS_13010 4367 3390 gene locus_tag LOCUS_13020 4367 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 4727 4392 gene locus_tag LOCUS_13030 gene yajC 4727 4392 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764747.1 protein_id gnl|my_center|LOCUS_13030 5725 4739 gene locus_tag LOCUS_13040 gene nusB 5725 4739 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768080.1 protein_id gnl|my_center|LOCUS_13040 5815 6189 gene locus_tag LOCUS_13050 5815 6189 CDS product PUR family DNA/RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962695.1 protein_id gnl|my_center|LOCUS_13050 6230 7249 gene locus_tag LOCUS_13060 6230 7249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13060 7277 7729 gene locus_tag LOCUS_13070 7277 7729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13070 7766 8668 gene locus_tag LOCUS_13080 7766 8668 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763946.1 protein_id gnl|my_center|LOCUS_13080 8686 9555 gene locus_tag LOCUS_13090 8686 9555 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764604.1 protein_id gnl|my_center|LOCUS_13090 10842 9631 gene locus_tag LOCUS_13100 10842 9631 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667343.1 protein_id gnl|my_center|LOCUS_13100 >Feature sequence077 1199 1717 gene locus_tag LOCUS_13110 1199 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 1725 3083 gene locus_tag LOCUS_13120 1725 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 3100 5859 gene locus_tag LOCUS_13130 gene leuS 3100 5859 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108648.1 protein_id gnl|my_center|LOCUS_13130 5868 6800 gene locus_tag LOCUS_13140 5868 6800 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108649.1 protein_id gnl|my_center|LOCUS_13140 6781 7740 gene locus_tag LOCUS_13150 6781 7740 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769516.1 protein_id gnl|my_center|LOCUS_13150 7856 8956 gene locus_tag LOCUS_13160 7856 8956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 9660 8926 gene locus_tag LOCUS_13170 9660 8926 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_13170 10093 9674 gene locus_tag LOCUS_13180 gene fabZ 10093 9674 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565430.1 protein_id gnl|my_center|LOCUS_13180 <10817 10106 gene locus_tag LOCUS_13190 <10817 10106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966836.1:beta-ketoacyl-ACP synthase II >Feature sequence078 <1 702 gene locus_tag LOCUS_13200 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005798804.1:transcription termination factor Rho 708 2264 gene locus_tag LOCUS_13210 708 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 2287 3633 gene locus_tag LOCUS_13220 2287 3633 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_13220 3643 4545 gene locus_tag LOCUS_13230 3643 4545 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723840.1 protein_id gnl|my_center|LOCUS_13230 7840 4598 gene locus_tag LOCUS_13240 gene carB 7840 4598 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788239.1 protein_id gnl|my_center|LOCUS_13240 8924 7848 gene locus_tag LOCUS_13250 gene carA 8924 7848 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788241.1 protein_id gnl|my_center|LOCUS_13250 9122 10537 gene locus_tag LOCUS_13260 gene mnmE 9122 10537 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202306.1 protein_id gnl|my_center|LOCUS_13260 >Feature sequence079 <1 877 gene locus_tag LOCUS_13270 <1 877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_019538492.1:methionyl-tRNA formyltransferase 874 1548 gene locus_tag LOCUS_13280 874 1548 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108280.1 protein_id gnl|my_center|LOCUS_13280 1585 3078 gene locus_tag LOCUS_13290 1585 3078 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765754.1 protein_id gnl|my_center|LOCUS_13290 3085 4476 gene locus_tag LOCUS_13300 3085 4476 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765753.1 protein_id gnl|my_center|LOCUS_13300 4717 4805 gene locus_tag LOCUS_t00280 4717 4805 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6513 5155 gene locus_tag LOCUS_13310 6513 5155 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_13310 7382 6516 gene locus_tag LOCUS_13320 7382 6516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 8724 7414 gene locus_tag LOCUS_13330 8724 7414 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201998.1 protein_id gnl|my_center|LOCUS_13330 9685 8738 gene locus_tag LOCUS_13340 9685 8738 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202768.1 protein_id gnl|my_center|LOCUS_13340 <10786 9698 gene locus_tag LOCUS_13350 <10786 9698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107412.1:F0F1 ATP synthase subunit alpha >Feature sequence080 567 1001 gene locus_tag LOCUS_13360 567 1001 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005641953.1 protein_id gnl|my_center|LOCUS_13360 1001 2662 gene locus_tag LOCUS_13370 1001 2662 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435782.1 protein_id gnl|my_center|LOCUS_13370 3210 2659 gene locus_tag LOCUS_13380 3210 2659 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879640.1 protein_id gnl|my_center|LOCUS_13380 3770 5200 gene locus_tag LOCUS_13390 3770 5200 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964479.1 protein_id gnl|my_center|LOCUS_13390 5217 6350 gene locus_tag LOCUS_13400 5217 6350 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733226.1 protein_id gnl|my_center|LOCUS_13400 6338 9154 gene locus_tag LOCUS_13410 6338 9154 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776704.1 protein_id gnl|my_center|LOCUS_13410 9205 9921 gene locus_tag LOCUS_13420 9205 9921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 >Feature sequence081 <1 1537 gene locus_tag LOCUS_13430 <1 1537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008658063.1:glycoside hydrolase family 127 protein 1622 3427 gene locus_tag LOCUS_13440 1622 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 3454 5277 gene locus_tag LOCUS_13450 3454 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 5287 7449 gene locus_tag LOCUS_13460 5287 7449 CDS product DUF5722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061473288.1 protein_id gnl|my_center|LOCUS_13460 9573 7639 gene locus_tag LOCUS_13470 9573 7639 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 protein_id gnl|my_center|LOCUS_13470 <10414 9589 gene locus_tag LOCUS_13480 <10414 9589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790424.1:ribonuclease Y >Feature sequence082 418 179 gene locus_tag LOCUS_13490 418 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 326 1516 gene locus_tag LOCUS_13500 326 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 4024 1517 gene locus_tag LOCUS_13510 gene hrpB 4024 1517 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887065.1 protein_id gnl|my_center|LOCUS_13510 6612 4021 gene locus_tag LOCUS_13520 6612 4021 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109093.1 protein_id gnl|my_center|LOCUS_13520 7616 6624 gene locus_tag LOCUS_13530 7616 6624 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390188.1 protein_id gnl|my_center|LOCUS_13530 7720 9084 gene locus_tag LOCUS_13540 7720 9084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 9090 9776 gene locus_tag LOCUS_13550 9090 9776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 <10403 9833 gene locus_tag LOCUS_13560 <10403 9833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785877.1:TrpB-like pyridoxal phosphate-dependent enzyme >Feature sequence083 2568 850 gene