>Feature sequence01 1908 910 gene locus_tag LOCUS_00010 1908 910 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682379.1 protein_id gnl|my_center|LOCUS_00010 3798 1921 gene locus_tag LOCUS_00020 3798 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 4800 3814 gene locus_tag LOCUS_00030 4800 3814 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963501.1 protein_id gnl|my_center|LOCUS_00030 7507 5492 gene locus_tag LOCUS_00040 7507 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 7868 9079 gene locus_tag LOCUS_00050 7868 9079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 9090 10436 gene locus_tag LOCUS_00060 gene radA 9090 10436 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989380.1 protein_id gnl|my_center|LOCUS_00060 10525 11232 gene locus_tag LOCUS_00070 10525 11232 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948011.1 protein_id gnl|my_center|LOCUS_00070 11229 11648 gene locus_tag LOCUS_00080 11229 11648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 11738 12172 gene locus_tag LOCUS_00090 11738 12172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 12309 13241 gene locus_tag LOCUS_00100 12309 13241 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384427.1 protein_id gnl|my_center|LOCUS_00100 13271 14542 gene locus_tag LOCUS_00110 13271 14542 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966804.1 protein_id gnl|my_center|LOCUS_00110 14633 15166 gene locus_tag LOCUS_00120 gene thpR 14633 15166 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583814.1 protein_id gnl|my_center|LOCUS_00120 15172 18477 gene locus_tag LOCUS_00130 gene addB 15172 18477 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151864400.1 protein_id gnl|my_center|LOCUS_00130 19175 18546 gene locus_tag LOCUS_00140 gene upp 19175 18546 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437840.1 protein_id gnl|my_center|LOCUS_00140 19623 19168 gene locus_tag LOCUS_00150 gene rpiB 19623 19168 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583174.1 protein_id gnl|my_center|LOCUS_00150 20132 19626 gene locus_tag LOCUS_00160 20132 19626 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437844.1 protein_id gnl|my_center|LOCUS_00160 21196 20153 gene locus_tag LOCUS_00170 21196 20153 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393872.1 protein_id gnl|my_center|LOCUS_00170 22263 21196 gene locus_tag LOCUS_00180 gene prfA 22263 21196 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_00180 23091 22267 gene locus_tag LOCUS_00190 gene prmC 23091 22267 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_00190 24139 23093 gene locus_tag LOCUS_00200 24139 23093 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966170.1 protein_id gnl|my_center|LOCUS_00200 24267 25184 gene locus_tag LOCUS_00210 24267 25184 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963403.1 protein_id gnl|my_center|LOCUS_00210 25195 25872 gene locus_tag LOCUS_00220 25195 25872 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948375.1 protein_id gnl|my_center|LOCUS_00220 26800 26282 gene locus_tag LOCUS_00230 26800 26282 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966286.1 protein_id gnl|my_center|LOCUS_00230 27627 26797 gene locus_tag LOCUS_00240 27627 26797 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_00240 28609 27620 gene locus_tag LOCUS_00250 28609 27620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 29289 28621 gene locus_tag LOCUS_00260 29289 28621 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_00260 29455 30255 gene locus_tag LOCUS_00270 29455 30255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 30489 30265 gene locus_tag LOCUS_00280 30489 30265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 30545 31813 gene locus_tag LOCUS_00290 30545 31813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 32027 31875 gene locus_tag LOCUS_00300 32027 31875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 33576 32071 gene locus_tag LOCUS_00310 33576 32071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 34935 33595 gene locus_tag LOCUS_00320 34935 33595 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920595.1 protein_id gnl|my_center|LOCUS_00320 35684 35103 gene locus_tag LOCUS_00330 35684 35103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 36262 35681 gene locus_tag LOCUS_00340 36262 35681 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679463.1 protein_id gnl|my_center|LOCUS_00340 36709 36503 gene locus_tag LOCUS_00350 36709 36503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 37558 36773 gene locus_tag LOCUS_00360 37558 36773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 38051 37548 gene locus_tag LOCUS_00370 38051 37548 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480180.1 protein_id gnl|my_center|LOCUS_00370 38255 39301 gene locus_tag LOCUS_00380 gene ord 38255 39301 CDS product 2,4-diaminopentanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895461.1 protein_id gnl|my_center|LOCUS_00380 39323 39625 gene locus_tag LOCUS_00390 gene ortA 39323 39625 CDS product 2-amino-4-oxopentanoate thiolase subunit OrtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860811.1 protein_id gnl|my_center|LOCUS_00390 39622 41037 gene locus_tag LOCUS_00400 gene ortB 39622 41037 CDS product 2-amino-4-oxopentanoate thiolase subunit OrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032507361.1 protein_id gnl|my_center|LOCUS_00400 41034 41402 gene locus_tag LOCUS_00410 41034 41402 CDS product ornithine aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434665.1 protein_id gnl|my_center|LOCUS_00410 41399 43618 gene locus_tag LOCUS_00420 gene oraE 41399 43618 CDS product D-ornithine 4,5-aminomutase subunit OraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895465.1 protein_id gnl|my_center|LOCUS_00420 43660 45018 gene locus_tag LOCUS_00430 43660 45018 CDS product GlmL-related ornithine degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895468.1 protein_id gnl|my_center|LOCUS_00430 45030 46109 gene locus_tag LOCUS_00440 gene orr 45030 46109 CDS product ornithine racemase Orr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860813.1 protein_id gnl|my_center|LOCUS_00440 46135 47124 gene locus_tag LOCUS_00450 gene argF 46135 47124 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861433.1 protein_id gnl|my_center|LOCUS_00450 47190 48320 gene locus_tag LOCUS_00460 gene alr 47190 48320 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963814.1 protein_id gnl|my_center|LOCUS_00460 48440 50389 gene locus_tag LOCUS_00470 48440 50389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 50389 50781 gene locus_tag LOCUS_00480 50389 50781 CDS product Zn-finger containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964917.1 protein_id gnl|my_center|LOCUS_00480 50849 51046 gene locus_tag LOCUS_00490 50849 51046 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519083.1 protein_id gnl|my_center|LOCUS_00490 51054 51539 gene locus_tag LOCUS_00500 51054 51539 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392747.1 protein_id gnl|my_center|LOCUS_00500 52847 51609 gene locus_tag LOCUS_00510 52847 51609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 54492 52882 gene locus_tag LOCUS_00520 54492 52882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 55077 54571 gene locus_tag LOCUS_00530 55077 54571 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949067.1 protein_id gnl|my_center|LOCUS_00530 55569 55087 gene locus_tag LOCUS_00540 gene rlmH 55569 55087 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435703.1 protein_id gnl|my_center|LOCUS_00540 56543 55566 gene locus_tag LOCUS_00550 56543 55566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 57337 56540 gene locus_tag LOCUS_00560 57337 56540 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_00560 57556 58185 gene locus_tag LOCUS_00570 gene udk 57556 58185 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546365.1 protein_id gnl|my_center|LOCUS_00570 59250 58339 gene locus_tag LOCUS_00580 59250 58339 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948815.1 protein_id gnl|my_center|LOCUS_00580 59963 59250 gene locus_tag LOCUS_00590 59963 59250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 60291 60076 gene locus_tag LOCUS_00600 gene rpmE 60291 60076 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966172.1 protein_id gnl|my_center|LOCUS_00600 61324 60476 gene locus_tag LOCUS_00610 gene ispE 61324 60476 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103329367.1 protein_id gnl|my_center|LOCUS_00610 61420 61977 gene locus_tag LOCUS_00620 gene spoIIR 61420 61977 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227654.1 protein_id gnl|my_center|LOCUS_00620 61974 62657 gene locus_tag LOCUS_00630 gene sleB 61974 62657 CDS product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964005.1 protein_id gnl|my_center|LOCUS_00630 62667 63992 gene locus_tag LOCUS_00640 gene ypeB 62667 63992 CDS product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947975.1 protein_id gnl|my_center|LOCUS_00640 64142 65845 gene locus_tag LOCUS_00650 64142 65845 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680798.1 protein_id gnl|my_center|LOCUS_00650 66009 67274 gene locus_tag LOCUS_00660 66009 67274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 67288 68235 gene locus_tag LOCUS_00670 67288 68235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 68232 69200 gene locus_tag LOCUS_00680 68232 69200 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812232.1 protein_id gnl|my_center|LOCUS_00680 69244 70113 gene locus_tag LOCUS_00690 69244 70113 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966986.1 protein_id gnl|my_center|LOCUS_00690 70113 70325 gene locus_tag LOCUS_00700 70113 70325 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562948.1 protein_id gnl|my_center|LOCUS_00700 70306 70899 gene locus_tag LOCUS_00710 gene lepB 70306 70899 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_00710 70903 71442 gene locus_tag LOCUS_00720 gene lepB 70903 71442 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662493.1 protein_id gnl|my_center|LOCUS_00720 71748 73352 gene locus_tag LOCUS_00730 71748 73352 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903241.1 protein_id gnl|my_center|LOCUS_00730 74468 73533 gene locus_tag LOCUS_00740 74468 73533 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643925.1 protein_id gnl|my_center|LOCUS_00740 75873 74533 gene locus_tag LOCUS_00750 75873 74533 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_00750 77534 76014 gene locus_tag LOCUS_00760 77534 76014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 78939 77650 gene locus_tag LOCUS_00770 78939 77650 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869172.1 protein_id gnl|my_center|LOCUS_00770 80020 78941 gene locus_tag LOCUS_00780 80020 78941 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869172.1 protein_id gnl|my_center|LOCUS_00780 79947 80198 gene locus_tag LOCUS_00790 79947 80198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 80332 80466 gene locus_tag LOCUS_00800 80332 80466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 80600 80950 gene locus_tag LOCUS_00810 gene rnpA 80600 80950 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359393.1 protein_id gnl|my_center|LOCUS_00810 80947 81276 gene locus_tag LOCUS_00820 80947 81276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 81313 82350 gene locus_tag LOCUS_00830 81313 82350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 82373 83422 gene locus_tag LOCUS_00840 82373 83422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 84287 83712 gene locus_tag LOCUS_00850 84287 83712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808298.1 protein_id gnl|my_center|LOCUS_00850 84427 85062 gene locus_tag LOCUS_00860 84427 85062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 87719 85152 gene locus_tag LOCUS_00870 87719 85152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 87867 89204 gene locus_tag LOCUS_00880 87867 89204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 >Feature sequence02 409 2571 gene locus_tag LOCUS_00890 409 2571 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392356.1 protein_id gnl|my_center|LOCUS_00890 2575 4017 gene locus_tag LOCUS_00900 2575 4017 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_00900 4026 5015 gene locus_tag LOCUS_00910 gene mraY 4026 5015 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460699.1 protein_id gnl|my_center|LOCUS_00910 5197 6555 gene locus_tag LOCUS_00920 gene murD 5197 6555 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454967.1 protein_id gnl|my_center|LOCUS_00920 6566 7759 gene locus_tag LOCUS_00930 gene spoVE 6566 7759 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949037.1 protein_id gnl|my_center|LOCUS_00930 7822 9078 gene locus_tag LOCUS_00940 gene murA 7822 9078 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392365.1 protein_id gnl|my_center|LOCUS_00940 9096 10043 gene locus_tag LOCUS_00950 9096 10043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 10170 11336 gene locus_tag LOCUS_00960 gene ftsA 10170 11336 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216485.1 protein_id gnl|my_center|LOCUS_00960 11357 12634 gene locus_tag LOCUS_00970 gene ftsZ 11357 12634 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386373.1 protein_id gnl|my_center|LOCUS_00970 12651 13049 gene locus_tag LOCUS_00980 12651 13049 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393004.1 protein_id gnl|my_center|LOCUS_00980 13083 14576 gene locus_tag LOCUS_00990 13083 14576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 15621 14569 gene locus_tag LOCUS_01000 15621 14569 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227915.1 protein_id gnl|my_center|LOCUS_01000 15751 18135 gene locus_tag LOCUS_01010 15751 18135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 19545 18499 gene locus_tag LOCUS_01020 19545 18499 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420729.1 protein_id gnl|my_center|LOCUS_01020 19958 21001 gene locus_tag LOCUS_01030 19958 21001 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459800.1 protein_id gnl|my_center|LOCUS_01030 20986 22020 gene locus_tag LOCUS_01040 20986 22020 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963539.1 protein_id gnl|my_center|LOCUS_01040 22033 23034 gene locus_tag LOCUS_01050 22033 23034 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811663.1 protein_id gnl|my_center|LOCUS_01050 23214 23489 gene locus_tag LOCUS_01060 23214 23489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 23867 24367 gene locus_tag LOCUS_01070 23867 24367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 24364 26094 gene locus_tag LOCUS_01080 24364 26094 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_01080 26096 28027 gene locus_tag LOCUS_01090 26096 28027 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_01090 28375 29628 gene locus_tag LOCUS_01100 28375 29628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 29940 29686 gene locus_tag LOCUS_01110 gene spoIIID 29940 29686 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966143.1 protein_id gnl|my_center|LOCUS_01110 30102 30875 gene locus_tag LOCUS_01120 gene sigG 30102 30875 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965003.1 protein_id gnl|my_center|LOCUS_01120 31866 30877 gene locus_tag LOCUS_01130 31866 30877 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389640.1 protein_id gnl|my_center|LOCUS_01130 32009 33301 gene locus_tag LOCUS_01140 32009 33301 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_01140 33430 34641 gene locus_tag LOCUS_01150 33430 34641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 34641 34952 gene locus_tag LOCUS_01160 34641 34952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 35006 35908 gene locus_tag LOCUS_01170 35006 35908 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435320.1 protein_id gnl|my_center|LOCUS_01170 35895 37103 gene locus_tag LOCUS_01180 35895 37103 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964224.1 protein_id gnl|my_center|LOCUS_01180 38004 37228 gene locus_tag LOCUS_01190 38004 37228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 39639 38101 gene locus_tag LOCUS_01200 gene gpmI 39639 38101 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_01200 41579 39651 gene locus_tag LOCUS_01210 41579 39651 CDS product bifunctional phosphoglycerate kinase/triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081072.1 protein_id gnl|my_center|LOCUS_01210 41773 42012 gene locus_tag LOCUS_01220 41773 42012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 42117 42593 gene locus_tag LOCUS_01230 gene smpB 42117 42593 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_01230 42688 43923 gene locus_tag LOCUS_01240 42688 43923 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_01240 44005 45165 gene locus_tag LOCUS_01250 44005 45165 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679466.1 protein_id gnl|my_center|LOCUS_01250 45162 45539 gene locus_tag LOCUS_01260 gene rsfS 45162 45539 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_01260 46979 45609 gene locus_tag LOCUS_01270 46979 45609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 47152 47679 gene locus_tag LOCUS_01280 47152 47679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 48596 47778 gene locus_tag LOCUS_01290 48596 47778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 48693 48938 gene locus_tag LOCUS_01300 48693 48938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 48998 49906 gene locus_tag LOCUS_01310 gene trxB 48998 49906 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229015.1 protein_id gnl|my_center|LOCUS_01310 49911 51266 gene locus_tag LOCUS_01320 gene glmM 49911 51266 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963806.1 protein_id gnl|my_center|LOCUS_01320 51270 53072 gene locus_tag LOCUS_01330 gene lepA 51270 53072 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357725.1 protein_id gnl|my_center|LOCUS_01330 53072 54232 gene locus_tag LOCUS_01340 gene hemW 53072 54232 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964591.1 protein_id gnl|my_center|LOCUS_01340 54288 54746 gene locus_tag LOCUS_01350 54288 54746 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615364.1 protein_id gnl|my_center|LOCUS_01350 56702 54783 gene locus_tag LOCUS_01360 56702 54783 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948014.1 protein_id gnl|my_center|LOCUS_01360 56777 57841 gene locus_tag LOCUS_01370 56777 57841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 57834 58169 gene locus_tag LOCUS_01380 57834 58169 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546430.1 protein_id gnl|my_center|LOCUS_01380 58324 58491 gene locus_tag LOCUS_01390 58324 58491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 60589 59294 gene locus_tag LOCUS_01400 gene mtaB 60589 59294 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_01400 61319 60591 gene locus_tag LOCUS_01410 61319 60591 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964597.1 protein_id gnl|my_center|LOCUS_01410 62278 61316 gene locus_tag LOCUS_01420 gene prmA 62278 61316 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385115.1 protein_id gnl|my_center|LOCUS_01420 63612 62479 gene locus_tag LOCUS_01430 gene dnaJ 63612 62479 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048002.1 protein_id gnl|my_center|LOCUS_01430 65562 63721 gene locus_tag LOCUS_01440 gene dnaK 65562 63721 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_01440 66187 65600 gene locus_tag LOCUS_01450 gene grpE 66187 65600 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964593.1 protein_id gnl|my_center|LOCUS_01450 67228 66194 gene locus_tag LOCUS_01460 gene hrcA 67228 66194 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454754.1 protein_id gnl|my_center|LOCUS_01460 68537 67455 gene locus_tag LOCUS_01470 gene buk 68537 67455 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454677.1 protein_id gnl|my_center|LOCUS_01470 69441 68545 gene locus_tag LOCUS_01480 69441 68545 CDS product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869129.1 protein_id gnl|my_center|LOCUS_01480 69890 69522 gene locus_tag LOCUS_01490 69890 69522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 70210 71541 gene locus_tag LOCUS_01500 gene rsxC 70210 71541 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428488.1 protein_id gnl|my_center|LOCUS_01500 71548 72537 gene locus_tag LOCUS_01510 71548 72537 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_01510 72530 73153 gene locus_tag LOCUS_01520 72530 73153 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419045.1 protein_id gnl|my_center|LOCUS_01520 73155 73766 gene locus_tag LOCUS_01530 gene rsxA 73155 73766 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_01530 73780 74577 gene locus_tag LOCUS_01540 73780 74577 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_01540 74699 74774 gene locus_tag LOCUS_t00010 74699 74774 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence03 <1 878 gene locus_tag LOCUS_01550 <1 878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436885.1:arginine--tRNA ligase 880 2157 gene locus_tag LOCUS_01560 gene serS 880 2157 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_01560 2175 2843 gene locus_tag LOCUS_01570 2175 2843 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850144.1 protein_id gnl|my_center|LOCUS_01570 2985 3060 gene locus_tag LOCUS_t00020 2985 3060 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3625 4272 gene locus_tag LOCUS_01580 3625 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 4402 4881 gene locus_tag LOCUS_01590 4402 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 4890 6092 gene locus_tag LOCUS_01600 4890 6092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 6106 6837 gene locus_tag LOCUS_01610 6106 6837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 6839 7231 gene locus_tag LOCUS_01620 6839 7231 CDS product holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721755.1 protein_id gnl|my_center|LOCUS_01620 8315 7329 gene locus_tag LOCUS_01630 8315 7329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 8405 8680 gene locus_tag LOCUS_01640 8405 8680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 8691 9230 gene locus_tag LOCUS_01650 8691 9230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 9233 10663 gene locus_tag LOCUS_01660 9233 10663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 10663 10842 gene locus_tag LOCUS_01670 10663 10842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 10877 12025 gene locus_tag LOCUS_01680 10877 12025 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808433.1 protein_id gnl|my_center|LOCUS_01680 12036 12632 gene locus_tag LOCUS_01690 gene lspA 12036 12632 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895436.1 protein_id gnl|my_center|LOCUS_01690 12632 13612 gene locus_tag LOCUS_01700 12632 13612 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371731.1 protein_id gnl|my_center|LOCUS_01700 13703 14053 gene locus_tag LOCUS_01710 13703 14053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 14437 16800 gene locus_tag LOCUS_01720 14437 16800 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016705.1 protein_id gnl|my_center|LOCUS_01720 17839 16901 gene locus_tag LOCUS_01730 17839 16901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 20174 18480 gene locus_tag LOCUS_01740 20174 18480 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965634.1 protein_id gnl|my_center|LOCUS_01740 21031 20333 gene locus_tag LOCUS_01750 21031 20333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 21393 21974 gene locus_tag LOCUS_01760 21393 21974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 21967 22929 gene locus_tag LOCUS_01770 gene dusB 21967 22929 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966475.1 protein_id gnl|my_center|LOCUS_01770 23049 23122 gene locus_tag LOCUS_t00030 23049 23122 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 23185 24396 gene locus_tag LOCUS_01780 gene tuf 23185 24396 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393939.1 protein_id gnl|my_center|LOCUS_01780 24537 25196 gene locus_tag LOCUS_01790 24537 25196 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_01790 25219 25992 gene locus_tag LOCUS_01800 25219 25992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 26006 27478 gene locus_tag LOCUS_01810 gene malQ 26006 27478 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917858.1 protein_id gnl|my_center|LOCUS_01810 27811 29181 gene locus_tag LOCUS_01820 27811 29181 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249925.1 protein_id gnl|my_center|LOCUS_01820 29464 29778 gene locus_tag LOCUS_01830 gene rpsJ 29464 29778 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810163.1 protein_id gnl|my_center|LOCUS_01830 29789 30415 gene locus_tag LOCUS_01840 gene rplC 29789 30415 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_01840 30429 31052 gene locus_tag LOCUS_01850 gene rplD 30429 31052 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357518.1 protein_id gnl|my_center|LOCUS_01850 31049 31342 gene locus_tag LOCUS_01860 gene rplW 31049 31342 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435681.1 