>Feature sequence1 440 670 gene locus_tag LOCUS_00010 440 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 4456 3983 gene locus_tag LOCUS_00020 4456 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 4850 4422 gene locus_tag LOCUS_00030 4850 4422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 5097 4912 gene locus_tag LOCUS_00040 5097 4912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5303 5491 gene locus_tag LOCUS_00050 5303 5491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5727 6032 gene locus_tag LOCUS_00060 5727 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00060 6119 6352 gene locus_tag LOCUS_00070 6119 6352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00070 6349 6828 gene locus_tag LOCUS_00080 6349 6828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00080 7418 7999 gene locus_tag LOCUS_00090 7418 7999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00090 7908 8345 gene locus_tag LOCUS_00100 7908 8345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00100 8427 8855 gene locus_tag LOCUS_00110 8427 8855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00110 9419 9132 gene locus_tag LOCUS_00120 9419 9132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 9502 9900 gene locus_tag LOCUS_00130 9502 9900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 10003 10341 gene locus_tag LOCUS_00140 10003 10341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 10927 11517 gene locus_tag LOCUS_00150 10927 11517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 13417 14448 gene locus_tag LOCUS_00160 13417 14448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 14502 14744 gene locus_tag LOCUS_00170 14502 14744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 15065 15757 gene locus_tag LOCUS_00180 15065 15757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00180 15944 16477 gene locus_tag LOCUS_00190 15944 16477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 16744 17208 gene locus_tag LOCUS_00200 16744 17208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 17329 20304 gene locus_tag LOCUS_00210 17329 20304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 20896 21525 gene locus_tag LOCUS_00220 20896 21525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 21954 22700 gene locus_tag LOCUS_00230 21954 22700 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401225.1 protein_id gnl|my_center|LOCUS_00230 22802 23065 gene locus_tag LOCUS_00240 22802 23065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 23087 23599 gene locus_tag LOCUS_00250 23087 23599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 23603 24010 gene locus_tag LOCUS_00260 23603 24010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 24007 25509 gene locus_tag LOCUS_00270 gene atpA 24007 25509 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851836.1 protein_id gnl|my_center|LOCUS_00270 25522 26436 gene locus_tag LOCUS_00280 gene atpG 25522 26436 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948667.1 protein_id gnl|my_center|LOCUS_00280 26457 27836 gene locus_tag LOCUS_00290 gene atpD 26457 27836 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933887.1 protein_id gnl|my_center|LOCUS_00290 27911 28357 gene locus_tag LOCUS_00300 27911 28357 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940790.1 protein_id gnl|my_center|LOCUS_00300 28635 29750 gene locus_tag LOCUS_00310 28635 29750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 29803 30258 gene locus_tag LOCUS_00320 29803 30258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 30355 33318 gene locus_tag LOCUS_00330 30355 33318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 33400 34017 gene locus_tag LOCUS_00340 33400 34017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 34357 35016 gene locus_tag LOCUS_00350 gene pyrE 34357 35016 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946936.1 protein_id gnl|my_center|LOCUS_00350 35143 35799 gene locus_tag LOCUS_00360 35143 35799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 35911 37056 gene locus_tag LOCUS_00370 35911 37056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 37076 37525 gene locus_tag LOCUS_00380 37076 37525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 37576 39288 gene locus_tag LOCUS_00390 gene pilB 37576 39288 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546013.1 protein_id gnl|my_center|LOCUS_00390 39418 40473 gene locus_tag LOCUS_00400 39418 40473 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546785.1 protein_id gnl|my_center|LOCUS_00400 40521 40958 gene locus_tag LOCUS_00410 40521 40958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 41277 43469 gene locus_tag LOCUS_00420 41277 43469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 43720 48192 gene locus_tag LOCUS_00430 43720 48192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 48529 49416 gene locus_tag LOCUS_00440 48529 49416 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546849.1 protein_id gnl|my_center|LOCUS_00440 50732 49614 gene locus_tag LOCUS_00450 50732 49614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 51120 51881 gene locus_tag LOCUS_00460 51120 51881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 52250 58678 gene locus_tag LOCUS_00470 52250 58678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 58782 68786 gene locus_tag LOCUS_00480 58782 68786 CDS product ESPR-type extended signal peptide-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205613.1 protein_id gnl|my_center|LOCUS_00480 71666 69186 gene locus_tag LOCUS_00490 71666 69186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 73177 71702 gene locus_tag LOCUS_00500 73177 71702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 73297 74637 gene locus_tag LOCUS_00510 73297 74637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 74706 77489 gene locus_tag LOCUS_00520 74706 77489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 77577 79484 gene locus_tag LOCUS_00530 77577 79484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 79540 80697 gene locus_tag LOCUS_00540 gene tgt 79540 80697 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_00540 81054 84473 gene locus_tag LOCUS_00550 81054 84473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 84589 88215 gene locus_tag LOCUS_00560 84589 88215 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776388.1 protein_id gnl|my_center|LOCUS_00560 88361 90922 gene locus_tag LOCUS_00570 88361 90922 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392586.1 protein_id gnl|my_center|LOCUS_00570 91035 92438 gene locus_tag LOCUS_00580 91035 92438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 92479 95508 gene locus_tag LOCUS_00590 92479 95508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 95598 96776 gene locus_tag LOCUS_00600 95598 96776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 96929 97417 gene locus_tag LOCUS_00610 96929 97417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 97435 97926 gene locus_tag LOCUS_00620 97435 97926 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212976.1 protein_id gnl|my_center|LOCUS_00620 98027 98236 gene locus_tag LOCUS_00630 gene rpsR 98027 98236 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_00630 98248 98805 gene locus_tag LOCUS_00640 gene efp 98248 98805 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082309.1 protein_id gnl|my_center|LOCUS_00640 98935 99324 gene locus_tag LOCUS_00650 98935 99324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 99510 101582 gene locus_tag LOCUS_00660 gene gyrB 99510 101582 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963335.1 protein_id gnl|my_center|LOCUS_00660 101772 102356 gene locus_tag LOCUS_00670 101772 102356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 102577 102897 gene locus_tag LOCUS_00680 102577 102897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 102991 103659 gene locus_tag LOCUS_00690 102991 103659 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324826.1 protein_id gnl|my_center|LOCUS_00690 104532 103975 gene locus_tag LOCUS_00700 gene pth 104532 103975 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048384.1 protein_id gnl|my_center|LOCUS_00700 106002 104587 gene locus_tag LOCUS_00710 106002 104587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 106463 107116 gene locus_tag LOCUS_00720 gene lepB 106463 107116 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870097.1 protein_id gnl|my_center|LOCUS_00720 107129 108529 gene locus_tag LOCUS_00730 gene hisS 107129 108529 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545147.1 protein_id gnl|my_center|LOCUS_00730 108556 109083 gene locus_tag LOCUS_00740 108556 109083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 109088 109462 gene locus_tag LOCUS_00750 109088 109462 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902960.1 protein_id gnl|my_center|LOCUS_00750 109582 109836 gene locus_tag LOCUS_00760 109582 109836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 109848 110303 gene locus_tag LOCUS_00770 109848 110303 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582556.1 protein_id gnl|my_center|LOCUS_00770 110459 110818 gene locus_tag LOCUS_00780 110459 110818 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715480.1 protein_id gnl|my_center|LOCUS_00780 111004 112251 gene locus_tag LOCUS_00790 gene ftsA 111004 112251 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256643.1 protein_id gnl|my_center|LOCUS_00790 112339 112713 gene locus_tag LOCUS_00800 112339 112713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 112757 113593 gene locus_tag LOCUS_00810 112757 113593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 114553 115893 gene locus_tag LOCUS_00820 114553 115893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 115927 117360 gene locus_tag LOCUS_00830 115927 117360 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258481.1 protein_id gnl|my_center|LOCUS_00830 117392 118237 gene locus_tag LOCUS_00840 117392 118237 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948181.1 protein_id gnl|my_center|LOCUS_00840 118271 118495 gene locus_tag LOCUS_00850 118271 118495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 118530 119237 gene locus_tag LOCUS_00860 118530 119237 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191371.1 protein_id gnl|my_center|LOCUS_00860 119314 119922 gene locus_tag LOCUS_00870 119314 119922 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763353.1 protein_id gnl|my_center|LOCUS_00870 120850 121059 gene locus_tag LOCUS_00880 120850 121059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 121195 121266 gene locus_tag LOCUS_t00010 121195 121266 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 121754 121323 gene locus_tag LOCUS_00890 gene mscL 121754 121323 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785250.1 protein_id gnl|my_center|LOCUS_00890 122066 122794 gene locus_tag LOCUS_00900 122066 122794 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930880.1 protein_id gnl|my_center|LOCUS_00900 123043 123378 gene locus_tag LOCUS_00910 gene rpsL 123043 123378 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966418.1 protein_id gnl|my_center|LOCUS_00910 123505 123972 gene locus_tag LOCUS_00920 gene rpsG 123505 123972 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393941.1 protein_id gnl|my_center|LOCUS_00920 124034 126124 gene locus_tag LOCUS_00930 gene fusA 124034 126124 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_00930 126333 127529 gene locus_tag LOCUS_00940 126333 127529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 127574 129334 gene locus_tag LOCUS_00950 127574 129334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 129996 132155 gene locus_tag LOCUS_00960 129996 132155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 132553 135752 gene locus_tag LOCUS_r00010 132553 135752 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 136185 137021 gene locus_tag LOCUS_00970 136185 137021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 137103 138209 gene locus_tag LOCUS_00980 gene ftsW 137103 138209 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_00980 138295 138513 gene locus_tag LOCUS_00990 138295 138513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 138671 140299 gene locus_tag LOCUS_01000 138671 140299 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258196.1 protein_id gnl|my_center|LOCUS_01000 140421 141455 gene locus_tag LOCUS_01010 140421 141455 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880453.1 protein_id gnl|my_center|LOCUS_01010 141544 141628 gene locus_tag LOCUS_t00020 141544 141628 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 142310 144097 gene locus_tag LOCUS_01020 142310 144097 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256877.1 protein_id gnl|my_center|LOCUS_01020 144329 146905 gene locus_tag LOCUS_01030 gene mgtA 144329 146905 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932315.1 protein_id gnl|my_center|LOCUS_01030 146963 147976 gene locus_tag LOCUS_01040 146963 147976 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706765.1 protein_id gnl|my_center|LOCUS_01040 147967 148227 gene locus_tag LOCUS_01050 147967 148227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 148890 149306 gene locus_tag LOCUS_01060 148890 149306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 150130 152694 gene locus_tag LOCUS_01070 gene uvrA 150130 152694 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546498.1 protein_id gnl|my_center|LOCUS_01070 152798 153832 gene locus_tag LOCUS_01080 152798 153832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 153829 155172 gene locus_tag LOCUS_01090 153829 155172 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121201.1 protein_id gnl|my_center|LOCUS_01090 155226 155612 gene locus_tag LOCUS_01100 155226 155612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 155760 157412 gene locus_tag LOCUS_01110 155760 157412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 157471 158910 gene locus_tag LOCUS_01120 157471 158910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 158907 159347 gene locus_tag LOCUS_01130 158907 159347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 159322 160728 gene locus_tag LOCUS_01140 159322 160728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 160732 161268 gene locus_tag LOCUS_01150 160732 161268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 161287 161730 gene locus_tag LOCUS_01160 161287 161730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 161805 162260 gene locus_tag LOCUS_01170 161805 162260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 162278 162736 gene locus_tag LOCUS_01180 162278 162736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 163069 163326 gene locus_tag LOCUS_01190 163069 163326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 163326 164000 gene locus_tag LOCUS_01200 163326 164000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 163993 165621 gene locus_tag LOCUS_01210 163993 165621 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144196.1 protein_id gnl|my_center|LOCUS_01210 165639 166031 gene locus_tag LOCUS_01220 165639 166031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 166113 167351 gene locus_tag LOCUS_01230 gene murA 166113 167351 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083644.1 protein_id gnl|my_center|LOCUS_01230 167534 168541 gene locus_tag LOCUS_01240 167534 168541 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258891.1 protein_id gnl|my_center|LOCUS_01240 168549 169658 gene locus_tag LOCUS_01250 168549 169658 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255994.1 protein_id gnl|my_center|LOCUS_01250 169946 169713 gene locus_tag LOCUS_01260 169946 169713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 170009 171145 gene locus_tag LOCUS_01270 170009 171145 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966352.1 protein_id gnl|my_center|LOCUS_01270 171167 172069 gene locus_tag LOCUS_01280 171167 172069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 172326 173060 gene locus_tag LOCUS_01290 172326 173060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 175018 173081 gene locus_tag LOCUS_01300 175018 173081 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225853.1 protein_id gnl|my_center|LOCUS_01300 176869 175253 gene locus_tag LOCUS_01310 176869 175253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 176979 180179 gene locus_tag LOCUS_01320 176979 