locus_tag LOCUS_13570 2568 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 3080 2565 gene locus_tag LOCUS_13580 gene folK 3080 2565 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783639.1 protein_id gnl|my_center|LOCUS_13580 3517 3086 gene locus_tag LOCUS_13590 3517 3086 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919725.1 protein_id gnl|my_center|LOCUS_13590 3923 3492 gene locus_tag LOCUS_13600 3923 3492 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003015065.1 protein_id gnl|my_center|LOCUS_13600 5175 3949 gene locus_tag LOCUS_13610 5175 3949 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_13610 5237 5830 gene locus_tag LOCUS_13620 gene ruvA 5237 5830 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790555.1 protein_id gnl|my_center|LOCUS_13620 7786 5873 gene locus_tag LOCUS_13630 gene mnmG 7786 5873 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783704.1 protein_id gnl|my_center|LOCUS_13630 8290 7862 gene locus_tag LOCUS_13640 gene ybeY 8290 7862 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108739.1 protein_id gnl|my_center|LOCUS_13640 8428 9120 gene locus_tag LOCUS_13650 8428 9120 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761051.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence084 345 1010 gene locus_tag LOCUS_13660 345 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 1007 1720 gene locus_tag LOCUS_13670 gene rsmI 1007 1720 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108201.1 protein_id gnl|my_center|LOCUS_13670 1756 2706 gene locus_tag LOCUS_13680 1756 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 3534 2659 gene locus_tag LOCUS_13690 gene xerD 3534 2659 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791940.1 protein_id gnl|my_center|LOCUS_13690 5537 3543 gene locus_tag LOCUS_13700 5537 3543 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769535.1 protein_id gnl|my_center|LOCUS_13700 5653 7008 gene locus_tag LOCUS_13710 5653 7008 CDS product clostripain-related cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202581.1 protein_id gnl|my_center|LOCUS_13710 7113 7700 gene locus_tag LOCUS_13720 7113 7700 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760337.1 protein_id gnl|my_center|LOCUS_13720 7737 8324 gene locus_tag LOCUS_13730 gene pth 7737 8324 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785758.1 protein_id gnl|my_center|LOCUS_13730 8460 8636 gene locus_tag LOCUS_13740 8460 8636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 9431 8709 gene locus_tag LOCUS_13750 gene tpiA 9431 8709 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760849.1 protein_id gnl|my_center|LOCUS_13750 >Feature sequence085 <1 882 gene locus_tag LOCUS_13760 <1 882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940210.1:glutamine--tRNA ligase/YqeY domain fusion protein 958 1752 gene locus_tag LOCUS_13770 958 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 1749 3203 gene locus_tag LOCUS_13780 1749 3203 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_13780 3211 4695 gene locus_tag LOCUS_13790 3211 4695 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202124.1 protein_id gnl|my_center|LOCUS_13790 4704 6857 gene locus_tag LOCUS_13800 4704 6857 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057163.1 protein_id gnl|my_center|LOCUS_13800 6863 8185 gene locus_tag LOCUS_13810 6863 8185 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582782.1 protein_id gnl|my_center|LOCUS_13810 8224 9885 gene locus_tag LOCUS_13820 8224 9885 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786230.1 protein_id gnl|my_center|LOCUS_13820 >Feature sequence086 1454 315 gene locus_tag LOCUS_13830 gene lpxK 1454 315 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292736.1 protein_id gnl|my_center|LOCUS_13830 2340 1462 gene locus_tag LOCUS_13840 gene purU 2340 1462 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762395.1 protein_id gnl|my_center|LOCUS_13840 2583 3572 gene locus_tag LOCUS_13850 2583 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 3700 5703 gene locus_tag LOCUS_13860 3700 5703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 6237 5707 gene locus_tag LOCUS_13870 6237 5707 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931087.1 protein_id gnl|my_center|LOCUS_13870 6311 6481 gene locus_tag LOCUS_13880 6311 6481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 7503 6469 gene locus_tag LOCUS_13890 gene dusB 7503 6469 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108618.1 protein_id gnl|my_center|LOCUS_13890 8279 7500 gene locus_tag LOCUS_13900 8279 7500 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943899.1 protein_id gnl|my_center|LOCUS_13900 >Feature sequence087 582 508 gene locus_tag LOCUS_t00290 582 508 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 808 608 gene locus_tag LOCUS_13910 gene rpsT 808 608 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767624.1 protein_id gnl|my_center|LOCUS_13910 956 882 gene locus_tag LOCUS_t00300 956 882 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3293 1035 gene locus_tag LOCUS_13920 3293 1035 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762490.1 protein_id gnl|my_center|LOCUS_13920 4318 3290 gene locus_tag LOCUS_13930 4318 3290 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785463.1 protein_id gnl|my_center|LOCUS_13930 5684 4350 gene locus_tag LOCUS_13940 gene rseP 5684 4350 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203410.1 protein_id gnl|my_center|LOCUS_13940 6862 5681 gene locus_tag LOCUS_13950 6862 5681 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802379.1 protein_id gnl|my_center|LOCUS_13950 7723 6872 gene locus_tag LOCUS_13960 7723 6872 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108084.1 protein_id gnl|my_center|LOCUS_13960 7769 8194 gene locus_tag LOCUS_13970 gene ruvX 7769 8194 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786562.1 protein_id gnl|my_center|LOCUS_13970 8191 8745 gene locus_tag LOCUS_13980 gene def 8191 8745 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786565.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence088 1959 709 gene locus_tag LOCUS_13990 1959 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 2903 2133 gene locus_tag LOCUS_14000 2903 2133 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222589.1 protein_id gnl|my_center|LOCUS_14000 6478 2900 gene locus_tag LOCUS_14010 6478 2900 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062542257.1 protein_id gnl|my_center|LOCUS_14010 6945 6475 gene locus_tag LOCUS_14020 gene rlmH 6945 6475 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786211.1 protein_id gnl|my_center|LOCUS_14020 7000 7404 gene locus_tag LOCUS_14030 7000 7404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 7423 9063 gene locus_tag LOCUS_14040 gene lnt 7423 9063 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933164.1 protein_id gnl|my_center|LOCUS_14040 >Feature sequence089 3233 414 gene locus_tag LOCUS_14050 gene uvrA 3233 414 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813763.1 protein_id gnl|my_center|LOCUS_14050 5424 3253 gene locus_tag LOCUS_14060 5424 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 5506 6177 gene locus_tag LOCUS_14070 5506 6177 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889182.1 protein_id gnl|my_center|LOCUS_14070 6186 7475 gene locus_tag LOCUS_14080 6186 7475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 >Feature sequence090 <1 1050 gene locus_tag LOCUS_14090 <1 1050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048248.1:NADPH-dependent