protein_id gnl|my_center|LOCUS_01860 31354 32187 gene locus_tag LOCUS_01870 gene rplB 31354 32187 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966409.1 protein_id gnl|my_center|LOCUS_01870 32210 32491 gene locus_tag LOCUS_01880 gene rpsS 32210 32491 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_01880 32504 32902 gene locus_tag LOCUS_01890 gene rplV 32504 32902 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048353.1 protein_id gnl|my_center|LOCUS_01890 32914 33552 gene locus_tag LOCUS_01900 gene rpsC 32914 33552 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385450.1 protein_id gnl|my_center|LOCUS_01900 33568 33996 gene locus_tag LOCUS_01910 gene rplP 33568 33996 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_01910 33996 34199 gene locus_tag LOCUS_01920 gene rpmC 33996 34199 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357691.1 protein_id gnl|my_center|LOCUS_01920 34218 34475 gene locus_tag LOCUS_01930 gene rpsQ 34218 34475 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966403.1 protein_id gnl|my_center|LOCUS_01930 34496 34864 gene locus_tag LOCUS_01940 gene rplN 34496 34864 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966402.1 protein_id gnl|my_center|LOCUS_01940 34876 35214 gene locus_tag LOCUS_01950 gene rplX 34876 35214 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187422288.1 protein_id gnl|my_center|LOCUS_01950 35234 35851 gene locus_tag LOCUS_01960 gene rplE 35234 35851 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435673.1 protein_id gnl|my_center|LOCUS_01960 35862 36047 gene locus_tag LOCUS_01970 35862 36047 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421149.1 protein_id gnl|my_center|LOCUS_01970 36066 36464 gene locus_tag LOCUS_01980 gene rpsH 36066 36464 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_01980 36541 37080 gene locus_tag LOCUS_01990 gene rplF 36541 37080 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086558.1 protein_id gnl|my_center|LOCUS_01990 37102 37470 gene locus_tag LOCUS_02000 gene rplR 37102 37470 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628816.1 protein_id gnl|my_center|LOCUS_02000 37483 37986 gene locus_tag LOCUS_02010 gene rpsE 37483 37986 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357254.1 protein_id gnl|my_center|LOCUS_02010 38001 38180 gene locus_tag LOCUS_02020 gene rpmD 38001 38180 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258249.1 protein_id gnl|my_center|LOCUS_02020 38193 38636 gene locus_tag LOCUS_02030 gene rplO 38193 38636 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421135.1 protein_id gnl|my_center|LOCUS_02030 38636 39907 gene locus_tag LOCUS_02040 gene secY 38636 39907 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_02040 39918 40547 gene locus_tag LOCUS_02050 39918 40547 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_02050 40544 41299 gene locus_tag LOCUS_02060 gene map 40544 41299 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_02060 41309 41617 gene locus_tag LOCUS_02070 41309 41617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 41595 41816 gene locus_tag LOCUS_02080 gene infA 41595 41816 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_02080 42159 44111 gene locus_tag LOCUS_02090 42159 44111 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_02090 44127 44573 gene locus_tag LOCUS_02100 gene rplI 44127 44573 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_02100 44589 45917 gene locus_tag LOCUS_02110 44589 45917 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048440.1 protein_id gnl|my_center|LOCUS_02110 45941 47635 gene locus_tag LOCUS_02120 45941 47635 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272334.1 protein_id gnl|my_center|LOCUS_02120 48475 49398 gene locus_tag LOCUS_02130 48475 49398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 49535 50470 gene locus_tag LOCUS_02140 49535 50470 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861239.1 protein_id gnl|my_center|LOCUS_02140 50754 50903 gene locus_tag LOCUS_02150 gene rpmG 50754 50903 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_02150 50919 51191 gene locus_tag LOCUS_02160 50919 51191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 51210 51800 gene locus_tag LOCUS_02170 gene nusG 51210 51800 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_02170 51891 52316 gene locus_tag LOCUS_02180 gene rplK 51891 52316 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_02180 52368 53060 gene locus_tag LOCUS_02190 gene rplA 52368 53060 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357362.1 protein_id gnl|my_center|LOCUS_02190 53896 53201 gene locus_tag LOCUS_02200 53896 53201 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436256.1 protein_id gnl|my_center|LOCUS_02200 54701 53904 gene locus_tag LOCUS_02210 54701 53904 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358531.1 protein_id gnl|my_center|LOCUS_02210 54980 55354 gene locus_tag LOCUS_02220 54980 55354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 55365 56072 gene locus_tag LOCUS_02230 55365 56072 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963629.1 protein_id gnl|my_center|LOCUS_02230 56404 58374 gene locus_tag LOCUS_02240 gene metG 56404 58374 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_02240 58379 58921 gene locus_tag LOCUS_02250 58379 58921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 58921 59688 gene locus_tag LOCUS_02260 58921 59688 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_02260 60887 59892 gene locus_tag LOCUS_02270 60887 59892 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_02270 61590 60898 gene locus_tag LOCUS_02280 61590 60898 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_02280 61907 61698 gene locus_tag LOCUS_02290 61907 61698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02290 62410 61868 gene locus_tag LOCUS_02300 62410 61868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 <63371 62479 gene locus_tag LOCUS_02310 <63371 62479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_042515450.1:glycogen synthase GlgA >Feature sequence04 <1 1552 gene locus_tag LOCUS_02320 <1 1552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680842.1:ABC transporter ATP-binding protein 1549 3420 gene locus_tag LOCUS_02330 1549 3420 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 protein_id gnl|my_center|LOCUS_02330 3935 3537 gene locus_tag LOCUS_02340 3935 3537 CDS product DUF1284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061260.1 protein_id gnl|my_center|LOCUS_02340 5179 3920 gene locus_tag LOCUS_02350 5179 3920 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963605.1 protein_id gnl|my_center|LOCUS_02350 5772 5176 gene locus_tag LOCUS_02360 gene mocA 5772 5176 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047953.1 protein_id gnl|my_center|LOCUS_02360 7130 5769 gene locus_tag LOCUS_02370 gene hydA 7130 5769 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861449.1 protein_id gnl|my_center|LOCUS_02370 7626 7414 gene locus_tag LOCUS_02380 7626 7414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 7550 8641 gene locus_tag LOCUS_02390 7550 8641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 10593 8698 gene locus_tag LOCUS_02400 10593 8698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 11493 10600 gene locus_tag LOCUS_02410 gene ftcD 11493 10600 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836511.1 protein_id gnl|my_center|LOCUS_02410 13526 11505 gene locus_tag LOCUS_02420 13526 11505 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869356.1 protein_id gnl|my_center|LOCUS_02420 15084 13537 gene locus_tag LOCUS_02430 gene hutH 15084 13537 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922740.1 protein_id gnl|my_center|LOCUS_02430 16147 15119 gene locus_tag LOCUS_02440 16147 15119 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141484866.1 protein_id gnl|my_center|LOCUS_02440 16306 16965 gene locus_tag LOCUS_02450 16306 16965 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667037.1 protein_id gnl|my_center|LOCUS_02450 16968 17606 gene locus_tag LOCUS_02460 gene pcp 16968 17606 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250786.1 protein_id gnl|my_center|LOCUS_02460 17587 18477 gene locus_tag LOCUS_02470 17587 18477 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617359.1 protein_id gnl|my_center|LOCUS_02470 18656 18865 gene locus_tag LOCUS_02480 18656 18865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 19327 20190 gene locus_tag LOCUS_02490 19327 20190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 20200 20550 gene locus_tag LOCUS_02500 20200 20550 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869442.1 protein_id gnl|my_center|LOCUS_02500 20555 20974 gene locus_tag LOCUS_02510 20555 20974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 20991 22304 gene locus_tag LOCUS_02520 20991 22304 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_02520 22279 22656 gene locus_tag LOCUS_02530 22279 22656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583278.1 protein_id gnl|my_center|LOCUS_02530 22661 23362 gene locus_tag LOCUS_02540 22661 23362 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_02540 23476 24036 gene locus_tag LOCUS_02550 23476 24036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 24038 24778 gene locus_tag LOCUS_02560 24038 24778 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233185.1 protein_id gnl|my_center|LOCUS_02560 24788 25357 gene locus_tag LOCUS_02570 24788 25357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 26152 25361 gene locus_tag LOCUS_02580 gene radC 26152 25361 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016743.1 protein_id gnl|my_center|LOCUS_02580 27337 26354 gene locus_tag LOCUS_02590 27337 26354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 27650 27330 gene locus_tag LOCUS_02600 27650 27330 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669619.1 protein_id gnl|my_center|LOCUS_02600 27795 28463 gene locus_tag LOCUS_02610 27795 28463 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111910.1 protein_id gnl|my_center|LOCUS_02610 30130 28565 gene locus_tag LOCUS_02620 30130 28565 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986179.1 protein_id gnl|my_center|LOCUS_02620 30551 32848 gene locus_tag LOCUS_02630 30551 32848 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942516.1 protein_id gnl|my_center|LOCUS_02630 33783 32902 gene locus_tag LOCUS_02640 33783 32902 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965994.1 protein_id gnl|my_center|LOCUS_02640 33977 34279 gene locus_tag LOCUS_02650 gene rplU 33977 34279 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355866.1 protein_id gnl|my_center|LOCUS_02650 34283 34612 gene locus_tag LOCUS_02660 34283 34612 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016913.1 protein_id gnl|my_center|LOCUS_02660 34616 34903 gene locus_tag LOCUS_02670 gene rpmA 34616 34903 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816541.1 protein_id gnl|my_center|LOCUS_02670 35166 34960 gene locus_tag LOCUS_02680 35166 34960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 35343 35648 gene locus_tag LOCUS_02690 35343 35648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 35661 36092 gene locus_tag LOCUS_02700 gene spoIIAB 35661 36092 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357714.1 protein_id gnl|my_center|LOCUS_02700 36085 36825 gene locus_tag LOCUS_02710 gene sigF 36085 36825 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860953.1 protein_id gnl|my_center|LOCUS_02710 37482 36910 gene locus_tag LOCUS_02720 37482 36910 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948910.1 protein_id gnl|my_center|LOCUS_02720 38108 37608 gene locus_tag LOCUS_02730 38108 37608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 38655 38335 gene locus_tag LOCUS_02740 38655 38335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02740 40287 38926 gene locus_tag LOCUS_02750 40287 38926 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945002.1 protein_id gnl|my_center|LOCUS_02750 41043 41522 gene locus_tag LOCUS_02760 41043 41522 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287575.1 protein_id gnl|my_center|LOCUS_02760 42129 41755 gene locus_tag LOCUS_02770 42129 41755 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_02770 42533 42742 gene locus_tag LOCUS_02780 42533 42742 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360986.1 protein_id gnl|my_center|LOCUS_02780 42793 43014 gene locus_tag LOCUS_02790 42793 43014 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_02790 43102 45519 gene locus_tag LOCUS_02800 43102 45519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 45544 45717 gene locus_tag LOCUS_02810 45544 45717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 46044 46274 gene locus_tag LOCUS_02820 46044 46274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 46271 46516 gene locus_tag LOCUS_02830 46271 46516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 46513 46737 gene locus_tag LOCUS_02840 46513 46737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 46950 46864 gene locus_tag LOCUS_t00040 46950 46864 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 47049 46965 gene locus_tag LOCUS_t00050 47049 46965 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 47137 47062 gene locus_tag LOCUS_t00060 47137 47062 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence05 1378 74 gene locus_tag LOCUS_02850 1378 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 2553 1378 gene locus_tag LOCUS_02860 2553 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 3497 2553 gene locus_tag LOCUS_02870 3497 2553 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583074.1 protein_id gnl|my_center|LOCUS_02870 3738 5312 gene locus_tag LOCUS_02880 gene dnaX 3738 5312 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421622.1 protein_id gnl|my_center|LOCUS_02880 5586 6839 gene locus_tag LOCUS_02890 gene hisS 5586 6839 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048076.1 protein_id gnl|my_center|LOCUS_02890 6841 8628 gene locus_tag LOCUS_02900 gene aspS 6841 8628 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965567.1 protein_id gnl|my_center|LOCUS_02900 8633 9061 gene locus_tag LOCUS_02910 8633 9061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 9393 9205 gene locus_tag LOCUS_02920 9393 9205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 11204 9582 gene locus_tag LOCUS_02930 11204 9582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 13668 11173 gene locus_tag LOCUS_02940 gene clpC 13668 11173 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971183.1 protein_id gnl|my_center|LOCUS_02940 14149 13790 gene locus_tag LOCUS_02950 gene spoVAE 14149 13790 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403640.1 protein_id gnl|my_center|LOCUS_02950 15201 14152 gene locus_tag LOCUS_02960 gene spoVAD 15201 14152 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437476.1 protein_id gnl|my_center|LOCUS_02960 15653 15204 gene locus_tag LOCUS_02970 gene spoVAC 15653 15204 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418420.1 protein_id gnl|my_center|LOCUS_02970 15924 15637 gene locus_tag LOCUS_02980 15924 15637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 16045 16536 gene locus_tag LOCUS_02990 16045 16536 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392594.1 protein_id gnl|my_center|LOCUS_02990 16508 17314 gene locus_tag LOCUS_03000 16508 17314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 17318 18817 gene locus_tag LOCUS_03010 17318 18817 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_03010 18962 18804 gene locus_tag LOCUS_03020 18962 18804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 20244 18964 gene locus_tag LOCUS_03030 20244 18964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 21353 20232 gene locus_tag LOCUS_03040 21353 20232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 22951 21350 gene locus_tag LOCUS_03050 22951 21350 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947970.1 protein_id gnl|my_center|LOCUS_03050 24172 23009 gene locus_tag LOCUS_03060 24172 23009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 24792 24169 gene locus_tag LOCUS_03070 gene udg 24792 24169 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762472.1 protein_id gnl|my_center|LOCUS_03070 27606 24796 gene locus_tag LOCUS_03080 27606 24796 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048098.1 protein_id gnl|my_center|LOCUS_03080 27785 28786 gene locus_tag LOCUS_03090 gene trpS 27785 28786 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070666.1 protein_id gnl|my_center|LOCUS_03090 31476 28885 gene locus_tag LOCUS_03100 gene clpB 31476 28885 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_03100 32157 31504 gene locus_tag LOCUS_03110 32157 31504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 34306 32333 gene locus_tag LOCUS_03120 gene tkt 34306 32333 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964262.1 protein_id gnl|my_center|LOCUS_03120 34512 35858 gene locus_tag LOCUS_03130 gene gdhA 34512 35858 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020063.1 protein_id gnl|my_center|LOCUS_03130 36845 35916 gene locus_tag LOCUS_03140 36845 35916 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948854.1 protein_id gnl|my_center|LOCUS_03140 38489 36939 gene locus_tag LOCUS_03150 gene rny 38489 36939 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428216.1 protein_id gnl|my_center|LOCUS_03150 39690 38671 gene locus_tag LOCUS_03160 gene recA 39690 38671 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_03160 40342 39788 gene locus_tag LOCUS_03170 gene pgsA 40342 39788 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459962.1 protein_id gnl|my_center|LOCUS_03170 41637 40339 gene locus_tag LOCUS_03180 gene rimO 41637 40339 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_03180 44167 41627 gene locus_tag LOCUS_03190 44167 41627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 44769 44290 gene locus_tag LOCUS_03200 44769 44290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 45581 44946 gene locus_tag LOCUS_03210 45581 44946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 >Feature sequence06 245 715 gene locus_tag LOCUS_03220 245 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03220 672 1520 gene locus_tag LOCUS_03230 672 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03230 1504 2355 gene locus_tag LOCUS_03240 1504 2355 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902122.1 protein_id gnl|my_center|LOCUS_03240 4102 2411 gene locus_tag LOCUS_03250 gene recN 4102 2411 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387037.1 protein_id gnl|my_center|LOCUS_03250 4566 4117 gene locus_tag LOCUS_03260 4566 4117 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_03260 5490 4693 gene locus_tag LOCUS_03270 5490 4693 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810952.1 protein_id gnl|my_center|LOCUS_03270 6334 5513 gene locus_tag LOCUS_03280 6334 5513 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358964.1 protein_id gnl|my_center|LOCUS_03280 8174 6318 gene locus_tag LOCUS_03290 gene dxs 8174 6318 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_03290 9066 8182 gene locus_tag LOCUS_03300 9066 8182 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_03300 9271 9068 gene locus_tag LOCUS_03310 9271 9068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 10473 9274 gene locus_tag LOCUS_03320 gene xseA 10473 9274 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358983.1 protein_id gnl|my_center|LOCUS_03320 11418 10474 gene locus_tag LOCUS_03330 11418 10474 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272419.1 protein_id gnl|my_center|LOCUS_03330 11830 11420 gene locus_tag LOCUS_03340 gene nusB 11830 11420 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942335.1 protein_id gnl|my_center|LOCUS_03340 12088 11858 gene locus_tag LOCUS_03350 12088 11858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 12650 12096 gene locus_tag LOCUS_03360 12650 12096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 13085 12678 gene locus_tag LOCUS_03370 13085 12678 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_03370 13697 13185 gene locus_tag LOCUS_03380 13697 13185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 14170 13709 gene locus_tag LOCUS_03390 14170 13709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 15577 14360 gene locus_tag LOCUS_03400 gene spoIIIAE 15577 14360 CDS product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358911.1 protein_id gnl|my_center|LOCUS_03400 15972 15574 gene locus_tag LOCUS_03410 gene spoIIIAD 15972 15574 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393042.1 protein_id gnl|my_center|LOCUS_03410 16163 15969 gene locus_tag LOCUS_03420 gene spoIIIAC 16163 15969 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965391.1 protein_id gnl|my_center|LOCUS_03420 16680 16171 gene locus_tag LOCUS_03430 16680 16171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 17588 16668 gene locus_tag LOCUS_03440 gene spoIIIAA 17588 16668 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358945.1 protein_id gnl|my_center|LOCUS_03440 18205 17636 gene locus_tag LOCUS_03450 18205 17636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 20732 18336 gene locus_tag LOCUS_03460 gene pheT 20732 18336 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357703.1 protein_id gnl|my_center|LOCUS_03460 21767 20745 gene locus_tag LOCUS_03470 gene pheS 21767 20745 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965654.1 protein_id gnl|my_center|LOCUS_03470 22140 23768 gene locus_tag LOCUS_03480 22140 23768 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_03480 23839 23915 gene locus_tag LOCUS_t00070 23839 23915 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 24594 24175 gene locus_tag LOCUS_03490 24594 24175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03490 24869 24591 gene locus_tag LOCUS_03500 24869 24591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03500 25588 25019 gene locus_tag LOCUS_03510 25588 25019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 26878 26420 gene locus_tag LOCUS_03520 26878 26420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 27315 28163 gene locus_tag LOCUS_03530 gene cdaA 27315 28163 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_03530 28150 29538 gene locus_tag LOCUS_03540 28150 29538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 29540 31147 gene locus_tag LOCUS_03550 29540 31147 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861896.1 protein_id gnl|my_center|LOCUS_03550 31163 31876 gene locus_tag LOCUS_03560 31163 31876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357453.1 protein_id gnl|my_center|LOCUS_03560 32079 32294 gene locus_tag LOCUS_03570 32079 32294 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420706.1 protein_id gnl|my_center|LOCUS_03570 32311 33381 gene locus_tag LOCUS_03580 32311 33381 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432442.1 protein_id gnl|my_center|LOCUS_03580 33384 34121 gene locus_tag LOCUS_03590 33384 34121 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_03590 34127 34663 gene locus_tag LOCUS_03600 34127 34663 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420711.1 protein_id gnl|my_center|LOCUS_03600 34818 35780 gene locus_tag LOCUS_03610 34818 35780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 35793 36389 gene locus_tag LOCUS_03620 35793 36389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 38650 36386 gene locus_tag LOCUS_03630 gene priA 38650 36386 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047882.1 protein_id gnl|my_center|LOCUS_03630 38897 38688 gene locus_tag LOCUS_03640 38897 38688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 39522 38890 gene locus_tag LOCUS_03650 gene gmk 39522 38890 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431170.1 protein_id gnl|my_center|LOCUS_03650 40418 39534 gene locus_tag LOCUS_03660 40418 39534 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_03660 41457 40489 gene locus_tag LOCUS_03670 41457 40489 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146584.1 protein_id gnl|my_center|LOCUS_03670 <42961 41454 gene locus_tag LOCUS_03680 <42961 41454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965961.1:NAD-dependent DNA ligase LigA >Feature sequence07 <1 353 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaatccacgctcccgcgtggggagcgac 814 524 gene locus_tag LOCUS_03690 gene cas2 814 524 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932801.1 protein_id gnl|my_center|LOCUS_03690 1850 819 gene locus_tag LOCUS_03700 gene cas1c 1850 819 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_03700 2524 1847 gene locus_tag LOCUS_03710 gene cas4 2524 1847 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060901.1 protein_id gnl|my_center|LOCUS_03710 3393 2506 gene locus_tag LOCUS_03720 gene cas7c 3393 2506 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_03720 5116 3395 gene locus_tag LOCUS_03730 gene cas8c 5116 3395 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388585.1 protein_id gnl|my_center|LOCUS_03730 5778 5113 gene locus_tag LOCUS_03740 gene cas5c 5778 5113 