180179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 180209 180541 gene locus_tag LOCUS_01330 180209 180541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 180608 181123 gene locus_tag LOCUS_01340 180608 181123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 181211 181672 gene locus_tag LOCUS_01350 181211 181672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 181693 184209 gene locus_tag LOCUS_01360 181693 184209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 185742 184258 gene locus_tag LOCUS_01370 185742 184258 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148882924.1 protein_id gnl|my_center|LOCUS_01370 186849 186241 gene locus_tag LOCUS_01380 186849 186241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 188365 186857 gene locus_tag LOCUS_01390 188365 186857 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081553.1 protein_id gnl|my_center|LOCUS_01390 189385 188408 gene locus_tag LOCUS_01400 189385 188408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 190401 189394 gene locus_tag LOCUS_01410 190401 189394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 191590 190463 gene locus_tag LOCUS_01420 191590 190463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 191968 191594 gene locus_tag LOCUS_01430 191968 191594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 193979 191970 gene locus_tag LOCUS_01440 193979 191970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 195085 193976 gene locus_tag LOCUS_01450 195085 193976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 196118 195168 gene locus_tag LOCUS_01460 196118 195168 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257444.1 protein_id gnl|my_center|LOCUS_01460 196350 196120 gene locus_tag LOCUS_01470 196350 196120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 197669 196377 gene locus_tag LOCUS_01480 197669 196377 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081274.1 protein_id gnl|my_center|LOCUS_01480 197877 199031 gene locus_tag LOCUS_01490 197877 199031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 199140 200468 gene locus_tag LOCUS_01500 199140 200468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 200518 202602 gene locus_tag LOCUS_01510 200518 202602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 203011 203409 gene locus_tag LOCUS_01520 203011 203409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 203498 204583 gene locus_tag LOCUS_01530 203498 204583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 204633 205937 gene locus_tag LOCUS_01540 204633 205937 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583661.1 protein_id gnl|my_center|LOCUS_01540 209438 205998 gene locus_tag LOCUS_01550 209438 205998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 210607 209498 gene locus_tag LOCUS_01560 210607 209498 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763619.1 protein_id gnl|my_center|LOCUS_01560 213094 211424 gene locus_tag LOCUS_01570 213094 211424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 213238 213585 gene locus_tag LOCUS_01580 213238 213585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 213658 213894 gene locus_tag LOCUS_01590 213658 213894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 213961 214821 gene locus_tag LOCUS_01600 213961 214821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 214860 215144 gene locus_tag LOCUS_01610 214860 215144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 215269 215526 gene locus_tag LOCUS_01620 215269 215526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 215828 217312 gene locus_tag LOCUS_01630 215828 217312 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_01630 217347 218627 gene locus_tag LOCUS_01640 217347 218627 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942239.1 protein_id gnl|my_center|LOCUS_01640 218684 219718 gene locus_tag LOCUS_01650 218684 219718 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906150.1 protein_id gnl|my_center|LOCUS_01650 219734 220459 gene locus_tag LOCUS_01660 gene rsmI 219734 220459 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903175.1 protein_id gnl|my_center|LOCUS_01660 220996 222423 gene locus_tag LOCUS_01670 gene metG 220996 222423 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041424295.1 protein_id gnl|my_center|LOCUS_01670 222430 223263 gene locus_tag LOCUS_01680 222430 223263 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494599.1 protein_id gnl|my_center|LOCUS_01680 223526 223795 gene locus_tag LOCUS_01690 223526 223795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01690 223822 224754 gene locus_tag LOCUS_01700 223822 224754 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728914.1 protein_id gnl|my_center|LOCUS_01700 224742 225518 gene locus_tag LOCUS_01710 224742 225518 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059649.1 protein_id gnl|my_center|LOCUS_01710 225521 226321 gene locus_tag LOCUS_01720 225521 226321 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613822.1 protein_id gnl|my_center|LOCUS_01720 227114 226407 gene locus_tag LOCUS_01730 227114 226407 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_01730 227522 227271 gene locus_tag LOCUS_01740 227522 227271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 229769 227691 gene locus_tag LOCUS_01750 229769 227691 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392959.1 protein_id gnl|my_center|LOCUS_01750 230069 232192 gene locus_tag LOCUS_01760 230069 232192 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_01760 233071 232217 gene locus_tag LOCUS_01770 233071 232217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 233260 233901 gene locus_tag LOCUS_01780 233260 233901 CDS product DUF1361 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726991.1 protein_id gnl|my_center|LOCUS_01780 235056 233905 gene locus_tag LOCUS_01790 235056 233905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 235511 235236 gene locus_tag LOCUS_01800 235511 235236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 235682 237709 gene locus_tag LOCUS_01810 gene uvrB 235682 237709 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379127.1 protein_id gnl|my_center|LOCUS_01810 238691 238251 gene locus_tag LOCUS_01820 238691 238251 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228454.1 protein_id gnl|my_center|LOCUS_01820 239438 238728 gene locus_tag LOCUS_01830 239438 238728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 239612 240163 gene locus_tag LOCUS_01840 239612 240163 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_01840 240173 241063 gene locus_tag LOCUS_01850 gene htpX 240173 241063 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583272.1 protein_id gnl|my_center|LOCUS_01850 241128 241508 gene locus_tag LOCUS_01860 241128 241508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 241685 243115 gene locus_tag LOCUS_01870 gene pyk 241685 243115 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584142.1 protein_id gnl|my_center|LOCUS_01870 243136 243468 gene locus_tag LOCUS_01880 243136 243468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 243518 243805 gene locus_tag LOCUS_01890 243518 243805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 244015 244102 gene locus_tag LOCUS_t00030 244015 244102 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 245571 244024 gene locus_tag LOCUS_01900 245571 244024 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922052.1 protein_id gnl|my_center|LOCUS_01900 246364 245597 gene locus_tag LOCUS_01910 246364 245597 CDS product Rep protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387574.1 protein_id gnl|my_center|LOCUS_01910 246671 246369 gene locus_tag LOCUS_01920 246671 246369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 247325 246738 gene locus_tag LOCUS_01930 247325 246738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 247598 247894 gene locus_tag LOCUS_01940 247598 247894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 248523 249206 gene locus_tag LOCUS_01950 248523 249206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 249211 250194 gene locus_tag LOCUS_01960 249211 250194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095383.1 protein_id gnl|my_center|LOCUS_01960 250862 251578 gene locus_tag LOCUS_01970 250862 251578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 252182 252607 gene locus_tag LOCUS_01980 252182 252607 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020586.1 protein_id gnl|my_center|LOCUS_01980 252894 253310 gene locus_tag LOCUS_01990 252894 253310 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966951.1 protein_id gnl|my_center|LOCUS_01990 253303 253581 gene locus_tag LOCUS_02000 253303 253581 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079596.1 protein_id gnl|my_center|LOCUS_02000 253559 253816 gene locus_tag LOCUS_02010 253559 253816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 253968 254969 gene locus_tag LOCUS_02020 253968 254969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 255030 256070 gene locus_tag LOCUS_02030 gene recA 255030 256070 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965121.1 protein_id gnl|my_center|LOCUS_02030 256345 257535 gene locus_tag LOCUS_02040 gene tuf 256345 257535 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_02040 257668 257997 gene locus_tag LOCUS_02050 gene rpsJ 257668 257997 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810163.1 protein_id gnl|my_center|LOCUS_02050 258246 258842 gene locus_tag LOCUS_02060 gene rplC 258246 258842 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933842.1 protein_id gnl|my_center|LOCUS_02060 258878 259537 gene locus_tag LOCUS_02070 gene rplD 258878 259537 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810159.1 protein_id gnl|my_center|LOCUS_02070 259543 259863 gene locus_tag LOCUS_02080 259543 259863 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531424.1 protein_id gnl|my_center|LOCUS_02080 259942 260733 gene locus_tag LOCUS_02090 gene rplB 259942 260733 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512900.1 protein_id gnl|my_center|LOCUS_02090 260781 261119 gene locus_tag LOCUS_02100 gene rpsS 260781 261119 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851509.1 protein_id gnl|my_center|LOCUS_02100 261124 261639 gene locus_tag LOCUS_02110 261124 261639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 261665 262312 gene locus_tag LOCUS_02120 gene rpsC 261665 262312 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393931.1 protein_id gnl|my_center|LOCUS_02120 262332 262742 gene locus_tag LOCUS_02130 gene rplP 262332 262742 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393930.1 protein_id gnl|my_center|LOCUS_02130 262800 262985 gene locus_tag LOCUS_02140 262800 262985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 262993 263280 gene locus_tag LOCUS_02150 gene rpsQ 262993 263280 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909280.1 protein_id gnl|my_center|LOCUS_02150 263325 263690 gene locus_tag LOCUS_02160 gene rplN 263325 263690 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936658.1 protein_id gnl|my_center|LOCUS_02160 263718 264026 gene locus_tag LOCUS_02170 gene rplX 263718 264026 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558200.1 protein_id gnl|my_center|LOCUS_02170 264067 264630 gene locus_tag LOCUS_02180 gene rplE 264067 264630 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114368.1 protein_id gnl|my_center|LOCUS_02180 264834 265241 gene locus_tag LOCUS_02190 gene rpsH 264834 265241 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258245.1 protein_id gnl|my_center|LOCUS_02190 265309 265854 gene locus_tag LOCUS_02200 gene rplF 265309 265854 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919142.1 protein_id gnl|my_center|LOCUS_02200 265861 266226 gene locus_tag LOCUS_02210 gene rplR 265861 266226 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003739848.1 protein_id gnl|my_center|LOCUS_02210 266260 266817 gene locus_tag LOCUS_02220 gene rpsE 266260 266817 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001860543.1 protein_id gnl|my_center|LOCUS_02220 266835 267317 gene locus_tag LOCUS_02230 gene rplO 266835 267317 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262321.1 protein_id gnl|my_center|LOCUS_02230 267337 268617 gene locus_tag LOCUS_02240 gene secY 267337 268617 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974248.1 protein_id gnl|my_center|LOCUS_02240 268642 269307 gene locus_tag LOCUS_02250 268642 269307 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966391.1 protein_id gnl|my_center|LOCUS_02250 269430 270200 gene locus_tag LOCUS_02260 gene map 269430 270200 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_02260 270419 271369 gene locus_tag LOCUS_02270 270419 271369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 271802 271620 gene locus_tag LOCUS_02280 271802 271620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 272799 273698 gene locus_tag LOCUS_02290 272799 273698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 273850 275757 gene locus_tag LOCUS_02300 273850 275757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 275754 276107 gene locus_tag LOCUS_02310 275754 276107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 276345 277007 gene locus_tag LOCUS_02320 gene radC 276345 277007 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546157.1 protein_id gnl|my_center|LOCUS_02320 277089 278396 gene locus_tag LOCUS_02330 277089 278396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 278470 279750 gene locus_tag LOCUS_02340 gene dcm 278470 279750 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962895.1 protein_id gnl|my_center|LOCUS_02340 279813 280166 gene locus_tag LOCUS_02350 279813 280166 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972298.1 protein_id gnl|my_center|LOCUS_02350 280191 280601 gene locus_tag LOCUS_02360 gene ruvX 280191 280601 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940329.1 protein_id gnl|my_center|LOCUS_02360 280649 281431 gene locus_tag LOCUS_02370 280649 281431 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_02370 281486 282532 gene locus_tag LOCUS_02380 gene galT 281486 282532 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080684.1 protein_id gnl|my_center|LOCUS_02380 282537 283316 gene locus_tag LOCUS_02390 282537 283316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 283313 284242 gene locus_tag LOCUS_02400 283313 284242 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393881.1 protein_id gnl|my_center|LOCUS_02400 284275 285264 gene locus_tag LOCUS_02410 gene gap 284275 285264 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_02410 285353 286951 gene locus_tag LOCUS_02420 285353 286951 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_02420 287096 289627 gene locus_tag LOCUS_02430 287096 289627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 289691 290854 gene locus_tag LOCUS_02440 289691 290854 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142146.1 protein_id gnl|my_center|LOCUS_02440 290933 291853 gene locus_tag LOCUS_02450 gene trxB 290933 291853 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080734.1 protein_id gnl|my_center|LOCUS_02450 291973 291901 gene locus_tag LOCUS_t00040 291973 291901 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 292124 292894 gene locus_tag LOCUS_02460 292124 292894 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530095.1 protein_id gnl|my_center|LOCUS_02460 292869 293177 gene locus_tag LOCUS_02470 292869 293177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 293293 293901 gene locus_tag LOCUS_02480 293293 293901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 293914 294600 gene locus_tag LOCUS_02490 293914 294600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02490 294630 295070 gene locus_tag LOCUS_02500 294630 295070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02500 295128 295715 gene locus_tag LOCUS_02510 295128 295715 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053782.1 protein_id gnl|my_center|LOCUS_02510 296102 296917 gene locus_tag LOCUS_02520 296102 296917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 297041 298510 gene locus_tag LOCUS_02530 gene gatB 297041 298510 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_02530 301147 300197 gene locus_tag LOCUS_02540 gene miaA 301147 300197 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679096.1 protein_id gnl|my_center|LOCUS_02540 304718 301155 gene locus_tag LOCUS_02550 304718 301155 