glutamate synthase 1054 1374 gene locus_tag LOCUS_14100 1054 1374 CDS product DUF4491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797188.1 protein_id gnl|my_center|LOCUS_14100 1751 1446 gene locus_tag LOCUS_14110 1751 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 3719 1917 gene locus_tag LOCUS_14120 gene argS 3719 1917 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765307.1 protein_id gnl|my_center|LOCUS_14120 4572 3712 gene locus_tag LOCUS_14130 4572 3712 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_14130 6131 4659 gene locus_tag LOCUS_14140 6131 4659 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_14140 6268 7386 gene locus_tag LOCUS_14150 gene dnaN 6268 7386 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788748.1 protein_id gnl|my_center|LOCUS_14150 7399 8376 gene locus_tag LOCUS_14160 7399 8376 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_14160 8116 8023 gene locus_tag LOCUS_t00310 8116 8023 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 <8916 8368 gene locus_tag LOCUS_14170 <8916 8368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201906.1:L-fucose:H+ symporter permease >Feature sequence091 2818 737 gene locus_tag LOCUS_14180 2818 737 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963110.1 protein_id gnl|my_center|LOCUS_14180 2901 4424 gene locus_tag LOCUS_14190 2901 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 5654 4425 gene locus_tag LOCUS_14200 5654 4425 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765300.1 protein_id gnl|my_center|LOCUS_14200 5743 7131 gene locus_tag LOCUS_14210 5743 7131 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895536.1 protein_id gnl|my_center|LOCUS_14210 8030 7128 gene locus_tag LOCUS_14220 8030 7128 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769918.1 protein_id gnl|my_center|LOCUS_14220 >Feature sequence092 2885 3619 gene locus_tag LOCUS_14230 2885 3619 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524612.1 protein_id gnl|my_center|LOCUS_14230 3616 3996 gene locus_tag LOCUS_14240 gene folB 3616 3996 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203462.1 protein_id gnl|my_center|LOCUS_14240 3986 5230 gene locus_tag LOCUS_14250 gene mtaB 3986 5230 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763943.1 protein_id gnl|my_center|LOCUS_14250 5231 6172 gene locus_tag LOCUS_14260 5231 6172 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403269.1 protein_id gnl|my_center|LOCUS_14260 8058 6148 gene locus_tag LOCUS_14270 8058 6148 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 protein_id gnl|my_center|LOCUS_14270 >Feature sequence093 3384 247 gene locus_tag LOCUS_14280 3384 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202277.1 protein_id gnl|my_center|LOCUS_14280 3435 4415 gene locus_tag LOCUS_14290 3435 4415 CDS product DUF5106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793053.1 protein_id gnl|my_center|LOCUS_14290 4422 5471 gene locus_tag LOCUS_14300 4422 5471 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_14300 5482 6276 gene locus_tag LOCUS_14310 5482 6276 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691712.1 protein_id gnl|my_center|LOCUS_14310 6326 6832 gene locus_tag LOCUS_14320 gene folA 6326 6832 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648125.1 protein_id gnl|my_center|LOCUS_14320 6878 8167 gene locus_tag LOCUS_14330 6878 8167 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762587.1 protein_id gnl|my_center|LOCUS_14330 >Feature sequence094 165 1709 gene locus_tag LOCUS_14340 165 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 2667 1696 gene locus_tag LOCUS_14350 2667 1696 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873993.1 protein_id gnl|my_center|LOCUS_14350 3227 2664 gene locus_tag LOCUS_14360 3227 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 4036 3224 gene locus_tag LOCUS_14370 4036 3224 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082267.1 protein_id gnl|my_center|LOCUS_14370 4186 5583 gene locus_tag LOCUS_14380 4186 5583 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596611.1 protein_id gnl|my_center|LOCUS_14380 5755 7536 gene locus_tag LOCUS_14390 5755 7536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 <8405 7609 gene locus_tag LOCUS_14400 <8405 7609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765908.1:pyruvate carboxylase subunit B >Feature sequence095 1677 1468 gene locus_tag LOCUS_14410 1677 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 1870 2295 gene locus_tag LOCUS_14420 1870 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 2312 2932 gene locus_tag LOCUS_14430 2312 2932 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796757.1 protein_id gnl|my_center|LOCUS_14430 2954 5116 gene locus_tag LOCUS_14440 2954 5116 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789096.1 protein_id gnl|my_center|LOCUS_14440 5116 6186 gene locus_tag LOCUS_14450 5116 6186 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791723.1 protein_id gnl|my_center|LOCUS_14450 6269 6757 gene locus_tag LOCUS_14460 6269 6757 CDS product DUF4890 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108962.1 protein_id gnl|my_center|LOCUS_14460 <8392 6700 gene locus_tag LOCUS_14470 <8392 6700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010922720.1:cysteine proteinase exotoxin SpeB >Feature sequence096 <1 908 gene locus_tag LOCUS_14480 <1 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107261.1:tetratricopeptide repeat protein 908 1732 gene locus_tag LOCUS_14490 908 1732 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761509.1 protein_id gnl|my_center|LOCUS_14490 1800 2396 gene locus_tag LOCUS_14500 1800 2396 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894834.1 protein_id gnl|my_center|LOCUS_14500 3740 2409 gene locus_tag LOCUS_14510 3740 2409 CDS product IgA Peptidase M64 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797944.1 protein_id gnl|my_center|LOCUS_14510 3788 4420 gene locus_tag LOCUS_14520 3788 4420 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990647.1 protein_id gnl|my_center|LOCUS_14520 4577 5737 gene locus_tag LOCUS_14530 4577 5737 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764891.1 protein_id gnl|my_center|LOCUS_14530 5773 7548 gene locus_tag LOCUS_14540 gene fucI 5773 7548 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779363.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence097 <1 2234 gene locus_tag LOCUS_14550 <1 2234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009039946.1:polysaccharide biosynthesis tyrosine autokinase 2244 2654 gene locus_tag LOCUS_14560 2244 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039966.1 protein_id gnl|my_center|LOCUS_14560 2651 2911 gene locus_tag LOCUS_14570 2651 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 2932 3879 gene locus_tag LOCUS_14580 2932 3879 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107079.1 protein_id gnl|my_center|LOCUS_14580 4173 4009 gene locus_tag LOCUS_14590 4173 4009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 4879 4184 gene locus_tag LOCUS_14600 4879 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 5454 5110 gene locus_tag LOCUS_14610 5454 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 6552 6480 gene locus_tag LOCUS_t00320 6552 6480 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6781 6599 gene locus_tag LOCUS_14620 gene rpmF 6781 6599 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562387.1 protein_id gnl|my_center|LOCUS_14620 7340 6804 gene locus_tag LOCUS_14630 7340 6804 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814383.1 protein_id gnl|my_center|LOCUS_14630 7734 7411 gene locus_tag LOCUS_14640 7734 7411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14640 >Feature sequence098 316 999 gene locus_tag LOCUS_14650 316 999 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765906.1 protein_id gnl|my_center|LOCUS_14650 2855 1083 gene locus_tag LOCUS_14660 2855 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 3540 2875 gene locus_tag LOCUS_14670 3540 2875 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538563.1 protein_id gnl|my_center|LOCUS_14670 5414 3537 gene locus_tag LOCUS_14680 gene yidC 5414 3537 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763174.1 protein_id gnl|my_center|LOCUS_14680 7547 5421 gene locus_tag LOCUS_14690 7547 5421 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764283.