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176707.1 protein_id gnl|my_center|LOCUS_03740 8031 5887 gene locus_tag LOCUS_03750 8031 5887 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787402.1 protein_id gnl|my_center|LOCUS_03750 9244 8561 gene locus_tag LOCUS_03760 9244 8561 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811882.1 protein_id gnl|my_center|LOCUS_03760 9334 11127 gene locus_tag LOCUS_03770 9334 11127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 11165 11548 gene locus_tag LOCUS_03780 11165 11548 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_03780 14208 11728 gene locus_tag LOCUS_03790 gene gyrA 14208 11728 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429305.1 protein_id gnl|my_center|LOCUS_03790 16151 14220 gene locus_tag LOCUS_03800 gene gyrB 16151 14220 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963335.1 protein_id gnl|my_center|LOCUS_03800 17259 16177 gene locus_tag LOCUS_03810 gene recF 17259 16177 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963333.1 protein_id gnl|my_center|LOCUS_03810 17987 17457 gene locus_tag LOCUS_03820 17987 17457 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902280.1 protein_id gnl|my_center|LOCUS_03820 19250 18111 gene locus_tag LOCUS_03830 19250 18111 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436121.1 protein_id gnl|my_center|LOCUS_03830 19347 19670 gene locus_tag LOCUS_03840 19347 19670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 20370 20143 gene locus_tag LOCUS_03850 20370 20143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 20488 20793 gene locus_tag LOCUS_03860 20488 20793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 21275 20982 gene locus_tag LOCUS_03870 21275 20982 CDS product cysteine-rich small domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437519.1 protein_id gnl|my_center|LOCUS_03870 21862 21272 gene locus_tag LOCUS_03880 21862 21272 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803433.1 protein_id gnl|my_center|LOCUS_03880 21969 22634 gene locus_tag LOCUS_03890 21969 22634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 22622 23410 gene locus_tag LOCUS_03900 gene yqeB 22622 23410 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393498.1 protein_id gnl|my_center|LOCUS_03900 23407 24447 gene locus_tag LOCUS_03910 gene selD 23407 24447 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957237.1 protein_id gnl|my_center|LOCUS_03910 25576 24434 gene locus_tag LOCUS_03920 25576 24434 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048446.1 protein_id gnl|my_center|LOCUS_03920 26190 25573 gene locus_tag LOCUS_03930 gene yedF 26190 25573 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986892.1 protein_id gnl|my_center|LOCUS_03930 26288 26527 gene locus_tag LOCUS_03940 26288 26527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 27393 26524 gene locus_tag LOCUS_03950 27393 26524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 28069 27383 gene locus_tag LOCUS_03960 28069 27383 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_03960 28199 28915 gene locus_tag LOCUS_03970 28199 28915 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433947.1 protein_id gnl|my_center|LOCUS_03970 29551 29174 gene locus_tag LOCUS_03980 29551 29174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 31236 30082 gene locus_tag LOCUS_03990 31236 30082 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_03990 34109 31332 gene locus_tag LOCUS_04000 34109 31332 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072762.1 protein_id gnl|my_center|LOCUS_04000 35242 34106 gene locus_tag LOCUS_04010 35242 34106 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072763.1 protein_id gnl|my_center|LOCUS_04010 35934 35239 gene locus_tag LOCUS_04020 35934 35239 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678782.1 protein_id gnl|my_center|LOCUS_04020 36956 36243 gene locus_tag LOCUS_04030 36956 36243 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462080.1 protein_id gnl|my_center|LOCUS_04030 38013 36943 gene locus_tag LOCUS_04040 38013 36943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 38528 38124 gene locus_tag LOCUS_04050 38528 38124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 39533 38601 gene locus_tag LOCUS_04060 39533 38601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 40197 39562 gene locus_tag LOCUS_04070 40197 39562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 40369 42123 gene locus_tag LOCUS_04080 40369 42123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 42185 42649 gene locus_tag LOCUS_04090 42185 42649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 >Feature sequence08 780 127 gene locus_tag LOCUS_04100 780 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 1173 820 gene locus_tag LOCUS_04110 1173 820 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581517.1 protein_id gnl|my_center|LOCUS_04110 2032 1502 gene locus_tag LOCUS_04120 2032 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 2153 3169 gene locus_tag LOCUS_04130 gene galE 2153 3169 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_04130 3288 4526 gene locus_tag LOCUS_04140 3288 4526 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964048.1 protein_id gnl|my_center|LOCUS_04140 6235 5111 gene locus_tag LOCUS_04150 6235 5111 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964085.1 protein_id gnl|my_center|LOCUS_04150 6372 7352 gene locus_tag LOCUS_04160 6372 7352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 7491 8909 gene locus_tag LOCUS_04170 7491 8909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 8944 10059 gene locus_tag LOCUS_04180 8944 10059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 10612 10130 gene locus_tag LOCUS_04190 10612 10130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 10825 11607 gene locus_tag LOCUS_04200 10825 11607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 11851 13104 gene locus_tag LOCUS_04210 11851 13104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 13462 17046 gene locus_tag LOCUS_04220 gene nifJ 13462 17046 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391612.1 protein_id gnl|my_center|LOCUS_04220 18264 17122 gene locus_tag LOCUS_04230 18264 17122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 18914 18285 gene locus_tag LOCUS_04240 18914 18285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 18898 19047 gene locus_tag LOCUS_04250 18898 19047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 20156 19401 gene locus_tag LOCUS_04260 20156 19401 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462044.1 protein_id gnl|my_center|LOCUS_04260 20520 20801 gene locus_tag LOCUS_04270 20520 20801 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815560.1 protein_id gnl|my_center|LOCUS_04270 21204 22889 gene locus_tag LOCUS_04280 21204 22889 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_04280 23557 22970 gene locus_tag LOCUS_04290 23557 22970 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382314.1 protein_id gnl|my_center|LOCUS_04290 23919 24467 gene locus_tag LOCUS_04300 23919 24467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 24514 24993 gene locus_tag LOCUS_04310 24514 24993 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966433.1 protein_id gnl|my_center|LOCUS_04310 24977 26116 gene locus_tag LOCUS_04320 24977 26116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 26113 26745 gene locus_tag LOCUS_04330 26113 26745 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387199.1 protein_id gnl|my_center|LOCUS_04330 27975 27142 gene locus_tag LOCUS_04340 gene noc 27975 27142 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429292.1 protein_id gnl|my_center|LOCUS_04340 28692 27991 gene locus_tag LOCUS_04350 gene rsmG 28692 27991 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462328.1 protein_id gnl|my_center|LOCUS_04350 30562 28682 gene locus_tag LOCUS_04360 gene mnmG 30562 28682 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_04360 30861 32231 gene locus_tag LOCUS_04370 30861 32231 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868530.1 protein_id gnl|my_center|LOCUS_04370 33577 32300 gene locus_tag LOCUS_04380 33577 32300 CDS product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658539.1 protein_id gnl|my_center|LOCUS_04380 33684 34556 gene locus_tag LOCUS_04390 gene rsmI 33684 34556 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815011.1 protein_id gnl|my_center|LOCUS_04390 34740 35849 gene locus_tag LOCUS_04400 34740 35849 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356002.1 protein_id gnl|my_center|LOCUS_04400 35862 36044 gene locus_tag LOCUS_04410 35862 36044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 36507 36127 gene locus_tag LOCUS_04420 36507 36127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 37093 36500 gene locus_tag LOCUS_04430 37093 36500 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802006.1 protein_id gnl|my_center|LOCUS_04430 37246 38502 gene locus_tag LOCUS_04440 37246 38502 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986389.1 protein_id gnl|my_center|LOCUS_04440 38668 39369 gene locus_tag LOCUS_04450 38668 39369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 39398 40462 gene locus_tag LOCUS_04460 39398 40462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 40459 40977 gene locus_tag LOCUS_04470 40459 40977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 41044 42450 gene locus_tag LOCUS_04480 41044 42450 CDS product MBOAT family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035887521.1 protein_id gnl|my_center|LOCUS_04480 >Feature sequence09 1992 148 gene locus_tag LOCUS_04490 1992 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 2901 2350 gene locus_tag LOCUS_04500 2901 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04500 4954 3206 gene locus_tag LOCUS_04510 4954 3206 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_04510 6436 5117 gene locus_tag LOCUS_04520 gene mnmE 6436 5117 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898860.1 protein_id gnl|my_center|LOCUS_04520 6916 6536 gene locus_tag LOCUS_04530 6916 6536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 8440 7001 gene locus_tag LOCUS_04540 8440 7001 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231051.1 protein_id gnl|my_center|LOCUS_04540 9549 8473 gene locus_tag LOCUS_04550 9549 8473 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987044.1 protein_id gnl|my_center|LOCUS_04550 12724 9881 gene locus_tag LOCUS_04560 12724 9881 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054447.1 protein_id gnl|my_center|LOCUS_04560 13333 13148 gene locus_tag LOCUS_04570 13333 13148 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811990.1 protein_id gnl|my_center|LOCUS_04570 13693 13355 gene locus_tag LOCUS_04580 13693 13355 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983741.1 protein_id gnl|my_center|LOCUS_04580 13833 15131 gene locus_tag LOCUS_04590 13833 15131 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965885.1 protein_id gnl|my_center|LOCUS_04590 15760 15254 gene locus_tag LOCUS_04600 15760 15254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 16002 15757 gene locus_tag LOCUS_04610 16002 15757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 16606 16160 gene locus_tag LOCUS_04620 16606 16160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 17188 16640 gene locus_tag LOCUS_04630 17188 16640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 17583 17185 gene locus_tag LOCUS_04640 17583 17185 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416526.1 protein_id gnl|my_center|LOCUS_04640 18029 17595 gene locus_tag LOCUS_04650 18029 17595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 18570 18031 gene locus_tag LOCUS_04660 18570 18031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 19538 18561 gene locus_tag LOCUS_04670 19538 18561 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_04670 20838 19528 gene locus_tag LOCUS_04680 gene rsxC 20838 19528 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869095.1 protein_id gnl|my_center|LOCUS_04680 21892 20849 gene locus_tag LOCUS_04690 21892 20849 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775309.1 protein_id gnl|my_center|LOCUS_04690 23096 22047 gene locus_tag LOCUS_04700 23096 22047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 23638 24744 gene locus_tag LOCUS_04710 23638 24744 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 protein_id gnl|my_center|LOCUS_04710 24944 25447 gene locus_tag LOCUS_04720 24944 25447 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944439.1 protein_id gnl|my_center|LOCUS_04720 25437 26360 gene locus_tag LOCUS_04730 25437 26360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 28921 26468 gene locus_tag LOCUS_04740 28921 26468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 29286 28921 gene locus_tag LOCUS_04750 29286 28921 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459275.1 protein_id gnl|my_center|LOCUS_04750 29734 29991 gene locus_tag LOCUS_04760 29734 29991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666892.1 protein_id gnl|my_center|LOCUS_04760 30098 30877 gene locus_tag LOCUS_04770 30098 30877 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680889.1 protein_id gnl|my_center|LOCUS_04770 32120 31107 gene locus_tag LOCUS_04780 32120 31107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 32626 32213 gene locus_tag LOCUS_04790 32626 32213 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673963.1 protein_id gnl|my_center|LOCUS_04790 32899 33111 gene locus_tag LOCUS_04800 32899 33111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 33304 33570 gene locus_tag LOCUS_04810 33304 33570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 33855 34049 gene locus_tag LOCUS_04820 33855 34049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 34729 34160 gene locus_tag LOCUS_04830 34729 34160 CDS product nucleoside-triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047955.1 protein_id gnl|my_center|LOCUS_04830 35751 34726 gene locus_tag LOCUS_04840 35751 34726 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362591.1 protein_id gnl|my_center|LOCUS_04840 36039 35824 gene locus_tag LOCUS_04850 36039 35824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04850 36616 36332 gene locus_tag LOCUS_04860 36616 36332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 37099 36749 gene locus_tag LOCUS_04870 37099 36749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 37913 37122 gene locus_tag LOCUS_04880 37913 37122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 38121 37900 gene locus_tag LOCUS_04890 38121 37900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 38487 38341 gene locus_tag LOCUS_04900 38487 38341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 38707 38519 gene locus_tag LOCUS_04910 38707 38519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 39560 38721 gene locus_tag LOCUS_04920 39560 38721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 40936 39557 gene locus_tag LOCUS_04930 40936 39557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 41218 40943 gene locus_tag LOCUS_04940 41218 40943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 >Feature sequence10 <1 599 gene locus_tag LOCUS_04950 <1 599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966254.1:tRNA 4-thiouridine(8) synthase ThiI 1267 596 gene locus_tag LOCUS_04960 gene yunB 1267 596 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965597.1 protein_id gnl|my_center|LOCUS_04960 2595 1357 gene locus_tag LOCUS_04970 2595 1357 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393494.1 protein_id gnl|my_center|LOCUS_04970 3800 2592 gene locus_tag LOCUS_04980 gene pepT 3800 2592 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963798.1 protein_id gnl|my_center|LOCUS_04980 3915 4721 gene locus_tag LOCUS_04990 3915 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 6106 4730 gene locus_tag LOCUS_05000 gene hslU 6106 4730 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245556.1 protein_id gnl|my_center|LOCUS_05000 6650 6117 gene locus_tag LOCUS_05010 gene hslV 6650 6117 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724001.1 protein_id gnl|my_center|LOCUS_05010 8015 6711 gene locus_tag LOCUS_05020 gene trmFO 8015 6711 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989721.1 protein_id gnl|my_center|LOCUS_05020 10119 8005 gene locus_tag LOCUS_05030 gene topA 10119 8005 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965091.1 protein_id gnl|my_center|LOCUS_05030 11252 10140 gene locus_tag LOCUS_05040 gene dprA 11252 10140 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_05040 12785 11256 gene locus_tag LOCUS_05050 12785 11256 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546463.1 protein_id gnl|my_center|LOCUS_05050 13264 12785 gene locus_tag LOCUS_05060 13264 12785 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393838.1 protein_id gnl|my_center|LOCUS_05060 17284 13271 gene locus_tag LOCUS_05070 17284 13271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 17711 17352 gene locus_tag LOCUS_05080 17711 17352 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438259.1 protein_id gnl|my_center|LOCUS_05080 18359 17730 gene locus_tag LOCUS_05090 18359 17730 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254306.1 protein_id gnl|my_center|LOCUS_05090 19212 18346 gene locus_tag LOCUS_05100 gene ylqF 19212 18346 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861161.1 protein_id gnl|my_center|LOCUS_05100 19622 19269 gene locus_tag LOCUS_05110 gene rplS 19622 19269 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813207.1 protein_id gnl|my_center|LOCUS_05110 20494 19754 gene locus_tag LOCUS_05120 gene trmD 20494 19754 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829466.1 protein_id gnl|my_center|LOCUS_05120 20936 20484 gene locus_tag LOCUS_05130 gene rimM 20936 20484 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_05130 21295 20999 gene locus_tag LOCUS_05140 21295 20999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 21534 21295 gene locus_tag LOCUS_05150 gene rpsP 21534 21295 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_05150 22924 21587 gene locus_tag LOCUS_05160 gene ffh 22924 21587 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_05160 23267 22926 gene locus_tag LOCUS_05170 23267 22926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 24253 23366 gene locus_tag LOCUS_05180 24253 23366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 27826 24263 gene locus_tag LOCUS_05190 gene smc 27826 24263 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478972.1 protein_id gnl|my_center|LOCUS_05190 28557 27853 gene locus_tag LOCUS_05200 gene rnc 28557 27853 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440969.1 protein_id gnl|my_center|LOCUS_05200 28856 28629 gene locus_tag LOCUS_05210 gene acpP 28856 28629 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163100.1 protein_id gnl|my_center|LOCUS_05210 29918 28899 gene locus_tag LOCUS_05220 gene plsX 29918 28899 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047867.1 protein_id gnl|my_center|LOCUS_05220 30216 30028 gene locus_tag LOCUS_05230 gene rpmF 30216 30028 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362601.1 protein_id gnl|my_center|LOCUS_05230 30755 30219 gene locus_tag LOCUS_05240 30755 30219 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094714.1 protein_id gnl|my_center|LOCUS_05240 32027 30825 gene locus_tag LOCUS_05250 32027 30825 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438096.1 protein_id gnl|my_center|LOCUS_05250 33041 32040 gene locus_tag LOCUS_05260 gene pta 33041 32040 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_05260 33158 34366 gene locus_tag LOCUS_05270 33158 34366 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965048.1 protein_id gnl|my_center|LOCUS_05270 35298 34906 gene locus_tag LOCUS_05280 35298 34906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 36471 35536 gene locus_tag LOCUS_05290 36471 35536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 36955 36455 gene locus_tag LOCUS_05300 gene coaD 36955 36455 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295492.1 protein_id gnl|my_center|LOCUS_05300 37397 36957 gene locus_tag LOCUS_05310 37397 36957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 38133 37555 gene locus_tag LOCUS_05320 38133 37555 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642751.1 protein_id gnl|my_center|LOCUS_05320 <39174 38126 gene locus_tag LOCUS_05330 <39174 38126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860647.1:amidohydrolase >Feature sequence11 80 277 gene locus_tag LOCUS_05340 80 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05340 671 1357 gene locus_tag LOCUS_05350 671 1357 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760196.1 protein_id gnl|my_center|LOCUS_05350 1419 1859 gene locus_tag LOCUS_05360 1419 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 1981 2406 gene locus_tag LOCUS_05370 gene mscL 1981 2406 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054763.1 protein_id gnl|my_center|LOCUS_05370 2885 2580 gene locus_tag LOCUS_05380 2885 2580 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214503.1 protein_id gnl|my_center|LOCUS_05380 3561 3070 gene locus_tag LOCUS_05390 3561 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 3727 4224 gene locus_tag LOCUS_05400 3727 4224 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880100.1 protein_id gnl|my_center|LOCUS_05400 4772 4464 gene locus_tag LOCUS_05410 4772 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 5043 6359 gene locus_tag LOCUS_05420 5043 6359 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_05420 6473 7558 gene locus_tag LOCUS_05430 6473 7558 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944368.1 protein_id gnl|my_center|LOCUS_05430 7571 8368 gene locus_tag LOCUS_05440 7571 8368 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680450.1 protein_id gnl|my_center|LOCUS_05440 10088 8550 gene locus_tag LOCUS_05450 10088 8550 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368539.1 protein_id gnl|my_center|LOCUS_05450 10673 10101 gene locus_tag LOCUS_05460 10673 10101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 11835 10744 gene locus_tag LOCUS_05470 11835 10744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 12612 12037 gene locus_tag LOCUS_05480 gene pyrE 12612 12037 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420885.1 protein_id gnl|my_center|LOCUS_05480 13527 12622 gene locus_tag LOCUS_05490 13527 12622 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860662.1 protein_id gnl|my_center|LOCUS_05490 14239 13520 gene locus_tag LOCUS_05500 14239 13520 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434506.1 protein_id gnl|my_center|LOCUS_05500 15081 14230 gene locus_tag LOCUS_05510 gene pyrF 15081 14230 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965940.1 protein_id gnl|my_center|LOCUS_05510 16222 15044 gene locus_tag LOCUS_05520 16222 15044 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048209.1 protein_id gnl|my_center|LOCUS_05520 16641 16219 gene locus_tag LOCUS_05530 16641 16219 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357668.1 protein_id gnl|my_center|LOCUS_05530 17571 16654 gene locus_tag LOCUS_05540 gene pyrB 17571 16654 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_05540 17835 18227 gene locus_tag LOCUS_05550 17835 18227 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722027.1 protein_id gnl|my_center|LOCUS_05550 18477 21122 gene locus_tag LOCUS_05560 18477 21122 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566079.1 protein_id gnl|my_center|LOCUS_05560 22388 21219 gene locus_tag LOCUS_05570 22388 21219 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048277.1 protein_id gnl|my_center|LOCUS_05570 22524 22862 gene locus_tag LOCUS_05580 22524 22862 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813638.1 protein_id gnl|my_center|LOCUS_05580 23036 23917 gene locus_tag LOCUS_05590 23036 23917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 23907 25622 gene locus_tag LOCUS_05600 23907 25622 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460241.1 protein_id gnl|my_center|LOCUS_05600 25681 25953 gene locus_tag LOCUS_05610 25681 25953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 27797 26022 gene locus_tag LOCUS_05620 27797 26022 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611218.1 protein_id gnl|my_center|LOCUS_05620 29587 27794 gene locus_tag LOCUS_05630 29587 27794 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230927.1 protein_id gnl|my_center|LOCUS_05630 30267 30842 gene locus_tag LOCUS_05640 30267 30842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 30872 31414 gene locus_tag LOCUS_05650 30872 31414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 31496 32242 gene locus_tag LOCUS_05660 31496 32242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 32355 33170 gene locus_tag LOCUS_05670 32355 33170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 33501 34052 gene locus_tag LOCUS_05680 33501 34052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 34188 34754 gene locus_tag LOCUS_05690 34188 