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583743.1 protein_id gnl|my_center|LOCUS_02550 304954 305463 gene locus_tag LOCUS_02560 304954 305463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 306834 306646 gene locus_tag LOCUS_02570 306834 306646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 306899 307372 gene locus_tag LOCUS_02580 306899 307372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 307480 308166 gene locus_tag LOCUS_02590 307480 308166 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546482.1 protein_id gnl|my_center|LOCUS_02590 308205 308417 gene locus_tag LOCUS_02600 gene rpmF 308205 308417 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670496.1 protein_id gnl|my_center|LOCUS_02600 308493 308987 gene locus_tag LOCUS_02610 gene nusB 308493 308987 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909412.1 protein_id gnl|my_center|LOCUS_02610 309072 309764 gene locus_tag LOCUS_02620 gene rnc 309072 309764 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287896.1 protein_id gnl|my_center|LOCUS_02620 309843 310382 gene locus_tag LOCUS_02630 309843 310382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 310564 311937 gene locus_tag LOCUS_02640 gene hisS 310564 311937 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036976.1 protein_id gnl|my_center|LOCUS_02640 312720 312148 gene locus_tag LOCUS_02650 312720 312148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 314511 312796 gene locus_tag LOCUS_02660 314511 312796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 315258 314515 gene locus_tag LOCUS_02670 315258 314515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901416.1 protein_id gnl|my_center|LOCUS_02670 315503 315814 gene locus_tag LOCUS_02680 315503 315814 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869065.1 protein_id gnl|my_center|LOCUS_02680 316043 316684 gene locus_tag LOCUS_02690 316043 316684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 316882 317295 gene locus_tag LOCUS_02700 316882 317295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 317292 317966 gene locus_tag LOCUS_02710 317292 317966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 318337 319644 gene locus_tag LOCUS_02720 gene purD 318337 319644 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288007.1 protein_id gnl|my_center|LOCUS_02720 319774 321762 gene locus_tag LOCUS_02730 319774 321762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 321775 323172 gene locus_tag LOCUS_02740 321775 323172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 323129 323311 gene locus_tag LOCUS_02750 323129 323311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 323313 324251 gene locus_tag LOCUS_02760 323313 324251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 324283 324876 gene locus_tag LOCUS_02770 324283 324876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 324936 326612 gene locus_tag LOCUS_02780 324936 326612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 326761 326688 gene locus_tag LOCUS_t00050 326761 326688 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 326918 327706 gene locus_tag LOCUS_02790 326918 327706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 327849 328325 gene locus_tag LOCUS_02800 327849 328325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 328335 329660 gene locus_tag LOCUS_02810 gene aspS 328335 329660 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948698.1 protein_id gnl|my_center|LOCUS_02810 329853 330896 gene locus_tag LOCUS_02820 329853 330896 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392074.1 protein_id gnl|my_center|LOCUS_02820 330929 331744 gene locus_tag LOCUS_02830 gene mreC 330929 331744 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942723.1 protein_id gnl|my_center|LOCUS_02830 331741 332286 gene locus_tag LOCUS_02840 331741 332286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 332360 333538 gene locus_tag LOCUS_02850 332360 333538 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582745.1 protein_id gnl|my_center|LOCUS_02850 333843 333562 gene locus_tag LOCUS_02860 333843 333562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 333728 334861 gene locus_tag LOCUS_02870 333728 334861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 334933 336234 gene locus_tag LOCUS_02880 334933 336234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 336404 337156 gene locus_tag LOCUS_02890 336404 337156 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404464.1 protein_id gnl|my_center|LOCUS_02890 337298 337873 gene locus_tag LOCUS_02900 337298 337873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 337901 338578 gene locus_tag LOCUS_02910 337901 338578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 338586 339170 gene locus_tag LOCUS_02920 gene dcd 338586 339170 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051821.1 protein_id gnl|my_center|LOCUS_02920 339181 340194 gene locus_tag LOCUS_02930 339181 340194 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298126.1 protein_id gnl|my_center|LOCUS_02930 340219 340719 gene locus_tag LOCUS_02940 340219 340719 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941234.1 protein_id gnl|my_center|LOCUS_02940 340764 341921 gene locus_tag LOCUS_02950 340764 341921 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240438.1 protein_id gnl|my_center|LOCUS_02950 342000 343643 gene locus_tag LOCUS_02960 342000 343643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 343708 345573 gene locus_tag LOCUS_02970 gene mrdA 343708 345573 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_02970 345690 346145 gene locus_tag LOCUS_02980 gene greA 345690 346145 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391698.1 protein_id gnl|my_center|LOCUS_02980 346339 346893 gene locus_tag LOCUS_02990 346339 346893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 346923 347717 gene locus_tag LOCUS_03000 gene uppP 346923 347717 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392108.1 protein_id gnl|my_center|LOCUS_03000 347714 348568 gene locus_tag LOCUS_03010 gene folD 347714 348568 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_03010 348673 348589 gene locus_tag LOCUS_t00060 348673 348589 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 348778 349551 gene locus_tag LOCUS_03020 348778 349551 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940782.1 protein_id gnl|my_center|LOCUS_03020 349757 352063 gene locus_tag LOCUS_03030 349757 352063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 352101 353591 gene locus_tag LOCUS_03040 gene lysS 352101 353591 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809769.1 protein_id gnl|my_center|LOCUS_03040 353606 354934 gene locus_tag LOCUS_03050 gene serS 353606 354934 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887919.1 protein_id gnl|my_center|LOCUS_03050 355007 355081 gene locus_tag LOCUS_t00070 355007 355081 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 355428 356369 gene locus_tag LOCUS_03060 355428 356369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 356401 356958 gene locus_tag LOCUS_03070 gene frr 356401 356958 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531503.1 protein_id gnl|my_center|LOCUS_03070 357034 358185 gene locus_tag LOCUS_03080 gene rseP 357034 358185 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583162.1 protein_id gnl|my_center|LOCUS_03080 358362 359174 gene locus_tag LOCUS_03090 358362 359174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 359330 360109 gene locus_tag LOCUS_03100 359330 360109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 360109 361950 gene locus_tag LOCUS_03110 360109 361950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 362191 362709 gene locus_tag LOCUS_03120 362191 362709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 363646 362780 gene locus_tag LOCUS_03130 363646 362780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 363764 364066 gene locus_tag LOCUS_03140 363764 364066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 363990 364280 gene locus_tag LOCUS_03150 363990 364280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 364343 365497 gene locus_tag LOCUS_03160 364343 365497 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061295.1 protein_id gnl|my_center|LOCUS_03160 366572 367522 gene locus_tag LOCUS_03170 366572 367522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 367606 368808 gene locus_tag LOCUS_03180 367606 368808 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142191.1 protein_id gnl|my_center|LOCUS_03180 368805 370229 gene locus_tag LOCUS_03190 368805 370229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 370410 371636 gene locus_tag LOCUS_03200 370410 371636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 371759 374386 gene locus_tag LOCUS_03210 gene secA 371759 374386 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945439.1 protein_id gnl|my_center|LOCUS_03210 374396 374929 gene locus_tag LOCUS_03220 374396 374929 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002690264.1 protein_id gnl|my_center|LOCUS_03220 375121 375666 gene locus_tag LOCUS_03230 375121 375666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 375709 375942 gene locus_tag LOCUS_03240 375709 375942 CDS product DUF1653 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948275.1 protein_id gnl|my_center|LOCUS_03240 375939 376355 gene locus_tag LOCUS_03250 375939 376355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 376735 377253 gene locus_tag LOCUS_03260 376735 377253 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195801.1 protein_id gnl|my_center|LOCUS_03260 377325 377252 gene locus_tag LOCUS_t00080 377325 377252 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 377498 378517 gene locus_tag LOCUS_03270 gene prfB 377498 378517 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083772533.1 protein_id gnl|my_center|LOCUS_03270 378600 379280 gene locus_tag LOCUS_03280 gene ftsE 378600 379280 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228039.1 protein_id gnl|my_center|LOCUS_03280 379297 380232 gene locus_tag LOCUS_03290 gene ftsX 379297 380232 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317241.1 protein_id gnl|my_center|LOCUS_03290 380339 380411 gene locus_tag LOCUS_t00090 380339 380411 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 380446 381108 gene locus_tag LOCUS_03300 380446 381108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 381291 381962 gene locus_tag LOCUS_03310 381291 381962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 382002 382559 gene locus_tag LOCUS_03320 382002 382559 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026983.1 protein_id gnl|my_center|LOCUS_03320 382663 382938 gene locus_tag LOCUS_03330 382663 382938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 382994 383473 gene locus_tag LOCUS_03340 382994 383473 CDS product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024098.1 protein_id gnl|my_center|LOCUS_03340 384071 384706 gene locus_tag LOCUS_03350 384071 384706 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365354.1 protein_id gnl|my_center|LOCUS_03350 384737 385489 gene locus_tag LOCUS_03360 384737 385489 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776999.1 protein_id gnl|my_center|LOCUS_03360 390069 385504 gene locus_tag LOCUS_03370 390069 385504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 390399 390608 gene locus_tag LOCUS_03380 390399 390608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 390704 391150 gene locus_tag LOCUS_03390 390704 391150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 391183 392361 gene locus_tag LOCUS_03400 391183 392361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 392472 392545 gene locus_tag LOCUS_t00100 392472 392545 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 393826 393191 gene locus_tag LOCUS_03410 393826 393191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 394181 395281 gene locus_tag LOCUS_03420 gene ddlA 394181 395281 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816930.1 protein_id gnl|my_center|LOCUS_03420 397066 395393 gene locus_tag LOCUS_03430 397066 395393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 398964 397108 gene locus_tag LOCUS_03440 398964 397108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 399165 400928 gene locus_tag LOCUS_03450 399165 400928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 401106 402593 gene locus_tag LOCUS_03460 401106 402593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 402633 404207 gene locus_tag LOCUS_03470 402633 404207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 404294 404971 gene locus_tag LOCUS_03480 404294 404971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 405065 406681 gene locus_tag LOCUS_03490 405065 406681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 406707 408611 gene locus_tag LOCUS_03500 406707 408611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 408629 410146 gene locus_tag LOCUS_03510 gene pelB 408629 410146 CDS product exopolygalacturonase PelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865120.1 protein_id gnl|my_center|LOCUS_03510 411137 410199 gene locus_tag LOCUS_03520 411137 410199 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724106.1 protein_id gnl|my_center|LOCUS_03520 411340 411414 gene locus_tag LOCUS_t00110 411340 411414 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 411443 411889 gene locus_tag LOCUS_03530 gene rplI 411443 411889 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864242.1 protein_id gnl|my_center|LOCUS_03530 412126 413781 gene locus_tag LOCUS_03540 gene pyrG 412126 413781 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867477.1 protein_id gnl|my_center|LOCUS_03540 413861 414298 gene locus_tag LOCUS_03550 413861 414298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 414388 414630 gene locus_tag LOCUS_03560 414388 414630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 414843 415340 gene locus_tag LOCUS_03570 414843 415340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 415328 416662 gene locus_tag LOCUS_03580 415328 416662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 416712 419087 gene locus_tag LOCUS_03590 416712 419087 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496762.1 protein_id gnl|my_center|LOCUS_03590 419171 419371 gene locus_tag LOCUS_03600 419171 419371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 419383 420495 gene locus_tag LOCUS_03610 419383 420495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 420606 421529 gene locus_tag LOCUS_03620 420606 421529 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_03620 421534 423849 gene locus_tag LOCUS_03630 421534 423849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 423859 424458 gene locus_tag LOCUS_03640 423859 424458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 424514 424867 gene locus_tag LOCUS_03650 424514 424867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 425982 425584 gene locus_tag LOCUS_03660 425982 425584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 426163 427974 gene locus_tag LOCUS_03670 426163 427974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 428093 429349 gene locus_tag LOCUS_03680 428093 429349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 429447 429854 gene locus_tag LOCUS_03690 429447 429854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 430984 429872 gene locus_tag LOCUS_03700 430984 429872 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255994.1 protein_id gnl|my_center|LOCUS_03700 431694 430990 gene locus_tag LOCUS_03710 gene pyrH 431694 430990 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668261.1 protein_id gnl|my_center|LOCUS_03710 432946 431711 gene locus_tag LOCUS_03720 432946 431711 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389451.1 protein_id gnl|my_center|LOCUS_03720 433064 433978 gene locus_tag LOCUS_03730 433064 433978 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528681.1 protein_id gnl|my_center|LOCUS_03730 434007 434768 gene locus_tag LOCUS_03740 434007 434768 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328580.1 protein_id gnl|my_center|LOCUS_03740 435588 434770 gene locus_tag LOCUS_03750 435588 434770 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546598.1 protein_id gnl|my_center|LOCUS_03750 436929 435601 gene locus_tag LOCUS_03760 436929 435601 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228370.1 protein_id gnl|my_center|LOCUS_03760 437345 436926 gene