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence099 1168 341 gene locus_tag LOCUS_14700 1168 341 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963938.1 protein_id gnl|my_center|LOCUS_14700 2013 1165 gene locus_tag LOCUS_14710 2013 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 3409 2024 gene locus_tag LOCUS_14720 3409 2024 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_14720 4324 3413 gene locus_tag LOCUS_14730 4324 3413 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_14730 5419 4382 gene locus_tag LOCUS_14740 gene holA 5419 4382 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_14740 5719 5426 gene locus_tag LOCUS_14750 5719 5426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 6677 5703 gene locus_tag LOCUS_14760 6677 5703 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963321.1 protein_id gnl|my_center|LOCUS_14760 <7843 6661 gene locus_tag LOCUS_14770 <7843 6661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839799.1:HD domain-containing protein >Feature sequence100 1615 770 gene locus_tag LOCUS_14780 1615 770 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963408.1 protein_id gnl|my_center|LOCUS_14780 2172 1618 gene locus_tag LOCUS_14790 gene updY 2172 1618 CDS product capsular polysaccharide transcription antiterminator UpdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770021.1 protein_id gnl|my_center|LOCUS_14790 4631 2412 gene locus_tag LOCUS_14800 4631 2412 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107405.1 protein_id gnl|my_center|LOCUS_14800 5685 4648 gene locus_tag LOCUS_14810 gene mltG 5685 4648 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_14810 6950 5691 gene locus_tag LOCUS_14820 6950 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 >Feature sequence101 1633 218 gene locus_tag LOCUS_14830 1633 218 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201994.1 protein_id gnl|my_center|LOCUS_14830 1722 4967 gene locus_tag LOCUS_14840 1722 4967 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005821947.1 protein_id gnl|my_center|LOCUS_14840 4974 5693 gene locus_tag LOCUS_14850 4974 5693 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203156.1 protein_id gnl|my_center|LOCUS_14850 5695 7074 gene locus_tag LOCUS_14860 5695 7074 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037401.1 protein_id gnl|my_center|LOCUS_14860 >Feature sequence102 1098 1631 gene locus_tag LOCUS_14870 1098 1631 CDS product DUF4251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202632.1 protein_id gnl|my_center|LOCUS_14870 2811 1612 gene locus_tag LOCUS_14880 2811 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 3022 2932 gene locus_tag LOCUS_t00330 3022 2932 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4969 3227 gene locus_tag LOCUS_14890 4969 3227 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769526.1 protein_id gnl|my_center|LOCUS_14890 <7144 4984 gene locus_tag LOCUS_14900 <7144 4984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008658407.1:TonB-dependent receptor >Feature sequence103 1927 89 gene locus_tag LOCUS_14910 1927 89 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203603.1 protein_id gnl|my_center|LOCUS_14910 2081 2734 gene locus_tag LOCUS_14920 2081 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 2749 3450 gene locus_tag LOCUS_14930 2749 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 3447 4463 gene locus_tag LOCUS_14940 gene miaA 3447 4463 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759993.1 protein_id gnl|my_center|LOCUS_14940 4573 5040 gene locus_tag LOCUS_14950 gene purE 4573 5040 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880741.1 protein_id gnl|my_center|LOCUS_14950 5070 6425 gene locus_tag LOCUS_14960 gene gdhA 5070 6425 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_14960 6435 6821 gene locus_tag LOCUS_14970 6435 6821 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_14970 >Feature sequence104 2202 385 gene locus_tag LOCUS_14980 2202 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 5315 2253 gene locus_tag LOCUS_14990 5315 2253 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_14990 <6933 5426 gene locus_tag LOCUS_15000 <6933 5426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108531.1:hybrid sensor histidine kinase/response regulator transcription factor >Feature sequence105 <1 917 gene locus_tag LOCUS_15010 <1 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003228960.1:flotillin lipid rafts scaffold protein FloT 924 1160 gene locus_tag LOCUS_15020 924 1160 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231396.1 protein_id gnl|my_center|LOCUS_15020 2576 1176 gene locus_tag LOCUS_15030 2576 1176 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794507.1 protein_id gnl|my_center|LOCUS_15030 2639 4048 gene locus_tag LOCUS_15040 2639 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 5115 4003 gene locus_tag LOCUS_15050 5115 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 6556 5117 gene locus_tag LOCUS_15060 6556 5117 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533356.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence106 80 2323 gene locus_tag LOCUS_15070 gene pbpC 80 2323 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992445.1 protein_id gnl|my_center|LOCUS_15070 3815 2328 gene locus_tag LOCUS_15080 3815 2328 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016326.1 protein_id gnl|my_center|LOCUS_15080 4600 3821 gene locus_tag LOCUS_15090 gene murI 4600 3821 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099300.1 protein_id gnl|my_center|LOCUS_15090 5040 5504 gene locus_tag LOCUS_15100 5040 5504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 5516 5713 gene locus_tag LOCUS_15110 5516 5713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 5714 6157 gene locus_tag LOCUS_15120 5714 6157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 >Feature sequence107 <1 3278 gene locus_tag LOCUS_15130 <1 3278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107318.1:glutamate synthase large subunit 3285 4631 gene locus_tag LOCUS_15140 3285 4631 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763133.1 protein_id gnl|my_center|LOCUS_15140 4631 6250 gene locus_tag LOCUS_15150 4631 6250 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763175.1 protein_id gnl|my_center|LOCUS_15150 >Feature sequence108 2489 1653 gene locus_tag LOCUS_15160 gene cdaA 2489 1653 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779023.1 protein_id gnl|my_center|LOCUS_15160 2681 3277 gene locus_tag LOCUS_15170 gene rplC 2681 3277 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782189.1 protein_id gnl|my_center|LOCUS_15170 3281 3910 gene locus_tag LOCUS_15180 gene rplD 3281 3910 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782191.1 protein_id gnl|my_center|LOCUS_15180 3923 4213 gene locus_tag LOCUS_15190 gene rplW 3923 4213 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791542.1 protein_id gnl|my_center|LOCUS_15190 4227 5054 gene locus_tag LOCUS_15200 gene rplB 4227 5054 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791545.1 protein_id gnl|my_center|LOCUS_15200 5082 5354 gene locus_tag LOCUS_15210 gene rpsS 5082 5354 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_15210 5376 5801 gene locus_tag LOCUS_15220 gene rplV 5376 5801 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558069.