34754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 34769 37750 gene locus_tag LOCUS_05700 34769 37750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 >Feature sequence12 1520 15 gene locus_tag LOCUS_05710 gene lysS 1520 15 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966473.1 protein_id gnl|my_center|LOCUS_05710 2007 1531 gene locus_tag LOCUS_05720 gene greA 2007 1531 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_05720 3462 2365 gene locus_tag LOCUS_05730 3462 2365 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262909.1 protein_id gnl|my_center|LOCUS_05730 3593 4729 gene locus_tag LOCUS_05740 3593 4729 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_05740 4788 5882 gene locus_tag LOCUS_05750 gene gcvT 4788 5882 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631769.1 protein_id gnl|my_center|LOCUS_05750 5912 6289 gene locus_tag LOCUS_05760 gene gcvH 5912 6289 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259335.1 protein_id gnl|my_center|LOCUS_05760 6303 7643 gene locus_tag LOCUS_05770 gene gcvPA 6303 7643 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393441.1 protein_id gnl|my_center|LOCUS_05770 7640 9091 gene locus_tag LOCUS_05780 gene gcvPB 7640 9091 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948420.1 protein_id gnl|my_center|LOCUS_05780 9750 11147 gene locus_tag LOCUS_05790 gene cysS 9750 11147 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_05790 11176 11694 gene locus_tag LOCUS_05800 11176 11694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 11696 12985 gene locus_tag LOCUS_05810 11696 12985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 14056 13145 gene locus_tag LOCUS_05820 14056 13145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 14353 15066 gene locus_tag LOCUS_05830 14353 15066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 15322 16863 gene locus_tag LOCUS_05840 15322 16863 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837092.1 protein_id gnl|my_center|LOCUS_05840 16944 17945 gene locus_tag LOCUS_05850 16944 17945 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016441.1 protein_id gnl|my_center|LOCUS_05850 18592 18062 gene locus_tag LOCUS_05860 gene rplQ 18592 18062 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357477.1 protein_id gnl|my_center|LOCUS_05860 19564 18620 gene locus_tag LOCUS_05870 19564 18620 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966385.1 protein_id gnl|my_center|LOCUS_05870 20248 19619 gene locus_tag LOCUS_05880 gene rpsD 20248 19619 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459108.1 protein_id gnl|my_center|LOCUS_05880 20667 20263 gene locus_tag LOCUS_05890 gene rpsK 20667 20263 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401717.1 protein_id gnl|my_center|LOCUS_05890 21049 20681 gene locus_tag LOCUS_05900 gene rpsM 21049 20681 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_05900 21425 23455 gene locus_tag LOCUS_05910 21425 23455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 25500 24019 gene locus_tag LOCUS_05920 25500 24019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 27834 25927 gene locus_tag LOCUS_05930 27834 25927 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_05930 28949 27903 gene locus_tag LOCUS_05940 28949 27903 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986916.1 protein_id gnl|my_center|LOCUS_05940 30010 28946 gene locus_tag LOCUS_05950 30010 28946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986915.1 protein_id gnl|my_center|LOCUS_05950 34899 30181 gene locus_tag LOCUS_05960 34899 30181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986914.1 protein_id gnl|my_center|LOCUS_05960 35087 35389 gene locus_tag LOCUS_05970 35087 35389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 <36155 35565 gene locus_tag LOCUS_05980 <36155 35565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003359170.1:V-type ATP synthase subunit D >Feature sequence13 1545 337 gene locus_tag LOCUS_05990 1545 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 3238 1952 gene locus_tag LOCUS_06000 gene galK 3238 1952 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456582.1 protein_id gnl|my_center|LOCUS_06000 4104 3304 gene locus_tag LOCUS_06010 4104 3304 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861405.1 protein_id gnl|my_center|LOCUS_06010 5704 4196 gene locus_tag LOCUS_06020 5704 4196 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423106.1 protein_id gnl|my_center|LOCUS_06020 6581 5718 gene locus_tag LOCUS_06030 gene folD 6581 5718 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545120.1 protein_id gnl|my_center|LOCUS_06030 10313 6633 gene locus_tag LOCUS_06040 10313 6633 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390101.1 protein_id gnl|my_center|LOCUS_06040 11590 10316 gene locus_tag LOCUS_06050 gene purD 11590 10316 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_06050 12774 11605 gene locus_tag LOCUS_06060 12774 11605 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788311.1 protein_id gnl|my_center|LOCUS_06060 13480 12764 gene locus_tag LOCUS_06070 13480 12764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 14067 13477 gene locus_tag LOCUS_06080 gene purN 14067 13477 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_06080 15098 14061 gene locus_tag LOCUS_06090 gene purM 15098 14061 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461474.1 protein_id gnl|my_center|LOCUS_06090 16562 15102 gene locus_tag LOCUS_06100 gene purF 16562 15102 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964701.1 protein_id gnl|my_center|LOCUS_06100 17265 16555 gene locus_tag LOCUS_06110 17265 16555 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480166.1 protein_id gnl|my_center|LOCUS_06110 17847 17365 gene locus_tag LOCUS_06120 gene purE 17847 17365 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147124.1 protein_id gnl|my_center|LOCUS_06120 18153 19433 gene locus_tag LOCUS_06130 18153 19433 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943920.1 protein_id gnl|my_center|LOCUS_06130 19433 20848 gene locus_tag LOCUS_06140 gene purB 19433 20848 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_06140 21574 20921 gene locus_tag LOCUS_06150 gene rpe 21574 20921 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589959.1 protein_id gnl|my_center|LOCUS_06150 22439 21567 gene locus_tag LOCUS_06160 gene rsgA 22439 21567 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113935.1 protein_id gnl|my_center|LOCUS_06160 24300 22420 gene locus_tag LOCUS_06170 gene pknB 24300 22420 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392429.1 protein_id gnl|my_center|LOCUS_06170 25031 24297 gene locus_tag LOCUS_06180 gene prpC 25031 24297 CDS product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 protein_id gnl|my_center|LOCUS_06180 26112 25033 gene locus_tag LOCUS_06190 gene rlmN 26112 25033 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965033.1 protein_id gnl|my_center|LOCUS_06190 27391 26087 gene locus_tag LOCUS_06200 gene rsmB 27391 26087 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249680.1 protein_id gnl|my_center|LOCUS_06200 28329 27388 gene locus_tag LOCUS_06210 gene fmt 28329 27388 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460526.1 protein_id gnl|my_center|LOCUS_06210 28805 28326 gene locus_tag LOCUS_06220 gene def 28805 28326 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_06220 30419 29145 gene locus_tag LOCUS_06230 30419 29145 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899653.1 protein_id gnl|my_center|LOCUS_06230 30544 31275 gene locus_tag LOCUS_06240 30544 31275 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_06240 31412 32056 gene locus_tag LOCUS_06250 31412 32056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 32053 32982 gene locus_tag LOCUS_06260 32053 32982 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948969.1 protein_id gnl|my_center|LOCUS_06260 32987 33760 gene locus_tag LOCUS_06270 32987 33760 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948970.1 protein_id gnl|my_center|LOCUS_06270 33744 34316 gene locus_tag LOCUS_06280 33744 34316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 >Feature sequence14 <1 1593 gene locus_tag LOCUS_06290 <1 1593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_066666688.1:NADH-quinone oxidoreductase subunit NuoF 1728 3704 gene locus_tag LOCUS_06300 gene gyrB 1728 3704 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391556.1 protein_id gnl|my_center|LOCUS_06300 3691 6099 gene locus_tag LOCUS_06310 gene gyrA 3691 6099 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429305.1 protein_id gnl|my_center|LOCUS_06310 6196 6810 gene locus_tag LOCUS_06320 6196 6810 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048153.1 protein_id gnl|my_center|LOCUS_06320 6881 7639 gene locus_tag LOCUS_06330 6881 7639 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929384.1 protein_id gnl|my_center|LOCUS_06330 7639 9342 gene locus_tag LOCUS_06340 gene rqcH 7639 9342 CDS product tRNA modification protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886504.1 protein_id gnl|my_center|LOCUS_06340 9400 10335 gene locus_tag LOCUS_06350 9400 10335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 10393 10986 gene locus_tag LOCUS_06360 10393 10986 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965953.1 protein_id gnl|my_center|LOCUS_06360 11098 12789 gene locus_tag LOCUS_06370 gene lonB 11098 12789 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357503.1 protein_id gnl|my_center|LOCUS_06370 13100 15514 gene locus_tag LOCUS_06380 gene leuS 13100 15514 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830785.1 protein_id gnl|my_center|LOCUS_06380 16204 18108 gene locus_tag LOCUS_06390 16204 18108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 18130 19497 gene locus_tag LOCUS_06400 gene lpdA 18130 19497 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108698.1 protein_id gnl|my_center|LOCUS_06400 19515 19946 gene locus_tag LOCUS_06410 gene tadA 19515 19946 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434328.1 protein_id gnl|my_center|LOCUS_06410 19950 20558 gene locus_tag LOCUS_06420 gene yihA 19950 20558 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891775.1 protein_id gnl|my_center|LOCUS_06420 20628 21008 gene locus_tag LOCUS_06430 20628 21008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 21024 21719 gene locus_tag LOCUS_06440 21024 21719 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963959.1 protein_id gnl|my_center|LOCUS_06440 23088 21721 gene locus_tag LOCUS_06450 23088 21721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 23178 25115 gene locus_tag LOCUS_06460 23178 25115 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966001.1 protein_id gnl|my_center|LOCUS_06460 26052 25180 gene locus_tag LOCUS_06470 26052 25180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 26331 27164 gene locus_tag LOCUS_06480 gene coaW 26331 27164 CDS product type II pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446246.1 protein_id gnl|my_center|LOCUS_06480 27320 29344 gene locus_tag LOCUS_06490 gene uvrB 27320 29344 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_06490 29355 32189 gene locus_tag LOCUS_06500 gene uvrA 29355 32189 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401468.1 protein_id gnl|my_center|LOCUS_06500 32192 32929 gene locus_tag LOCUS_06510 32192 32929 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964066.1 protein_id gnl|my_center|LOCUS_06510 34119 32941 gene locus_tag LOCUS_06520 34119 32941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 34299 35648 gene locus_tag LOCUS_06530 34299 35648 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964010.1 protein_id gnl|my_center|LOCUS_06530 >Feature sequence15 1113 229 gene locus_tag LOCUS_06540 1113 229 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_06540 3053 1110 gene locus_tag LOCUS_06550 3053 1110 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510924.1 protein_id gnl|my_center|LOCUS_06550 3739 3053 gene locus_tag LOCUS_06560 3739 3053 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461250.1 protein_id gnl|my_center|LOCUS_06560 7373 3828 gene locus_tag LOCUS_06570 gene addA 7373 3828 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965560.1 protein_id gnl|my_center|LOCUS_06570 8422 7427 gene locus_tag LOCUS_06580 8422 7427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 9044 8451 gene locus_tag LOCUS_06590 gene recR 9044 8451 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722062.1 protein_id gnl|my_center|LOCUS_06590 9393 9058 gene locus_tag LOCUS_06600 9393 9058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 9563 10114 gene locus_tag LOCUS_06610 gene yfcE 9563 10114 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966036.1 protein_id gnl|my_center|LOCUS_06610 10351 10166 gene locus_tag LOCUS_06620 10351 10166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 10899 10348 gene locus_tag LOCUS_06630 gene frr 10899 10348 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640736.1 protein_id gnl|my_center|LOCUS_06630 11667 10966 gene locus_tag LOCUS_06640 gene pyrH 11667 10966 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965095.1 protein_id gnl|my_center|LOCUS_06640 12652 11771 gene locus_tag LOCUS_06650 gene tsf 12652 11771 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231929.1 protein_id gnl|my_center|LOCUS_06650 13427 12675 gene locus_tag LOCUS_06660 gene rpsB 13427 12675 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460417.1 protein_id gnl|my_center|LOCUS_06660 13867 13592 gene locus_tag LOCUS_06670 13867 13592 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964988.1 protein_id gnl|my_center|LOCUS_06670 14306 13872 gene locus_tag LOCUS_06680 gene ruvX 14306 13872 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440635.1 protein_id gnl|my_center|LOCUS_06680 15260 14316 gene locus_tag LOCUS_06690 15260 14316 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393143.1 protein_id gnl|my_center|LOCUS_06690 15537 15265 gene locus_tag LOCUS_06700 15537 15265 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348590.1 protein_id gnl|my_center|LOCUS_06700 15758 16981 gene locus_tag LOCUS_06710 15758 16981 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459866.1 protein_id gnl|my_center|LOCUS_06710 18332 17052 gene locus_tag LOCUS_06720 18332 17052 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_06720 18417 19481 gene locus_tag LOCUS_06730 gene mtnA 18417 19481 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948892.1 protein_id gnl|my_center|LOCUS_06730 21024 19537 gene locus_tag LOCUS_06740 21024 19537 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_06740 21319 21246 gene locus_tag LOCUS_t00080 21319 21246 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 21482 22864 gene locus_tag LOCUS_06750 gene asnS 21482 22864 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432161.1 protein_id gnl|my_center|LOCUS_06750 23243 23905 gene locus_tag LOCUS_06760 23243 23905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 24280 25548 gene locus_tag LOCUS_06770 24280 25548 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583013.1 protein_id gnl|my_center|LOCUS_06770 25637 26482 gene locus_tag LOCUS_06780 25637 26482 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112931.1 protein_id gnl|my_center|LOCUS_06780 26482 27327 gene locus_tag LOCUS_06790 26482 27327 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068636.1 protein_id gnl|my_center|LOCUS_06790 28133 27390 gene locus_tag LOCUS_06800 28133 27390 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_06800 28776 28204 gene locus_tag LOCUS_06810 28776 28204 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947937.1 protein_id gnl|my_center|LOCUS_06810 29698 28766 gene locus_tag LOCUS_06820 29698 28766 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387471.1 protein_id gnl|my_center|LOCUS_06820 29894 31366 gene locus_tag LOCUS_06830 29894 31366 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_06830 31883 31970 gene locus_tag LOCUS_t00090 31883 31970 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 33161 32004 gene locus_tag LOCUS_06840 33161 32004 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272155.1 protein_id gnl|my_center|LOCUS_06840 33506 33279 gene locus_tag LOCUS_06850 33506 33279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 34358 33582 gene locus_tag LOCUS_06860 34358 33582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368666.1 protein_id gnl|my_center|LOCUS_06860 >Feature sequence16 991 20 gene locus_tag LOCUS_06870 991 20 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812740.1 protein_id gnl|my_center|LOCUS_06870 1943 1362 gene locus_tag LOCUS_06880 1943 1362 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226290.1 protein_id gnl|my_center|LOCUS_06880 3012 2011 gene locus_tag LOCUS_06890 3012 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 3247 4296 gene locus_tag LOCUS_06900 3247 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 4293 5732 gene locus_tag LOCUS_06910 4293 5732 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427657.1 protein_id gnl|my_center|LOCUS_06910 5702 6244 gene locus_tag LOCUS_06920 5702 6244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 6261 7151 gene locus_tag LOCUS_06930 6261 7151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 7162 7809 gene locus_tag LOCUS_06940 gene deoC 7162 7809 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017446.1 protein_id gnl|my_center|LOCUS_06940 8165 9220 gene locus_tag LOCUS_06950 8165 9220 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874921.1 protein_id gnl|my_center|LOCUS_06950 10115 9315 gene locus_tag LOCUS_06960 10115 9315 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680889.1 protein_id gnl|my_center|LOCUS_06960 11001 10129 gene locus_tag LOCUS_06970 11001 10129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 11254 11129 gene locus_tag LOCUS_06980 11254 11129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 13138 11309 gene locus_tag LOCUS_06990 13138 11309 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_06990 14813 13131 gene locus_tag LOCUS_07000 14813 13131 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_07000 15182 16060 gene locus_tag LOCUS_07010 15182 16060 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549090.1 protein_id gnl|my_center|LOCUS_07010 17175 16243 gene locus_tag LOCUS_07020 17175 16243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 18232 17501 gene locus_tag LOCUS_07030 18232 17501 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956797.1 protein_id gnl|my_center|LOCUS_07030 18960 18232 gene locus_tag LOCUS_07040 18960 18232 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681925.1 protein_id gnl|my_center|LOCUS_07040 19526 18963 gene locus_tag LOCUS_07050 19526 18963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 20497 19721 gene locus_tag LOCUS_07060 gene murI 20497 19721 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048400.1 protein_id gnl|my_center|LOCUS_07060 20979 20494 gene locus_tag LOCUS_07070 gene rimI 20979 20494 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243019.1 protein_id gnl|my_center|LOCUS_07070 21634 20972 gene locus_tag LOCUS_07080 21634 20972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 22089 21631 gene locus_tag LOCUS_07090 gene tsaE 22089 21631 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_07090 23201 22086 gene locus_tag LOCUS_07100 gene tgt 23201 22086 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_07100 24234 23212 gene locus_tag LOCUS_07110 gene queA 24234 23212 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965581.1 protein_id gnl|my_center|LOCUS_07110 24584 24832 gene locus_tag LOCUS_07120 24584 24832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 24829 26046 gene locus_tag LOCUS_07130 24829 26046 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461101.1 protein_id gnl|my_center|LOCUS_07130 26401 26078 gene locus_tag LOCUS_07140 26401 26078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 26899 26459 gene locus_tag LOCUS_07150 26899 26459 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213920.1 protein_id gnl|my_center|LOCUS_07150 27665 26979 gene locus_tag LOCUS_07160 27665 26979 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_07160 28918 27680 gene locus_tag LOCUS_07170 28918 27680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 29383 29015 gene locus_tag LOCUS_07180 29383 29015 CDS product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284098.1 protein_id gnl|my_center|LOCUS_07180 30653 29397 gene locus_tag LOCUS_07190 30653 29397 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_07190 31356 30664 gene locus_tag LOCUS_07200 31356 30664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 33624 31531 gene locus_tag LOCUS_07210 gene pnp 33624 31531 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_07210 >Feature sequence17 110 1252 gene locus_tag LOCUS_07220 110 1252 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_07220 1263 2054 gene locus_tag LOCUS_07230 1263 2054 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888867.1 protein_id gnl|my_center|LOCUS_07230 2070 3074 gene locus_tag LOCUS_07240 2070 3074 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428573.1 protein_id gnl|my_center|LOCUS_07240 3847 3170 gene locus_tag LOCUS_07250 3847 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 4485 3961 gene locus_tag LOCUS_07260 gene raiA 4485 3961 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_07260 4665 5264 gene locus_tag LOCUS_07270 gene pth 4665 5264 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892068.1 protein_id gnl|my_center|LOCUS_07270 5264 8704 gene locus_tag LOCUS_07280 gene mfd 5264 8704 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048383.1 protein_id gnl|my_center|LOCUS_07280 8753 10177 gene locus_tag LOCUS_07290 8753 10177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 10185 10424 gene locus_tag LOCUS_07300 10185 10424 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966486.1 protein_id gnl|my_center|LOCUS_07300 10421 11086 gene locus_tag LOCUS_07310 gene ispD 10421 11086 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235019.1 protein_id gnl|my_center|LOCUS_07310 11083 11589 gene locus_tag LOCUS_07320 gene ispF 11083 11589 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425513.1 protein_id gnl|my_center|LOCUS_07320 11705 12061 gene locus_tag LOCUS_07330 11705 12061 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720130.1 protein_id gnl|my_center|LOCUS_07330 12141 13784 gene locus_tag LOCUS_07340 12141 13784 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440884.1 protein_id gnl|my_center|LOCUS_07340 13784 15799 gene locus_tag LOCUS_07350 gene recG 13784 15799 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_07350 15936 16109 gene locus_tag LOCUS_07360 15936 16109 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_07360 16251 16439 gene locus_tag LOCUS_07370 16251 16439 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_07370 16749 17399 gene locus_tag LOCUS_07380 16749 17399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 17427 18092 gene locus_tag LOCUS_07390 17427 18092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 18954 18139 gene locus_tag LOCUS_07400 18954 18139 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_07400 19745 18954 gene locus_tag LOCUS_07410 19745 18954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 20206 19874 gene locus_tag LOCUS_07420 gene darA 20206 19874 CDS product cyclic di-AMP receptor DarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242755.1 protein_id gnl|my_center|LOCUS_07420 21720 20335 gene locus_tag LOCUS_07430 21720 20335 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048125.1 protein_id gnl|my_center|LOCUS_07430 22273 21704 gene locus_tag LOCUS_07440 22273 21704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 22420 23463 gene locus_tag LOCUS_07450 22420 23463 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428483.1 protein_id gnl|my_center|LOCUS_07450 23545 24564 gene locus_tag LOCUS_07460 gene gapA 23545 24564 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097053.1 protein_id gnl|my_center|LOCUS_07460 25930 24815 gene locus_tag LOCUS_07470 25930 24815 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 protein_id gnl|my_center|LOCUS_07470 26867 25944 gene locus_tag LOCUS_07480 26867 25944 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_07480 27163 28098 gene locus_tag LOCUS_07490 gene fba 27163 28098 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939420.1 protein_id gnl|my_center|LOCUS_07490 28107 28376 gene locus_tag LOCUS_07500 28107 28376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 28505 29371 gene locus_tag LOCUS_07510 28505 29371 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394787.1 protein_id gnl|my_center|LOCUS_07510 29588 31477 gene locus_tag LOCUS_07520 29588 31477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 31511 32770 gene locus_tag LOCUS_07530 31511 32770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 <33595 33044 gene locus_tag LOCUS_07540 <33595 33044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679755.1:carboxypeptidase-like