locus_tag LOCUS_03770 437345 436926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 437968 437450 gene locus_tag LOCUS_03780 437968 437450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 439829 438123 gene locus_tag LOCUS_03790 439829 438123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 440335 439982 gene locus_tag LOCUS_03800 440335 439982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 441340 440405 gene locus_tag LOCUS_03810 gene murB 441340 440405 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124176.1 protein_id gnl|my_center|LOCUS_03810 442826 441423 gene locus_tag LOCUS_03820 gene murC 442826 441423 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018214193.1 protein_id gnl|my_center|LOCUS_03820 444035 442848 gene locus_tag LOCUS_03830 gene murG 444035 442848 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545433.1 protein_id gnl|my_center|LOCUS_03830 445112 444045 gene locus_tag LOCUS_03840 gene spoVE 445112 444045 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244810.1 protein_id gnl|my_center|LOCUS_03840 445959 445288 gene locus_tag LOCUS_03850 gene trmD 445959 445288 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941307.1 protein_id gnl|my_center|LOCUS_03850 446226 446035 gene locus_tag LOCUS_03860 446226 446035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 447314 446574 gene locus_tag LOCUS_03870 447314 446574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 447640 447428 gene locus_tag LOCUS_03880 447640 447428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 449288 448422 gene locus_tag LOCUS_03890 449288 448422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 449943 449308 gene locus_tag LOCUS_03900 449943 449308 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767813.1 protein_id gnl|my_center|LOCUS_03900 450594 450013 gene locus_tag LOCUS_03910 450594 450013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 451225 450656 gene locus_tag LOCUS_03920 451225 450656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 452098 451829 gene locus_tag LOCUS_03930 452098 451829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 453514 453017 gene locus_tag LOCUS_03940 453514 453017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 456546 459917 gene locus_tag LOCUS_03950 456546 459917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 459924 460655 gene locus_tag LOCUS_03960 459924 460655 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496955.1 protein_id gnl|my_center|LOCUS_03960 460661 461020 gene locus_tag LOCUS_03970 460661 461020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 463111 464274 gene locus_tag LOCUS_03980 463111 464274 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870581.1 protein_id gnl|my_center|LOCUS_03980 464375 466198 gene locus_tag LOCUS_03990 gene asnB 464375 466198 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_03990 466232 467323 gene locus_tag LOCUS_04000 466232 467323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 467336 468466 gene locus_tag LOCUS_04010 467336 468466 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957839.1 protein_id gnl|my_center|LOCUS_04010 468489 469544 gene locus_tag LOCUS_04020 468489 469544 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582745.1 protein_id gnl|my_center|LOCUS_04020 470303 469566 gene locus_tag LOCUS_04030 470303 469566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 471154 470318 gene locus_tag LOCUS_04040 471154 470318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 472174 471161 gene locus_tag LOCUS_04050 gene gmd 472174 471161 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096890.1 protein_id gnl|my_center|LOCUS_04050 473332 472193 gene locus_tag LOCUS_04060 473332 472193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 474470 473337 gene locus_tag LOCUS_04070 474470 473337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 475017 474484 gene locus_tag LOCUS_04080 475017 474484 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881425.1 protein_id gnl|my_center|LOCUS_04080 476606 475023 gene locus_tag LOCUS_04090 476606 475023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 477286 476615 gene locus_tag LOCUS_04100 gene rpe 477286 476615 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_04100 477849 477295 gene locus_tag LOCUS_04110 gene hxlB 477849 477295 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246343.1 protein_id gnl|my_center|LOCUS_04110 478424 477861 gene locus_tag LOCUS_04120 478424 477861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 478485 478667 gene locus_tag LOCUS_04130 478485 478667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 480018 479221 gene locus_tag LOCUS_04140 gene rfbA 480018 479221 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721498.1 protein_id gnl|my_center|LOCUS_04140 480138 481592 gene locus_tag LOCUS_04150 480138 481592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 481664 482383 gene locus_tag LOCUS_04160 481664 482383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 483437 482487 gene locus_tag LOCUS_04170 483437 482487 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_04170 484624 483434 gene locus_tag LOCUS_04180 484624 483434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 485949 484636 gene locus_tag LOCUS_04190 485949 484636 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305385.1 protein_id gnl|my_center|LOCUS_04190 487466 485949 gene locus_tag LOCUS_04200 gene gltX 487466 485949 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964308.1 protein_id gnl|my_center|LOCUS_04200 488849 488286 gene locus_tag LOCUS_04210 gene thpR 488849 488286 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545374.1 protein_id gnl|my_center|LOCUS_04210 490020 488938 gene locus_tag LOCUS_04220 gene dnaJ 490020 488938 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454751.1 protein_id gnl|my_center|LOCUS_04220 492144 490216 gene locus_tag LOCUS_04230 492144 490216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 492802 492338 gene locus_tag LOCUS_04240 492802 492338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 493420 495064 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atctacaaaagtagaaattgtgtaggtcttattgcg 495548 495267 gene locus_tag LOCUS_04250 495548 495267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 496525 495554 gene locus_tag LOCUS_04260 496525 495554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 497116 496541 gene locus_tag LOCUS_04270 gene cas4 497116 496541 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114935545.1 protein_id gnl|my_center|LOCUS_04270 501229 497117 gene locus_tag LOCUS_04280 501229 497117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 502589 501546 gene locus_tag LOCUS_04290 gene mltG 502589 501546 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257814.1 protein_id gnl|my_center|LOCUS_04290 503071 502631 gene locus_tag LOCUS_04300 503071 502631 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933077.1 protein_id gnl|my_center|LOCUS_04300 503433 503119 gene locus_tag LOCUS_04310 gene trxA 503433 503119 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405369.1 protein_id gnl|my_center|LOCUS_04310 503750 503481 gene locus_tag LOCUS_04320 503750 503481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 505744 503861 gene locus_tag LOCUS_04330 gene lepA 505744 503861 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258913.1 protein_id gnl|my_center|LOCUS_04330 507499 505856 gene locus_tag LOCUS_04340 gene murJ 507499 505856 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403539.1 protein_id gnl|my_center|LOCUS_04340 509418 507532 gene locus_tag LOCUS_04350 509418 507532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 509498 509680 gene locus_tag LOCUS_04360 509498 509680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 511164 509980 gene locus_tag LOCUS_04370 511164 509980 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257578.1 protein_id gnl|my_center|LOCUS_04370 511886 511161 gene locus_tag LOCUS_04380 511886 511161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 512852 511947 gene locus_tag LOCUS_04390 gene galU 512852 511947 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583975.1 protein_id gnl|my_center|LOCUS_04390 514145 512901 gene locus_tag LOCUS_04400 514145 512901 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880274.1 protein_id gnl|my_center|LOCUS_04400 514779 514273 gene locus_tag LOCUS_04410 gene rpsI 514779 514273 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393901.1 protein_id gnl|my_center|LOCUS_04410 515199 514795 gene locus_tag LOCUS_04420 gene rplM 515199 514795 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421107.1 protein_id gnl|my_center|LOCUS_04420 515575 515204 gene locus_tag LOCUS_04430 gene rplQ 515575 515204 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641268.1 protein_id gnl|my_center|LOCUS_04430 516508 515600 gene locus_tag LOCUS_04440 516508 515600 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 protein_id gnl|my_center|LOCUS_04440 517160 516624 gene locus_tag LOCUS_04450 gene rpsD 517160 516624 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_04450 517769 517299 gene locus_tag LOCUS_04460 gene rpsK 517769 517299 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557092.1 protein_id gnl|my_center|LOCUS_04460 518269 517880 gene locus_tag LOCUS_04470 gene rpsM 518269 517880 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966388.1 protein_id gnl|my_center|LOCUS_04470 518714 518487 gene locus_tag LOCUS_04480 gene infA 518714 518487 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393913.1 protein_id gnl|my_center|LOCUS_04480 519970 519032 gene locus_tag LOCUS_04490 519970 519032 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_04490 521446 520019 gene locus_tag LOCUS_04500 521446 520019 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583255.1 protein_id gnl|my_center|LOCUS_04500 524590 522212 gene locus_tag LOCUS_04510 gene pheT 524590 522212 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_04510 525705 524644 gene locus_tag LOCUS_04520 gene pheS 525705 524644 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942166.1 protein_id gnl|my_center|LOCUS_04520 526136 525768 gene locus_tag LOCUS_04530 526136 525768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 527862 526156 gene locus_tag LOCUS_04540 527862 526156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 528579 527956 gene locus_tag LOCUS_04550 528579 527956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 529541 528696 gene locus_tag LOCUS_04560 529541 528696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 530774 529599 gene locus_tag LOCUS_04570 gene tyrS 530774 529599 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081488.1 protein_id gnl|my_center|LOCUS_04570 531135 530797 gene locus_tag LOCUS_04580 531135 530797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 532450 531311 gene locus_tag LOCUS_04590 gene secF 532450 531311 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016589.1 protein_id gnl|my_center|LOCUS_04590 534147 532447 gene locus_tag LOCUS_04600 534147 532447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 535665 535144 gene locus_tag LOCUS_04610 535665 535144 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761848.1 protein_id gnl|my_center|LOCUS_04610 536383 535667 gene locus_tag LOCUS_04620 536383 535667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 537862 536627 gene locus_tag LOCUS_04630 537862 536627 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937699.1 protein_id gnl|my_center|LOCUS_04630 539119 537866 gene locus_tag LOCUS_04640 539119 537866 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_04640 540496 539249 gene locus_tag LOCUS_04650 540496 539249 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583204.1 protein_id gnl|my_center|LOCUS_04650 542265 540520 gene locus_tag LOCUS_04660 542265 540520 CDS product cytochrome c biogenesis protein DipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040121148.1 protein_id gnl|my_center|LOCUS_04660 542867 542271 gene locus_tag LOCUS_04670 542867 542271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 543474 543103 gene locus_tag LOCUS_04680 543474 543103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 543695 543492 gene locus_tag LOCUS_04690 543695 543492 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250290.1 protein_id gnl|my_center|LOCUS_04690 544590 543877 gene locus_tag LOCUS_04700 gene uppS 544590 543877 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250124.1 protein_id gnl|my_center|LOCUS_04700 545681 544611 gene locus_tag LOCUS_04710 gene idsA 545681 544611 CDS product geranylgeranyl pyrophosphate synthase IdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856555.1 protein_id gnl|my_center|LOCUS_04710 545670 545906 gene locus_tag LOCUS_04720 545670 545906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 546044 546694 gene locus_tag LOCUS_04730 546044 546694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 547320 546916 gene locus_tag LOCUS_04740 547320 546916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 548390 547371 gene locus_tag LOCUS_04750 548390 547371 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057962.1 protein_id gnl|my_center|LOCUS_04750 548773 548393 gene locus_tag LOCUS_04760 548773 548393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 550005 548872 gene locus_tag LOCUS_04770 gene rmuC 550005 548872 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946690.1 protein_id gnl|my_center|LOCUS_04770 550618 550016 gene locus_tag LOCUS_04780 550618 550016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 550766 553156 gene locus_tag LOCUS_04790 550766 553156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 554344 553241 gene locus_tag LOCUS_04800 554344 553241 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966352.1 protein_id gnl|my_center|LOCUS_04800 554674 554369 gene locus_tag LOCUS_04810 554674 554369 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198632.1 protein_id gnl|my_center|LOCUS_04810 555171 554857 gene locus_tag LOCUS_04820 gene rplU 555171 554857 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419082.1 protein_id gnl|my_center|LOCUS_04820 557105 555225 gene locus_tag LOCUS_04830 557105 555225 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_04830 557384 557133 gene locus_tag LOCUS_04840 557384 557133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 557860 557477 gene locus_tag LOCUS_04850 557860 557477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 560039 557877 gene locus_tag LOCUS_04860 560039 557877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 561330 560074 gene locus_tag LOCUS_04870 561330 560074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 562432 561407 gene locus_tag LOCUS_04880 562432 561407 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020716.1 protein_id gnl|my_center|LOCUS_04880 563763 562480 gene locus_tag LOCUS_04890 gene eno 563763 562480 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080719.1 protein_id gnl|my_center|LOCUS_04890 566031 565468 gene locus_tag LOCUS_04900 566031 565468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 566584 566204 gene locus_tag LOCUS_04910 566584 566204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 567974 566685 gene locus_tag LOCUS_04920 567974 566685 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548990.1 protein_id gnl|my_center|LOCUS_04920 569703 568018 gene locus_tag LOCUS_04930 569703 568018 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392356.1 protein_id gnl|my_center|LOCUS_04930 570151 569849 gene locus_tag LOCUS_04940 570151 569849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 571279 570323 gene locus_tag LOCUS_04950 gene rsmH 571279 570323 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943702.1 protein_id gnl|my_center|LOCUS_04950 571758 571324 gene locus_tag LOCUS_04960 gene mraZ 571758 571324 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286645.1 protein_id gnl|my_center|LOCUS_04960 573464 572085 gene locus_tag LOCUS_04970 573464 572085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 573896 573579 gene locus_tag LOCUS_04980 573896 573579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 575246 573987 gene locus_tag LOCUS_04990 575246 573987 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562821.1 protein_id gnl|my_center|LOCUS_04990 575844 575257 gene locus_tag LOCUS_05000 575844 575257 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880387.1 protein_id gnl|my_center|LOCUS_05000 576626 575844 gene locus_tag LOCUS_05010 gene xth 576626 575844 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_05010 578328 577189 gene locus_tag LOCUS_05020 578328 577189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 579270 578332 gene locus_tag LOCUS_05030 gene rlmN 579270 578332 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583788.1 protein_id gnl|my_center|LOCUS_05030 580753 580445 gene locus_tag LOCUS_05040 580753 580445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 581464 580814 gene locus_tag LOCUS_05050 gene lexA 581464 580814 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908066.1 protein_id gnl|my_center|LOCUS_05050 583852 581669 gene locus_tag LOCUS_05060 583852 581669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 584241 583981 gene locus_tag LOCUS_05070 584241 583981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 585002 584535 gene locus_tag LOCUS_05080 585002 584535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 585728 585135 gene locus_tag LOCUS_05090 585728 585135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 587214 586774 gene locus_tag LOCUS_05100 587214 586774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 587486 587274 gene locus_tag LOCUS_05110 587486 587274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 588999 587589 gene locus_tag LOCUS_r00020 588999 587589 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 589859 589353 gene locus_tag LOCUS_05120 589859 589353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 589983 591470 gene locus_tag LOCUS_05130 589983 591470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 592553 591510 gene locus_tag LOCUS_05140 592553 591510 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272149.1 protein_id gnl|my_center|LOCUS_05140 593850 592723 gene locus_tag LOCUS_05150 gene mraY 593850 592723 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256653.1 protein_id gnl|my_center|LOCUS_05150 594888 593890 gene locus_tag LOCUS_05160 594888 593890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 595532 594942 gene locus_tag LOCUS_05170 gene scpB 595532 594942 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259764.1 protein_id gnl|my_center|LOCUS_05170 596214 595540 gene locus_tag LOCUS_05180 596214 595540 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259072.1 protein_id gnl|my_center|LOCUS_05180 597383 596568 gene locus_tag LOCUS_05190 597383 596568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 598297 597380 gene locus_tag LOCUS_05200 598297 597380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 599356 598649 gene locus_tag LOCUS_05210 gene rplA 599356 598649 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167141.1 protein_id gnl|my_center|LOCUS_05210 599825 599403 gene locus_tag LOCUS_05220 gene rplK 599825 599403 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811655.1 protein_id gnl|my_center|LOCUS_05220 600487 599942 gene locus_tag LOCUS_05230 gene nusG 600487 599942 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393950.1 protein_id gnl|my_center|LOCUS_05230 600700 600512 gene locus_tag LOCUS_05240 600700 600512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 601414 600884 gene locus_tag LOCUS_05250 601414 600884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 602889 601432 gene locus_tag LOCUS_05260 gene gatA 602889 601432 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812377.1 protein_id gnl|my_center|LOCUS_05260 603178 602891 gene locus_tag LOCUS_05270 gene gatC 603178 602891 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257310.1 protein_id gnl|my_center|LOCUS_05270 605289 603190 gene locus_tag LOCUS_05280 gene ligA 605289 603190 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989804.1 protein_id gnl|my_center|LOCUS_05280 605874 605389 gene locus_tag LOCUS_05290 605874 605389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 606465 605965 gene locus_tag LOCUS_05300 606465 605965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 607125 606589 gene locus_tag LOCUS_05310 607125 606589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 608058 607252 gene locus_tag LOCUS_05320 608058 607252 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142428.1 protein_id gnl|my_center|LOCUS_05320 608617 608204 gene locus_tag LOCUS_05330 608617 608204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 609110 608694 gene locus_tag LOCUS_05340 609110 608694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 610394 609183 gene locus_tag LOCUS_05350 610394 609183 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393061.1 protein_id gnl|my_center|LOCUS_05350 611719 610640 gene locus_tag LOCUS_05360 611719 610640 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386380.1 protein_id gnl|my_center|LOCUS_05360 612211 611795 gene locus_tag LOCUS_05370 612211 611795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 613912 612245 gene locus_tag LOCUS_05380 613912 612245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 614807 613974 gene locus_tag LOCUS_05390 614807 613974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 615416 614889 gene locus_tag LOCUS_05400 615416 614889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 616567 615500 gene locus_tag LOCUS_05410 gene pilM 616567 615500 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393054.1 protein_id gnl|my_center|LOCUS_05410 616757 619261 gene locus_tag LOCUS_05420 616757 619261 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966466.1 protein_id gnl|my_center|LOCUS_05420 619617 619390 gene locus_tag LOCUS_05430 619617 619390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 620678 621406 gene locus_tag LOCUS_05440 620678 621406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 622364 621411 gene locus_tag LOCUS_05450 622364 621411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 623536 622361 gene locus_tag LOCUS_05460 623536 622361 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021207.1 protein_id gnl|my_center|LOCUS_05460 624856 623546 gene locus_tag LOCUS_05470 624856 623546 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203517.1 protein_id gnl|my_center|LOCUS_05470 625791 624880 gene locus_tag LOCUS_05480 625791 624880 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021208.1 protein_id gnl|my_center|LOCUS_05480 625966 625778 gene locus_tag LOCUS_05490 625966 625778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 628088 626181 gene locus_tag LOCUS_05500 gene dnaK 628088 626181 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_05500 628590 628186 gene locus_tag LOCUS_05510 628590 628186 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_05510 629577 628660 gene locus_tag LOCUS_05520 629577 628660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 630336 629590 gene locus_tag LOCUS_05530 630336 629590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 630479 631057 gene locus_tag LOCUS_05540 gene rfaE2 630479 631057 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896999.1 protein_id gnl|my_center|LOCUS_05540 631153 631644 gene locus_tag LOCUS_05550 631153 631644 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870448.1 protein_id gnl|my_center|LOCUS_05550 631970 632878 gene locus_tag LOCUS_05560 631970 632878 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939248.1 protein_id gnl|my_center|LOCUS_05560 633017 633382 gene locus_tag LOCUS_05570 633017 633382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 633398 633784 gene locus_tag LOCUS_05580 633398 633784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 633809 634786 gene locus_tag LOCUS_05590 633809 634786 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966047.1 protein_id gnl|my_center|LOCUS_05590 634885 634730 gene locus_tag LOCUS_05600 634885 634730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 634884 635699 gene locus_tag LOCUS_05610 634884 635699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 636531 635959 gene locus_tag LOCUS_05620 636531 635959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 638241 636649 gene locus_tag LOCUS_05630 638241 636649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 638857 638222 gene locus_tag LOCUS_05640 638857 638222 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140612.1 protein_id gnl|my_center|LOCUS_05640 639678 638947 gene locus_tag LOCUS_05650 639678 638947 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049748363.1 protein_id gnl|my_center|LOCUS_05650 640124 639690 gene locus_tag LOCUS_05660 640124 639690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 641443 640436 gene locus_tag LOCUS_05670 641443 640436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 642026 641601 gene locus_tag LOCUS_05680 gene rplL 642026 641601 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707747.1 protein_id gnl|my_center|LOCUS_05680 642575 642060 gene locus_tag LOCUS_05690 gene rplJ 642575 642060 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215373.1 protein_id gnl|my_center|LOCUS_05690 643361 642996 gene locus_tag LOCUS_05700 643361 642996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 644011 645507 gene locus_tag LOCUS_05710 644011 645507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 645482 646006 gene locus_tag LOCUS_05720 gene def 645482 646006 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948295.1 protein_id gnl|my_center|LOCUS_05720 646261 647220 gene locus_tag LOCUS_05730 gene fmt 646261 647220 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_05730 647228 648064 gene locus_tag LOCUS_05740 647228 648064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 648453 648166 gene locus_tag LOCUS_05750 gene groES 648453 648166 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233675.1 protein_id gnl|my_center|LOCUS_05750 649733 648546 gene locus_tag LOCUS_05760 649733 648546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 650437 649817 gene locus_tag LOCUS_05770 650437 649817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 652421 650724 gene locus_tag LOCUS_05780 652421 650724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 653178 652534 gene locus_tag LOCUS_05790 653178 652534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 655105 653606 gene locus_tag LOCUS_05800 655105 653606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 656957 655257 gene locus_tag LOCUS_05810 656957 655257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 657372 657106 gene locus_tag LOCUS_05820 657372 657106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 657478 658734 gene locus_tag LOCUS_05830 657478 658734 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_05830 658801 658875 gene locus_tag LOCUS_t00120 658801 658875 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 660538 658835 gene locus_tag LOCUS_05840 660538 658835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 660772 660548 gene locus_tag LOCUS_05850 660772 660548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 661641 660940 gene locus_tag LOCUS_05860 661641 660940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 662798 661689 gene locus_tag LOCUS_05870 662798 661689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 665781 662971 gene locus_tag LOCUS_05880 665781 662971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 666123 667463 gene locus_tag LOCUS_05890 666123 667463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 667871 667530 gene locus_tag LOCUS_05900 667871 667530 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027987.1 protein_id gnl|my_center|LOCUS_05900 668324 668079 gene locus_tag LOCUS_05910 668324 668079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 668869 669099 gene locus_tag LOCUS_05920 668869 669099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 669051 669356 gene locus_tag LOCUS_05930 669051 669356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 669457 670572 gene locus_tag LOCUS_05940 gene tsaD 669457 670572 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731954.1 protein_id gnl|my_center|LOCUS_05940 670606 673227 gene locus_tag LOCUS_05950 670606 673227 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258507.1 protein_id gnl|my_center|LOCUS_05950 673224 673733 gene locus_tag LOCUS_05960 673224 673733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 673819 674373 gene locus_tag LOCUS_05970 673819 674373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 675220 674945 gene locus_tag LOCUS_05980 675220 674945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 675137 675766 gene locus_tag LOCUS_05990 675137 675766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 675852 675927 gene locus_tag LOCUS_t00130 675852 675927 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 676013 676085 gene locus_tag LOCUS_t00140 676013 676085 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 676163 676236 gene locus_tag LOCUS_t00150 676163 676236 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 677051 676320 gene locus_tag LOCUS_06000 677051 676320 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932971.1 protein_id gnl|my_center|LOCUS_06000 677720 677073 gene locus_tag LOCUS_06010 677720 677073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 678187 677738 gene locus_tag LOCUS_06020 678187 677738 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128238.1 protein_id gnl|my_center|LOCUS_06020 678714 678211 gene locus_tag LOCUS_06030 678714 678211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 679306 678731 gene locus_tag LOCUS_06040 679306 678731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 679707 679315 gene locus_tag LOCUS_06050 679707 679315 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890780.1 protein_id gnl|my_center|LOCUS_06050 679828 680244 gene locus_tag LOCUS_06060 679828 680244 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261949.1 protein_id gnl|my_center|LOCUS_06060 680241 680789 gene locus_tag LOCUS_06070 680241 680789 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251061.1 protein_id gnl|my_center|LOCUS_06070 682066 680798 gene locus_tag LOCUS_06080 682066 680798 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 protein_id gnl|my_center|LOCUS_06080 682705 682079 gene locus_tag LOCUS_06090 682705 682079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 683629 682790 gene locus_tag LOCUS_06100 683629 682790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 683891 683634 gene locus_tag LOCUS_06110 683891 683634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 684082 683891 gene locus_tag LOCUS_06120 684082 683891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 684988 684191 gene locus_tag LOCUS_06130 684988 684191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 685491 685225 gene locus_tag LOCUS_06140 685491 685225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 686522 685788 gene locus_tag LOCUS_06150 686522 685788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 688015 686636 gene locus_tag LOCUS_06160 gene scfB 688015 686636 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_06160 688717 688316 gene locus_tag LOCUS_06170 688717 688316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 689186 689110 gene locus_tag LOCUS_t00160 689186 689110 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 689295 689219 gene locus_tag LOCUS_t00170 689295 689219 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 689771 689439 gene locus_tag LOCUS_06180 689771 689439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 691406 689799 gene locus_tag LOCUS_06190 691406 689799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 693189 691483 gene locus_tag LOCUS_06200 693189 691483 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444571.1 protein_id gnl|my_center|LOCUS_06200 693510 693436 gene locus_tag LOCUS_t00180 693510 693436 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 693947 693873 gene locus_tag LOCUS_t00190 693947 693873 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 694685 694014 gene locus_tag LOCUS_06210 694685 694014 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948163.1 protein_id gnl|my_center|LOCUS_06210 694908 694833 gene locus_tag LOCUS_t00200 694908 694833 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 695945 695160 gene locus_tag LOCUS_06220 695945 695160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 696511 696191 gene locus_tag LOCUS_06230 696511 696191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 697292 696528 gene locus_tag LOCUS_06240 697292 696528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 697915 697343 gene locus_tag LOCUS_06250 697915 697343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 698993 697899 gene locus_tag LOCUS_06260 gene pilM 698993 697899 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887416.1 protein_id gnl|my_center|LOCUS_06260 700406 699036 gene locus_tag LOCUS_06270 700406 699036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 701094 700483 gene locus_tag LOCUS_06280 701094 700483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 702518 701142 gene locus_tag LOCUS_06290 702518 701142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 703767 702544 gene locus_tag LOCUS_06300 703767 702544 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228203.1 protein_id gnl|my_center|LOCUS_06300 704846 703794 gene locus_tag LOCUS_06310 gene msrB 704846 703794 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262910.1 protein_id gnl|my_center|LOCUS_06310 707410 705005 gene locus_tag LOCUS_06320 707410 705005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 708257 707592 gene locus_tag LOCUS_06330 708257 707592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 709254 708319 gene locus_tag LOCUS_06340 709254 708319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 712192 709268 gene locus_tag LOCUS_06350 gene uvrA 712192 709268 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436266.1 protein_id gnl|my_center|LOCUS_06350 712390 713091 gene locus_tag LOCUS_06360 712390 713091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 713605 713219 gene locus_tag LOCUS_06370 713605 713219 CDS product pyrimidine dimer DNA glycosylase/endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065892.1 protein_id gnl|my_center|LOCUS_06370 714377 713610 gene locus_tag LOCUS_06380 714377 713610 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_06380 714772 714374 gene locus_tag LOCUS_06390 714772 714374 CDS product DUF2177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009912062.1 protein_id gnl|my_center|LOCUS_06390 715424 714786 gene locus_tag LOCUS_06400 715424 714786 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920406.1 protein_id gnl|my_center|LOCUS_06400 715833 715429 gene locus_tag LOCUS_06410 715833 715429 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123177.1 protein_id gnl|my_center|LOCUS_06410 716579 716106 gene locus_tag LOCUS_06420 716579 716106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405426.1 protein_id gnl|my_center|LOCUS_06420 717089 716886 gene locus_tag LOCUS_06430 717089 716886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 717883 717116 gene locus_tag LOCUS_06440 717883 717116 CDS product type-2 restriction enzyme DpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418960.1 protein_id gnl|my_center|LOCUS_06440 718113 717901 gene locus_tag LOCUS_06450 718113 717901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 718322 718116 gene locus_tag LOCUS_06460 718322 718116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 718816 718729 gene locus_tag LOCUS_t00210 718816 718729 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 719074 719493 gene locus_tag LOCUS_06470 719074 719493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 720672 719596 gene locus_tag LOCUS_06480 720672 719596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 721109 720879 gene locus_tag LOCUS_06490 721109 720879 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381996.1 protein_id gnl|my_center|LOCUS_06490 722146 721289 gene locus_tag LOCUS_06500 722146 721289 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228861.1 protein_id gnl|my_center|LOCUS_06500 722266 722177 gene locus_tag LOCUS_t00220 722266 722177 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 722530 722859 gene locus_tag LOCUS_06510 722530 722859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 722870 722943 gene locus_tag LOCUS_t00230 722870 722943 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 723442 723026 gene locus_tag LOCUS_06520 723442 723026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 725526 723652 gene locus_tag LOCUS_06530 725526 723652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 725746 726006 gene locus_tag LOCUS_06540 725746 726006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06540 726843 726373 gene locus_tag LOCUS_06550 726843 726373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 727009 729093 gene locus_tag LOCUS_06560 gene recG 727009 729093 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056582.1 protein_id gnl|my_center|LOCUS_06560 730662 729352 gene locus_tag LOCUS_06570 730662 729352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 730962 730762 gene locus_tag LOCUS_06580 730962 730762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 731355 731074 gene locus_tag LOCUS_06590 731355 731074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 733353 731563 gene locus_tag LOCUS_06600 gene typA 733353 731563 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790221.1 protein_id gnl|my_center|LOCUS_06600 734157 733759 gene locus_tag LOCUS_06610 734157 733759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 735870 734176 gene locus_tag LOCUS_06620 735870 734176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 737435 735885 gene locus_tag LOCUS_06630 737435 735885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 739745 737493 gene locus_tag LOCUS_06640 739745 737493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 740678 739767 gene locus_tag LOCUS_06650 740678 739767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 746623 740687 gene locus_tag LOCUS_06660 746623 740687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 746818 747264 gene locus_tag LOCUS_06670 gene smpB 746818 747264 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943280.1 protein_id gnl|my_center|LOCUS_06670 747983 748405 gene locus_tag LOCUS_06680 gene infC 747983 748405 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881156.1 protein_id gnl|my_center|LOCUS_06680 748417 748611 gene locus_tag LOCUS_06690 748417 748611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 748637 748981 gene locus_tag LOCUS_06700 gene rplT 748637 748981 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131615061.1 protein_id gnl|my_center|LOCUS_06700 749723 749292 gene locus_tag LOCUS_06710 749723 749292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 750809 750075 gene locus_tag LOCUS_06720 750809 750075 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963586.1 protein_id gnl|my_center|LOCUS_06720 751812 750841 gene locus_tag LOCUS_06730 751812 750841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 752855 751860 gene locus_tag LOCUS_06740 752855 751860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 753538 752969 gene locus_tag LOCUS_06750 753538 752969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 754724 753675 gene locus_tag LOCUS_06760 754724 753675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 755142 754741 gene locus_tag LOCUS_06770 755142 754741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 755853 755161 gene locus_tag LOCUS_06780 gene lgt 755853 755161 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932768.1 protein_id gnl|my_center|LOCUS_06780 757004 756006 gene locus_tag LOCUS_06790 757004 756006 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064122.1 protein_id gnl|my_center|LOCUS_06790 758164 757103 gene locus_tag LOCUS_06800 758164 757103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 758223 759200 gene locus_tag LOCUS_06810 758223 759200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 760323 759241 gene locus_tag LOCUS_06820 gene mnmA 760323 759241 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657419.1 protein_id gnl|my_center|LOCUS_06820 761535 760564 gene locus_tag LOCUS_06830 761535 760564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 761878 761516 gene locus_tag LOCUS_06840 761878 761516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 763304 762033 gene locus_tag LOCUS_06850 763304 762033 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099579.1 protein_id gnl|my_center|LOCUS_06850 764881 763610 gene locus_tag LOCUS_06860 764881 763610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 766326 765310 gene locus_tag LOCUS_06870 gene obgE 766326 765310 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963487.1 protein_id gnl|my_center|LOCUS_06870 766558 767100 gene locus_tag LOCUS_06880 766558 767100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 767598 767212 gene locus_tag LOCUS_06890 767598 767212 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940847.1 protein_id gnl|my_center|LOCUS_06890 768449 769072 gene locus_tag LOCUS_06900 768449 769072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 769797 769126 gene locus_tag LOCUS_06910 769797 769126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 770443 769811 gene locus_tag LOCUS_06920 770443 769811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 771508 770501 gene locus_tag LOCUS_06930 771508 770501 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183783.1 protein_id gnl|my_center|LOCUS_06930 772347 771610 gene locus_tag LOCUS_06940 772347 771610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 773368 772907 gene locus_tag LOCUS_06950 773368 772907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 774022 773537 gene locus_tag LOCUS_06960 774022 773537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 775527 774043 gene locus_tag LOCUS_06970 775527 774043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 775960 775583 gene locus_tag LOCUS_06980 775960 775583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 776528 775974 gene locus_tag LOCUS_06990 776528 775974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 778022 776544 gene locus_tag LOCUS_07000 778022 776544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 778796 778050 gene locus_tag LOCUS_07010 778796 778050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 779360 778821 gene locus_tag LOCUS_07020 779360 778821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 780395 779538 gene locus_tag LOCUS_07030 780395 779538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 783526 780392 gene locus_tag LOCUS_07040 gene ileS 783526 780392 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962393.1 protein_id gnl|my_center|LOCUS_07040 785143 784574 gene locus_tag LOCUS_07050 gene cobC 785143 784574 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_07050 785400 785325 gene locus_tag LOCUS_t00240 785400 785325 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 785540 785469 gene locus_tag LOCUS_t00250 785540 785469 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 785828 785755 gene locus_tag LOCUS_t00260 785828 785755 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 786259 785819 gene locus_tag LOCUS_07060 786259 785819 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485767.1 protein_id gnl|my_center|LOCUS_07060 786370 786287 gene locus_tag LOCUS_t00270 786370 786287 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 786642 786568 gene locus_tag LOCUS_t00280 786642 786568 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 787655 786687 gene locus_tag LOCUS_07070 787655 786687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 788332 787742 gene locus_tag LOCUS_07080 gene tsf 788332 787742 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228249.1 protein_id gnl|my_center|LOCUS_07080 789230 788406 gene locus_tag LOCUS_07090 gene rpsB 789230 788406 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424537.1 protein_id gnl|my_center|LOCUS_07090 789485 789793 gene locus_tag LOCUS_07100 gene rpmE 789485 789793 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328932.1 protein_id gnl|my_center|LOCUS_07100 789925 791019 gene locus_tag LOCUS_07110 gene prfA 789925 791019 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_07110 791052 791987 gene locus_tag LOCUS_07120 gene prmC 791052 791987 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267061.1 protein_id gnl|my_center|LOCUS_07120 792233 792048 gene locus_tag LOCUS_07130 792233 792048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 792454 793926 gene locus_tag LOCUS_07140 gene cysS 792454 793926 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228277.1 protein_id gnl|my_center|LOCUS_07140 794375 795736 gene locus_tag LOCUS_07150 gene dnaB 794375 795736 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256839.1 protein_id gnl|my_center|LOCUS_07150 795873 796469 gene locus_tag LOCUS_07160 gene recR 795873 796469 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559169.1 protein_id gnl|my_center|LOCUS_07160 798831 796486 gene locus_tag LOCUS_07170 798831 796486 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714164.1 protein_id gnl|my_center|LOCUS_07170 800242 798842 gene locus_tag LOCUS_07180 800242 798842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 800930 801685 gene locus_tag LOCUS_07190 800930 801685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 801692 802354 gene locus_tag LOCUS_07200 801692 802354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 802439 804112 gene locus_tag LOCUS_07210 gene dnaX 802439 804112 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660459.1 protein_id gnl|my_center|LOCUS_07210 804187 804259 gene locus_tag LOCUS_t00290 804187 804259 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 804270 804896 gene locus_tag LOCUS_07220 804270 804896 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547369.1 protein_id gnl|my_center|LOCUS_07220 804993 805523 gene locus_tag LOCUS_07230 804993 805523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 805756 806253 gene locus_tag LOCUS_07240 805756 806253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 807006 807650 gene locus_tag LOCUS_07250 807006 807650 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025687389.1 protein_id gnl|my_center|LOCUS_07250 808907 807654 gene locus_tag LOCUS_07260 808907 807654 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460214.1 protein_id gnl|my_center|LOCUS_07260 809108 809824 gene locus_tag LOCUS_07270 809108 809824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07270 809869 810219 gene locus_tag LOCUS_07280 809869 810219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 810254 812428 gene locus_tag LOCUS_07290 gene topA 810254 812428 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958589.1 protein_id gnl|my_center|LOCUS_07290 813425 812433 gene locus_tag LOCUS_07300 813425 812433 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930706.1 protein_id gnl|my_center|LOCUS_07300 814319 815806 gene locus_tag LOCUS_07310 814319 815806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 817694 816036 gene locus_tag LOCUS_07320 gene groL 817694 816036 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965990.1 protein_id gnl|my_center|LOCUS_07320 818091 817858 gene locus_tag LOCUS_07330 818091 817858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 818311 818129 gene locus_tag LOCUS_07340 818311 818129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 819202 818585 gene locus_tag LOCUS_07350 819202 818585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 820490 819441 gene locus_tag LOCUS_07360 gene ychF 820490 819441 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036111.1 protein_id gnl|my_center|LOCUS_07360 821033 820566 gene locus_tag LOCUS_07370 821033 820566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 821597 821067 gene locus_tag LOCUS_07380 821597 821067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 821681 823018 gene locus_tag LOCUS_07390 821681 823018 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_07390 823024 823440 gene locus_tag LOCUS_07400 823024 823440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 823437 823841 gene locus_tag LOCUS_07410 823437 823841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07410 823777 824406 gene locus_tag LOCUS_07420 823777 824406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07420 825163 824765 gene locus_tag LOCUS_07430 825163 824765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 826197 825199 gene locus_tag LOCUS_07440 gene trpS 826197 825199 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454934.1 protein_id gnl|my_center|LOCUS_07440 827541 826267 gene locus_tag LOCUS_07450 827541 826267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 829206 827581 gene locus_tag LOCUS_07460 829206 827581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 830831 829203 gene locus_tag LOCUS_07470 830831 829203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 831984 830797 gene locus_tag LOCUS_07480 831984 830797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 832708 831989 gene locus_tag LOCUS_07490 832708 831989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 833472 832705 gene locus_tag LOCUS_07500 833472 832705 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933740.1 protein_id gnl|my_center|LOCUS_07500 833997 833488 gene locus_tag LOCUS_07510 833997 833488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 834829 834014 gene locus_tag LOCUS_07520 834829 834014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 835739 834843 gene locus_tag LOCUS_07530 835739 834843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 840544 835736 gene locus_tag LOCUS_07540 840544 835736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 841380 840727 gene locus_tag LOCUS_07550 841380 840727 CDS product phosphatase PAP2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947360.1 protein_id gnl|my_center|LOCUS_07550 843404 841392 gene locus_tag LOCUS_07560 843404 841392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 845694 843340 gene locus_tag LOCUS_07570 845694 843340 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028834.1 protein_id gnl|my_center|LOCUS_07570 846759 845698 gene locus_tag LOCUS_07580 846759 845698 CDS product M57 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207667.1 protein_id gnl|my_center|LOCUS_07580 846961 847479 gene locus_tag LOCUS_07590 846961 847479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 847550 848926 gene locus_tag LOCUS_07600 847550 848926 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544964.1 protein_id gnl|my_center|LOCUS_07600 849914 849507 gene locus_tag LOCUS_07610 849914 849507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 850641 849898 gene locus_tag LOCUS_07620 850641 849898 CDS product DUF6390 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894094.1 protein_id gnl|my_center|LOCUS_07620 851101 850736 gene locus_tag LOCUS_07630 851101 850736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 851511 851188 gene locus_tag LOCUS_07640 851511 851188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 852944 851508 gene locus_tag LOCUS_07650 852944 851508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 854951 853041 gene locus_tag LOCUS_07660 854951 853041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 857032 855173 gene locus_tag LOCUS_07670 857032 855173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 858332 857118 gene locus_tag LOCUS_07680 858332 857118 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809406.1 protein_id gnl|my_center|LOCUS_07680 859009 858329 gene locus_tag LOCUS_07690 859009 858329 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_07690 860187 859042 gene locus_tag LOCUS_07700 860187 859042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 860738 860211 gene locus_tag LOCUS_07710 860738 860211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 862344 860893 gene locus_tag LOCUS_07720 862344 860893 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193365310.1 protein_id gnl|my_center|LOCUS_07720 864390 862420 gene locus_tag LOCUS_07730 864390 862420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 865049 864522 gene locus_tag LOCUS_07740 865049 864522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 865145 865074 gene locus_tag LOCUS_t00300 865145 865074 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 865266 866720 gene locus_tag LOCUS_07750 865266 866720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 866843 868582 gene locus_tag LOCUS_07760 gene thrS 866843 868582 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257081.1 protein_id gnl|my_center|LOCUS_07760 868647 868922 gene locus_tag LOCUS_07770 868647 868922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 869922 868996 gene locus_tag LOCUS_07780 869922 868996 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888855.1 protein_id gnl|my_center|LOCUS_07780 872053 870050 gene locus_tag LOCUS_07790 872053 870050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 872244 872438 gene locus_tag LOCUS_07800 872244 872438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 874241 872535 gene locus_tag LOCUS_07810 874241 872535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 874883 874332 gene locus_tag LOCUS_07820 874883 874332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 875033 874962 gene locus_tag LOCUS_t00310 875033 874962 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 875815 875099 gene locus_tag LOCUS_07830 875815 875099 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918869.1 protein_id gnl|my_center|LOCUS_07830 875923 875852 gene locus_tag LOCUS_t00320 875923 875852 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 876440 876156 gene locus_tag LOCUS_07840 876440 876156 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421291.1 protein_id gnl|my_center|LOCUS_07840 878114 876582 gene locus_tag LOCUS_07850 gene rny 878114 876582 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_07850 878476 880047 gene locus_tag LOCUS_07860 gene gpmI 878476 880047 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541097.1 protein_id gnl|my_center|LOCUS_07860 880781 880191 gene locus_tag LOCUS_07870 gene clpP 880781 880191 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036184.1 protein_id gnl|my_center|LOCUS_07870 882236 880944 gene locus_tag LOCUS_07880 gene tig 882236 880944 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417090.1 protein_id gnl|my_center|LOCUS_07880 882755 882363 gene locus_tag LOCUS_07890 882755 882363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 883399 882863 gene locus_tag LOCUS_07900 883399 882863 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875902.1 protein_id gnl|my_center|LOCUS_07900 884944 883520 gene locus_tag LOCUS_07910 884944 883520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 885428 886195 gene locus_tag LOCUS_07920 885428 886195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 886195 887526 gene locus_tag LOCUS_07930 886195 887526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 888060 887593 gene locus_tag LOCUS_07940 888060 887593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 888986 888615 gene locus_tag LOCUS_07950 888986 888615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 889098 888922 gene locus_tag LOCUS_07960 889098 888922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 889857 889564 gene locus_tag LOCUS_07970 889857 889564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 890686 889880 gene locus_tag LOCUS_07980 890686 889880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 891262 890882 gene locus_tag LOCUS_07990 891262 890882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 891617 891348 gene locus_tag LOCUS_08000 891617 891348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 892360 891638 gene locus_tag LOCUS_08010 892360 891638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 893218 892388 gene locus_tag LOCUS_08020 893218 892388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 895445 894036 gene locus_tag LOCUS_08030 895445 894036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 896044 895499 gene locus_tag LOCUS_08040 896044 895499 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978770.1 protein_id gnl|my_center|LOCUS_08040 896380 896465 gene locus_tag LOCUS_t00330 896380 896465 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 896653 897117 gene locus_tag LOCUS_08050 896653 897117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 899116 899925 gene locus_tag LOCUS_08060 899116 899925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941627.1 protein_id gnl|my_center|LOCUS_08060 900209 900499 gene locus_tag LOCUS_08070 900209 900499 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030953.1 protein_id gnl|my_center|LOCUS_08070 900600 901538 gene locus_tag LOCUS_08080 900600 901538 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064623064.1 protein_id gnl|my_center|LOCUS_08080 902164 901628 gene locus_tag LOCUS_08090 902164 901628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 902876 902334 gene locus_tag LOCUS_08100 902876 902334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 903139 904914 gene locus_tag LOCUS_08110 gene infB 903139 904914 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965108.1 protein_id gnl|my_center|LOCUS_08110 904998 906623 gene locus_tag LOCUS_08120 904998 906623 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986767.1 protein_id gnl|my_center|LOCUS_08120 906926 906997 gene locus_tag LOCUS_t00340 906926 906997 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 907132 907458 gene locus_tag LOCUS_08130 907132 907458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 907470 907555 gene locus_tag LOCUS_t00350 907470 907555 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 908756 907722 gene locus_tag LOCUS_08140 908756 907722 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873440.1 protein_id gnl|my_center|LOCUS_08140 911818 908930 gene locus_tag LOCUS_08150 911818 908930 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224745.1 protein_id gnl|my_center|LOCUS_08150 912485 911910 gene locus_tag LOCUS_08160 912485 911910 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941819.1 protein_id gnl|my_center|LOCUS_08160 913222 912563 gene locus_tag LOCUS_08170 gene ahpC 913222 912563 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810052.1 protein_id gnl|my_center|LOCUS_08170 913341 914321 gene locus_tag LOCUS_08180 913341 914321 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256790.1 protein_id gnl|my_center|LOCUS_08180 914425 915798 gene locus_tag LOCUS_08190 914425 915798 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258702.1 protein_id gnl|my_center|LOCUS_08190 916648 916151 gene locus_tag LOCUS_08200 916648 916151 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902263.1 protein_id gnl|my_center|LOCUS_08200 917165 916884 gene locus_tag LOCUS_08210 gene rpsO 917165 916884 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948459.1 protein_id gnl|my_center|LOCUS_08210 919716 917251 gene locus_tag LOCUS_08220 gene gyrA 919716 917251 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257126.1 protein_id gnl|my_center|LOCUS_08220 920421 919939 gene locus_tag LOCUS_08230 920421 919939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 921232 920582 gene locus_tag LOCUS_08240 921232 920582 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257009.1 protein_id gnl|my_center|LOCUS_08240 921437 921901 gene locus_tag LOCUS_08250 921437 921901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 921968 922052 gene locus_tag LOCUS_t00360 921968 922052 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 922120 922196 gene locus_tag LOCUS_t00370 922120 922196 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 922273 922345 gene locus_tag LOCUS_t00380 922273 922345 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 922454 922526 gene locus_tag LOCUS_t00390 922454 922526 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 922680 922752 gene locus_tag LOCUS_t00400 922680 922752 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 923399 922971 gene locus_tag LOCUS_08260 923399 922971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 923698 923402 gene locus_tag LOCUS_08270 923698 923402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 924185 924586 gene locus_tag LOCUS_08280 924185 924586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 924871 925419 gene locus_tag LOCUS_08290 924871 925419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 925513 925586 gene locus_tag LOCUS_t00410 925513 925586 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 925610 925696 gene locus_tag LOCUS_t00420 925610 925696 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 925784 926035 gene locus_tag LOCUS_08300 925784 926035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 926923 926330 gene locus_tag LOCUS_08310 926923 926330 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583745.1 protein_id gnl|my_center|LOCUS_08310 928013 927045 gene locus_tag LOCUS_08320 928013 927045 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583572.1 protein_id gnl|my_center|LOCUS_08320 928372 928010 gene locus_tag LOCUS_08330 928372 928010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 928588 928516 gene locus_tag LOCUS_t00430 928588 928516 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 929288 928710 gene locus_tag LOCUS_08340 929288 928710 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234219.1 protein_id gnl|my_center|LOCUS_08340 929388 929315 gene locus_tag LOCUS_t00440 929388 929315 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 932052 933065 gene locus_tag LOCUS_08350 932052 933065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 933259 934236 gene locus_tag LOCUS_08360 933259 934236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 934576 934502 gene locus_tag LOCUS_t00450 934576 934502 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 935507 934593 gene locus_tag LOCUS_08370 935507 934593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 937489 935630 gene locus_tag LOCUS_08380 gene ftsH 937489 935630 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942598.1 protein_id gnl|my_center|LOCUS_08380 938589 937600 gene locus_tag LOCUS_08390 938589 937600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 939145 938582 gene locus_tag LOCUS_08400 gene gmk 939145 938582 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904066.1 protein_id gnl|my_center|LOCUS_08400 939691 939542 gene locus_tag LOCUS_08410 939691 939542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 941864 940017 gene locus_tag LOCUS_08420 gene glmS 941864 940017 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838750.1 protein_id gnl|my_center|LOCUS_08420 942035 942217 gene locus_tag LOCUS_08430 942035 942217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 942349 944493 gene locus_tag LOCUS_08440 942349 944493 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460388.1 protein_id gnl|my_center|LOCUS_08440 945361 946023 gene locus_tag LOCUS_08450 945361 946023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 946873 947274 gene locus_tag LOCUS_08460 946873 947274 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361979.1 protein_id gnl|my_center|LOCUS_08460 947341 947691 gene locus_tag LOCUS_08470 947341 947691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 948171 949697 gene locus_tag LOCUS_08480 948171 949697 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257250.1 protein_id gnl|my_center|LOCUS_08480 949957 950919 gene locus_tag LOCUS_08490 949957 950919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 950922 951743 gene locus_tag LOCUS_08500 gene rsmA 950922 951743 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216839.1 protein_id gnl|my_center|LOCUS_08500 953391 951754 gene locus_tag LOCUS_08510 953391 951754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 953456 955696 gene locus_tag LOCUS_08520 gene pcrA 953456 955696 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002319708.1 protein_id gnl|my_center|LOCUS_08520 956654 955728 gene locus_tag LOCUS_08530 gene xerC 956654 955728 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_08530 957066 958082 gene locus_tag LOCUS_08540 957066 958082 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832086.1 protein_id gnl|my_center|LOCUS_08540 958986 960833 gene locus_tag LOCUS_08550 958986 960833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 960869 962221 gene locus_tag LOCUS_08560 960869 962221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 962221 962700 gene locus_tag LOCUS_08570 962221 962700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 962820 963542 gene locus_tag LOCUS_08580 962820 963542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 963641 965461 gene locus_tag LOCUS_08590 963641 965461 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222039.1 protein_id gnl|my_center|LOCUS_08590 965523 966203 gene locus_tag LOCUS_08600 965523 966203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 966228 966929 gene locus_tag LOCUS_08610 966228 966929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 966926 969634 gene locus_tag LOCUS_08620 966926 969634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 970211 971119 gene locus_tag LOCUS_08630 970211 971119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 971124 972281 gene locus_tag LOCUS_08640 971124 972281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 972381 972878 gene locus_tag LOCUS_08650 972381 972878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 974697 973750 gene locus_tag LOCUS_08660 974697 973750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 975809 974997 gene locus_tag LOCUS_08670 975809 974997 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202149.1 protein_id gnl|my_center|LOCUS_08670 976668 975799 gene locus_tag LOCUS_08680 976668 975799 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259591.1 protein_id gnl|my_center|LOCUS_08680 978122 976665 gene locus_tag LOCUS_08690 978122 976665 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875981.1 protein_id gnl|my_center|LOCUS_08690 978795 978319 gene locus_tag LOCUS_08700 978795 978319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 979714 978923 gene locus_tag LOCUS_08710 979714 978923 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429300.1 protein_id gnl|my_center|LOCUS_08710 979842 980057 gene locus_tag LOCUS_08720 979842 980057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 980486 982048 gene locus_tag LOCUS_08730 980486 982048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 982130 983269 gene locus_tag LOCUS_08740 gene dnaN 982130 983269 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258498.1 protein_id gnl|my_center|LOCUS_08740 983274 983588 gene locus_tag LOCUS_08750 983274 983588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 983615 984865 gene locus_tag LOCUS_08760 983615 984865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 984930 985232 gene locus_tag LOCUS_08770 984930 985232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 985347 986120 gene locus_tag LOCUS_08780 985347 986120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 986803 987177 gene locus_tag LOCUS_08790 986803 987177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 987384 987950 gene locus_tag LOCUS_08800 987384 987950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 988023 988577 gene locus_tag LOCUS_08810 988023 988577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 991520 988659 gene locus_tag LOCUS_08820 991520 988659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 992445 991618 gene locus_tag LOCUS_08830 992445 991618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 994932 993523 gene locus_tag LOCUS_08840 994932 993523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 995589 994936 gene locus_tag LOCUS_08850 995589 994936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 996164 995661 gene locus_tag LOCUS_08860 gene ruvC 996164 995661 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902123.1 protein_id gnl|my_center|LOCUS_08860 996935 996189 gene locus_tag LOCUS_08870 996935 996189 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583963.1 protein_id gnl|my_center|LOCUS_08870 997335 997054 gene locus_tag LOCUS_08880 997335 997054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 997306 997656 gene locus_tag LOCUS_08890 997306 997656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 999223 998210 gene locus_tag LOCUS_08900 gene ruvB 999223 998210 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_08900 999597 1000013 gene locus_tag LOCUS_08910 999597 1000013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 1000112 1000297 gene locus_tag LOCUS_08920 1000112 1000297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 1004643 1001605 gene locus_tag LOCUS_08930 1004643 1001605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 1005833 1004697 gene locus_tag LOCUS_08940 1005833 1004697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 1006361 1006573 gene locus_tag LOCUS_08950 1006361 1006573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 1006831 1007277 gene locus_tag LOCUS_08960 gene tsaE 1006831 1007277 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583329.1 protein_id gnl|my_center|LOCUS_08960 1007244 1007447 gene locus_tag LOCUS_08970 1007244 1007447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 1008028 1007663 gene locus_tag LOCUS_08980 1008028 1007663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 1008184 1010838 gene locus_tag LOCUS_08990 gene polA 1008184 1010838 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048038.1 protein_id gnl|my_center|LOCUS_08990 1010873 1011091 gene locus_tag LOCUS_09000 1010873 1011091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 1011217 1012398 gene locus_tag LOCUS_09010 1011217 1012398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 1012571 1013575 gene locus_tag LOCUS_09020 gene holA 1012571 1013575 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583467.1 protein_id gnl|my_center|LOCUS_09020 1013776 1014945 gene locus_tag LOCUS_09030 1013776 1014945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 1015742 1015470 gene locus_tag LOCUS_09040 gene rpsT 1015742 1015470 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273615.1 protein_id gnl|my_center|LOCUS_09040 1015859 1016437 gene locus_tag LOCUS_09050 gene ruvA 1015859 1016437 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728708.1 protein_id gnl|my_center|LOCUS_09050 1016484 1017494 gene locus_tag LOCUS_09060 1016484 1017494 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393885.1 protein_id gnl|my_center|LOCUS_09060 1017523 1018305 gene locus_tag LOCUS_09070 1017523 1018305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 1018705 1019979 gene locus_tag LOCUS_09080 1018705 1019979 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258202.1 protein_id gnl|my_center|LOCUS_09080 1021223 1020039 gene locus_tag LOCUS_09090 1021223 1020039 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015552.1 protein_id gnl|my_center|LOCUS_09090 1022661 1021354 gene locus_tag LOCUS_09100 1022661 1021354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 1022824 1023360 gene locus_tag LOCUS_09110 1022824 1023360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 1023535 1024731 gene locus_tag LOCUS_09120 1023535 1024731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150048584.1 protein_id gnl|my_center|LOCUS_09120 1024864 1025706 gene locus_tag LOCUS_09130 1024864 1025706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 1025811 1027097 gene locus_tag LOCUS_09140 gene xseA 1025811 1027097 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119437.1 protein_id gnl|my_center|LOCUS_09140 1027150 1027353 gene locus_tag LOCUS_09150 1027150 1027353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 1027697 1028815 gene locus_tag LOCUS_09160 1027697 1028815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 1028964 1030097 gene locus_tag LOCUS_09170 1028964 1030097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 1030119 1031819 gene locus_tag LOCUS_09180 1030119 1031819 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080205.1 protein_id gnl|my_center|LOCUS_09180 1031826 1032692 gene locus_tag LOCUS_09190 1031826 1032692 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080204.1 protein_id gnl|my_center|LOCUS_09190 1033504 1033193 gene locus_tag LOCUS_09200 1033504 1033193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 1033849 1033577 gene locus_tag LOCUS_09210 1033849 1033577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 1034229 1033861 gene locus_tag LOCUS_09220 1034229 1033861 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259321.1 protein_id gnl|my_center|LOCUS_09220 1035457 1034231 gene locus_tag LOCUS_09230 1035457 1034231 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228877.1 protein_id gnl|my_center|LOCUS_09230 1036062 1035454 gene locus_tag LOCUS_09240 1036062 1035454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 1037947 1036073 gene locus_tag LOCUS_09250 1037947 1036073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 1038668 1037952 gene locus_tag LOCUS_09260 gene sufC 1038668 1037952 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946339.1 protein_id gnl|my_center|LOCUS_09260 1039106 1038678 gene locus_tag LOCUS_09270 1039106 1038678 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479949.1 protein_id gnl|my_center|LOCUS_09270 1039236 1039607 gene locus_tag LOCUS_09280 1039236 1039607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 1039597 1040793 gene locus_tag LOCUS_09290 gene rpoD 1039597 1040793 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_09290 1040885 1041139 gene locus_tag LOCUS_09300 1040885 1041139 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089667.1 protein_id gnl|my_center|LOCUS_09300 1041291 1041363 gene locus_tag LOCUS_t00460 1041291 1041363 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1042871 1041324 gene locus_tag LOCUS_09310 1042871 1041324 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861147.1 protein_id gnl|my_center|LOCUS_09310 1043685 1043077 gene locus_tag LOCUS_09320 1043685 1043077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 1045934 1043727 gene locus_tag LOCUS_09330 1045934 1043727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 1046423 1046238 gene locus_tag LOCUS_09340 1046423 1046238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 1046716 1046429 gene locus_tag LOCUS_09350 1046716 1046429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 1048244 1046829 gene locus_tag LOCUS_09360 1048244 1046829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 1048293 1048517 gene locus_tag LOCUS_09370 1048293 1048517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 1048569 1050035 gene locus_tag LOCUS_09380 1048569 1050035 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728610.1 protein_id gnl|my_center|LOCUS_09380 1050032 1051219 gene locus_tag LOCUS_09390 1050032 1051219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 1051243 1053600 gene locus_tag LOCUS_09400 1051243 1053600 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229101.1 protein_id gnl|my_center|LOCUS_09400 1053611 1053793 gene locus_tag LOCUS_09410 1053611 1053793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 1054014 1054799 gene locus_tag LOCUS_09420 1054014 1054799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 1055494 1056531 gene locus_tag LOCUS_09430 1055494 1056531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 1056792 1058267 gene locus_tag LOCUS_09440 1056792 1058267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 1058284 1058568 gene locus_tag LOCUS_09450 1058284 1058568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 1059095 1060072 gene locus_tag LOCUS_09460 1059095 1060072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 1060077 1061255 gene locus_tag LOCUS_09470 1060077 1061255 CDS product adenine-specific methyltransferase EcoRI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196835716.1 protein_id gnl|my_center|LOCUS_09470 1061252 1062343 gene locus_tag LOCUS_09480 1061252 1062343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 1062362 1063288 gene locus_tag LOCUS_09490 1062362 1063288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 1063302 1064327 gene locus_tag LOCUS_09500 1063302 1064327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 1065072 1064461 gene locus_tag LOCUS_09510 1065072 1064461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 1065173 1066321 gene locus_tag LOCUS_09520 gene waaC 1065173 1066321 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_09520 1066720 1066379 gene locus_tag LOCUS_09530 1066720 1066379 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027987.1 protein_id gnl|my_center|LOCUS_09530 1067052 1068002 gene locus_tag LOCUS_09540 gene argE 1067052 1068002 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114054.1 protein_id gnl|my_center|LOCUS_09540 1068148 1068771 gene locus_tag LOCUS_09550 1068148 1068771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 1068793 1068951 gene locus_tag LOCUS_09560 1068793 1068951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 1069088 1069669 gene locus_tag LOCUS_09570 1069088 1069669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 1069763 1071544 gene locus_tag LOCUS_09580 1069763 1071544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 1071567 1071884 gene locus_tag LOCUS_09590 1071567 1071884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 1072180 1073103 gene locus_tag LOCUS_09600 1072180 1073103 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116510.1 protein_id gnl|my_center|LOCUS_09600 1073479 1073703 gene locus_tag LOCUS_09610 1073479 1073703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 1075068 1073776 gene locus_tag LOCUS_09620 1075068 1073776 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869050.1 protein_id gnl|my_center|LOCUS_09620 1075414 1075187 gene locus_tag LOCUS_09630 1075414 1075187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 1078799 1075521 gene locus_tag LOCUS_09640 1078799 1075521 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963916.1 protein_id gnl|my_center|LOCUS_09640 1079976 1078792 gene locus_tag LOCUS_09650 1079976 1078792 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957780.1 protein_id gnl|my_center|LOCUS_09650 1080291 1080019 gene locus_tag LOCUS_09660 1080291 1080019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 1080657 1081157 gene locus_tag LOCUS_09670 1080657 1081157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 1081157 1081678 gene locus_tag LOCUS_09680 1081157 1081678 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256454.1 protein_id gnl|my_center|LOCUS_09680 1081764 1082243 gene locus_tag LOCUS_09690 1081764 1082243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 1082863 1082366 gene locus_tag LOCUS_09700 1082863 1082366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 1083665 1082874 gene locus_tag LOCUS_09710 1083665 1082874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926870.1 protein_id gnl|my_center|LOCUS_09710 1084334 1083708 gene locus_tag LOCUS_09720 1084334 1083708 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932189.1 protein_id gnl|my_center|LOCUS_09720 1084608 1085168 gene locus_tag LOCUS_09730 1084608 1085168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 1085177 1085809 gene locus_tag LOCUS_09740 gene nth 1085177 1085809 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065874.1 protein_id gnl|my_center|LOCUS_09740 1090718 1085988 gene locus_tag LOCUS_09750 1090718 1085988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 1090955 1091209 gene locus_tag LOCUS_09760 1090955 1091209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 1091181 1092020 gene locus_tag LOCUS_09770 1091181 1092020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1093382 1092306 gene locus_tag LOCUS_09780 1093382 1092306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 1093588 1095231 gene locus_tag LOCUS_09790 gene argS 1093588 1095231 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723609.1 protein_id gnl|my_center|LOCUS_09790 1095314 1097152 gene locus_tag LOCUS_09800 gene recQ 1095314 1097152 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707789.1 protein_id gnl|my_center|LOCUS_09800 1097360 1098850 gene locus_tag LOCUS_09810 1097360 1098850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 1098971 1099810 gene locus_tag LOCUS_09820 1098971 1099810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 1099857 1101071 gene locus_tag LOCUS_09830 1099857 1101071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 1101232 1102602 gene locus_tag LOCUS_09840 1101232 1102602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 1102692 1103483 gene locus_tag LOCUS_09850 1102692 1103483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 1103521 1103913 gene locus_tag LOCUS_09860 1103521 1103913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 1103799 1104038 gene locus_tag LOCUS_09870 1103799 1104038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 1104466 1105716 gene locus_tag LOCUS_09880 1104466 1105716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 1105837 1107930 gene locus_tag LOCUS_09890 1105837 1107930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 1108020 1108871 gene locus_tag LOCUS_09900 1108020 1108871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900