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence109 306 1448 gene locus_tag LOCUS_15230 306 1448 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789543.1 protein_id gnl|my_center|LOCUS_15230 1510 2808 gene locus_tag LOCUS_15240 1510 2808 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_15240 3945 2926 gene locus_tag LOCUS_15250 3945 2926 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087473.1 protein_id gnl|my_center|LOCUS_15250 4063 4671 gene locus_tag LOCUS_15260 4063 4671 CDS product V-type ATP synthase subunit E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788438.1 protein_id gnl|my_center|LOCUS_15260 4684 5292 gene locus_tag LOCUS_15270 4684 5292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence110 1 1695 gene locus_tag LOCUS_15280 1 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 1699 2418 gene locus_tag LOCUS_15290 1699 2418 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_15290 2415 3449 gene locus_tag LOCUS_15300 2415 3449 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799038.1 protein_id gnl|my_center|LOCUS_15300 3446 4684 gene locus_tag LOCUS_15310 3446 4684 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107343.1 protein_id gnl|my_center|LOCUS_15310 4691 5692 gene locus_tag LOCUS_15320 4691 5692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 >Feature sequence111 1809 16 gene locus_tag LOCUS_15330 1809 16 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107811.1 protein_id gnl|my_center|LOCUS_15330 2175 1816 gene locus_tag LOCUS_15340 2175 1816 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815873.1 protein_id gnl|my_center|LOCUS_15340 3601 2189 gene locus_tag LOCUS_15350 3601 2189 CDS product calcineurin-like phosphoesterase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766056.1 protein_id gnl|my_center|LOCUS_15350 3671 5056 gene locus_tag LOCUS_15360 gene glpT 3671 5056 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948732.1 protein_id gnl|my_center|LOCUS_15360 5126 5665 gene locus_tag LOCUS_15370 gene grpE 5126 5665 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_15370 >Feature sequence112 1279 716 gene locus_tag LOCUS_15380 1279 716 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357763.1 protein_id gnl|my_center|LOCUS_15380 1394 2125 gene locus_tag LOCUS_15390 1394 2125 CDS product DUF5020 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790377.1 protein_id gnl|my_center|LOCUS_15390 2156 3490 gene locus_tag LOCUS_15400 2156 3490 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 protein_id gnl|my_center|LOCUS_15400 3667 5904 gene locus_tag LOCUS_15410 gene nrdD 3667 5904 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083208.1 protein_id gnl|my_center|LOCUS_15410 >Feature sequence113 <1 912 gene locus_tag LOCUS_15420 <1 912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787210.1:NADH:ubiquinone reductase (Na(+)-transporting) subunit F 1370 972 gene locus_tag LOCUS_15430 1370 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 1502 2209 gene locus_tag LOCUS_15440 gene deoD 1502 2209 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843292.1 protein_id gnl|my_center|LOCUS_15440 2908 2237 gene locus_tag LOCUS_15450 2908 2237 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788379.1 protein_id gnl|my_center|LOCUS_15450 3958 2921 gene locus_tag LOCUS_15460 3958 2921 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_15460 4827 3985 gene locus_tag LOCUS_15470 gene kduI 4827 3985 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762839.1 protein_id gnl|my_center|LOCUS_15470 <5947 4829 gene locus_tag LOCUS_15480 <5947 4829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764329.1:MFS transporter >Feature sequence114 368 817 gene locus_tag LOCUS_15490 368 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 1861 890 gene locus_tag LOCUS_15500 1861 890 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963746.1 protein_id gnl|my_center|LOCUS_15500 2399 1866 gene locus_tag LOCUS_15510 2399 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 3859 2516 gene locus_tag LOCUS_15520 gene gdhA 3859 2516 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051757.1 protein_id gnl|my_center|LOCUS_15520 5127 4111 gene locus_tag LOCUS_15530 gene tsaD 5127 4111 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_15530 5573 5124 gene locus_tag LOCUS_15540 gene rimI 5573 5124 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243019.1 protein_id gnl|my_center|LOCUS_15540 >Feature sequence115 2076 568 gene locus_tag LOCUS_15550 2076 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 3731 2097 gene locus_tag LOCUS_15560 3731 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 5013 3754 gene locus_tag LOCUS_15570 5013 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 >Feature sequence116 <1 1318 gene locus_tag LOCUS_15580 <1 1318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099259854.1:putative sulfate exporter family transporter 1332 1601 gene locus_tag LOCUS_15590 1332 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 1598 2251 gene locus_tag LOCUS_15600 1598 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 2260 3039 gene locus_tag LOCUS_15610 2260 3039 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108741.1 protein_id gnl|my_center|LOCUS_15610 4272 3130 gene locus_tag LOCUS_15620 gene galK 4272 3130 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800633.1 protein_id gnl|my_center|LOCUS_15620 5377 4370 gene locus_tag LOCUS_15630 5377 4370 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815003.1 protein_id gnl|my_center|LOCUS_15630 >Feature sequence117 138 1784 gene locus_tag LOCUS_15640 138 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 2666 1791 gene locus_tag LOCUS_15650 gene miaA 2666 1791 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759877.1 protein_id gnl|my_center|LOCUS_15650 3253 2672 gene locus_tag LOCUS_15660 3253 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 3411 3968 gene locus_tag LOCUS_15670 3411 3968 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794496.1 protein_id gnl|my_center|LOCUS_15670 3978 4883 gene locus_tag LOCUS_15680 gene pyrB 3978 4883 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787548.1 protein_id gnl|my_center|LOCUS_15680 >Feature sequence118 1703 2158 gene locus_tag LOCUS_15690 gene smpB 1703 2158 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780358.1 protein_id gnl|my_center|LOCUS_15690 2174 3547 gene locus_tag LOCUS_15700 2174 3547 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108981.1 protein_id gnl|my_center|LOCUS_15700 4899 3553 gene locus_tag LOCUS_15710 gene metK 4899 3553 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762826.1 protein_id gnl|my_center|LOCUS_15710 >Feature sequence119 <1 519 gene locus_tag LOCUS_15720 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727913.1:FAD-dependent oxidoreductase 516 2006 gene locus_tag LOCUS_15730 516 2006 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298170.1 protein_id gnl|my_center|LOCUS_15730 2003 2884 gene locus_tag LOCUS_15740 2003 2884 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038545.1 protein_id gnl|my_center|LOCUS_15740 4906 2894 gene locus_tag LOCUS_15750 4906 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 >Feature sequence120 <1 1503 gene locus_tag LOCUS_15760 <1 1503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786230.1:phospho-sugar mutase 3573 1588 gene locus_tag LOCUS_15770 3573 1588 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108029.1 protein_id gnl|my_center|LOCUS_15770 <5037 3591 gene locus_tag LOCUS_15780 <5037 3591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460214.