regulatory domain-containing protein >Feature sequence18 606 1496 gene locus_tag LOCUS_07550 606 1496 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048026.1 protein_id gnl|my_center|LOCUS_07550 1530 3365 gene locus_tag LOCUS_07560 1530 3365 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_07560 3376 4017 gene locus_tag LOCUS_07570 3376 4017 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392092.1 protein_id gnl|my_center|LOCUS_07570 4071 5330 gene locus_tag LOCUS_07580 gene nagZ 4071 5330 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813606.1 protein_id gnl|my_center|LOCUS_07580 5383 5880 gene locus_tag LOCUS_07590 gene ruvC 5383 5880 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256932.1 protein_id gnl|my_center|LOCUS_07590 5890 6492 gene locus_tag LOCUS_07600 gene ruvA 5890 6492 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460360.1 protein_id gnl|my_center|LOCUS_07600 6504 7508 gene locus_tag LOCUS_07610 gene ruvB 6504 7508 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229718.1 protein_id gnl|my_center|LOCUS_07610 7519 8373 gene locus_tag LOCUS_07620 7519 8373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 8556 9992 gene locus_tag LOCUS_07630 gene proS 8556 9992 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895182.1 protein_id gnl|my_center|LOCUS_07630 9931 10101 gene locus_tag LOCUS_07640 9931 10101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 10990 10088 gene locus_tag LOCUS_07650 10990 10088 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948783.1 protein_id gnl|my_center|LOCUS_07650 12107 11019 gene locus_tag LOCUS_07660 gene serC 12107 11019 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_07660 12305 13522 gene locus_tag LOCUS_07670 gene arcA 12305 13522 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385506.1 protein_id gnl|my_center|LOCUS_07670 13576 14304 gene locus_tag LOCUS_07680 13576 14304 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_07680 15796 14405 gene locus_tag LOCUS_07690 15796 14405 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_07690 16982 15849 gene locus_tag LOCUS_07700 16982 15849 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811557.1 protein_id gnl|my_center|LOCUS_07700 17463 17101 gene locus_tag LOCUS_07710 gene rnhA 17463 17101 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392156.1 protein_id gnl|my_center|LOCUS_07710 17793 17554 gene locus_tag LOCUS_07720 17793 17554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 17880 18494 gene locus_tag LOCUS_07730 gene lexA 17880 18494 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208755.1 protein_id gnl|my_center|LOCUS_07730 19740 18481 gene locus_tag LOCUS_07740 19740 18481 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986378.1 protein_id gnl|my_center|LOCUS_07740 19989 19753 gene locus_tag LOCUS_07750 gene hfq 19989 19753 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081393.1 protein_id gnl|my_center|LOCUS_07750 20951 19986 gene locus_tag LOCUS_07760 gene miaA 20951 19986 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861408.1 protein_id gnl|my_center|LOCUS_07760 22915 20951 gene locus_tag LOCUS_07770 gene mutL 22915 20951 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020571.1 protein_id gnl|my_center|LOCUS_07770 25520 22905 gene locus_tag LOCUS_07780 gene mutS 25520 22905 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047675.1 protein_id gnl|my_center|LOCUS_07780 26929 25520 gene locus_tag LOCUS_07790 gene miaB 26929 25520 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965143.1 protein_id gnl|my_center|LOCUS_07790 27577 27491 gene locus_tag LOCUS_t00100 27577 27491 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 29542 28172 gene locus_tag LOCUS_07800 29542 28172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 30226 30150 gene locus_tag LOCUS_t00110 30226 30150 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 30308 30233 gene locus_tag LOCUS_t00120 30308 30233 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 30509 31651 gene locus_tag LOCUS_07810 30509 31651 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391743.1 protein_id gnl|my_center|LOCUS_07810 >Feature sequence19 1278 514 gene locus_tag LOCUS_07820 1278 514 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_07820 1848 1393 gene locus_tag LOCUS_07830 1848 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 2533 2796 gene locus_tag LOCUS_07840 2533 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 3147 2905 gene locus_tag LOCUS_07850 3147 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 3421 4701 gene locus_tag LOCUS_07860 3421 4701 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968391.1 protein_id gnl|my_center|LOCUS_07860 4864 5439 gene locus_tag LOCUS_07870 4864 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 6344 5553 gene locus_tag LOCUS_07880 gene estA 6344 5553 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761976.1 protein_id gnl|my_center|LOCUS_07880 8213 7146 gene locus_tag LOCUS_07890 8213 7146 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941317.1 protein_id gnl|my_center|LOCUS_07890 8899 8261 gene locus_tag LOCUS_07900 8899 8261 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965593.1 protein_id gnl|my_center|LOCUS_07900 10134 8899 gene locus_tag LOCUS_07910 gene tyrS 10134 8899 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_07910 11331 10147 gene locus_tag LOCUS_07920 11331 10147 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867316.1 protein_id gnl|my_center|LOCUS_07920 11735 13021 gene locus_tag LOCUS_07930 11735 13021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 14100 13864 gene locus_tag LOCUS_07940 14100 13864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 14255 15055 gene locus_tag LOCUS_07950 gene spo0A 14255 15055 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358896.1 protein_id gnl|my_center|LOCUS_07950 17998 16499 gene locus_tag LOCUS_07960 gene ypwA 17998 16499 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398513.1 protein_id gnl|my_center|LOCUS_07960 18897 18223 gene locus_tag LOCUS_07970 18897 18223 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902564.1 protein_id gnl|my_center|LOCUS_07970 22023 19825 gene locus_tag LOCUS_07980 22023 19825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 23706 22348 gene locus_tag LOCUS_07990 23706 22348 CDS product Trk family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888508.1 protein_id gnl|my_center|LOCUS_07990 24559 24392 gene locus_tag LOCUS_08000 24559 24392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 25747 24665 gene locus_tag LOCUS_08010 gene tsaD 25747 24665 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860650.1 protein_id gnl|my_center|LOCUS_08010 26457 25747 gene locus_tag LOCUS_08020 26457 25747 CDS product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965992.1 protein_id gnl|my_center|LOCUS_08020 27326 26685 gene locus_tag LOCUS_08030 gene plsY 27326 26685 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_08030 28124 27657 gene locus_tag LOCUS_08040 28124 27657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08040 28921 28493 gene locus_tag LOCUS_08050 28921 28493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 29372 28935 gene locus_tag LOCUS_08060 29372 28935 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868208.1 protein_id gnl|my_center|LOCUS_08060 30688 29588 gene locus_tag LOCUS_08070 gene dnaN 30688 29588 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963331.1 protein_id gnl|my_center|LOCUS_08070 >Feature sequence20 <1 1041 gene locus_tag LOCUS_08080 <1 1041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009968147.1:iron ABC transporter permease 1035 1787 gene locus_tag LOCUS_08090 1035 1787 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680085.1 protein_id gnl|my_center|LOCUS_08090 1790 2851 gene locus_tag LOCUS_08100 gene cobT 1790 2851 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964681.1 protein_id gnl|my_center|LOCUS_08100 2851 3378 gene locus_tag LOCUS_08110 gene cobU 2851 3378 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680310.1 protein_id gnl|my_center|LOCUS_08110 3369 4145 gene locus_tag LOCUS_08120 3369 4145 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729695.1 protein_id gnl|my_center|LOCUS_08120 4136 4483 gene locus_tag LOCUS_08130 4136 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 4485 5447 gene locus_tag LOCUS_08140 4485 5447 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015945.1 protein_id gnl|my_center|LOCUS_08140 5783 5454 gene locus_tag LOCUS_08150 5783 5454 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870369.1 protein_id gnl|my_center|LOCUS_08150 5926 6576 gene locus_tag LOCUS_08160 5926 6576 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770252.1 protein_id gnl|my_center|LOCUS_08160 6586 7518 gene locus_tag LOCUS_08170 6586 7518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 7966 9183 gene locus_tag LOCUS_08180 7966 9183 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_08180 9405 10247 gene locus_tag LOCUS_08190 9405 10247 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868068.1 protein_id gnl|my_center|LOCUS_08190 10250 11650 gene locus_tag LOCUS_08200 gene gltA 10250 11650 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_08200 11875 12123 gene locus_tag LOCUS_08210 11875 12123 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986396.1 protein_id gnl|my_center|LOCUS_08210 12139 13809 gene locus_tag LOCUS_08220 12139 13809 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396717.1 protein_id gnl|my_center|LOCUS_08220 13799 14977 gene locus_tag LOCUS_08230 13799 14977 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_08230 15097 16020 gene locus_tag LOCUS_08240 15097 16020 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129881641.1 protein_id gnl|my_center|LOCUS_08240 16320 16565 gene locus_tag LOCUS_08250 16320 16565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 16778 17137 gene locus_tag LOCUS_08260 16778 17137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 18115 17249 gene locus_tag LOCUS_08270 18115 17249 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_08270 18445 18290 gene locus_tag LOCUS_08280 18445 18290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 18570 19160 gene locus_tag LOCUS_08290 18570 19160 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397458.1 protein_id gnl|my_center|LOCUS_08290 19529 19311 gene locus_tag LOCUS_08300 19529 19311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 19948 19532 gene locus_tag LOCUS_08310 19948 19532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 21468 19945 gene locus_tag LOCUS_08320 21468 19945 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_08320 22802 21828 gene locus_tag LOCUS_08330 22802 21828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942807.1 protein_id gnl|my_center|LOCUS_08330 23019 22792 gene locus_tag LOCUS_08340 23019 22792 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809987.1 protein_id gnl|my_center|LOCUS_08340 23973 23029 gene locus_tag LOCUS_08350 23973 23029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809989.1 protein_id gnl|my_center|LOCUS_08350 24726 24208 gene locus_tag LOCUS_08360 24726 24208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 25520 24951 gene locus_tag LOCUS_08370 25520 24951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08370 25828 25625 gene locus_tag LOCUS_08380 25828 25625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 26673 26227 gene locus_tag LOCUS_08390 26673 26227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893285.1 protein_id gnl|my_center|LOCUS_08390 27355 26822 gene locus_tag LOCUS_08400 27355 26822 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774219.1 protein_id gnl|my_center|LOCUS_08400 28400 29002 gene locus_tag LOCUS_08410 28400 29002 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027096094.1 protein_id gnl|my_center|LOCUS_08410 >Feature sequence21 2277 307 gene locus_tag LOCUS_08420 2277 307 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964880.1 protein_id gnl|my_center|LOCUS_08420 3246 2416 gene locus_tag LOCUS_08430 3246 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 5024 3336 gene locus_tag LOCUS_08440 5024 3336 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814523.1 protein_id gnl|my_center|LOCUS_08440 6577 5213 gene locus_tag LOCUS_08450 gene pepV 6577 5213 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966010.1 protein_id gnl|my_center|LOCUS_08450 7512 6607 gene locus_tag LOCUS_08460 7512 6607 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356230.1 protein_id gnl|my_center|LOCUS_08460 8391 7525 gene locus_tag LOCUS_08470 8391 7525 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104281.1 protein_id gnl|my_center|LOCUS_08470 8583 8750 gene locus_tag LOCUS_08480 8583 8750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 8918 9445 gene locus_tag LOCUS_08490 8918 9445 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965804.1 protein_id gnl|my_center|LOCUS_08490 10411 9917 gene locus_tag LOCUS_08500 gene xdhC 10411 9917 CDS product xanthine dehydrogenase iron sulfur-binding subunit XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706036.1 protein_id gnl|my_center|LOCUS_08500 11292 10411 gene locus_tag LOCUS_08510 gene xdhB 11292 10411 CDS product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393457.1 protein_id gnl|my_center|LOCUS_08510 13591 11303 gene locus_tag LOCUS_08520 gene xdhA 13591 11303 CDS product xanthine dehydrogenase molybdenum-binding subunit XdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393458.1 protein_id gnl|my_center|LOCUS_08520 15195 13606 gene locus_tag LOCUS_08530 gene ade 15195 13606 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439445.1 protein_id gnl|my_center|LOCUS_08530 15903 16562 gene locus_tag LOCUS_08540 15903 16562 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983642.1 protein_id gnl|my_center|LOCUS_08540 16565 17221 gene locus_tag LOCUS_08550 16565 17221 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191181.1 protein_id gnl|my_center|LOCUS_08550 17268 18452 gene locus_tag LOCUS_08560 17268 18452 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_08560 18582 18657 gene locus_tag LOCUS_t00130 18582 18657 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 18834 19490 gene locus_tag LOCUS_08570 18834 19490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 19662 20393 gene locus_tag LOCUS_08580 gene sigI 19662 20393 CDS product RNA polymerase sigma factor SigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965076.1 protein_id gnl|my_center|LOCUS_08580 20390 21352 gene locus_tag LOCUS_08590 20390 21352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 21621 23018 gene locus_tag LOCUS_08600 21621 23018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 23275 24903 gene locus_tag LOCUS_08610 gene pruA 23275 24903 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404266.1 protein_id gnl|my_center|LOCUS_08610 25848 25159 gene locus_tag LOCUS_08620 25848 25159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 26022 27455 gene locus_tag LOCUS_08630 26022 27455 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682416.1 protein_id gnl|my_center|LOCUS_08630 27663 >28360 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaatccacgctcccgcgtggggagcgac >Feature sequence22 1065 226 gene locus_tag LOCUS_08640 1065 226 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964020.1 protein_id gnl|my_center|LOCUS_08640 1825 1184 gene locus_tag LOCUS_08650 1825 1184 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583839.1 protein_id gnl|my_center|LOCUS_08650 2389 1853 gene locus_tag LOCUS_08660 2389 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 2884 2528 gene locus_tag LOCUS_08670 2884 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 3225 3067 gene locus_tag LOCUS_08680 3225 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 4380 3286 gene locus_tag LOCUS_08690 4380 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 4712 5248 gene locus_tag LOCUS_08700 gene rplJ 4712 5248 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360185.1 protein_id gnl|my_center|LOCUS_08700 5292 5663 gene locus_tag LOCUS_08710 gene rplL 5292 5663 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931848.1 protein_id gnl|my_center|LOCUS_08710 5781 6533 gene locus_tag LOCUS_08720 5781 6533 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963522.1 protein_id gnl|my_center|LOCUS_08720 6533 6949 gene locus_tag LOCUS_08730 6533 6949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 7651 6980 gene locus_tag LOCUS_08740 7651 6980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 9606 7780 gene locus_tag LOCUS_08750 gene typA 9606 7780 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 protein_id gnl|my_center|LOCUS_08750 11895 10069 gene locus_tag LOCUS_08760 gene glmS 11895 10069 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_08760 13290 11908 gene locus_tag LOCUS_08770 gene murC 13290 11908 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966501.1 protein_id gnl|my_center|LOCUS_08770 15077 13488 gene locus_tag LOCUS_08780 15077 13488 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861453.1 protein_id gnl|my_center|LOCUS_08780 15781 15074 gene locus_tag LOCUS_08790 15781 15074 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889773.1 protein_id gnl|my_center|LOCUS_08790 17536 15902 gene locus_tag LOCUS_08800 17536 15902 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454209.1 protein_id gnl|my_center|LOCUS_08800 18131 17517 gene locus_tag LOCUS_08810 gene coaE 18131 17517 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495251.1 protein_id gnl|my_center|LOCUS_08810 20722 18140 gene locus_tag LOCUS_08820 gene polA 20722 18140 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896068.1 protein_id gnl|my_center|LOCUS_08820 22045 20732 gene locus_tag LOCUS_08830 22045 20732 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289207.1 protein_id gnl|my_center|LOCUS_08830 23382 22060 gene locus_tag LOCUS_08840 23382 22060 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_08840 >Feature sequence23 338 982 gene locus_tag LOCUS_08850 338 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 1097 2020 gene locus_tag LOCUS_08860 gene gpr 1097 2020 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964587.1 protein_id gnl|my_center|LOCUS_08860 2842 2021 gene locus_tag LOCUS_08870 2842 2021 CDS product DUF4846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765761.1 protein_id gnl|my_center|LOCUS_08870 2947 6078 gene locus_tag LOCUS_08880 2947 6078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 6171 7208 gene locus_tag LOCUS_08890 gene prfB 6171 7208 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010959142.1 protein_id gnl|my_center|LOCUS_08890 7208 8098 gene locus_tag LOCUS_08900 7208 8098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 8103 9359 gene locus_tag LOCUS_08910 8103 9359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068300.1 protein_id gnl|my_center|LOCUS_08910 9371 10078 gene locus_tag LOCUS_08920 9371 10078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 10098 10355 gene locus_tag LOCUS_08930 10098 10355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948527.1 protein_id gnl|my_center|LOCUS_08930 10406 11287 gene locus_tag LOCUS_08940 10406 11287 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674286.1 protein_id gnl|my_center|LOCUS_08940 12305 11298 gene locus_tag LOCUS_08950 12305 11298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 12390 12638 gene locus_tag LOCUS_08960 12390 12638 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232153.1 protein_id gnl|my_center|LOCUS_08960 13024 12635 gene locus_tag LOCUS_08970 13024 12635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 13493 13125 gene locus_tag LOCUS_08980 gene yajC 13493 13125 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080747.1 protein_id gnl|my_center|LOCUS_08980 14492 13614 gene locus_tag LOCUS_08990 14492 13614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 15385 14489 gene locus_tag LOCUS_09000 15385 14489 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461887.1 protein_id gnl|my_center|LOCUS_09000 16150 15443 gene locus_tag LOCUS_09010 gene sigE 16150 15443 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811355.1 protein_id gnl|my_center|LOCUS_09010 16929 16144 gene locus_tag LOCUS_09020 16929 16144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 17068 18213 gene locus_tag LOCUS_09030 17068 18213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 18254 19144 gene locus_tag LOCUS_09040 gene murB 18254 19144 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048307.1 protein_id gnl|my_center|LOCUS_09040 19146 20027 gene locus_tag LOCUS_09050 gene rapZ 19146 20027 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963833.1 protein_id gnl|my_center|LOCUS_09050 20027 20962 gene locus_tag LOCUS_09060 gene whiA 20027 20962 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963835.1 protein_id gnl|my_center|LOCUS_09060 20962 24408 gene locus_tag LOCUS_09070 20962 24408 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963838.1 protein_id gnl|my_center|LOCUS_09070 24473 25438 gene locus_tag LOCUS_09080 gene pfkA 24473 25438 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_09080 25438 26817 gene locus_tag LOCUS_09090 gene rlmD 25438 26817 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963844.1 protein_id gnl|my_center|LOCUS_09090 >Feature sequence24 <1 1052 gene locus_tag LOCUS_09100 <1 1052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861166.1:cysteine desulfurase NifS 1082 1528 gene locus_tag LOCUS_09110 gene nifU 1082 1528 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391905.1 protein_id gnl|my_center|LOCUS_09110 1648 1806 gene locus_tag LOCUS_09120 1648 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 2778 1882 gene locus_tag LOCUS_09130 2778 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 3930 2854 gene locus_tag LOCUS_09140 gene buk 3930 2854 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420702.1 protein_id gnl|my_center|LOCUS_09140 4093 5733 gene locus_tag LOCUS_09150 4093 5733 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428989.1 protein_id gnl|my_center|LOCUS_09150 5753 7198 gene locus_tag LOCUS_09160 gene gltX 5753 7198 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_09160 7584 7273 gene locus_tag LOCUS_09170 7584 7273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 8080 7691 gene locus_tag LOCUS_09180 8080 7691 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437529.1 protein_id gnl|my_center|LOCUS_09180 8448 8077 gene locus_tag LOCUS_09190 8448 8077 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437532.1 protein_id gnl|my_center|LOCUS_09190 8528 9232 gene locus_tag LOCUS_09200 8528 9232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 9328 10701 gene locus_tag LOCUS_09210 gene tilS 9328 10701 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243704.1 protein_id gnl|my_center|LOCUS_09210 10740 11297 gene locus_tag LOCUS_09220 gene hpt 10740 11297 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817255.1 protein_id gnl|my_center|LOCUS_09220 11453 12166 gene locus_tag LOCUS_09230 11453 12166 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773678.1 protein_id gnl|my_center|LOCUS_09230 12793 12236 gene locus_tag LOCUS_09240 12793 12236 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814293.1 protein_id gnl|my_center|LOCUS_09240 13370 12873 gene locus_tag LOCUS_09250 13370 12873 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966038.1 protein_id gnl|my_center|LOCUS_09250 14878 13379 gene locus_tag LOCUS_09260 14878 13379 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454621.1 protein_id gnl|my_center|LOCUS_09260 16386 14956 gene locus_tag LOCUS_09270 16386 14956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 17906 16464 gene locus_tag LOCUS_09280 17906 16464 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966495.1 protein_id gnl|my_center|LOCUS_09280 18691 17993 gene locus_tag LOCUS_09290 18691 17993 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_09290 19361 20449 gene locus_tag LOCUS_09300 gene ychF 19361 20449 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949032.1 protein_id gnl|my_center|LOCUS_09300 20471 20725 gene locus_tag LOCUS_09310 20471 20725 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939908.1 protein_id gnl|my_center|LOCUS_09310 20729 21712 gene locus_tag LOCUS_09320 20729 21712 CDS product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965559.1 protein_id gnl|my_center|LOCUS_09320 21838 23661 gene locus_tag LOCUS_09330 gene glgB 21838 23661 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939518.1 protein_id gnl|my_center|LOCUS_09330 23679 24929 gene locus_tag LOCUS_09340 23679 24929 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965535.1 protein_id gnl|my_center|LOCUS_09340 24926 26050 gene locus_tag LOCUS_09350 gene glgD 24926 26050 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082940.1 protein_id gnl|my_center|LOCUS_09350 >Feature sequence25 5135 4041 gene locus_tag LOCUS_09360 5135 4041 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860623.1 protein_id gnl|my_center|LOCUS_09360 5642 5163 gene locus_tag LOCUS_09370 5642 5163 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810219.1 protein_id gnl|my_center|LOCUS_09370 7229 5898 gene locus_tag LOCUS_09380 7229 5898 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898040.1 protein_id gnl|my_center|LOCUS_09380 8614 7229 gene locus_tag LOCUS_09390 8614 7229 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891177.1 protein_id gnl|my_center|LOCUS_09390 10926 8857 gene locus_tag LOCUS_09400 gene fusA 10926 8857 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_09400 12361 11069 gene locus_tag LOCUS_09410 12361 11069 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272434.1 protein_id gnl|my_center|LOCUS_09410 12606 14093 gene locus_tag LOCUS_09420 12606 14093 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202731.1 protein_id gnl|my_center|LOCUS_09420 14090 14638 gene locus_tag LOCUS_09430 14090 14638 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765867.1 protein_id gnl|my_center|LOCUS_09430 15739 14690 gene locus_tag LOCUS_09440 15739 14690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 16597 15743 gene locus_tag LOCUS_09450 16597 15743 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459951.1 protein_id gnl|my_center|LOCUS_09450 18806 16656 gene locus_tag LOCUS_09460 gene ftsH 18806 16656 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_09460 19838 18930 gene locus_tag LOCUS_09470 19838 18930 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948816.1 protein_id gnl|my_center|LOCUS_09470 21264 19816 gene locus_tag LOCUS_09480 21264 19816 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681807.1 protein_id gnl|my_center|LOCUS_09480 21413 22420 gene locus_tag LOCUS_09490 21413 22420 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966497.1 protein_id gnl|my_center|LOCUS_09490 23362 22541 gene locus_tag LOCUS_09500 23362 22541 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680483.1 protein_id gnl|my_center|LOCUS_09500 23966 23388 gene locus_tag LOCUS_09510 gene cobC 23966 23388 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_09510 24186 25169 gene locus_tag LOCUS_09520 gene hflK 24186 25169 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409358.1 protein_id gnl|my_center|LOCUS_09520 >Feature sequence26 1861 263 gene locus_tag LOCUS_09530 1861 263 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015673.1 protein_id gnl|my_center|LOCUS_09530 2281 3624 gene locus_tag LOCUS_09540 2281 3624 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809868.1 protein_id gnl|my_center|LOCUS_09540 4149 3679 gene locus_tag LOCUS_09550 4149 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 5049 4219 gene locus_tag LOCUS_09560 5049 4219 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966060.1 protein_id gnl|my_center|LOCUS_09560 5552 6487 gene locus_tag LOCUS_09570 5552 6487 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811999.1 protein_id gnl|my_center|LOCUS_09570 6488 7597 gene locus_tag LOCUS_09580 6488 7597 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812002.1 protein_id gnl|my_center|LOCUS_09580 7610 8623 gene locus_tag LOCUS_09590 7610 8623 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812003.1 protein_id gnl|my_center|LOCUS_09590 8616 9644 gene locus_tag LOCUS_09600 8616 9644 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812005.1 protein_id gnl|my_center|LOCUS_09600 9719 11350 gene locus_tag LOCUS_09610 9719 11350 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913630.1 protein_id gnl|my_center|LOCUS_09610 11528 12220 gene locus_tag LOCUS_09620 11528 12220 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127552.1 protein_id gnl|my_center|LOCUS_09620 12836 12760 gene locus_tag LOCUS_t00140 12836 12760 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 13844 12996 gene locus_tag LOCUS_09630 13844 12996 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 protein_id gnl|my_center|LOCUS_09630 14038 13965 gene locus_tag LOCUS_t00150 14038 13965 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 14318 14242 gene locus_tag LOCUS_t00160 14318 14242 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 14544 15098 gene locus_tag LOCUS_09640 gene pgsA 14544 15098 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966859.1 protein_id gnl|my_center|LOCUS_09640 15224 15910 gene locus_tag LOCUS_09650 gene sigK 15224 15910 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047887.1 protein_id gnl|my_center|LOCUS_09650 16011 17081 gene locus_tag LOCUS_09660 gene pepQ 16011 17081 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411056.1 protein_id gnl|my_center|LOCUS_09660 17113 17670 gene locus_tag LOCUS_09670 gene efp 17113 17670 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_09670 17702 18283 gene locus_tag LOCUS_09680 17702 18283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 18380 19687 gene locus_tag LOCUS_09690 18380 19687 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903281.1 protein_id gnl|my_center|LOCUS_09690 19703 21070 gene locus_tag LOCUS_09700 gene der 19703 21070 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965018.1 protein_id gnl|my_center|LOCUS_09700 21063 21737 gene locus_tag LOCUS_09710 gene plsY 21063 21737 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_09710 21867 23345 gene locus_tag LOCUS_09720 gene spoIVA 21867 23345 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986845.1 protein_id gnl|my_center|LOCUS_09720 24017 23388 gene locus_tag LOCUS_09730 24017 23388 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420189.1 protein_id gnl|my_center|LOCUS_09730 >Feature sequence27 2085 301 gene locus_tag LOCUS_09740 gene dnaG 2085 301 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_09740 3443 2391 gene locus_tag LOCUS_09750 3443 2391 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930756.1 protein_id gnl|my_center|LOCUS_09750 4774 3458 gene locus_tag LOCUS_09760 gene kbaZ 4774 3458 CDS product tagatose-bisphosphate aldolase subunit KbaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024130977.1 protein_id gnl|my_center|LOCUS_09760 5559 4858 gene locus_tag LOCUS_09770 5559 4858 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981011.1 protein_id gnl|my_center|LOCUS_09770 7334 5574 gene locus_tag LOCUS_09780 7334 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 8227 7352 gene locus_tag LOCUS_09790 8227 7352 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061983.1 protein_id gnl|my_center|LOCUS_09790 9350 8214 gene locus_tag LOCUS_09800 9350 8214 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905635.1 protein_id gnl|my_center|LOCUS_09800 11110 9782 gene locus_tag LOCUS_09810 11110 9782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 14442 11818 gene locus_tag LOCUS_09820 gene ppdK 14442 11818 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_09820 15290 14550 gene locus_tag LOCUS_09830 gene recO 15290 14550 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460852.1 protein_id gnl|my_center|LOCUS_09830 15366 15491 gene locus_tag LOCUS_09840 15366 15491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 16369 15482 gene locus_tag LOCUS_09850 gene era 16369 15482 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134765.1 protein_id gnl|my_center|LOCUS_09850 16788 16366 gene locus_tag LOCUS_09860 16788 16366 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721969.1 protein_id gnl|my_center|LOCUS_09860 17225 16785 gene locus_tag LOCUS_09870 gene ybeY 17225 16785 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054684.1 protein_id gnl|my_center|LOCUS_09870 19386 17218 gene locus_tag LOCUS_09880 19386 17218 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964604.1 protein_id gnl|my_center|LOCUS_09880 20405 19395 gene locus_tag LOCUS_09890 20405 19395 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_09890 21599 20406 gene locus_tag LOCUS_09900 gene yqfD 21599 20406 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964603.1 protein_id gnl|my_center|LOCUS_09900 21892 21605 gene locus_tag LOCUS_09910 21892 21605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 23305 22091 gene locus_tag LOCUS_09920 23305 22091 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_09920 <24203 23540 gene locus_tag LOCUS_09930 <24203 23540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048387.1:bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU >Feature sequence28 1819 575 gene locus_tag LOCUS_09940 1819 575 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814424.1 protein_id gnl|my_center|LOCUS_09940 3363 1816 gene locus_tag LOCUS_09950 3363 1816 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459549.1 protein_id gnl|my_center|LOCUS_09950 4730 3495 gene locus_tag LOCUS_09960 4730 3495 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966257.1 protein_id gnl|my_center|LOCUS_09960 5864 4737 gene locus_tag LOCUS_09970 gene mltG 5864 4737 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230083.1 protein_id gnl|my_center|LOCUS_09970 6218 5868 gene locus_tag LOCUS_09980 6218 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 7888 6233 gene locus_tag LOCUS_09990 7888 6233 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_09990 9051 7936 gene locus_tag LOCUS_10000 9051 7936 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963546.1 protein_id gnl|my_center|LOCUS_10000 10937 9048 gene locus_tag LOCUS_10010 10937 9048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 11841 10921 gene locus_tag LOCUS_10020 gene hslO 11841 10921 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_10020 12573 11842 gene locus_tag LOCUS_10030 12573 11842 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229973.1 protein_id gnl|my_center|LOCUS_10030 12798 13994 gene locus_tag LOCUS_10040 12798 13994 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438357.1 protein_id gnl|my_center|LOCUS_10040 15078 14194 gene locus_tag LOCUS_10050 15078 14194 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993515.1 protein_id gnl|my_center|LOCUS_10050 16084 15158 gene locus_tag LOCUS_10060 gene cysK 16084 15158 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356610.1 protein_id gnl|my_center|LOCUS_10060 16339 17229 gene locus_tag LOCUS_10070 16339 17229 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459574.1 protein_id gnl|my_center|LOCUS_10070 17908 17249 gene locus_tag LOCUS_10080 17908 17249 CDS product CatA-like O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963558.1 protein_id gnl|my_center|LOCUS_10080 18212 19942 gene locus_tag LOCUS_10090 18212 19942 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294013.1 protein_id gnl|my_center|LOCUS_10090 19939 21720 gene locus_tag LOCUS_10100 19939 21720 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_10100 22384 22175 gene locus_tag LOCUS_10110 22384 22175 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860795.1 protein_id gnl|my_center|LOCUS_10110 22717 22388 gene locus_tag LOCUS_10120 22717 22388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 >Feature sequence29 <1 806 gene locus_tag LOCUS_10130 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461677.1:hydratase 910 1818 gene locus_tag LOCUS_10140 910 1818 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_10140 2699 1974 gene locus_tag LOCUS_10150 2699 1974 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870390.1 protein_id gnl|my_center|LOCUS_10150 2860 5784 gene locus_tag LOCUS_10160 2860 5784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 5795 6481 gene locus_tag LOCUS_10170 5795 6481 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861069.1 protein_id gnl|my_center|LOCUS_10170 6513 7199 gene locus_tag LOCUS_10180 6513 7199 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861070.1 protein_id gnl|my_center|LOCUS_10180 8533 7337 gene locus_tag LOCUS_10190 gene ygeW 8533 7337 CDS product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379712.1 protein_id gnl|my_center|LOCUS_10190 9741 8530 gene locus_tag LOCUS_10200 9741 8530 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107117.1 protein_id gnl|my_center|LOCUS_10200 10383 9763 gene locus_tag LOCUS_10210 10383 9763 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381503.1 protein_id gnl|my_center|LOCUS_10210 10563 11891 gene locus_tag LOCUS_10220 gene ssnA 10563 11891 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861868.1 protein_id gnl|my_center|LOCUS_10220 11902 14838 gene locus_tag LOCUS_10230 gene ygfK 11902 14838 CDS product putative selenate reductase subunit YgfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387142.1 protein_id gnl|my_center|LOCUS_10230 14849 17395 gene locus_tag LOCUS_10240 gene xdh 14849 17395 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891588.1 protein_id gnl|my_center|LOCUS_10240 17540 17839 gene locus_tag LOCUS_10250 gene citD 17540 17839 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691461.1 protein_id gnl|my_center|LOCUS_10250 17839 18729 gene locus_tag LOCUS_10260 gene citE 17839 18729 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355998.1 protein_id gnl|my_center|LOCUS_10260 18731 20278 gene locus_tag LOCUS_10270 gene citF 18731 20278 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192238.1 protein_id gnl|my_center|LOCUS_10270 20278 21249 gene locus_tag LOCUS_10280 gene citC 20278 21249 CDS product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016310.1 protein_id gnl|my_center|LOCUS_10280 21251 22561 gene locus_tag LOCUS_10290 gene citG 21251 22561 CDS product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668027.1 protein_id gnl|my_center|LOCUS_10290 >Feature sequence30 74 1 gene locus_tag LOCUS_t00170 74 1 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 158 82 gene locus_tag LOCUS_t00180 158 82 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 551 626 gene locus_tag LOCUS_t00190 551 626 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 995 1324 gene locus_tag LOCUS_10300 995 1324 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972493.1 protein_id gnl|my_center|LOCUS_10300 1898 2431 gene locus_tag LOCUS_10310 1898 2431 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233562.1 protein_id gnl|my_center|LOCUS_10310 2462 2887 gene locus_tag LOCUS_10320 2462 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 4285 3038 gene locus_tag LOCUS_10330 4285 3038 CDS product methylaspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680089.1 protein_id gnl|my_center|LOCUS_10330 5755 4298 gene locus_tag LOCUS_10340 5755 4298 CDS product methylaspartate mutase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460941.1 protein_id gnl|my_center|LOCUS_10340 7127 5739 gene locus_tag LOCUS_10350 gene glmL 7127 5739 CDS product methylaspartate mutase accessory protein GlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945203.1 protein_id gnl|my_center|LOCUS_10350 7554 7138 gene locus_tag LOCUS_10360 gene glmS 7554 7138 CDS product methylaspartate mutase subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816944.1 protein_id gnl|my_center|LOCUS_10360 8698 7715 gene locus_tag LOCUS_10370 8698 7715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 9273 8698 gene locus_tag LOCUS_10380 9273 8698 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099538.1 protein_id gnl|my_center|LOCUS_10380 10134 9289 gene locus_tag LOCUS_10390 10134 9289 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519031.1 protein_id gnl|my_center|LOCUS_10390 11551 10151 gene locus_tag LOCUS_10400 gene citF 11551 10151 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870113.1 protein_id gnl|my_center|LOCUS_10400 12428 11544 gene locus_tag LOCUS_10410 12428 11544 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870112.1 protein_id gnl|my_center|LOCUS_10410 12610 13548 gene locus_tag LOCUS_10420 12610 13548 CDS product alanine-tRNA synthetase second additional domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816923.1 protein_id gnl|my_center|LOCUS_10420 14403 13618 gene locus_tag LOCUS_10430 14403 13618 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947991.1 protein_id gnl|my_center|LOCUS_10430 15204 14662 gene locus_tag LOCUS_10440 15204 14662 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356034.1 protein_id gnl|my_center|LOCUS_10440 17021 15201 gene locus_tag LOCUS_10450 gene ftsH 17021 15201 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272679.1 protein_id gnl|my_center|LOCUS_10450 19006 17483 gene locus_tag LOCUS_10460 19006 17483 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948022.1 protein_id gnl|my_center|LOCUS_10460 19942 19073 gene locus_tag LOCUS_10470 gene pgeF 19942 19073 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_10470 20399 19932 gene locus_tag LOCUS_10480 gene nrdR 20399 19932 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_10480 20876 20562 gene locus_tag LOCUS_10490 20876 20562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 20772 22106 gene locus_tag LOCUS_10500 gene scfB 20772 22106 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence31 2355 724 gene locus_tag LOCUS_10510 2355 724 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_10510 2501 3283 gene locus_tag LOCUS_10520 gene truA 2501 3283 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435654.1 protein_id gnl|my_center|LOCUS_10520 3274 4452 gene locus_tag LOCUS_10530 3274 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 5554 4667 gene locus_tag LOCUS_10540 gene sdaAA 5554 4667 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393444.1 protein_id gnl|my_center|LOCUS_10540 6213 5551 gene locus_tag LOCUS_10550 gene sdaAB 6213 5551 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460514.1 protein_id gnl|my_center|LOCUS_10550 6855 6355 gene locus_tag LOCUS_10560 6855 6355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 7813 6845 gene locus_tag LOCUS_10570 7813 6845 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906252.1 protein_id gnl|my_center|LOCUS_10570 7957 8526 gene locus_tag LOCUS_10580 7957 8526 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462242.1 protein_id gnl|my_center|LOCUS_10580 8843 8601 gene locus_tag LOCUS_10590 gene rpsR 8843 8601 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_10590 9309 8878 gene locus_tag LOCUS_10600 gene ssb 9309 8878 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934760.1 protein_id gnl|my_center|LOCUS_10600 9630 9343 gene locus_tag LOCUS_10610 gene rpsF 9630 9343 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966984.1 protein_id gnl|my_center|LOCUS_10610 11095 9968 gene locus_tag LOCUS_10620 11095 9968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 12279 11263 gene locus_tag LOCUS_10630 12279 11263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 13822 12533 gene locus_tag LOCUS_10640 13822 12533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 14673 13819 gene locus_tag LOCUS_10650 14673 13819 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_10650 15387 14683 gene locus_tag LOCUS_10660 15387 14683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 16528 15398 gene locus_tag LOCUS_10670 16528 15398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 17447 16551 gene locus_tag LOCUS_10680 17447 16551 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583958.1 protein_id gnl|my_center|LOCUS_10680 17541 18413 gene locus_tag LOCUS_10690 gene dapF 17541 18413 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768322.1 protein_id gnl|my_center|LOCUS_10690 19920 18499 gene locus_tag LOCUS_10700 gene glnA 19920 18499 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_10700 19822 20031 gene locus_tag LOCUS_10710 19822 20031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 21334 20045 gene locus_tag LOCUS_10720 21334 20045 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081535.1 protein_id gnl|my_center|LOCUS_10720 21782 21453 gene locus_tag LOCUS_10730 21782 21453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 22534 21845 gene locus_tag LOCUS_10740 22534 21845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 >Feature sequence32 <1 537 gene locus_tag LOCUS_10750 <1 537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011987111.1:MATE family efflux transporter 866 1681 gene locus_tag LOCUS_10760 866 1681 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_10760 1741 2622 gene locus_tag LOCUS_10770 gene pstC 1741 2622 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454007.1 protein_id gnl|my_center|LOCUS_10770 2615 3460 gene locus_tag LOCUS_10780 gene pstA 2615 3460 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427927.1 protein_id gnl|my_center|LOCUS_10780 3457 4212 gene locus_tag LOCUS_10790 gene pstB 3457 4212 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_10790 4209 4847 gene locus_tag LOCUS_10800 gene phoU 4209 4847 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_10800 4852 5529 gene locus_tag LOCUS_10810 4852 5529 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_10810 5526 7181 gene locus_tag LOCUS_10820 5526 7181 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_10820 7352 11074 gene locus_tag LOCUS_10830 7352 11074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 13664 11142 gene locus_tag LOCUS_10840 13664 11142 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_10840 14056 13679 gene locus_tag LOCUS_10850 14056 13679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 15048 15596 gene locus_tag LOCUS_10860 15048 15596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 15681 17171 gene locus_tag LOCUS_10870 gene glpK 15681 17171 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015864.1 protein_id gnl|my_center|LOCUS_10870 17949 19751 gene locus_tag LOCUS_10880 gene pepF 17949 19751 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967010.1 protein_id gnl|my_center|LOCUS_10880 19958 21358 gene locus_tag LOCUS_10890 gene rmuC 19958 21358 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193862.1 protein_id gnl|my_center|LOCUS_10890 >Feature sequence33 1743 529 gene locus_tag LOCUS_10900 1743 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 2736 1939 gene locus_tag LOCUS_10910 2736 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 4412 2844 gene locus_tag LOCUS_10920 gene pckA 4412 2844 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392169.1 protein_id gnl|my_center|LOCUS_10920 5043 4513 gene locus_tag LOCUS_10930 5043 4513 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814019.1 protein_id gnl|my_center|LOCUS_10930 6426 5053 gene locus_tag LOCUS_10940 6426 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 7104 6490 gene locus_tag LOCUS_10950 7104 6490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 8157 7144 gene locus_tag LOCUS_10960 gene floA 8157 7144 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812222.1 protein_id gnl|my_center|LOCUS_10960 8383 8180 gene locus_tag LOCUS_10970 8383 8180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 8882 8373 gene locus_tag LOCUS_10980 8882 8373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 9525 8908 gene locus_tag LOCUS_10990 9525 8908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 9647 10630 gene locus_tag LOCUS_11000 gene spoIID 9647 10630 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393851.1 protein_id gnl|my_center|LOCUS_11000 10875 12293 gene locus_tag LOCUS_11010 10875 12293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 12293 13105 gene locus_tag LOCUS_11020 gene rsmA 12293 13105 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226751.1 protein_id gnl|my_center|LOCUS_11020 13124 13720 gene locus_tag LOCUS_11030 13124 13720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 13854 16148 gene locus_tag LOCUS_11040 gene pbpC 13854 16148 CDS product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227211.1 protein_id gnl|my_center|LOCUS_11040 17345 16332 gene locus_tag LOCUS_11050 17345 16332 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549977.1 protein_id gnl|my_center|LOCUS_11050 17480 18094 gene locus_tag LOCUS_11060 17480 18094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 18218 18688 gene locus_tag LOCUS_11070 18218 18688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 19997 18813 gene locus_tag LOCUS_11080 gene megL 19997 18813 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400106.1 protein_id gnl|my_center|LOCUS_11080 >Feature sequence34 1588 95 gene locus_tag LOCUS_11090 1588 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 2436 1630 gene locus_tag LOCUS_11100 2436 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 2988 2440 gene locus_tag LOCUS_11110 2988 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 3778 2978 gene locus_tag LOCUS_11120 3778 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 4441 5475 gene locus_tag LOCUS_11130 4441 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 5634 6080 gene locus_tag LOCUS_11140 5634 6080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 7252 6230 gene locus_tag LOCUS_11150 7252 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 8905 7376 gene locus_tag LOCUS_11160 8905 7376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 9073 9831 gene locus_tag LOCUS_11170 9073 9831 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674428.1 protein_id gnl|my_center|LOCUS_11170 9828 10724 gene locus_tag LOCUS_11180 9828 10724 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017180.1 protein_id gnl|my_center|LOCUS_11180 10727 12409 gene locus_tag LOCUS_11190 10727 12409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 12413 13888 gene locus_tag LOCUS_11200 12413 13888 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582721.1 protein_id gnl|my_center|LOCUS_11200 14050 14355 gene locus_tag LOCUS_11210 14050 14355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11210 14352 15455 gene locus_tag LOCUS_11220 14352 15455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11220 15448 15945 gene locus_tag LOCUS_11230 15448 15945 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064203.1 protein_id gnl|my_center|LOCUS_11230 15942 16217 gene locus_tag LOCUS_11240 15942 16217 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869716.1 protein_id gnl|my_center|LOCUS_11240 16214 17362 gene locus_tag LOCUS_11250 16214 17362 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925160.1 protein_id gnl|my_center|LOCUS_11250 18073 17525 gene locus_tag LOCUS_11260 18073 17525 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943659.1 protein_id gnl|my_center|LOCUS_11260 18680 18147 gene locus_tag LOCUS_11270 18680 18147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 19864 18986 gene locus_tag LOCUS_11280 19864 18986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 >Feature sequence35 1288 1632 gene locus_tag LOCUS_11290 1288 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1634 2836 gene locus_tag LOCUS_11300 1634 2836 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_11300 3404 4366 gene locus_tag LOCUS_11310 3404 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 4380 7184 gene locus_tag LOCUS_11320 4380 7184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 7196 7495 gene locus_tag LOCUS_11330 7196 7495 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871778.1 protein_id gnl|my_center|LOCUS_11330 7739 7912 gene locus_tag LOCUS_11340 7739 7912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 7974 9140 gene locus_tag LOCUS_11350 7974 9140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 9439 9364 gene locus_tag LOCUS_t00200 9439 9364 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10258 10623 gene locus_tag LOCUS_11360 10258 10623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 10763 11299 gene locus_tag LOCUS_11370 10763 11299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 12181 11432 gene locus_tag LOCUS_11380 12181 11432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 14008 12203 gene locus_tag LOCUS_11390 14008 12203 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_11390 14121 14951 gene locus_tag LOCUS_11400 14121 14951 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726170.1 protein_id gnl|my_center|LOCUS_11400 14935 17019 gene locus_tag LOCUS_11410 14935 17019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 17034 19397 gene locus_tag LOCUS_11420 17034 19397 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860930.1 protein_id gnl|my_center|LOCUS_11420 >Feature sequence36 1021 1839 gene locus_tag LOCUS_11430 1021 1839 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391588.1 protein_id gnl|my_center|LOCUS_11430 2833 1892 gene locus_tag LOCUS_11440 gene arcC 2833 1892 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869022.1 protein_id gnl|my_center|LOCUS_11440 3580 2849 gene locus_tag LOCUS_11450 3580 2849 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_11450 4496 3573 gene locus_tag LOCUS_11460 4496 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 4651 4741 gene locus_tag LOCUS_t00210 4651 4741 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5723 5349 gene locus_tag LOCUS_11470 5723 5349 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272757.1 protein_id gnl|my_center|LOCUS_11470 6740 5739 gene locus_tag LOCUS_11480 6740 5739 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462034.1 protein_id gnl|my_center|LOCUS_11480 7135 6848 gene locus_tag LOCUS_11490 7135 6848 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461958.1 protein_id gnl|my_center|LOCUS_11490 7364 7636 gene locus_tag LOCUS_11500 7364 7636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 7991 8239 gene locus_tag LOCUS_11510 7991 8239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11510 10444 8831 gene locus_tag LOCUS_11520 10444 8831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 11787 10459 gene locus_tag LOCUS_11530 11787 10459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 12184 12951 gene locus_tag LOCUS_11540 12184 12951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 13026 13550 gene locus_tag LOCUS_11550 13026 13550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 13696 14097 gene locus_tag LOCUS_11560 13696 14097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 14292 14858 gene locus_tag LOCUS_11570 14292 14858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 15426 14923 gene locus_tag LOCUS_11580 15426 14923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 16551 15778 gene locus_tag LOCUS_11590 16551 15778 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877555.1 protein_id gnl|my_center|LOCUS_11590 17349 16564 gene locus_tag LOCUS_11600 17349 16564 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473236.1 protein_id gnl|my_center|LOCUS_11600 18812 17805 gene locus_tag LOCUS_11610 18812 17805 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895580.1 protein_id gnl|my_center|LOCUS_11610 >Feature sequence37 1173 328 gene locus_tag LOCUS_11620 1173 328 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_11620 1999 1175 gene locus_tag LOCUS_11630 1999 1175 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435660.1 protein_id gnl|my_center|LOCUS_11630 2197 4110 gene locus_tag LOCUS_11640 2197 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 4179 4457 gene locus_tag LOCUS_11650 4179 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 4526 4723 gene locus_tag LOCUS_11660 4526 4723 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037754.1 protein_id gnl|my_center|LOCUS_11660 6541 4811 gene locus_tag LOCUS_11670 6541 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 6872 6588 gene locus_tag LOCUS_11680 6872 6588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 7417 6914 gene locus_tag LOCUS_11690 7417 6914 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_11690 7751 8245 gene locus_tag LOCUS_11700 gene infC 7751 8245 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048135.1 protein_id gnl|my_center|LOCUS_11700 8275 8472 gene locus_tag LOCUS_11710 gene rpmI 8275 8472 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429729.1 protein_id gnl|my_center|LOCUS_11710 8484 8840 gene locus_tag LOCUS_11720 gene rplT 8484 8840 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965656.1 protein_id gnl|my_center|LOCUS_11720 8900 9661 gene locus_tag LOCUS_11730 8900 9661 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003158483.1 protein_id gnl|my_center|LOCUS_11730 11529 9814 gene locus_tag LOCUS_11740 11529 9814 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679450.1 protein_id gnl|my_center|LOCUS_11740 12808 11519 gene locus_tag LOCUS_11750 12808 11519 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957028.1 protein_id gnl|my_center|LOCUS_11750 13031 14053 gene locus_tag LOCUS_11760 13031 14053 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450417.1 protein_id gnl|my_center|LOCUS_11760 14344 15363 gene locus_tag LOCUS_11770 14344 15363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 15450 16841 gene locus_tag LOCUS_11780 15450 16841 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_11780 16856 17983 gene locus_tag LOCUS_11790 16856 17983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 >Feature sequence38 <1 802 gene locus_tag LOCUS_11800 <1 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963351.1:aspartate-semialdehyde dehydrogenase 816 1715 gene locus_tag LOCUS_11810 gene dapA 816 1715 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_11810 2138 1920 gene locus_tag LOCUS_11820 2138 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11820 2303 2169 gene locus_tag LOCUS_11830 2303 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11830 3559 2537 gene locus_tag LOCUS_11840 3559 2537 CDS product PRK06851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048278.1 protein_id gnl|my_center|LOCUS_11840 3667 4443 gene locus_tag LOCUS_11850 3667 4443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 4436 5011 gene locus_tag LOCUS_11860 4436 5011 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392579.1 protein_id gnl|my_center|LOCUS_11860 5191 6393 gene locus_tag LOCUS_11870 5191 6393 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229564.1 protein_id gnl|my_center|LOCUS_11870 6932 7798 gene locus_tag LOCUS_11880 6932 7798 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926048.1 protein_id gnl|my_center|LOCUS_11880 7798 7929 gene locus_tag LOCUS_11890 7798 7929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 8189 8114 gene locus_tag LOCUS_t00220 8189 8114 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 8473 8946 gene locus_tag LOCUS_11900 8473 8946 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_11900 8951 10021 gene locus_tag LOCUS_11910 gene nusA 8951 10021 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_11910 10037 10306 gene locus_tag LOCUS_11920 10037 10306 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_11920 10296 10622 gene locus_tag LOCUS_11930 10296 10622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 10615 13200 gene locus_tag LOCUS_11940 10615 13200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 13211 13585 gene locus_tag LOCUS_11950 gene rbfA 13211 13585 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460392.1 protein_id gnl|my_center|LOCUS_11950 13582 14544 gene locus_tag LOCUS_11960 13582 14544 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_11960 14541 15434 gene locus_tag LOCUS_11970 gene truB 14541 15434 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944714.1 protein_id gnl|my_center|LOCUS_11970 15427 16305 gene locus_tag LOCUS_11980 15427 16305 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965112.1 protein_id gnl|my_center|LOCUS_11980 16448 16717 gene locus_tag LOCUS_11990 gene rpsO 16448 16717 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388351.1 protein_id gnl|my_center|LOCUS_11990 17127 16795 gene locus_tag LOCUS_12000 17127 16795 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428185.1 protein_id gnl|my_center|LOCUS_12000 >Feature sequence39 1339 170 gene locus_tag LOCUS_12010 1339 170 CDS product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835622.1 protein_id gnl|my_center|LOCUS_12010 3029 1884 gene locus_tag LOCUS_12020 3029 1884 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187945.1 protein_id gnl|my_center|LOCUS_12020 3423 4475 gene locus_tag LOCUS_12030 3423 4475 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052107.1 protein_id gnl|my_center|LOCUS_12030 4502 5125 gene locus_tag LOCUS_12040 4502 5125 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812798.1 protein_id gnl|my_center|LOCUS_12040 5318 5611 gene locus_tag LOCUS_12050 5318 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 6120 6503 gene locus_tag LOCUS_12060 6120 6503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 6683 6883 gene locus_tag LOCUS_12070 6683 6883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 7076 7000 gene locus_tag LOCUS_t00230 7076 7000 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7155 7080 gene locus_tag LOCUS_t00240 7155 7080 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8369 7227 gene locus_tag LOCUS_12080 8369 7227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_12080 9174 8476 gene locus_tag LOCUS_12090 gene deoD 9174 8476 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160304.1 protein_id gnl|my_center|LOCUS_12090 10391 9207 gene locus_tag LOCUS_12100 10391 9207 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582704.1 protein_id gnl|my_center|LOCUS_12100 10538 12364 gene locus_tag LOCUS_12110 gene uvrC 10538 12364 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_12110 12361 13173 gene locus_tag LOCUS_12120 gene yidA 12361 13173 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048269.1 protein_id gnl|my_center|LOCUS_12120 13170 14102 gene locus_tag LOCUS_12130 13170 14102 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416574.1 protein_id gnl|my_center|LOCUS_12130 14104 14775 gene locus_tag LOCUS_12140 14104 14775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 14974 16287 gene locus_tag LOCUS_12150 gene spoVB 14974 16287 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949021.1 protein_id gnl|my_center|LOCUS_12150 16368 16538 gene locus_tag LOCUS_12160 16368 16538 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963626.1 protein_id gnl|my_center|LOCUS_12160 16769 17305 gene locus_tag LOCUS_12170 16769 17305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 17317 17481 gene locus_tag LOCUS_12180 17317 17481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 17913 17566 gene locus_tag LOCUS_12190 17913 17566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 18065 17910 gene locus_tag LOCUS_12200 18065 17910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 >Feature sequence40 180 3929 gene locus_tag LOCUS_12210 gene rpoC 180 3929 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048356.1 protein_id gnl|my_center|LOCUS_12210 3980 4810 gene locus_tag LOCUS_12220 3980 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 5033 5407 gene locus_tag LOCUS_12230 gene rpsL 5033 5407 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393942.1 protein_id gnl|my_center|LOCUS_12230 5419 5889 gene locus_tag LOCUS_12240 gene rpsG 5419 5889 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393941.1 protein_id gnl|my_center|LOCUS_12240 5981 8050 gene locus_tag LOCUS_12250 gene fusA 5981 8050 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_12250 9225 8209 gene locus_tag LOCUS_12260 9225 8209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 9332 10321 gene locus_tag LOCUS_12270 9332 10321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367345.1 protein_id gnl|my_center|LOCUS_12270 10314 11774 gene locus_tag LOCUS_12280 10314 11774 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015882.1 protein_id gnl|my_center|LOCUS_12280 12082 12462 gene locus_tag LOCUS_12290 12082 12462 CDS product 3-aminobutyryl-CoA ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902967.1 protein_id gnl|my_center|LOCUS_12290 12468 13295 gene locus_tag LOCUS_12300 12468 13295 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_12300 13338 14378 gene locus_tag LOCUS_12310 gene kdd 13338 14378 CDS product L-erythro-3,5-diaminohexanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015884.1 protein_id gnl|my_center|LOCUS_12310 14453 15706 gene locus_tag LOCUS_12320 gene ablA 14453 15706 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_12320 15748 17307 gene locus_tag LOCUS_12330 15748 17307 CDS product D-lysine 5,6-aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015881.1 protein_id gnl|my_center|LOCUS_12330 >Feature sequence41 <1 1734 gene locus_tag LOCUS_12340 <1 1734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000941257.1:single-stranded-DNA-specific exonuclease RecJ 1724 2236 gene locus_tag LOCUS_12350 1724 2236 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_12350 2326 4488 gene locus_tag LOCUS_12360 2326 4488 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810772.1 protein_id gnl|my_center|LOCUS_12360 4501 4947 gene locus_tag LOCUS_12370 gene dtd 4501 4947 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289097.1 protein_id gnl|my_center|LOCUS_12370 4947 5582 gene locus_tag LOCUS_12380 4947 5582 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460349.1 protein_id gnl|my_center|LOCUS_12380 5575 7062 gene locus_tag LOCUS_12390 5575 7062 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_12390 7064 7795 gene locus_tag LOCUS_12400 7064 7795 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460415.1 protein_id gnl|my_center|LOCUS_12400 7805 8650 gene locus_tag LOCUS_12410 7805 8650 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384675.1 protein_id gnl|my_center|LOCUS_12410 8647 9828 gene locus_tag LOCUS_12420 8647 9828 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839296.1 protein_id gnl|my_center|LOCUS_12420 9831 10871 gene locus_tag LOCUS_12430 gene rseP 9831 10871 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392556.1 protein_id gnl|my_center|LOCUS_12430 10864 11916 gene locus_tag LOCUS_12440 gene ispG 10864 11916 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541503.1 protein_id gnl|my_center|LOCUS_12440 11934 16148 gene locus_tag LOCUS_12450 gene polC 11934 16148 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461752.1 protein_id gnl|my_center|LOCUS_12450 16364 17614 gene locus_tag LOCUS_12460 gene ugpC 16364 17614 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence42 364 2172 gene locus_tag LOCUS_12470 364 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 3257 4291 gene locus_tag LOCUS_12480 3257 4291 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562759.1 protein_id gnl|my_center|LOCUS_12480 4291 5655 gene locus_tag LOCUS_12490 4291 5655 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_12490 6227 7564 gene locus_tag LOCUS_12500 gene dnaA 6227 7564 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_12500 9726 8104 gene locus_tag LOCUS_12510 gene groL 9726 8104 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817317.1 protein_id gnl|my_center|LOCUS_12510 10023 9739 gene locus_tag LOCUS_12520 10023 9739 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420907.1 protein_id gnl|my_center|LOCUS_12520 10210 10659 gene locus_tag LOCUS_12530 10210 10659 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_12530 10652 11773 gene locus_tag LOCUS_12540 10652 11773 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986645.1 protein_id gnl|my_center|LOCUS_12540 13337 11937 gene locus_tag LOCUS_12550 13337 11937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 17561 13347 gene locus_tag LOCUS_12560 17561 13347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 >Feature sequence43 265 128 gene locus_tag LOCUS_12570 265 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 814 371 gene locus_tag LOCUS_12580 814 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 1080 1802 gene locus_tag LOCUS_12590 1080 1802 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966742.1 protein_id gnl|my_center|LOCUS_12590 2719 1895 gene locus_tag LOCUS_12600 2719 1895 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310510.1 protein_id gnl|my_center|LOCUS_12600 3823 2738 gene locus_tag LOCUS_12610 3823 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 3960 4619 gene locus_tag LOCUS_12620 3960 4619 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948893.1 protein_id gnl|my_center|LOCUS_12620 5355 4810 gene locus_tag LOCUS_12630 5355 4810 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948224.1 protein_id gnl|my_center|LOCUS_12630 5932 5501 gene locus_tag LOCUS_12640 5932 5501 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418377.1 protein_id gnl|my_center|LOCUS_12640 6172 7029 gene locus_tag LOCUS_12650 6172 7029 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219939.1 protein_id gnl|my_center|LOCUS_12650 8363 7797 gene locus_tag LOCUS_12660 8363 7797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 9708 8368 gene locus_tag LOCUS_12670 9708 8368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 10111 9722 gene locus_tag LOCUS_12680 10111 9722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 10410 11741 gene locus_tag LOCUS_12690 10410 11741 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618921.1 protein_id gnl|my_center|LOCUS_12690 12184 13116 gene locus_tag LOCUS_12700 12184 13116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 13505 13308 gene locus_tag LOCUS_12710 13505 13308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 13479 13649 gene locus_tag LOCUS_12720 13479 13649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 13829 14569 gene locus_tag LOCUS_12730 13829 14569 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891631.1 protein_id gnl|my_center|LOCUS_12730 14637 15362 gene locus_tag LOCUS_12740 14637 15362 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948430.1 protein_id gnl|my_center|LOCUS_12740 15359 16102 gene locus_tag LOCUS_12750 15359 16102 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061295975.1 protein_id gnl|my_center|LOCUS_12750 16598 16955 gene locus_tag LOCUS_tm00010 16598 16955 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 17143 17316 gene locus_tag LOCUS_12760 17143 17316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 17295 17519 gene locus_tag LOCUS_12770 17295 17519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12770 >Feature sequence44 <1 947 gene locus_tag LOCUS_12780 <1 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005902660.1:sodium ion-translocating decarboxylase subunit beta 949 2367 gene locus_tag LOCUS_12790 949 2367 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017109.1 protein_id gnl|my_center|LOCUS_12790 2463 3233 gene locus_tag LOCUS_12800 gene surE 2463 3233 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812070.1 protein_id gnl|my_center|LOCUS_12800 3230 4456 gene locus_tag LOCUS_12810 3230 4456 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986386.1 protein_id gnl|my_center|LOCUS_12810 4446 5129 gene locus_tag LOCUS_12820 gene cmk 4446 5129 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460204.1 protein_id gnl|my_center|LOCUS_12820 5134 5748 gene locus_tag LOCUS_12830 5134 5748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 5726 8065 gene locus_tag LOCUS_12840 5726 8065 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392842.1 protein_id gnl|my_center|LOCUS_12840 11285 8166 gene locus_tag LOCUS_12850 gene ileS 11285 8166 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966319.1 protein_id gnl|my_center|LOCUS_12850 11702 12367 gene locus_tag LOCUS_12860 11702 12367 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206385.1 protein_id gnl|my_center|LOCUS_12860 12548 13546 gene locus_tag LOCUS_12870 12548 13546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 13606 15150 gene locus_tag LOCUS_12880 13606 15150 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865052.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence45 2791 488 gene locus_tag LOCUS_12890 gene pcrA 2791 488 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163769.1 protein_id gnl|my_center|LOCUS_12890 3662 2793 gene locus_tag LOCUS_12900 3662 2793 CDS product DUF4438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080391.1 protein_id gnl|my_center|LOCUS_12900 4928 3759 gene locus_tag LOCUS_12910 4928 3759 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966253.1 protein_id gnl|my_center|LOCUS_12910 5562 4993 gene locus_tag LOCUS_12920 5562 4993 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965300.1 protein_id gnl|my_center|LOCUS_12920 7297 5567 gene locus_tag LOCUS_12930 gene iorA 7297 5567 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_12930 7489 8925 gene locus_tag LOCUS_12940 7489 8925 CDS product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053727.1 protein_id gnl|my_center|LOCUS_12940 9726 9418 gene locus_tag LOCUS_12950 9726 9418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 10847 9849 gene locus_tag LOCUS_12960 10847 9849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 11788 11339 gene locus_tag LOCUS_12970 11788 11339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 12150 11785 gene locus_tag LOCUS_12980 12150 11785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 12630 12548 gene locus_tag LOCUS_t00250 12630 12548 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13947 12838 gene locus_tag LOCUS_12990 gene mnmA 13947 12838 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723698.1 protein_id gnl|my_center|LOCUS_12990 14269 14955 gene locus_tag LOCUS_13000 14269 14955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 >Feature sequence46 7480 6647 gene locus_tag LOCUS_13010 7480 6647 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901831.1 protein_id gnl|my_center|LOCUS_13010 8262 7489 gene locus_tag LOCUS_13020 8262 7489 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901833.1 protein_id gnl|my_center|LOCUS_13020 9441 8287 gene locus_tag LOCUS_13030 gene metK 9441 8287 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392413.1 protein_id gnl|my_center|LOCUS_13030 9646 9933 gene locus_tag LOCUS_13040 9646 9933 CDS product DUF2087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886880.1 protein_id gnl|my_center|LOCUS_13040 11426 10047 gene locus_tag LOCUS_13050 11426 10047 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_13050 11610 11984 gene locus_tag LOCUS_13060 11610 11984 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478297.1 protein_id gnl|my_center|LOCUS_13060 12000 12872 gene locus_tag LOCUS_13070 12000 12872 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667339.1 protein_id gnl|my_center|LOCUS_13070 13803 12928 gene locus_tag LOCUS_13080 13803 12928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 14495 13797 gene locus_tag LOCUS_13090 14495 13797 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816590.1 protein_id gnl|my_center|LOCUS_13090 14868 14497 gene locus_tag LOCUS_13100 14868 14497 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119149.1 protein_id gnl|my_center|LOCUS_13100 >Feature sequence47 844 458 gene locus_tag LOCUS_13110 844 458 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_13110 2910 970 gene locus_tag LOCUS_13120 gene thrS 2910 970 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048136.1 protein_id gnl|my_center|LOCUS_13120 3307 4068 gene locus_tag LOCUS_13130 3307 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 4213 8205 gene locus_tag LOCUS_13140 4213 8205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 8195 8863 gene locus_tag LOCUS_13150 8195 8863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 9335 9075 gene locus_tag LOCUS_13160 gene rpsT 9335 9075 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774009.1 protein_id gnl|my_center|LOCUS_13160 10850 9450 gene locus_tag LOCUS_13170 10850 9450 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965627.1 protein_id gnl|my_center|LOCUS_13170 11683 10886 gene locus_tag LOCUS_13180 11683 10886 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242619.1 protein_id gnl|my_center|LOCUS_13180 12766 11690 gene locus_tag LOCUS_13190 12766 11690 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966344.1 protein_id gnl|my_center|LOCUS_13190 >Feature sequence48 <1 1009 gene locus_tag LOCUS_13200 <1 1009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390596.1:ABC transporter permease 1006 1929 gene locus_tag LOCUS_13210 1006 1929 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969293.1 protein_id gnl|my_center|LOCUS_13210 2921 1926 gene locus_tag LOCUS_13220 2921 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 3077 4996 gene locus_tag LOCUS_13230 3077 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 5222 5746 gene locus_tag LOCUS_13240 5222 5746 CDS product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646218.1 protein_id gnl|my_center|LOCUS_13240 5819 6640 gene locus_tag LOCUS_13250 5819 6640 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965364.1 protein_id gnl|my_center|LOCUS_13250 6628 7962 gene locus_tag LOCUS_13260 6628 7962 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 protein_id gnl|my_center|LOCUS_13260 8064 8906 gene locus_tag LOCUS_13270 gene mreC 8064 8906 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942723.1 protein_id gnl|my_center|LOCUS_13270 8909 9421 gene locus_tag LOCUS_13280 8909 9421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 9425 11944 gene locus_tag LOCUS_13290 9425 11944 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861128.1 protein_id gnl|my_center|LOCUS_13290 12401 12889 gene locus_tag LOCUS_13300 12401 12889 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868903.1 protein_id gnl|my_center|LOCUS_13300 12891 13448 gene locus_tag LOCUS_13310 12891 13448 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869297.1 protein_id gnl|my_center|LOCUS_13310 >Feature sequence49 1191 409 gene locus_tag LOCUS_13320 1191 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389995.1 protein_id gnl|my_center|LOCUS_13320 1495 2121 gene locus_tag LOCUS_13330 1495 2121 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965791.1 protein_id gnl|my_center|LOCUS_13330 4417 2141 gene locus_tag LOCUS_13340 4417 2141 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930732.1 protein_id gnl|my_center|LOCUS_13340 4767 5372 gene locus_tag LOCUS_13350 4767 5372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 5376 5669 gene locus_tag LOCUS_13360 5376 5669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 5678 5929 gene locus_tag LOCUS_13370 5678 5929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 8800 6107 gene locus_tag LOCUS_13380 gene feoB 8800 6107 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948706.1 protein_id gnl|my_center|LOCUS_13380 8912 8772 gene locus_tag LOCUS_13390 8912 8772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 10551 8896 gene locus_tag LOCUS_13400 10551 8896 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436982.1 protein_id gnl|my_center|LOCUS_13400 12298 10562 gene locus_tag LOCUS_13410 12298 10562 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948922.1 protein_id gnl|my_center|LOCUS_13410 12705 12433 gene locus_tag LOCUS_13420 12705 12433 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391633.1 protein_id gnl|my_center|LOCUS_13420 <13544 12819 gene locus_tag LOCUS_13430 <13544 12819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458939.1:nucleoside triphosphate pyrophosphohydrolase >Feature sequence50 <1 759 gene locus_tag LOCUS_13440 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_054935954.1:RNA polymerase sigma factor RpoD 1141 923 gene locus_tag LOCUS_13450 1141 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 2171 1143 gene locus_tag LOCUS_13460 2171 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 2388 2579 gene locus_tag LOCUS_13470 gene rpmB 2388 2579 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392437.1 protein_id gnl|my_center|LOCUS_13470 2830 2627 gene locus_tag LOCUS_13480 2830 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 2985 4268 gene locus_tag LOCUS_13490 2985 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 4252 5025 gene locus_tag LOCUS_13500 gene spo0A 4252 5025 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393014.1 protein_id gnl|my_center|LOCUS_13500 5331 5630 gene locus_tag LOCUS_13510 5331 5630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 5677 6837 gene locus_tag LOCUS_13520 5677 6837 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965365.1 protein_id gnl|my_center|LOCUS_13520 6935 7579 gene locus_tag LOCUS_13530 6935 7579 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372445.1 protein_id gnl|my_center|LOCUS_13530 7582 8361 gene locus_tag LOCUS_13540 7582 8361 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986419.1 protein_id gnl|my_center|LOCUS_13540 8354 8947 gene locus_tag LOCUS_13550 gene scpB 8354 8947 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402814.1 protein_id gnl|my_center|LOCUS_13550 9005 9559 gene locus_tag LOCUS_13560 9005 9559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 9571 10050 gene locus_tag LOCUS_13570 gene ytfJ 9571 10050 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965359.1 protein_id gnl|my_center|LOCUS_13570 10223 11173 gene locus_tag LOCUS_13580 10223 11173 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047683.1 protein_id gnl|my_center|LOCUS_13580 11186 11902 gene locus_tag LOCUS_13590 11186 11902 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435147.1 protein_id gnl|my_center|LOCUS_13590 12027 12386 gene locus_tag LOCUS_13600 12027 12386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 12413 12790 gene locus_tag LOCUS_13610 12413 12790 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence51 1429 50 gene locus_tag LOCUS_13620 1429 50 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422669.1 protein_id gnl|my_center|LOCUS_13620 3205 1439 gene locus_tag LOCUS_13630 3205 1439 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033047490.1 protein_id gnl|my_center|LOCUS_13630 3538 3206 gene locus_tag LOCUS_13640 3538 3206 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986934.1 protein_id gnl|my_center|LOCUS_13640 4511 3528 gene locus_tag LOCUS_13650 4511 3528 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439726.1 protein_id gnl|my_center|LOCUS_13650 5140 4535 gene locus_tag LOCUS_13660 5140 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 5671 5162 gene locus_tag LOCUS_13670 5671 5162 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904262.1 protein_id gnl|my_center|LOCUS_13670 7670 5745 gene locus_tag LOCUS_13680 7670 5745 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986938.1 protein_id gnl|my_center|LOCUS_13680 7978 7667 gene locus_tag LOCUS_13690 7978 7667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 8997 8050 gene locus_tag LOCUS_13700 8997 8050 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519082.1 protein_id gnl|my_center|LOCUS_13700 10200 9007 gene locus_tag LOCUS_13710 10200 9007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 10473 11867 gene locus_tag LOCUS_13720 10473 11867 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892302.1 protein_id gnl|my_center|LOCUS_13720 11874 12026 gene locus_tag LOCUS_13730 11874 12026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 >Feature sequence52 12 88 gene locus_tag LOCUS_t00260 12 88 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 451 1308 gene locus_tag LOCUS_13740 451 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 3296 2427 gene locus_tag LOCUS_13750 3296 2427 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490772.1 protein_id gnl|my_center|LOCUS_13750 3539 3883 gene locus_tag LOCUS_13760 3539 3883 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807902.1 protein_id gnl|my_center|LOCUS_13760 3880 5955 gene locus_tag LOCUS_13770 3880 5955 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459352.1 protein_id gnl|my_center|LOCUS_13770 6416 6051 gene locus_tag LOCUS_13780 6416 6051 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949091.1 protein_id gnl|my_center|LOCUS_13780 7275 6616 gene locus_tag LOCUS_13790 7275 6616 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 protein_id gnl|my_center|LOCUS_13790 7408 8070 gene locus_tag LOCUS_13800 7408 8070 CDS product chloramphenicol acetyltransferase CAT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890745.1 protein_id gnl|my_center|LOCUS_13800 8514 8083 gene locus_tag LOCUS_13810 8514 8083 CDS product iron dependent repressor, metal binding and dimerization domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815079.1 protein_id gnl|my_center|LOCUS_13810 8618 8848 gene locus_tag LOCUS_13820 8618 8848 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460459.1 protein_id gnl|my_center|LOCUS_13820 8859 11009 gene locus_tag LOCUS_13830 gene feoB 8859 11009 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439379.1 protein_id gnl|my_center|LOCUS_13830 >Feature sequence53 1018 80 gene locus_tag LOCUS_13840 gene rsmH 1018 80 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943702.1 protein_id gnl|my_center|LOCUS_13840 1470 1015 gene locus_tag LOCUS_13850 gene mraZ 1470 1015 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 protein_id gnl|my_center|LOCUS_13850 1755 2960 gene locus_tag LOCUS_13860 1755 2960 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583069.1 protein_id gnl|my_center|LOCUS_13860 4543 3173 gene locus_tag LOCUS_13870 4543 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 5382 4681 gene locus_tag LOCUS_13880 5382 4681 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963644.1 protein_id gnl|my_center|LOCUS_13880 6497 5379 gene locus_tag LOCUS_13890 6497 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 6858 7286 gene locus_tag LOCUS_13900 6858 7286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_13900 7283 7561 gene locus_tag LOCUS_13910 7283 7561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 7568 8215 gene locus_tag LOCUS_13920 7568 8215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 8278 8499 gene locus_tag LOCUS_13930 8278 8499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 9592 8504 gene locus_tag LOCUS_13940 9592 8504 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459550.1 protein_id gnl|my_center|LOCUS_13940 9834 10670 gene locus_tag LOCUS_13950 9834 10670 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_13950 10671 11300 gene locus_tag LOCUS_13960 10671 11300 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_13960 11291 11857 gene locus_tag LOCUS_13970 11291 11857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 >Feature sequence54 17 847 gene locus_tag LOCUS_13980 17 847 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459548.1 protein_id gnl|my_center|LOCUS_13980 898 1482 gene locus_tag LOCUS_13990 898 1482 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958632.1 protein_id gnl|my_center|LOCUS_13990 2190 2732 gene locus_tag LOCUS_14000 2190 2732 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964159.1 protein_id gnl|my_center|LOCUS_14000 2769 3881 gene locus_tag LOCUS_14010 2769 3881 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 protein_id gnl|my_center|LOCUS_14010 3878 4717 gene locus_tag LOCUS_14020 3878 4717 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808911.1 protein_id gnl|my_center|LOCUS_14020 4714 5523 gene locus_tag LOCUS_14030 4714 5523 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_14030 5604 6578 gene locus_tag LOCUS_14040 5604 6578 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459712.1 protein_id gnl|my_center|LOCUS_14040 7596 6658 gene locus_tag LOCUS_14050 7596 6658 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786960.1 protein_id gnl|my_center|LOCUS_14050 8338 7865 gene locus_tag LOCUS_14060 8338 7865 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890655.1 protein_id gnl|my_center|LOCUS_14060 9458 8454 gene locus_tag LOCUS_14070 9458 8454 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085629.1 protein_id gnl|my_center|LOCUS_14070 9667 10230 gene locus_tag LOCUS_14080 9667 10230 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890731.1 protein_id gnl|my_center|LOCUS_14080 >Feature sequence55 2547 745 gene locus_tag LOCUS_14090 2547 745 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193735789.1 protein_id gnl|my_center|LOCUS_14090 2653 2735 gene locus_tag LOCUS_t00270 2653 2735 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3127 4242 gene locus_tag LOCUS_14100 3127 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 5239 4466 gene locus_tag LOCUS_14110 5239 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 6747 6061 gene locus_tag LOCUS_14120 6747 6061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 7191 6835 gene locus_tag LOCUS_14130 7191 6835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 7952 7521 gene locus_tag LOCUS_14140 7952 7521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 >Feature sequence56 481 248 gene locus_tag LOCUS_14150 481 248 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816044.1 protein_id gnl|my_center|LOCUS_14150 602 778 gene locus_tag LOCUS_14160 602 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 >Feature sequence57 <1 770 gene locus_tag LOCUS_14170 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964615.1:Nif3-like dinuclear metal center hexameric protein 809 1537 gene locus_tag LOCUS_14180 809 1537 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047987.1 protein_id gnl|my_center|LOCUS_14180 2224 1967 gene locus_tag LOCUS_14190 2224 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 4223 2373 gene locus_tag LOCUS_14200 4223 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 4687 4355 gene locus_tag LOCUS_14210 4687 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 5073 4756 gene locus_tag LOCUS_14220 5073 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 5366 5073 gene locus_tag LOCUS_14230 5366 5073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 5663 7600 gene locus_tag LOCUS_14240 5663 7600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 >Feature sequence58 382 996 gene locus_tag LOCUS_14250 382 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1660 1166 gene locus_tag LOCUS_14260 1660 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 1872 1663 gene locus_tag LOCUS_14270 1872 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 2452 1835 gene locus_tag LOCUS_14280 2452 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 3538 4623 gene locus_tag LOCUS_14290 3538 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 4663 5676 gene locus_tag LOCUS_14300 4663 5676 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810402.1 protein_id gnl|my_center|LOCUS_14300 5673 6449 gene locus_tag LOCUS_14310 5673 6449 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761990.1 protein_id gnl|my_center|LOCUS_14310 6601 7083 gene locus_tag LOCUS_14320 6601 7083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 >Feature sequence59 162 437 gene locus_tag LOCUS_14330 162 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 449 694 gene locus_tag LOCUS_14340 449 694 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392904.1 protein_id gnl|my_center|LOCUS_14340 2542 920 gene locus_tag LOCUS_14350 2542 920 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861938.1 protein_id gnl|my_center|LOCUS_14350 3317 3045 gene locus_tag LOCUS_14360 3317 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 3562 3717 gene locus_tag LOCUS_14370 3562 3717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 3742 4383 gene locus_tag LOCUS_14380 3742 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 5047 4823 gene locus_tag LOCUS_14390 5047 4823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 5153 5398 gene locus_tag LOCUS_14400 5153 5398 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109531.1 protein_id gnl|my_center|LOCUS_14400 5512 5970 gene locus_tag LOCUS_14410 gene bcp 5512 5970 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439443.1 protein_id gnl|my_center|LOCUS_14410 5972 6562 gene locus_tag LOCUS_14420 5972 6562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 >Feature sequence60 50 388 gene locus_tag LOCUS_14430 50 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 2130 604 gene locus_tag LOCUS_14440 gene guaA 2130 604 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425341.1 protein_id gnl|my_center|LOCUS_14440 2717 2127 gene locus_tag LOCUS_14450 2717 2127 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389803.1 protein_id gnl|my_center|LOCUS_14450 3432 2806 gene locus_tag LOCUS_14460 3432 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 3775 3518 gene locus_tag LOCUS_14470 3775 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 4506 3793 gene locus_tag LOCUS_14480 4506 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 5744 4506 gene locus_tag LOCUS_14490 5744 4506 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392227.1 protein_id gnl|my_center|LOCUS_14490 >Feature sequence61 682 1251 gene locus_tag LOCUS_14500 682 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 1431 1769 gene locus_tag LOCUS_14510 1431 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 1869 2024 gene locus_tag LOCUS_14520 1869 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 2728 3030 gene locus_tag LOCUS_14530 2728 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 2978 3142 gene locus_tag LOCUS_14540 2978 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 3135 3311 gene locus_tag LOCUS_14550 3135 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 3361 4164 gene locus_tag LOCUS_14560 3361 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 4166 4393 gene locus_tag LOCUS_14570 4166 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 4490 4999 gene locus_tag LOCUS_14580 4490 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 5038 5277 gene locus_tag LOCUS_14590 5038 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 >Feature sequence62 462 596 gene locus_tag LOCUS_14600 462 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 2577 949 gene locus_tag LOCUS_14610 2577 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 3240 2986 gene locus_tag LOCUS_14620 3240 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 4999 4577 gene locus_tag LOCUS_14630 4999 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 5207 5004 gene locus_tag LOCUS_14640 5207 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 5350 5099 gene locus_tag LOCUS_14650 5350 5099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 >Feature sequence63 853 452 gene locus_tag LOCUS_14660 853 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 1921 1019 gene locus_tag LOCUS_14670 1921 1019 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837152.1 protein_id gnl|my_center|LOCUS_14670 2543 3826 gene locus_tag LOCUS_14680 2543 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 5397 4333 gene locus_tag LOCUS_14690 5397 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 >Feature sequence64 824 534 gene locus_tag LOCUS_14700 824 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 927 1412 gene locus_tag LOCUS_14710 927 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 1483 2127 gene locus_tag LOCUS_14720 gene nth 1483 2127 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964008.1 protein_id gnl|my_center|LOCUS_14720 2127 3395 gene locus_tag LOCUS_14730 gene obgE 2127 3395 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964572.1 protein_id gnl|my_center|LOCUS_14730 3416 3703 gene locus_tag LOCUS_14740 3416 3703 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034585320.1 protein_id gnl|my_center|LOCUS_14740 3706 4167 gene locus_tag LOCUS_14750 gene trmL 3706 4167 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016664.1 protein_id gnl|my_center|LOCUS_14750 4340 4774 gene locus_tag LOCUS_14760 gene rplM 4340 4774 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966379.1 protein_id gnl|my_center|LOCUS_14760 4788 5189 gene locus_tag LOCUS_14770 gene rpsI 4788 5189 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_14770 >Feature sequence65 1082 2497 gene locus_tag LOCUS_14780 1082 2497 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_14780 2603 3748 gene locus_tag LOCUS_14790 2603 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 3751 4932 gene locus_tag LOCUS_14800 gene rodA 3751 4932 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460900.1 protein_id gnl|my_center|LOCUS_14800 >Feature sequence66 2212 257 gene locus_tag LOCUS_14810 2212 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 3829 3599 gene locus_tag LOCUS_14820 3829 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 4102 3851 gene locus_tag LOCUS_14830 4102 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 >Feature sequence67 <1 2204 gene locus_tag LOCUS_14840 <1 2204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861890.1:valine--tRNA ligase 2984 2331 gene locus_tag LOCUS_14850 2984 2331 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518847.1 protein_id gnl|my_center|LOCUS_14850 3085 4014 gene locus_tag LOCUS_14860 3085 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 4211 4138 gene locus_tag LOCUS_t00280 4211 4138 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence68 364 558 gene locus_tag LOCUS_14870 364 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 642 1967 gene locus_tag LOCUS_14880 642 1967 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666065.1 protein_id gnl|my_center|LOCUS_14880 2128 3909 gene locus_tag LOCUS_14890 gene hflX 2128 3909 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965596.1 protein_id gnl|my_center|LOCUS_14890 4037 4113 gene locus_tag LOCUS_t00290 4037 4113 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence69 478 56 gene locus_tag LOCUS_14900 478 56 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047623.1 protein_id gnl|my_center|LOCUS_14900 784 566 gene locus_tag LOCUS_14910 784 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 1280 891 gene locus_tag LOCUS_14920 1280 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 1624 1226 gene locus_tag LOCUS_14930 1624 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 3292 1685 gene locus_tag LOCUS_14940 3292 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 >Feature sequence70 267 1010 gene locus_tag LOCUS_14950 267 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 1686 1012 gene locus_tag LOCUS_14960 1686 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 1973 1898 gene locus_tag LOCUS_t00300 1973 1898 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3258 2146 gene locus_tag LOCUS_14970 3258 2146 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_14970 3417 3854 gene locus_tag LOCUS_14980 3417 3854 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964982.1 protein_id gnl|my_center|LOCUS_14980 >Feature sequence71 <1 1929 gene locus_tag LOCUS_14990 <1 1929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009903185.1:C40 family peptidase 2621 1944 gene locus_tag LOCUS_15000 2621 1944 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_15000 <3907 2602 gene locus_tag LOCUS_15010 <3907 2602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011947993.1:ATP-dependent RecD-like DNA helicase >Feature sequence72 <1 847 gene locus_tag LOCUS_15020 <1 847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948973.1:M14 family metallopeptidase 1481 816 gene locus_tag LOCUS_15030 1481 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 2404 1565 gene locus_tag LOCUS_15040 2404 1565 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765762.1 protein_id gnl|my_center|LOCUS_15040 2827 2414 gene locus_tag LOCUS_15050 2827 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050