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence121 1095 2393 gene locus_tag LOCUS_15790 1095 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 2517 4436 gene locus_tag LOCUS_15800 2517 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 >Feature sequence122 2248 1934 gene locus_tag LOCUS_15810 2248 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 2402 4351 gene locus_tag LOCUS_15820 2402 4351 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878757.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence123 349 2283 gene locus_tag LOCUS_15830 349 2283 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203149.1 protein_id gnl|my_center|LOCUS_15830 2308 3105 gene locus_tag LOCUS_15840 gene nagB 2308 3105 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237064.1 protein_id gnl|my_center|LOCUS_15840 3110 4018 gene locus_tag LOCUS_15850 3110 4018 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907889.1 protein_id gnl|my_center|LOCUS_15850 <4848 4032 gene locus_tag LOCUS_15860 <4848 4032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763773.1:O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase >Feature sequence124 1496 267 gene locus_tag LOCUS_15870 gene pepT 1496 267 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764742.1 protein_id gnl|my_center|LOCUS_15870 3471 1501 gene locus_tag LOCUS_15880 3471 1501 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763503.1 protein_id gnl|my_center|LOCUS_15880 >Feature sequence125 <1 620 gene locus_tag LOCUS_15890 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058222.1:adenosylhomocysteinase 648 2054 gene locus_tag LOCUS_15900 gene nhaA 648 2054 CDS product sodium/proton antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049644.1 protein_id gnl|my_center|LOCUS_15900 3125 2058 gene locus_tag LOCUS_15910 3125 2058 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_15910 3573 3175 gene locus_tag LOCUS_15920 3573 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 <4599 3606 gene locus_tag LOCUS_15930 <4599 3606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109374.1:endonuclease MutS2 >Feature sequence126 103 1134 gene locus_tag LOCUS_15940 103 1134 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622700.1 protein_id gnl|my_center|LOCUS_15940 1788 1141 gene locus_tag LOCUS_15950 1788 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 2710 1802 gene locus_tag LOCUS_15960 2710 1802 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099535.1 protein_id gnl|my_center|LOCUS_15960 2820 3821 gene locus_tag LOCUS_15970 2820 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 <4575 3784 gene locus_tag LOCUS_15980 <4575 3784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000743599.1:DUF1846 domain-containing protein >Feature sequence127 3975 448 gene locus_tag LOCUS_15990 gene nifJ 3975 448 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767789.1 protein_id gnl|my_center|LOCUS_15990 <4512 4001 gene locus_tag LOCUS_16000 <4512 4001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962577.1:ACP S-malonyltransferase >Feature sequence128 1578 478 gene locus_tag LOCUS_16010 1578 478 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767104.1 protein_id gnl|my_center|LOCUS_16010 2218 1586 gene locus_tag LOCUS_16020 gene pnuC 2218 1586 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202077.1 protein_id gnl|my_center|LOCUS_16020 2281 4440 gene locus_tag LOCUS_16030 2281 4440 CDS product DUF5722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061473288.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence129 2667 1645 gene locus_tag LOCUS_16040 gene tsaD 2667 1645 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107518.1 protein_id gnl|my_center|LOCUS_16040 >Feature sequence130 1360 2532 gene locus_tag LOCUS_16050 1360 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 2550 3929 gene locus_tag LOCUS_16060 2550 3929 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107715.1 protein_id gnl|my_center|LOCUS_16060 >Feature sequence131 1253 819 gene locus_tag LOCUS_16070 1253 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 1301 2194 gene locus_tag LOCUS_16080 1301 2194 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761539.1 protein_id gnl|my_center|LOCUS_16080 2234 2629 gene locus_tag LOCUS_tm00010 2234 2629 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 3319 3798 gene locus_tag LOCUS_16090 gene bcp 3319 3798 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785789.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence132 1238 252 gene locus_tag LOCUS_16100 1238 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 3625 1250 gene locus_tag LOCUS_16110 3625 1250 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 protein_id gnl|my_center|LOCUS_16110 >Feature sequence133 >Feature sequence134 <1 698 gene locus_tag LOCUS_16120 <1 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203504.1:ComEC/Rec2 family competence protein 1689 691 gene locus_tag LOCUS_16130 1689 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 1771 2721 gene locus_tag LOCUS_16140 1771 2721 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785727.1 protein_id gnl|my_center|LOCUS_16140 2778 3449 gene locus_tag LOCUS_16150 2778 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 >Feature sequence135 439 1713 gene locus_tag LOCUS_16160 439 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201881.1 protein_id gnl|my_center|LOCUS_16160 <4167 2031 gene locus_tag LOCUS_16170 <4167 2031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202068.1:glycoside hydrolase family 78 protein >Feature sequence136 1736 570 gene locus_tag LOCUS_16180 1736 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 3804 1789 gene locus_tag LOCUS_16190 3804 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence137 124 2043 gene locus_tag LOCUS_16200 124 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 2049 3842 gene locus_tag LOCUS_16210 2049 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 >Feature sequence138 1595 648 gene locus_tag LOCUS_16220 gene corA 1595 648 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943935.1 protein_id gnl|my_center|LOCUS_16220 2755 1727 gene locus_tag LOCUS_16230 2755 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 3729 2764 gene locus_tag LOCUS_16240 3729 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 >Feature sequence139 180 2924 gene locus_tag LOCUS_16250 180 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 3341 2928 gene locus_tag LOCUS_16260 3341 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 <3963 3347 gene locus_tag LOCUS_16270 <3963 3347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013363706.1:DNA methylase >Feature sequence140 246 1532 gene locus_tag LOCUS_16280 246 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 1562 3124 gene locus_tag LOCUS_16290 1562 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 <3948 3188 gene locus_tag LOCUS_16300 <3948 3188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048268.1:peptide chain release factor 3 >Feature sequence141 2541 1858 gene locus_tag LOCUS_16310 2541 1858 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964113.1 protein_id gnl|my_center|LOCUS_16310 <3937 2585 gene locus_tag LOCUS_16320 <3937 2585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202755.1:UvrD-helicase domain-containing protein >Feature sequence142 1732 3252 gene locus_tag LOCUS_16330 1732 3252 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203676.1 protein_id gnl|my_center|LOCUS_16330 <3909 3242 gene locus_tag LOCUS_16340 <3909 3242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963266.1:4-hydroxy-tetrahydrodipicolinate reductase >Feature sequence143 <1 1148 gene locus_tag LOCUS_16350 <1 1148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008769257.1:TonB-dependent receptor 1152 2924 gene locus_tag LOCUS_16360 1152 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 3823 3047 gene locus_tag LOCUS_16370 gene truA 3823 3047 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785168.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence144 <1 927 gene locus_tag LOCUS_16380 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272358.1:1,4-alpha-glucan branching protein GlgB 932 3352 gene locus_tag LOCUS_16390 932 3352 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272357.1 protein_id gnl|my_center|LOCUS_16390 >Feature sequence145 416 814 gene locus_tag LOCUS_16400 416 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 818 1018 gene locus_tag LOCUS_16410 818 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 1015 2673 gene locus_tag LOCUS_16420 1015 2673 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127897.1 protein_id gnl|my_center|LOCUS_16420 >Feature sequence146 <1 999 gene locus_tag LOCUS_16430 <1 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201627021.1:elongation factor G 1070 3508 gene locus_tag LOCUS_16440 gene leuS 1070 3508 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246072.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence147 1357 311 gene locus_tag LOCUS_16450 1357 311 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118345.1 protein_id gnl|my_center|LOCUS_16450 2392 1370 gene locus_tag LOCUS_16460 2392 1370 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108492.1 protein_id gnl|my_center|LOCUS_16460 3330 2410 gene locus_tag LOCUS_16470 gene rbsK 3330 2410 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419503.1 protein_id gnl|my_center|LOCUS_16470 >Feature sequence148 2330 849 gene locus_tag LOCUS_16480 2330 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 2782 2327 gene locus_tag LOCUS_16490 gene coaD 2782 2327 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681221.1 protein_id gnl|my_center|LOCUS_16490 3462 2794 gene locus_tag LOCUS_16500 gene ung 3462 2794 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957938.1 protein_id gnl|my_center|LOCUS_16500 3751 3485 gene locus_tag LOCUS_16510 3751 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 >Feature sequence149 2411 822 gene locus_tag LOCUS_16520 2411 822 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108686.1 protein_id gnl|my_center|LOCUS_16520 3066 2422 gene locus_tag LOCUS_16530 3066 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 >Feature sequence150 2222 1458 gene locus_tag LOCUS_16540 2222 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 3121 2324 gene locus_tag LOCUS_16550 3121 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 >Feature sequence151 <1 2204 gene locus_tag LOCUS_16560 <1 2204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797373.1:YfhO family protein 2214 3338 gene locus_tag LOCUS_16570 2214 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 >Feature sequence152 1866 1243 gene locus_tag LOCUS_16580 1866 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 2193 2888 gene locus_tag LOCUS_16590 2193 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 3484 2957 gene locus_tag LOCUS_16600 3484 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 >Feature sequence153 <1 1218 gene locus_tag LOCUS_16610 <1 1218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108848.1:glutaminase family protein 2596 1229 gene locus_tag LOCUS_16620 2596 1229 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815375.1 protein_id gnl|my_center|LOCUS_16620 2659 3282 gene locus_tag LOCUS_16630 2659 3282 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence154 75 608 gene locus_tag LOCUS_16640 75 608 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109460.1 protein_id gnl|my_center|LOCUS_16640 609 1586 gene locus_tag LOCUS_16650 gene ispB 609 1586 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925908.1 protein_id gnl|my_center|LOCUS_16650 1591 2619 gene locus_tag LOCUS_16660 1591 2619 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799206.1 protein_id gnl|my_center|LOCUS_16660 >Feature sequence155 3346 224 gene locus_tag LOCUS_16670 3346 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 >Feature sequence156 377 1498 gene locus_tag LOCUS_16680 377 1498 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759752.1 protein_id gnl|my_center|LOCUS_16680 1482 2840 gene locus_tag LOCUS_16690 gene trkA 1482 2840 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_16690 <3429 2833 gene locus_tag LOCUS_16700 <3429 2833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005795166.1:ABC-F family ATP-binding cassette domain-containing protein >Feature sequence157 757 431 gene locus_tag LOCUS_16710 gene rhaM 757 431 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759851.1 protein_id gnl|my_center|LOCUS_16710 840 1724 gene locus_tag LOCUS_16720 840 1724 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 protein_id gnl|my_center|LOCUS_16720 1721 2545 gene locus_tag LOCUS_16730 gene murQ 1721 2545 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962884.1 protein_id gnl|my_center|LOCUS_16730 2550 3191 gene locus_tag LOCUS_16740 gene recR 2550 3191 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763508.1 protein_id gnl|my_center|LOCUS_16740 >Feature sequence158 <1 2022 gene locus_tag LOCUS_16750 <1 2022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009039975.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence159 673 2997 gene locus_tag LOCUS_16760 673 2997 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202942.1 protein_id gnl|my_center|LOCUS_16760 >Feature sequence160 3272 1704 gene locus_tag LOCUS_16770 3272 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 >Feature sequence161 227 652 gene locus_tag LOCUS_16780 227 652 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_16780 1667 657 gene locus_tag LOCUS_16790 1667 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 2687 1701 gene locus_tag LOCUS_16800 gene pfkA 2687 1701 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295279.1 protein_id gnl|my_center|LOCUS_16800 2997 2692 gene locus_tag LOCUS_16810 2997 2692 CDS product DUF4298 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837143.1 protein_id gnl|my_center|LOCUS_16810 >Feature sequence162 <1 1267 gene locus_tag LOCUS_16820 <1 1267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010992125.1:DNA polymerase III subunit alpha 3226 1271 gene locus_tag LOCUS_16830 gene metG 3226 1271 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791925.1 protein_id gnl|my_center|LOCUS_16830 >Feature sequence163 >Feature sequence164 134 2602 gene locus_tag LOCUS_16840 gene hrpB 134 2602 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887065.1 protein_id gnl|my_center|LOCUS_16840 2707 3087 gene locus_tag LOCUS_16850 gene rpsF 2707 3087 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759739.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence165 885 2912 gene locus_tag LOCUS_16860 885 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 >Feature sequence166 <1 1681 gene locus_tag LOCUS_16870 <1 1681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108712.1:DUF2723 domain-containing protein 1692 2681 gene locus_tag LOCUS_16880 1692 2681 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_16880 >Feature sequence167 2592 496 gene locus_tag LOCUS_16890 2592 496 CDS product DUF5722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061473288.1 protein_id gnl|my_center|LOCUS_16890 >Feature sequence168 1267 335 gene locus_tag LOCUS_16900 1267 335 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762562.1 protein_id gnl|my_center|LOCUS_16900 2296 1280 gene locus_tag LOCUS_16910 2296 1280 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108909.1 protein_id gnl|my_center|LOCUS_16910 >Feature sequence169 1060 473 gene locus_tag LOCUS_16920 1060 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785162.1 protein_id gnl|my_center|LOCUS_16920 <3026 1179 gene locus_tag LOCUS_16930 <3026 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108964.1:GH92 family glycosyl hydrolase >Feature sequence170 751 14 gene locus_tag LOCUS_16940 751 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 1506 2804 gene locus_tag LOCUS_16950 1506 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 >Feature sequence171 953 51 gene locus_tag LOCUS_16960 953 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 1104 2051 gene locus_tag LOCUS_16970 1104 2051 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 protein_id gnl|my_center|LOCUS_16970 >Feature sequence172 128 54 gene locus_tag LOCUS_t00340 128 54 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 210 135 gene locus_tag LOCUS_t00350 210 135 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 308 228 gene locus_tag LOCUS_t00360 308 228 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 417 341 gene locus_tag LOCUS_t00370 417 341 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2413 518 gene locus_tag LOCUS_16980 gene dxs 2413 518 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764325.1 protein_id gnl|my_center|LOCUS_16980 >Feature sequence173 621 1457 gene locus_tag LOCUS_16990 621 1457 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 protein_id gnl|my_center|LOCUS_16990 2249 1464 gene locus_tag LOCUS_17000 gene dapF 2249 1464 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927135.1 protein_id gnl|my_center|LOCUS_17000 <2908 2260 gene locus_tag LOCUS_17010 <2908 2260 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108642.1:redox-regulated ATPase YchF >Feature sequence174 <1 528 gene locus_tag LOCUS_17020 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010905897.1:dihydroorotate dehydrogenase 525 1226 gene locus_tag LOCUS_17030 gene pyrF 525 1226 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083510.1 protein_id gnl|my_center|LOCUS_17030 1233 1868 gene locus_tag LOCUS_17040 gene pyrE 1233 1868 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711449.1 protein_id gnl|my_center|LOCUS_17040 >Feature sequence175 2017 1211 gene locus_tag LOCUS_17050 2017 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 <2836 2048 gene locus_tag LOCUS_17060 <2836 2048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762559.1:glycine--tRNA ligase >Feature sequence176 381 1538 gene locus_tag LOCUS_17070 381 1538 CDS product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762566.1 protein_id gnl|my_center|LOCUS_17070 1541 2035 gene locus_tag LOCUS_17080 1541 2035 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766431.1 protein_id gnl|my_center|LOCUS_17080 2152 2409 gene locus_tag LOCUS_17090 2152 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 >Feature sequence177 3 461 gene locus_tag LOCUS_17100 3 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 472 2412 gene locus_tag LOCUS_17110 472 2412 CDS product glycogen debranching enzyme N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109193.1 protein_id gnl|my_center|LOCUS_17110 >Feature sequence178 <2799 1075 gene locus_tag LOCUS_17120 <2799 1075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793715.1:S41 family peptidase >Feature sequence179 1147 332 gene locus_tag LOCUS_17130 gene fkpA 1147 332 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704938.1 protein_id gnl|my_center|LOCUS_17130 >Feature sequence180 2552 351 gene locus_tag LOCUS_17140 2552 351 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918674.1 protein_id gnl|my_center|LOCUS_17140 >Feature sequence181 421 1818 gene locus_tag LOCUS_17150 gene xylE 421 1818 CDS product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202803.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence182 455 216 gene locus_tag LOCUS_17160 455 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 >Feature sequence183 358 1332 gene locus_tag LOCUS_17170 358 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 1340 2341 gene locus_tag LOCUS_17180 1340 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 >Feature sequence184 <1 2001 gene locus_tag LOCUS_17190 <1 2001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005796226.1:alanine--tRNA ligase >Feature sequence185 1320 715 gene locus_tag LOCUS_17200 1320 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 1451 2233 gene locus_tag LOCUS_17210 1451 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 >Feature sequence186 989 1741 gene locus_tag LOCUS_17220 989 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 >Feature sequence187 1369 488 gene locus_tag LOCUS_17230 1369 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 2246 1614 gene locus_tag LOCUS_17240 2246 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 >Feature sequence188 <1 855 gene locus_tag LOCUS_17250 <1 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108456.1:DUF4091 domain-containing protein 1884 856 gene locus_tag LOCUS_17260 1884 856 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201939.1 protein_id gnl|my_center|LOCUS_17260 >Feature sequence189 <1 548 gene locus_tag LOCUS_17270 <1 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789841.1:3-isopropylmalate dehydrogenase 571 1608 gene locus_tag LOCUS_17280 571 1608 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791729.1 protein_id gnl|my_center|LOCUS_17280 >Feature sequence190 >Feature sequence191 <1 580 gene locus_tag LOCUS_17290 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000868582.1:phosphatase PAP2 family protein 1801 650 gene locus_tag LOCUS_17300 gene recA 1801 650 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_17300 2410 1967 gene locus_tag LOCUS_17310 2410 1967 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244690.1 protein_id gnl|my_center|LOCUS_17310 >Feature sequence192 1622 942 gene locus_tag LOCUS_17320 1622 942 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761370.1 protein_id gnl|my_center|LOCUS_17320 <2511 1791 gene locus_tag LOCUS_17330 <2511 1791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease