COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence1 source 1..1865016 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 356..529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 note possible pseudo, frameshifted CDS 555..881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 note possible pseudo, internal stop codon, frameshifted CDS 893..1069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS 985..1335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00040 note possible pseudo, frameshifted CDS 1328..2062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00050 note possible pseudo, frameshifted CDS 3232..3480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00060 note possible pseudo, frameshifted CDS 3471..3740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 note possible pseudo, internal stop codon, frameshifted CDS 3784..4455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00080 note possible pseudo, internal stop codon CDS 5965..6342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 6503..7480 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808328.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 7574..8221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00110 note possible pseudo, frameshifted CDS 8211..8522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 8516..8833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 8830..9267 product PssD/Cps14F family polysaccharide biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065325.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene pssD CDS 9269..9733 product PssE/Cps14G family polysaccharide biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990828.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene pssE CDS 9862..11037 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021091.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 11208..12986 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868273.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene asnB CDS complement(13120..14442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(14657..14860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS 14938..16209 product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147032.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 16326..16829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(16986..19208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(19274..19714) product UPF0146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878243.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(19711..19926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS 20028..21089 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023772.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene ftsZ CDS complement(21343..22602) product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020304.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(22746..23447) product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064937.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 23601..24668 product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024465.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 24655..25320 product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024466.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene aroD CDS 25678..26694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 26862..27620 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393323.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 27614..28363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 28470..29480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(29481..31139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(31315..31647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(31964..32431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(32471..32635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(34134..34919) product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022865.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(34964..35161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 35246..35638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 35695..37161 product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064974.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(37144..37563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(37613..38512) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878250.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene dapF CDS 38593..39852 product bifunctional hexulose-6-phosphate synthase/ribonuclease regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860554.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 40046..40972 product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020197.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 40969..42651 product preprotein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020198.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(42698..43675) product flippase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013683404.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(43709..44677) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879224.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(44902..47865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(47937..48749) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene xth CDS 49418..49582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 49994..50914 product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868810.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 50941..51420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 51465..52547 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860150.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 52843..53601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 53709..54071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 54095..57898 product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272597.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene bchH CDS complement(57930..58409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(58393..58833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00590 note possible pseudo, frameshifted CDS complement(58899..59864) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860152.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(59968..60603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 60861..62006 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990611.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 62231..62500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 62597..63085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(63394..63591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 64298..64621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 64642..65430 product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589532.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(65504..66760) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860152.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(66800..67819) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860152.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 68228..68854 product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024140.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(68935..69786) product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870393.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene nifH CDS complement(69804..70952) product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106010848.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(70954..72420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 73314..74282 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860152.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 74279..75109 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990611.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 75142..76164 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860152.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(76214..77434) product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932105.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(77435..79138) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992488.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 79245..83081 product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932109.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene cobN CDS 83099..84193 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496656.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(84248..84583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 84980..85381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 85375..86157 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065716.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 86166..88190 product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020921.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 88195..89064 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546238.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 89066..89800 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211328137.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(89950..90129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00870 note possible pseudo, internal stop codon CDS complement(90493..90972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 note possible pseudo, frameshifted CDS complement(91176..91544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(91731..92066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(92507..92701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 92848..93036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 93215..93667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 93664..100269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS 100320..101588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 101678..104005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 104059..105315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 105317..113410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(113716..114114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 114358..115395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(115429..116502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 116753..116980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(117166..118554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(118821..119051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(119185..119400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 119357..119995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(120126..121106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(121173..121985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(122017..123960) product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767598.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene speA CDS 124335..125309 product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022952.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(125349..125942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(126013..126198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01120 tRNA complement(126217..126294) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(126304..126666) product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249594.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(126663..126890) product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021744.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(126887..127297) product rRNA maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021745.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(127297..127434) product DNA-directed RNA polymerase subunit P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021777.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(127735..128511) product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878001.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene rrp42 CDS complement(128504..129265) product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878000.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene rrp41 CDS complement(129262..129927) product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021780.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene rrp4 CDS complement(129946..130644) product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021781.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(130647..131420) product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065214.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene psmA CDS complement(131392..131889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(131928..132605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(132602..133018) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755897.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(133049..133636) product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870497.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(134103..134375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(134554..134772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(134895..135368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 135599..136294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(136314..137000) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023459.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(137085..137828) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022348.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(137912..138259) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061058.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 138610..139866 product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880742.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene ahcY CDS 139885..140970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 140983..141999 product TRM11 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020267.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(142166..142408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(142787..143383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 143485..143940 product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065945.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 143952..144428 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024155.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 144513..145145 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024156.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 145146..146123 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024157.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS 146146..146463 product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250366.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene rpl12p CDS complement(146555..146827) product non-histone chromosomal MC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024392.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 146967..147509 product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963430.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene cysC CDS 147727..148881 product type II glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013682815.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 148882..149949 product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023532.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene endA CDS complement(149902..150093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 150271..151131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 151197..151529 product CGGC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018214298.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(151613..152260) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249655.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(152619..153089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(153400..153885) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582794.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene bcp CDS complement(154059..154673) product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879779.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(155212..156798) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021497.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(156871..158184) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021494.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene trkA CDS 158360..159577 product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020481.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene larC CDS 159909..161129 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020630.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene hemL CDS 161132..162049 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020631.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene hemC CDS 162036..163538 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460180.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene cobA CDS 163549..164715 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978063.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(164763..164912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 165327..166427 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022968.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 166528..166980 product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021413.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 167455..168393 product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023186.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene ala CDS 168554..168787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(168876..169784) product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024080.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene nifB CDS 170010..170324 product signal recognition particle protein Srp19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066074.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 170334..170966 product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065077.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 171093..171419 product DUF2209 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023531.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 171492..172739 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755955.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene hflX CDS 172771..173493 product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021719.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 173803..174135 product non-histone chromosomal MC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024392.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(174145..174828) product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879553.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene cofC CDS complement(174859..175599) product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903932.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(175665..175889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(175899..176528) product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020240.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(176534..177049) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020241.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(177162..178403) product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021336.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene gatD CDS 178533..179354 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021804.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS 179389..179922 product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251061.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(179996..180259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 180454..180675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 180688..180855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(180873..181292) product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876110.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 181445..182191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 182269..182751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(182776..184752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 185012..185503 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143524.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(185500..185775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 185959..186516 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 187449..188174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 188320..189300 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478452.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 189497..190828 product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022225.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 191031..191261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(191296..194136) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020807.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(194114..194794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(194928..195455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(195460..195645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 195903..196970 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023154.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 196979..197449 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420437.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(197427..198122) product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024314.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 198158..198847 product HisA/HisF-related TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024313.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 199023..202184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02030 note possible pseudo, frameshifted CDS 202181..202399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 202755..203099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS 203096..203383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(204123..204668) product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 204815..205261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(205458..205802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 206061..206834 product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037361.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(206912..207709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(207908..208168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(208369..209781) product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943636.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 209774..210838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 210838..211734 product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878595.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 211731..212270 product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867611.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 212309..212941 product DUF434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023187.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 213199..213624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 213924..214643 product glucose-6-phosphate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020865.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 214714..215652 product UbiA prenyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065984.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(215684..216439) product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065422.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(216447..216755) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876568.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 217268..218329 product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167388862.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(218484..219332) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393681.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(219745..221319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(221294..221893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(221951..225556) product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022493.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(225708..226430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(226705..226884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(226877..227122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(227484..228410) product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393027.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 228780..230180 product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272418.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene gltA CDS complement(230250..231758) product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021977.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(231773..232645) product DUF1743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021976.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 232938..233102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(233108..233473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02360 note possible pseudo, frameshifted CDS complement(233488..234417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 note possible pseudo, frameshifted CDS complement(234424..234777) product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023203.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene pth2 CDS complement(234835..236157) product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250361.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene dnaG CDS complement(236576..237613) product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023765.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(237613..237993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(238004..240088) product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020726.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(240160..241428) product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020953.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(241541..242326) product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020954.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(242526..242708) product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878609.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(242709..243017) product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023602.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(243020..243550) product GTP-dependent dephospho-CoA kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023601.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(243552..243737) product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878612.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(243734..244318) product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023599.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(244318..244725) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023598.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(244730..246025) product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064633.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(246327..247142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 247371..248321 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066048.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene thiL CDS 248505..248768 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943587.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 248778..249206 product putative zinc-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065848.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 249203..250378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 250362..251972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 252084..252770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 252770..252922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 253013..253354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 253589..255001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 255369..255905 product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 255905..256162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 256162..257385 product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020091.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene porA CDS 257399..258274 product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020090.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene porB CDS 258277..258888 product IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876651.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene purO CDS 258921..259811 product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020069.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene fhcD CDS complement(260060..260761) product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719585.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(260797..261495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(261519..261683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 261787..262584 product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020491.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(263093..264109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(264240..264929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 265026..266234 product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022964.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 266581..267681 product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 267685..268626 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925382.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 268658..269359 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868278.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 269440..270642 product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868281.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 270662..271819 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene wecB CDS 271816..272811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(272936..274741) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022962.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene glmS CDS complement(274741..275970) product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022961.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 276094..277221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 277714..278433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 278598..279464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(279472..280479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(280454..280771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(280726..281328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 281564..281743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(281748..283214) product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060802.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(283221..283721) product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877830.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(283947..284825) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980041.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(284838..285845) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868293.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene rfbB CDS complement(285845..286897) product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868292.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(287007..288191) product homocitrate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023272.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(288264..288836) product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867925.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(288833..289513) product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876071.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(289528..291072) product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023184.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 291282..291839 product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020390.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(291975..293015) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172312.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene dinB CDS complement(293026..293604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 293936..294817 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583014.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(294848..296071) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889176.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(296140..297189) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892607.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(297276..297590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 297580..297768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(297828..298442) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060758.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(298557..299261) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545081.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 299396..299890 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021008.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(299936..300682) product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024415.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene htpX CDS 301005..301433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03110 note possible pseudo, frameshifted CDS 301457..301711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03120 note possible pseudo, frameshifted CDS 301858..302007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 302022..302489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(302842..303330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(303275..303865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(305126..305506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03170 note possible pseudo, internal stop codon, frameshifted CDS complement(305506..306297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03180 note possible pseudo, internal stop codon, frameshifted CDS complement(307174..307788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(308031..308651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 309040..309357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(309653..309871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03220 note possible pseudo, frameshifted CDS complement(310008..310445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03230 note possible pseudo, frameshifted CDS 310805..311212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(311330..311911) product Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066022.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(311912..312256) product DUF2073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064681.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(312277..312915) product Era-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878677.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(313332..314426) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020233.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 314530..315705 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022128.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 315757..316173 product DUF2111 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589540.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 316170..316631 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876630.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene rimI CDS complement(316816..316998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(317173..318387) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024000.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene ftsY CDS complement(318380..318835) product prefoldin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868641.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene pfdA CDS complement(318828..319016) product 50S ribosomal protein L18Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024002.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene rpl18a CDS complement(319032..319703) product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024003.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(319687..319983) product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024004.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(320047..320703) product alpha hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024006.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(320725..321066) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024007.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(321081..321548) product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877224.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(323181..324461) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925421.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(324690..325547) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404480.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS 325705..326595 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024378.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene pyrB CDS 326597..327115 product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060913.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene pyrI CDS 327270..328112 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022767.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(328485..328898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(329299..329907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(330065..331693) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021660.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(331740..332582) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066451.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene pheA CDS complement(332579..333529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03500 note possible pseudo, frameshifted CDS complement(333529..333849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03510 note possible pseudo, frameshifted CDS 333916..334974 product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065828.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(335441..335872) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(335919..336308) product AIR carboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021394.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(336345..336593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(336644..337498) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021396.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(337510..338034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(338081..339157) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024300.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 339122..339271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(339464..339871) product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024057.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 340327..342042 product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020719.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene oadA CDS 342073..342948 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024391.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene argB CDS complement(343112..343555) product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877697.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene nifU CDS 343742..344428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 note possible pseudo, frameshifted CDS complement(344823..345020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 345605..345970 product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013196.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 345960..346169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 346901..347131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(347170..347454) product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902003.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(347451..347660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(349216..350307) product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020763.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene dph2 CDS complement(350276..351295) product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023899.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene fen CDS 351377..351772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(351943..352572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 352707..353552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 353552..356116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 356123..356569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 356566..357564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 357561..358355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 358352..360508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 360711..361094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS 361091..361792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(362047..362319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03830 note possible pseudo, frameshifted CDS complement(363197..363616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 364263..364484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 364481..364747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 repeat_region 364859..368272 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgcaacgtactcgaaaacccgatagggattgaaac CDS complement(368627..370327) product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869281.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 370693..371157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 372087..374084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 374262..375287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(375384..375878) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020126.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 376123..377343 product cysteate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066469.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 377343..378182 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869614.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 378179..378877 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869613.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 379044..379679 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877278.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 379830..379991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 380437..380793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 380990..383266 product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021816.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 383586..383963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 383957..384865 product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065217.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 384946..385227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 385413..385580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(385725..386195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 386813..388159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 388188..388598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 388834..389883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(389943..390485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(390866..391261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04080 note possible pseudo, frameshifted CDS complement(391189..391659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04090 note possible pseudo, frameshifted CDS 392088..393008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 394159..394314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(394590..395279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(395438..395713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 396409..396927 product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065441.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 396924..397931 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022537.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 397989..399647 product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022536.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 399784..401070 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023136.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene hisD CDS 401120..402001 product DUF2099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022201.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(402055..404019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(404312..404941) product winged helix-turn-helix domain-containing protein/riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319832.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(405045..405710) product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(405707..406954) product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066440.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene hacA CDS complement(407012..408907) product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932766.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(408904..410169) product ATP citrate lyase citrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932767.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 410281..411279 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024418.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 tRNA complement(411312..411388) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(411419..412492) product UPF0104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876885.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 412613..412792 product DUF5350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879682.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 412807..414036 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877292.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 gene thiI CDS 414284..414481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(414628..416571) product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021214.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(416583..417284) product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022642.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 417604..418527 product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393446.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene arcC CDS 418708..419052 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060879.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(419255..422035) product S-layer protein domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023471.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 422067..422240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 422364..422675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 423009..424175 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066146.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 424172..424957 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020890.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 425117..425671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 425816..426649 product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023683.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene arsM CDS complement(426726..426863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(426853..427347) product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 427771..430740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 430915..432087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(433065..434861) product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870139.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(435197..436804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(436872..437279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(437547..437822) product DNA-directed RNA polymerase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020766.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(437823..438383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(438549..439196) product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020764.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(439225..441693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 441961..443202 product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020101.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene prf1 CDS 443208..443645 product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066042.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 443638..444405 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024526.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 444402..445052 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020150.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 445207..446817 product O-phosphoserine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020149.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene sepS CDS 446930..447622 product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021687.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene rpiA CDS complement(447657..447995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 448149..448343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 448400..448984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 448993..450636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 450827..451180 product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250923.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 451225..452460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 452532..452984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(453247..453660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(453779..454690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 454775..455977 product O-phospho-L-seryl-tRNA:Cys-tRNA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877542.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene pscS CDS complement(456023..456799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(456916..457707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 457994..459052 product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023783.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 459057..460142 product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 460196..461335 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869732.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene trpD CDS 462227..463255 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879296.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 463265..464620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 464875..465045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 465053..466921 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319494.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene acs CDS 467380..469398 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319494.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene acs CDS 469504..469665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 470095..471573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 note possible pseudo, frameshifted CDS 471548..472078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04800 note possible pseudo, frameshifted CDS 472300..474330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 475218..477188 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319494.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene acs CDS 477397..478281 product tetrahydromethanopterin:alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023202.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene mptN CDS 478326..479603 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024009.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(479949..481484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS complement(481864..482346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 482812..482976 product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081114.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 483009..484208 product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584117.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 484383..485201 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066246.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(485273..485836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022099.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS complement(485839..486678) product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022098.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene htpX CDS 486873..487331 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404934.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 487401..487955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 487972..489189 product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272642.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene ilvA CDS complement(489482..490477) product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021133.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(490690..491214) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879393.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(491217..491825) product DUF106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021131.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(491822..493435) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021124.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene secY CDS complement(493432..493809) product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021123.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS complement(493815..494270) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021122.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(494273..494896) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021121.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS complement(494901..495410) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021120.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(495412..495873) product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021119.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(495876..496250) product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879401.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(496257..496382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05050 note possible pseudo, frameshifted CDS complement(496797..497180) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021116.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(497196..497348) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879404.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(497345..497860) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021114.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(497857..498438) product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021113.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(498558..498845) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250481.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene rplX CDS complement(498925..499323) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021111.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene rpl14p CDS complement(499320..499640) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011696863.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(499637..499930) product ribonuclease P protein component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021109.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS complement(499927..500127) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021108.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene rpmC CDS complement(500133..500960) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021107.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS complement(500960..501370) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875649.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene rplV CDS complement(501431..501841) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021105.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(501851..502426) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875647.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(502575..502823) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722494.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(502820..503593) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021102.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene rpl4p CDS complement(503597..504601) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879418.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene rpl3p CDS complement(504602..505378) product putative RNA uridine N3 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879419.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(505772..506746) product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928941.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(506811..507752) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023440.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 507789..509210 product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066507.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(509332..510321) product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878259.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 510626..511318 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024311.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene tmk CDS complement(511439..512080) product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022401.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(512211..513131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 514033..514893 product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024306.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(514999..515229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 515212..515598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 515627..516226 product DUF2150 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023591.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(516282..517169) product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020270.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene map CDS complement(517257..518402) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020271.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(518409..519167) product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023864.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(519175..519324) product 50S ribosomal protein L40e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065861.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 519602..520855 product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229415.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene maeB CDS 520932..521078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(521130..522098) product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023652.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(522101..522928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023654.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(522930..523421) product homoaconitase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065791.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene hacB CDS 523717..523920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 524074..524688 product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879016.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 524691..525278 product archaeoflavoprotein AfpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064401.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene afpA CDS 525340..525735 product sirohydrochlorin nickelochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061042.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene cfbA CDS 525687..526940 product coenzyme F430 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023538.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene cfbE CDS 526948..528048 product Ni-sirohydrochlorin a,c-diamide reductive cyclase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023536.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene cfbD CDS complement(528117..528407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 528605..528802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(529277..529531) product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS complement(529659..532403) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020252.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene alaS CDS complement(532514..533131) product orotate phosphoribosyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020957.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(533128..533526) product NOB1 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066159.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 533668..534111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990637.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 534120..535880 product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023139.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 535893..536990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(537058..537675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(537890..538537) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855217.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(538534..539310) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022930.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene trpA CDS complement(539297..540478) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022931.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene trpB CDS complement(540651..540860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(540877..541569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05630 note possible pseudo, frameshifted CDS complement(541559..542083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05640 note possible pseudo, frameshifted CDS 542202..542897 product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023469.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 542894..543217 product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023468.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 543210..543992 product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065744.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene cbiQ CDS 544018..545253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(545498..546274) product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020480.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene larB CDS 546352..547617 product endonuclease Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020688.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 547916..548809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(548854..550473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 550546..550755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 551170..551481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 551606..552235 product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024449.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 552388..554538 product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 554630..556534 product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023222.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene lonB CDS 556539..557858 product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990640.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(557914..558492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(558639..559007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(559139..559984) product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(559981..560511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(560511..561617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05830 note possible pseudo, frameshifted CDS complement(561614..561946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 note possible pseudo, frameshifted CDS complement(561933..564452) product CoB-CoM heterodisulfide reductase HdrA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022820.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene hdrA2 CDS 565010..565309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(565375..566013) product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173254069.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 566269..567525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 567570..568184 product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066221.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 gene trmY CDS complement(568305..571664) product Swt1 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258561.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(571700..572344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(572346..573491) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530160.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(573570..576350) product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 576291..576440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 576650..577972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 577950..578120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(578192..581719) product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258557.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 582072..582416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(582524..582997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(582991..583800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(583797..585215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 note possible pseudo, frameshifted CDS complement(585194..586129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 note possible pseudo, frameshifted CDS 586297..587073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 587346..587873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 587958..588506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 588609..589271 product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496756.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(589278..590075) product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877350.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(589985..590884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(590965..592479) product AMP phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023176.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(592482..593420) product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065056.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(593417..594007) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903724.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(594011..594499) product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065943.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 594563..595780 product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879468.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene pan CDS 595795..596283 product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022308.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 596358..597281 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876019.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 597563..597721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 598337..599224 product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880173.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene rfaD CDS 599407..599880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 600461..601348 product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880173.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 gene rfaD CDS 601574..603121 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886617.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(604993..606249) product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296319.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(607320..607544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 608485..609000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 609094..609732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(609960..610103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(610118..611257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(611529..612482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(612957..614321) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081170.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS complement(614610..615608) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060801.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(615638..615823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(615796..616731) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060800.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(616945..617145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 note possible pseudo, frameshifted CDS complement(617312..618007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(618037..618264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 note possible pseudo, frameshifted CDS complement(618335..619114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06350 note possible pseudo, frameshifted CDS complement(619558..620265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(620574..620858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(620864..621160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(621283..621543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(621719..622084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(622035..622382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(622698..623147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(623098..623346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(623444..623692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(624175..625107) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022154.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 tRNA complement(626260..626345) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(626542..626901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 626794..627054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(627145..627576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(627591..628736) product formate--phosphoribosylaminoimidazolecarboxamide ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023596.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(628967..629167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 629240..629734 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020260.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 629731..630855 product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020259.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 631117..631323 product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296894.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS 631334..632824 product DNA-directed RNA polymerase subunit B'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755883.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 632808..633914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 note possible pseudo, frameshifted CDS 633907..634647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 note possible pseudo, frameshifted CDS 634656..637283 product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021284.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 637280..638419 product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066196.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 gene rpoA2 CDS 638425..638733 product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065070.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 638730..639161 product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021281.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 639209..639637 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064744.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 639634..640200 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021279.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 640312..640968 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020584.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(640901..643114) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035498.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(643120..643593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 643702..644889 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022460.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 644899..646059 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021679.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 646046..646792 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021673.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 646896..647510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 647746..648714 product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021714.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene mch CDS 648827..649081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(649092..650150) product EF-Tu/IF-2/RF-3 family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869822.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 650408..650659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(650753..651514) product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392949.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 651712..652737 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022929.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene trpD CDS 652734..653360 product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065580.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 653351..654793 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022927.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene trpE CDS 654790..655371 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022926.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 655359..656090 product indole-3-glycerol-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022932.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(656157..657818) product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249656.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene gapN CDS 658032..659324 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023956.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 659321..660064 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023957.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(660110..661255) product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065228.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(661290..661922) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021954.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene rnhB tRNA 662045..662119 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 662205..662486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 662689..663480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 663653..665005 product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545858.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 665029..666153 product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072974.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(666354..666587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(666550..667248) product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024048.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(667253..668641) product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024047.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(668655..670283) product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024046.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(670376..670675) product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024045.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(670677..671690) product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024044.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(671732..672280) product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878659.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(672308..672574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(672642..674582) product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589509.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 tRNA complement(672874..672946) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(674668..674994) product ATP synthase archaeal subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015591748.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene ahaH CDS complement(674987..675163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(675151..676314) product type III ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024428.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene rbcL CDS 676655..677548 product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942295.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 677629..678426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07020 note possible pseudo, frameshifted CDS 678341..679024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07030 note possible pseudo, frameshifted CDS 679260..680375 product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251114.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene fbp CDS 680505..681317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(681481..682305) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060749.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(682357..683106) product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545677.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 gene cbiQ CDS complement(683166..683501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(683578..683898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(683900..684529) product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546305.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene cbiM CDS complement(684538..685308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(685425..686216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(686430..686660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(686780..687511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 688111..688275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 688677..689828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(689947..690501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 690645..691154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 691282..691536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(691588..692886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(693295..693663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(694720..695175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07220 note possible pseudo, internal stop codon CDS 695869..696381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 696449..697210 product DUF1829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213043995.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(697461..698423) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879477.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene ilvC CDS complement(698497..698988) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene ilvN CDS complement(698989..699894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07270 note possible pseudo, frameshifted CDS complement(699891..700787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 note possible pseudo, frameshifted CDS complement(700772..702214) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589535.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 702495..703607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 703653..704309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 704331..704990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(704997..705479) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704775.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene rlmH CDS complement(705676..706818) product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022426.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(706852..708495) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022425.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(708520..709269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022424.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(709502..709954) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065868.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(710107..711030) product methanogenesis marker 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023887.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(711023..711595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(711597..712823) product methanogenesis marker 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023889.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(712820..713257) product methanogenesis marker 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869903.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(713273..713545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(713539..713685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07430 note possible pseudo, frameshifted CDS complement(713685..715208) product methanogenesis marker 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023892.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(715210..716811) product methyl coenzyme M reductase system, component A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023893.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene atwA CDS 717143..717652 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064860.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(717637..718227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(718321..718713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 718903..720174 product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048415.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(720235..720495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 720726..721103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(721277..721936) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064948.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(722144..722437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(722557..723405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 723739..724164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 724219..724716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS complement(724943..725746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 726795..727520 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020276.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene hisA CDS 727531..728097 product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020277.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene hisB CDS complement(728155..728958) product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020163.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene surE CDS complement(729219..729368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 729468..729695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07620 tRNA complement(729718..729809) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS complement(729846..730616) product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990666.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene uppS tRNA 730748..730821 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 731069..731239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 731256..732074 product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020938.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 732134..732676 product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020937.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 732712..734379 product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878819.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 734549..735649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065646.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 735670..736242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS complement(736275..736682) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173768.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene trxA CDS complement(736685..737263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 737644..739521 product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065589.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 739618..740808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(741161..742258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS complement(742712..742963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07750 note possible pseudo, frameshifted CDS complement(743010..744566) product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061171.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene rqcH note possible pseudo, frameshifted CDS 744735..745199 product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878928.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(745338..746018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(746525..746956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 747162..747281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(747290..748225) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020164.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene moaA CDS complement(748424..748825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(748866..749246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(749358..749960) product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024115.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(749953..750906) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880521.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 751270..751596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(751569..752471) product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 752575..752994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 753119..753541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 753716..755683 product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022843.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 755814..756008 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925387.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 756155..758299 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939521.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(758407..759054) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065013.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene pyrF CDS complement(759163..759345) product preprotein translocase subunit Sec61beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064803.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(759430..761292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 762017..762460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 762743..762997 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055429980.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS complement(763207..763392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 763976..766063 product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880430.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene glgP CDS complement(766032..766454) product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877139.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(766451..767641) product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020303.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(767695..768618) product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021807.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene mtrH CDS complement(768622..769242) product tetrahydromethanopterin S-methyltransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021808.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 769422..769808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 769814..771184 product gas vesicle protein GvpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904107.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene gvpD CDS complement(771200..771724) product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023216.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(771740..773590) product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066467.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene cooS CDS complement(773830..775020) product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064533.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene serB CDS complement(775442..776233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 note possible pseudo, frameshifted CDS complement(776945..777415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 note possible pseudo, frameshifted CDS complement(777420..777764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 note possible pseudo, internal stop codon CDS 778427..778699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 778784..778915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08130 tRNA complement(778995..779069) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS complement(779098..779772) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869727.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 779865..781109 product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003128157.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 tRNA complement(781130..781203) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(781256..782806) product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274408.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 783150..783848 product bifunctional fructose-bisphosphatase/inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023274.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 783841..784674 product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023273.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(784776..785831) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733783.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(785828..786736) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878506.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(786742..787848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(788055..789149) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990827.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(789333..790043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(790225..791406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(791454..792227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(792442..793257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(793490..794212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(794719..795441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08280 tRNA complement(795895..795971) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA complement(796059..796132) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS 796233..797225 product DUF128 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065980.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 797488..797889 product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021540.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(797934..799085) product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023790.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(799082..800974) product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020337.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 801070..802725 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021805.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene ilvD CDS 802722..803267 product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066123.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene thpR CDS 803281..804600 product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023473.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene cca CDS complement(804595..805647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 806149..808242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 808495..809538 product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546747.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 gene amrS CDS 809600..810805 product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392434.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(810920..811411) product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582602.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(811464..811955) product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065425.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 812029..814608 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022991.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 814605..815168 product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879480.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene cyaB CDS 815165..816040 product presenilin family intramembrane aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065870.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 816200..816397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 816394..817515 product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224291.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(817588..818400) product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020996.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 818441..819289 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020993.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene nadC CDS 819255..820496 product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020992.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 820582..821691 product tubulin/FtsZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066160.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(821685..822575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875877.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(822582..823685) product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066217.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 823787..824254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(824251..825534) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024209.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 gene thiC CDS 825618..826808 product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020737.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 826925..827608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 827659..829476 product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020947.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 829530..830093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 830095..830787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 830925..832130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08600 note possible pseudo, frameshifted CDS 832178..833545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08610 note possible pseudo, frameshifted CDS 833551..835266 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732291.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene mutL CDS 835320..836630 product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066157.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 836782..837165 product transcriptional regulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065665.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 837387..838010 product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066543.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(838029..838430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022359.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(838427..838699) product DUF2551 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878713.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 838926..839648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(839829..840269) product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023990.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(840282..840611) product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066569.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 840744..842096 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941271.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene purH CDS 842269..843588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 843589..844650 product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021469.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 844977..845648 product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878392.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene npdG CDS complement(845641..846951) product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020067.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(846957..848033) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020066.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(848277..848864) product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020321.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS complement(848866..850752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(850807..851022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(850973..852037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(852144..853439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 854030..854626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(854613..854786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 854935..856128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 856194..857381 product bifunctional 5,6,7,8-tetrahydromethanopterin hydro-lyase/3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024481.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 857540..858844 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065684.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 859787..860176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 note possible pseudo, frameshifted CDS 860344..862116 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022845.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(862251..863351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(863645..863962) product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256599.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(863953..865932) product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980092.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(865968..866462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 866602..867918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 note possible pseudo, frameshifted CDS complement(868035..868184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 868289..868453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 868556..868741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(868710..869669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(869682..870374) product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870165.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene gpmA CDS complement(870397..871314) product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065835.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(871324..872262) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640844.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene pfkB CDS 872643..873899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 873896..874669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 874647..876242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09030 tRNA 876259..876332 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS complement(876408..877184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(877274..877666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(877964..878962) product DUF1616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065996.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(879108..879851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(880572..881015) product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023936.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(881012..882181) product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(882178..883215) product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023934.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(883222..883941) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023933.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 tRNA complement(884042..884139) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(884223..884468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 884553..885107 product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023239.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 885257..886162 product tetrahydromethanopterin S-methyltransferase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020334.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene mtrE CDS 886159..886845 product tetrahydromethanopterin S-methyltransferase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020333.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene mtrD CDS 886847..887674 product tetrahydromethanopterin S-methyltransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020332.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene mtrC CDS 887685..888038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 888041..888772 product tetrahydromethanopterin S-methyltransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020330.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene mtrA CDS 888774..889001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 889005..889262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 889263..890198 product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020327.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene mtrH CDS 890234..890881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(891129..891341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(891786..892031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(892059..893018) product methanogenesis marker 12 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023754.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(893009..893902) product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066127.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene cofD CDS complement(893904..894473) product ZPR1 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023781.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(894470..894772) product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878285.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene sepF CDS complement(894873..895874) product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755891.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene cofG CDS complement(895875..896324) product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023592.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(896486..896650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09310 note possible pseudo, frameshifted CDS complement(896595..897518) product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023593.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 note possible pseudo, frameshifted CDS complement(897600..897944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09330 note possible pseudo, frameshifted CDS complement(897941..898357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09340 note possible pseudo, frameshifted CDS complement(898587..899411) product F420-dependent methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065986.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 899646..899807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 900058..900252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 900436..900753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09380 note possible pseudo, internal stop codon, frameshifted CDS 901385..902074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 902093..902749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(902947..903891) product IS5-like element ISMac22 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022661.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(904430..905047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(905194..905787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09430 tRNA complement(905960..906034) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 906443..907153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 907438..908142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 908152..908682 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250569.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 908679..909125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(909126..910130) product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021397.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(910140..910799) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461595.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene phoU CDS complement(910817..911563) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020934.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene pstB CDS 911881..913521 product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879727.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene thsB CDS 913561..914190 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene grpE CDS 914319..916172 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene dnaK CDS 916243..917412 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021493.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene dnaJ CDS complement(917393..917833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 917753..917953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 918415..918921 product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022945.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene fae CDS 919131..928523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 928707..929099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(929175..930365) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871084.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(930372..930605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(930800..931423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(931430..931774) product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021428.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 tRNA 932111..932186 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA 932192..932264 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS complement(932611..934101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(934423..935166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(935354..935992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 936236..936688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 937080..937280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(937434..937799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS 937966..939138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 939140..940732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 942001..942411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 942487..942738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 note possible pseudo, internal stop codon CDS complement(942774..942953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 943667..945280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 945408..946595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(946964..947893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(948311..949405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(949663..949887) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496448.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(949877..950248) product DUF2178 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023877.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 951498..951965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 951973..953205 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860152.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 953343..954284 product nucleoside recognition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023218.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 954497..954859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 954860..955687 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860221.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(956429..956866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09860 note possible pseudo, frameshifted CDS 957040..958290 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860152.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(958400..958810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(959098..959745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(960007..960855) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007204.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(960822..961568) product manganese ABC transporter ATP-binding protein MntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398644.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene mntB CDS complement(961591..962034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(962309..963847) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020360.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(963894..964622) product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020356.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(964595..965527) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020357.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(965514..966431) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020358.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(966428..967369) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020359.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(967655..969211) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020360.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(969474..971015) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020360.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(971028..971795) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020355.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(972130..973080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(973114..974865) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141301.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(974862..975848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10030 note possible pseudo, frameshifted CDS complement(975848..976672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 977005..977277 product non-histone chromosomal MC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023527.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 977503..978774 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990611.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 978848..980224 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860152.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 980549..981820 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990611.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(982209..982439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(982529..982978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(983138..983320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 983475..984554 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 984580..984981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(984972..985583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(985622..986995) product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022838.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(986986..988656) product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022839.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 988951..989532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(989703..989933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 990591..990863 product non-histone chromosomal MC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023527.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(990935..992239) product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021688.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene aspS CDS 992696..993205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 993208..993414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 993411..994139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10230 note possible pseudo, frameshifted CDS 994251..996632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 note possible pseudo, frameshifted CDS 996665..996853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(996755..996955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10260 note possible pseudo, internal stop codon CDS complement(997173..998075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(998398..999240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(999400..999717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(999818..1000933) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860150.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(1001356..1001931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(1002016..1004586) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877365.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 1004802..1005854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023363.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(1005928..1006665) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064947.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(1006702..1008126) product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020324.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(1008230..1008658) product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020323.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(1008687..1009640) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(1009870..1010700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10380 note possible pseudo, frameshifted CDS complement(1010814..1012412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10390 note possible pseudo, internal stop codon, frameshifted CDS complement(1012712..1013029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10400 note possible pseudo, internal stop codon CDS complement(1013042..1014871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10410 note possible pseudo, internal stop codon CDS complement(1014903..1015085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(1015156..1017720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(1018116..1018991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10440 note possible pseudo, frameshifted CDS 1019330..1019839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 1019924..1020613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(1020697..1022199) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876746.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene serS CDS complement(1022196..1022426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(1022423..1023745) product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023357.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(1023742..1024101) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020987.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 1024338..1025033 product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496950.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(1025077..1025256) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020483.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(1025329..1027605) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020131.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene nrdD tRNA 1028026..1028098 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 1028169..1028834 product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064923.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 1028845..1029738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 1029772..1030365 product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066526.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 1030362..1031909 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023782.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene proS CDS 1031918..1032901 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085984847.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 1032906..1033742 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022647.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 1033836..1034498 product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022466.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 1034580..1035191 product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879461.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 1035532..1035939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS 1035948..1036697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 1036764..1038122 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061190.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene hisS CDS 1038196..1038951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(1039122..1039337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(1039371..1041257) product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020139.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 1041554..1042393 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020718.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(1042840..1043232) product transcriptional regulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065665.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 1043560..1043739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS 1043785..1045119 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020230.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(1045421..1045690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 1045935..1046162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS 1046418..1047128 product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023580.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(1047220..1049250) product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402998.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 1049381..1050142 product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082088944.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(1050218..1051213) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066059.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene purM CDS complement(1051210..1052595) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020190.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 1052764..1054959 product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021278.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 1055029..1056303 product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021277.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene tuf CDS 1056329..1056637 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021276.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene rpsJ tRNA 1056738..1056811 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS complement(1056881..1057096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(1057210..1057428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 1058056..1058865 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023894.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 1059059..1059613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(1059845..1062172) product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209617549.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 1062282..1062764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(1062805..1063818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(1063868..1064557) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066013.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(1064615..1064821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 1064951..1065541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 1065651..1066148 product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943250.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 1066200..1067306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(1067371..1067859) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021819.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 gene ribC CDS complement(1067940..1069184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(1069366..1070046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022686.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 1070733..1071071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(1071663..1071842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(1071977..1072477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10990 note possible pseudo, frameshifted CDS complement(1072474..1072683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(1072763..1073782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(1074613..1076061) product funZ protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957049.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 1076247..1077338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 note possible pseudo, frameshifted CDS 1077304..1077819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11040 note possible pseudo, frameshifted CDS complement(1078391..1078570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 1078664..1079404 product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066008.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 1079535..1080611 product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020695.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene priS CDS 1080691..1081257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 1081270..1081545 product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020693.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 1081548..1081715 product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878831.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 1081758..1082495 product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064935.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 1082650..1083420 product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878032.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 1083395..1084729 product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065661.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 1084793..1085647 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021191.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(1085733..1086071) product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941431.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(1086064..1086804) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941430.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(1087028..1087744) product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942367.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(1087741..1090413) product oligosaccharyl transferase, archaeosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065792.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 tRNA complement(1090685..1090758) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(1090744..1090914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 1090956..1091384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(1091412..1091771) product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065925.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene queD CDS complement(1091935..1092750) product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021388.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene dph5 CDS 1092857..1093489 product methyl-coenzyme M reductase I operon protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024421.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene mcrC CDS 1093524..1094699 product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020191.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 1094708..1095658 product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879220.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 1095697..1096722 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065747.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene argC CDS 1096766..1097254 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065746.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 1097241..1098410 product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023478.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 gene argJ CDS 1098412..1099872 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021337.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene argH CDS 1099897..1100796 product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880173.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene rfaD CDS 1100965..1102065 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868579.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 1102088..1103032 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877828.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 1103144..1103917 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012940593.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 1103919..1104743 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877555.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 1105076..1105465 product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023967.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene nikR CDS 1105576..1107045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 1107185..1108009 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065716.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(1108091..1108318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 1108493..1108735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(1108763..1109995) product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064787.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(1110684..1111010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 1111541..1111750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 1112452..1113249 product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876426.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 1113282..1114262 product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108486.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(1114427..1115347) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021489.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 1115435..1115947 product precorrin-6Y C5,15-methyltransferase (decarboxylating) subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024144.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene cbiT CDS 1115941..1116549 product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024143.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 1116546..1117256 product cobalt-precorrin-4/precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024142.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 1117367..1118134 product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903134.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene cbiG CDS 1118136..1119539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 1119542..1120186 product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024140.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 1120167..1121192 product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020570.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 1121189..1121761 product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020569.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(1121813..1122958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(1123057..1123356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 1123689..1123949 product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064806.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 1124098..1124292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(1124247..1125260) product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020659.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(1125248..1125523) product Gar1/Naf1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867430.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 1125768..1126622 product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589523.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(1126631..1127260) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021454.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(1127316..1128101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(1128390..1130057) product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020145.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene thsB CDS 1130243..1130437 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331438.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(1130611..1131267) product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941521.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(1131200..1131619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11660 note possible pseudo, frameshifted CDS complement(1131561..1133009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11670 note possible pseudo, frameshifted CDS complement(1133109..1133567) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene ndk CDS complement(1133570..1133749) product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021537.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(1133746..1133958) product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065141.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(1133969..1134337) product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053845.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene rpl7ae CDS complement(1134452..1135306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(1135329..1136123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11730 note possible pseudo, frameshifted CDS complement(1136180..1136443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11740 note possible pseudo, frameshifted CDS complement(1136601..1136780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11750 note possible pseudo, frameshifted CDS complement(1136833..1137222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(1137229..1137972) product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066594.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 1138184..1140265 product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879431.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 1140331..1140936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 1141100..1141834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(1141916..1143253) product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024460.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(1143325..1146942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(1146920..1147255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(1147353..1147940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 1148161..1149195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 1149513..1149980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(1150143..1150505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990763.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(1150502..1151089) product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020976.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(1151089..1151853) product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020977.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 gene cobS CDS complement(1151850..1152329) product alpha-ribazole phosphatase CobZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065005.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene cobZ CDS 1152422..1152772 product MJ1244 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060970.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 1152756..1152983 product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791779.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 1153004..1153228 product Sm protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021429.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 1153238..1153639 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589516.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(1153721..1154029) product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023951.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene yciH CDS complement(1154099..1156459) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023083.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(1156456..1158198) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023084.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 1158305..1158766 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022827.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 1158784..1160016 product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065549.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 1160018..1160404 product molybdopterin dinucleotide binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065550.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 1160409..1161362 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023243.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene argF tRNA 1161683..1161768 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(1162095..1163135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(1163093..1163542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 1164376..1164996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 1165467..1165784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(1166013..1166552) product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877227.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(1166554..1167609) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064817.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene hisC CDS complement(1167596..1168744) product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066055.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(1168764..1169402) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024487.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 1169456..1170745 product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021793.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 gene thiC CDS complement(1170789..1171088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(1171336..1171749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(1172096..1173256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 1173521..1173763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 1173763..1174527 product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020095.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(1174576..1175256) product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020399.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(1175289..1175696) product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023967.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene nikR CDS 1175837..1176397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066058.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 1176410..1176682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(1176848..1177984) product DUF1646 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878290.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(1177974..1178138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(1178484..1179347) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545447.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(1179399..1180373) product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878512.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(1180391..1181290) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene trxB tRNA 1181442..1181513 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 1181636..1181779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 1181795..1183093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(1183869..1184123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 1184623..1185132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 1185300..1185812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 1186135..1186398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 1186428..1187120 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 1187121..1188041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 1188089..1189303 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393833.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(1189597..1190421) product DUF166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021826.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(1190418..1191212) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939814.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(1191214..1192527) product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080194.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene hcp CDS 1192601..1192960 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056318.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 1193489..1194367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 1194351..1194986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(1195244..1196470) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 1196499..1196696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(1196872..1197078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(1197159..1198355) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060795.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(1198359..1199483) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021211.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(1199568..1199804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(1199907..1200548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(1200565..1201152) product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021058.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(1201149..1202933) product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065029.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene iorA CDS 1203105..1204130 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023617.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 1204168..1204470 product DUF2551 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023626.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(1204629..1206131) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052292216.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 1206308..1207723 product L-aspartate semialdehyde sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021823.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 1207726..1208112 product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065229.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 1208239..1208406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 1208390..1208860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 1208814..1212248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(1212245..1212895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(1212995..1213921) product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020979.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(1213918..1214160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 note possible pseudo, frameshifted CDS complement(1214148..1215242) product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020980.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene cobD note possible pseudo, frameshifted CDS 1215541..1217958 product CO dehydrogenase/acetyl-CoA synthase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879884.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene cdhA CDS 1217979..1218542 product CO dehydrogenase/acetyl-CoA synthase complex subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879885.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene cdhB CDS 1218582..1219988 product CO dehydrogenase/CO-methylating acetyl-CoA synthase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877886.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene cdhC CDS 1220022..1220198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 1220284..1220460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 1220474..1221232 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023761.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 1221244..1222596 product CO dehydrogenase/acetyl-CoA synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021047.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene cdhD CDS 1222593..1224017 product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021046.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene acsC CDS 1224270..1224704 product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021802.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(1224761..1225579) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020266.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene truA CDS complement(1225630..1226919) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589524.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(1226916..1227548) product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762472.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 gene udg CDS 1227630..1227866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(1227871..1228977) product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978812.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 note possible pseudo, frameshifted CDS complement(1229336..1230304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(1230797..1231519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(1231516..1231746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(1233217..1233405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(1233975..1234682) product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459339.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene istB CDS complement(1234686..1236158) product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128955176.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene istA CDS 1236873..1237955 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022001.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene glk CDS 1238106..1239323 product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014128488.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 1239425..1240219 product serine/threonine-protein kinase RIO2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022486.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 1240216..1242237 product DUF460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990592.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(1242597..1246403) product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020926.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene cobN CDS complement(1246926..1247936) product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860356.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 1248272..1250287 product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020921.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 1250292..1251143 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546238.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 1251145..1251882 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211328137.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(1251907..1252887) product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545174.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(1253065..1253580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 1253905..1254735 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273465.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 1254836..1256158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(1256389..1257180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12940 note possible pseudo, frameshifted CDS 1258019..1258372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(1258573..1259031) product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020196.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 1259133..1260635 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066108.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 gene lysS CDS 1260650..1261084 product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023482.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 1261081..1261914 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020802.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 1261972..1262532 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057665.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene pyrE CDS complement(1262599..1263234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 1263441..1264634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 1264606..1265640 product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022056.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 tRNA 1265740..1265813 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS complement(1265810..1265989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(1266027..1266353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS 1266787..1267374 product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762292.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(1267371..1267592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 1267925..1268110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 1268232..1269977 product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096515.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene glyS CDS 1270014..1270679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 1270808..1271455 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357697.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 1271630..1272304 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020429.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene pyrH CDS complement(1272291..1273178) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021408.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(1273300..1274445) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024301.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(1274474..1274755) product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020946.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene hisI CDS 1274860..1276029 product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023953.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(1276176..1278839) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257097.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 1279315..1280877 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020229.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS 1280888..1282543 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021951.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene pheT CDS 1283088..1284404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(1284356..1284757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(1284884..1285114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 1285083..1285526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(1285623..1285826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(1285771..1286022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(1286089..1286247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(1286693..1287907) product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024286.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(1287889..1288623) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876773.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene sufC CDS complement(1288663..1289340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(1289347..1290630) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878303.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene lysA CDS complement(1290754..1292238) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056580.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 1292405..1292575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 1292776..1295103 product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209617549.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 1295093..1296145 product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064850.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 1296214..1296609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 1296687..1297031 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023100.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 1297049..1297516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 1297533..1299032 product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941860.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 1299117..1300088 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066092.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 tRNA complement(1300392..1300477) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(1300828..1301190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(1301530..1302015) product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(1302017..1302631) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene purN CDS complement(1302641..1302910) product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878567.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene albA CDS complement(1303062..1303634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 1303749..1303964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS 1303961..1304437 product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064835.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS 1304541..1305095 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024515.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 1305114..1305320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 1305295..1306074 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024516.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 1306137..1307054 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048168954.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 1307051..1307911 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024518.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 1307911..1308690 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589511.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 1308687..1309808 product RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024521.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 1309802..1311043 product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878773.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 1311336..1311887 product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024211.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 1311972..1314647 product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064990.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(1314727..1315374) product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023336.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 1315880..1316221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 1316218..1317885 product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938901.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 1318106..1319353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 1319634..1320101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 1320232..1320921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(1320942..1321916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(1321949..1322917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 1323377..1324702 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392811.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene glnA tRNA 1324843..1324917 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 1325197..1325505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 1325793..1326638 product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(1326624..1327016) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878970.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(1327041..1327286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(1327358..1327939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13700 note possible pseudo, frameshifted CDS complement(1328082..1328291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13710 note possible pseudo, frameshifted CDS 1328503..1329840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13720 tRNA 1329946..1330021 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(1330034..1330906) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene hisG CDS 1331116..1332057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 1332107..1332622 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877737.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 1332610..1334157 product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020870.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 1334236..1334619 product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020961.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS 1334635..1334847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(1334860..1335294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 1335401..1336297 product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391812.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 1336311..1337111 product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021656.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(1337253..1337873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(1338051..1338515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 1338677..1339204 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065212.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(1339431..1339805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS 1340307..1340477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 1340916..1342322 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990685.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 1342839..1343609 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024130.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 1343711..1344631 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024132.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 1344618..1345454 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065941.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 1345648..1346937 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860152.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 1346986..1347726 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022138.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 1347772..1349046 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250942.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 1349336..1349635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS 1350478..1352145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 1352410..1352922 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876052.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 1353102..1353425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048124573.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(1353928..1354077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(1354128..1354907) product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460477.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(1354904..1355617) product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021850.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(1355910..1357169) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860152.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 1357356..1358291 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020923.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 1358282..1358992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(1359073..1361286) product oligosaccharyl transferase, archaeosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065054.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(1361348..1361899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 1361867..1362016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 1362267..1362644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048124573.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(1362717..1363193) product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020591.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(1363222..1363764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14090 note possible pseudo, frameshifted CDS complement(1363775..1366384) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022402.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene ileS note possible pseudo, frameshifted CDS 1366513..1367484 product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879552.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(1367519..1370812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(1370809..1371357) product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583290.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(1371556..1371840) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938763.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(1371906..1372112) product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014310.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 tRNA 1372459..1372530 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS 1372746..1375424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 1375433..1377319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14170 note possible pseudo, frameshifted CDS 1377325..1377825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14180 note possible pseudo, frameshifted CDS 1378518..1379828 product IS66-like element ISH10B family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289081.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(1379948..1380691) product nitrogenase iron protein NifH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948411.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(1380688..1381959) product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065061.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(1381961..1383289) product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943674.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(1383367..1384263) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065716.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(1384265..1385356) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066493.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(1385359..1386141) product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020954.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(1386148..1386921) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021378.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 note possible pseudo, internal stop codon, frameshifted CDS complement(1387118..1388356) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860152.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(1388368..1389603) product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869577.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 1389811..1390116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 1390086..1390298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 1390364..1390795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 1390732..1391043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(1391873..1392856) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227876.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 1392851..1392994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 1393266..1394024 product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020444.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene zupT CDS 1394074..1395375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 1395506..1396000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 1396000..1396359 product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065940.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 1396381..1397229 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 1397226..1398182 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 1398182..1398769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(1398921..1399880) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249654.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(1399939..1400793) product 7,8-dihydropterin-6-methyl-4-(beta-D-ribofuranosyl)-aminobenzene-5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869799.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(1400894..1402939) product type B DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878196.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(1403297..1403716) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023052.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 1404005..1404196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS 1404147..1404386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 1404391..1404861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14480 note possible pseudo, frameshifted CDS 1404789..1405184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14490 note possible pseudo, frameshifted CDS 1405715..1406476 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012940593.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 1406612..1407289 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877555.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(1407677..1407883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 1410041..1410796 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979881.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(1410950..1411222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(1411387..1412184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 1412836..1413045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 1413215..1414198 product UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980131.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 1414222..1415040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 1416684..1416884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 1416874..1417797 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065032.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 1417842..1418879 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524118.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 1419679..1420146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 1420583..1421302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 1421268..1422434 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895560.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(1422452..1423021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 note possible pseudo, frameshifted CDS complement(1423033..1423473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 note possible pseudo, frameshifted CDS complement(1423479..1424063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 note possible pseudo, frameshifted CDS complement(1425309..1425614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(1427377..1427670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 1427707..1428153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 1428383..1430146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 1430440..1431168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 1431668..1434103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(1434308..1435627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(1437237..1437608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546344.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(1437608..1438597) product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546538.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene cmr4 CDS complement(1438594..1438986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(1438993..1441494) product CRISPR-associated protein Csx11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545561.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(1441568..1442488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(1442485..1443516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 1444525..1446015 product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932680.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(1446042..1446371) product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496854.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 1446683..1447219 product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978534.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 1447243..1447539 product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065930.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 1447573..1447830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 1447802..1447957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 1448097..1448318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 1448456..1449784 product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 1450109..1451746 product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020145.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene thsB CDS 1451828..1452742 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404262.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 1452779..1453750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 1453825..1454325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 1454408..1454683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(1454757..1456613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(1456565..1458454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 1459210..1460913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 1461352..1461690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(1461813..1463045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(1463000..1464367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(1464333..1464746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(1464760..1465389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(1465729..1468056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 1468415..1468627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 1468970..1469161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 1469181..1469831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(1470307..1470489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(1470677..1472410) product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene polX CDS complement(1472579..1473388) product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020491.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 1473583..1474614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS complement(1474688..1475638) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065995.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 1475849..1477624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS 1477729..1478979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 1479218..1479739 product Tfx family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868414.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 1479753..1480478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 1480619..1482178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(1482288..1483028) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990848.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene rsmA CDS complement(1483025..1483606) product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065124.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(1483612..1483956) product RNA polymerase Rpb4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021458.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(1483958..1484248) product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869531.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(1484214..1485569) product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021461.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(1485861..1486088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(1486337..1487662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(1487655..1488341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(1488331..1489920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 note possible pseudo, frameshifted CDS complement(1490050..1490397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 1490882..1492126 product multifunctional 5'-deoxyadenosine/S-adenosyl-L-homocysteine/5'-methylthioadenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871065.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 gene dadD CDS complement(1492161..1493204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(1493290..1493982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 1494014..1494583 product GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022535.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene engB CDS complement(1494555..1495508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(1495534..1495716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(1495743..1496732) product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942048.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene corA CDS 1496788..1496979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 1497233..1497742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 1497817..1498935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 1499031..1499501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS 1499573..1500202 product toll/interleukin-1 receptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022806.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(1500199..1501335) product tyrosine decarboxylase MfnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020065.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene mfnA CDS complement(1501400..1503670) product pyruvate, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878213.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene ppsA CDS 1503862..1504971 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023979.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 1505654..1506106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(1506205..1507176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(1507261..1508259) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755895.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(1508299..1509087) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065716.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(1509389..1510618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15450 tRNA complement(1510998..1511083) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS complement(1511325..1511924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 1512019..1512492 product DUF123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902479.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 1512941..1515463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 1515424..1516611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(1516686..1517042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(1517228..1518043) product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065155.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene pdxS CDS complement(1518293..1521955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(1522301..1522495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 1522802..1524022 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022629.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene pgk CDS complement(1524028..1525038) product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023750.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(1525150..1526193) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065962.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene scpB CDS 1526346..1527986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 1528173..1530116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(1530217..1530936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(1530955..1534479) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024214.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene smc CDS 1534692..1535930 product methyl coenzyme M reductase-arginine methyltransferase Mmp10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024424.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene mmp10 CDS 1536030..1537166 product TIGR04083 family peptide-modifying radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023249.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 1537203..1537430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 1537360..1537812 product DUF2124 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021715.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 1537947..1538672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 1538814..1539521 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249502.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(1539600..1540385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(1540505..1540888) product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023881.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(1540924..1542027) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021402.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(1542024..1542530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065104.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 1542596..1543039 product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779558.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS 1543194..1544414 product YcaO-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876618.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 1544368..1545021 product TfuA-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020222.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 1545142..1546044 product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020997.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene nadA CDS complement(1546152..1549712) product DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024425.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(1549709..1550137) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249520.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 1550598..1551560 product methanogenesis marker 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024078.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 1551569..1552384 product methanogenesis marker protein Mmp4/MtxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065223.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene mtxX CDS complement(1552419..1552865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(1553110..1554234) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(1554808..1556328) product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene gpmI CDS complement(1556359..1557015) product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877550.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(1556997..1557479) product HVO_0476 family zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020594.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 1557680..1557892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS 1558265..1558876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 1559041..1559253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(1559212..1559901) product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016533.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 1560039..1562006 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023255.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene uvrB CDS 1562068..1563489 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485723.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(1563696..1563851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS 1564021..1564140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(1564358..1564621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 1565200..1565670 product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990736.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(1565806..1566651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 1566816..1566980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(1567745..1568230) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249309.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene moaC CDS complement(1568233..1569651) product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021194.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 1569966..1570532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(1570698..1571612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(1571648..1572205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(1572213..1573079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(1573179..1573853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 1574171..1575574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(1575811..1578678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 1578820..1579005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(1579021..1579557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(1579567..1580373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(1580581..1581849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(1582186..1583169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 1583307..1583744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16100 note possible pseudo, frameshifted CDS 1583713..1584099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16110 note possible pseudo, frameshifted CDS 1584670..1585047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(1585069..1586160) product DUF1646 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878290.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(1586187..1586519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS complement(1586871..1587527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 1587703..1588104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(1588246..1588458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 1588801..1589205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(1589353..1589796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 1589925..1590809 product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869781.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 1590905..1591180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 1591435..1592013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 1592161..1593453 product methyl-coenzyme M reductase glutamine C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496936.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(1593574..1595253) product coenzyme-B sulfoethylthiotransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024419.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 gene mcrA CDS complement(1595268..1596035) product coenzyme-B sulfoethylthiotransferase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024420.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene mcrG CDS complement(1596038..1596541) product methyl-coenzyme M reductase operon protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024422.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene mcrD CDS complement(1596552..1597856) product coenzyme-B sulfoethylthiotransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024423.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene mcrB CDS 1598515..1600086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16280 note possible pseudo, frameshifted CDS 1600083..1600817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16290 note possible pseudo, frameshifted tRNA complement(1600940..1601014) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA complement(1601024..1601112) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS 1601170..1602207 product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020699.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 1602295..1602699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16310 note possible pseudo, frameshifted CDS 1602741..1603154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16320 tRNA 1603145..1603219 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS 1603547..1604026 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020962.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS 1604023..1605231 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020963.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 1605304..1605906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(1605937..1606623) product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021712.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(1606892..1608337) product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060885.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(1608338..1609381) product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060884.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene vorB CDS complement(1609384..1611285) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065557.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(1611307..1611888) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876339.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(1612266..1612631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(1613119..1613532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS 1613663..1614697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(1614747..1615220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(1615279..1616154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 1616317..1617135 product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403240.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(1617109..1618353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(1618645..1621791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(1622777..1623490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 1623791..1624867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 1624887..1625093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(1625149..1625853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 1626502..1627224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(1627270..1627737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16540 tRNA complement(1628307..1628380) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS complement(1628562..1629743) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065771.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(1629937..1630170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(1630559..1631806) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871132.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(1631971..1633755) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023586.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(1633763..1634461) product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146498.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(1634579..1636039) product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065226.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(1636040..1636468) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022180.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 1636623..1638107 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020720.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 1638124..1638939 product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877512.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 1638954..1639352 product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066255.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 1639419..1639850 product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064389.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 1639880..1640158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16660 note possible pseudo, internal stop codon CDS 1640174..1640356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16670 note possible pseudo, internal stop codon CDS complement(1640497..1640694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(1640787..1641254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS 1641351..1641899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 note possible pseudo, frameshifted CDS complement(1641969..1643033) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262757.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS 1643200..1643628 product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978745.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene rnhA CDS complement(1643765..1644121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(1644057..1645190) product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022383.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(1645879..1647354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16750 note possible pseudo, frameshifted CDS complement(1647266..1649452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16760 note possible pseudo, frameshifted CDS complement(1649453..1649896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909402.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(1650266..1650448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(1651160..1651660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16790 note possible pseudo, frameshifted CDS complement(1651657..1651866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(1652019..1652963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 1653975..1654922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS 1654919..1655917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(1656836..1657783) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020627.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene hemB CDS complement(1657853..1659019) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020626.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 gene hemA note possible pseudo, frameshifted CDS complement(1658979..1659683) product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020625.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(1659693..1660163) product siroheme decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064915.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene ahbB CDS complement(1660163..1662298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 1662417..1663685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 1663732..1664820 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020599.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene aroC CDS 1664853..1666622 product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024230.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(1666591..1666839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 note possible pseudo, frameshifted CDS complement(1666745..1667614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16930 note possible pseudo, frameshifted CDS complement(1667611..1668345) product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020169.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(1668397..1668657) product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878730.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 1668788..1669453 product DUF5612 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878900.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(1669450..1669698) product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064801.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(1669770..1670105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 1670380..1670610 product archaeal histone HpkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250364.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene hpkA CDS 1670614..1672518 product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022814.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 gene gatE CDS 1672545..1673645 product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020144.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 1673769..1674656 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020932.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene pstC CDS 1674658..1675905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(1675994..1676455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(1676786..1677067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 1677691..1677999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 1678002..1678346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(1679345..1679731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17080 note possible pseudo, frameshifted CDS complement(1679700..1680137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17090 note possible pseudo, frameshifted CDS 1680784..1681737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 1682052..1682972 product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022970.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 gene rnz CDS complement(1683047..1683601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 1683867..1684967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 1684964..1686685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 1687067..1688614 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860413.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS 1688644..1689393 product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065715.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 1689401..1689967 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023254.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 1690228..1692861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS complement(1692967..1693320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(1693566..1696151) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene fdhF CDS 1696542..1697666 product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092826.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene acuC CDS complement(1697648..1699540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 1699689..1699844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 tRNA 1699991..1700076 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS complement(1700544..1701494) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482305.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene glpQ CDS 1701883..1702962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 1703282..1703920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 1704113..1704328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS 1704371..1705156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(1705212..1705547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(1705800..1706078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 1706188..1707738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(1707920..1709020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(1709037..1709243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS complement(1709355..1709564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 1709921..1710181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 1710412..1711596 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066363.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 1711893..1712351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 1712713..1721622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 1721777..1723030 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065179.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene eno CDS 1723130..1723441 product DUF5611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065922.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(1723453..1724556) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061035.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS 1724648..1725883 product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289167.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(1726011..1727684) product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020145.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene thsB CDS 1728143..1729174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(1729126..1729380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 1729342..1730013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 1730650..1730922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 1730944..1731753 product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020999.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 1731868..1732983 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022844.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 1733200..1734216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 1734268..1735896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17510 note possible pseudo, frameshifted CDS 1735940..1737082 product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583973.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS 1737072..1740251 product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021188.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 1740248..1740454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(1740624..1741337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17550 note possible pseudo, frameshifted CDS complement(1741438..1741809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 note possible pseudo, frameshifted CDS complement(1741797..1742207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS 1742338..1743186 product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392998.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS 1743183..1743716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17590 note possible pseudo, internal stop codon, frameshifted CDS 1743682..1744128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17600 note possible pseudo, internal stop codon, frameshifted CDS complement(1744294..1745727) product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368063.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 gene gabD CDS 1745969..1746295 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990605.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 1746612..1747421 product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080596.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene larE CDS 1747418..1748677 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061297.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS 1748724..1749482 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393662.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene fdhD CDS 1749490..1750392 product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879092.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(1750573..1752744) product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(1753072..1753884) product late competence protein ComER inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020551.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene comER CDS complement(1753881..1754249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065385.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(1754322..1755083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(1755089..1755367) product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251068.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene moaD CDS complement(1755505..1755888) product DUF1894 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020188.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(1755885..1756334) product DUF1890 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020187.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(1756516..1757337) product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020313.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(1757327..1757509) product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061136.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(1757637..1758116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS 1758292..1758537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS complement(1759676..1760437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(1760511..1761461) product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066005.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene mptA CDS complement(1761462..1761653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS 1761771..1762427 product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877913.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS complement(1762491..1763102) product undecaprenyl diphosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024281.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS 1763166..1764380 product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021658.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS 1764524..1764925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17840 note possible pseudo, frameshifted CDS 1764874..1765386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17850 note possible pseudo, frameshifted CDS 1765517..1766398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(1766776..1767909) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021821.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS complement(1767913..1768359) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021820.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 gene ribH CDS 1768439..1769305 product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065968.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene ilvE CDS complement(1769338..1769757) product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868534.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 1770386..1771195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS 1771764..1772396 product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261778.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(1772539..1773426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS 1773830..1775980 product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS 1775964..1776182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 1776299..1776916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 1776909..1777904 product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879792.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 1777905..1778396 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879795.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 1778403..1779608 product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879796.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 1779685..1781040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS 1781159..1781491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(1782127..1783488) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066384.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 1783754..1784098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 1784911..1785291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 1785429..1785770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(1786172..1786840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 1786920..1787438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 1787488..1788171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(1788295..1789344) product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024505.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 gene rtcA CDS complement(1789438..1790772) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943960.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(1790820..1791389) product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023516.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 1791526..1791786 product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020862.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 1791827..1792453 product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(1792580..1793263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS 1793728..1795785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18150 rRNA 1796323..1797785 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 tRNA 1797909..1797981 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 rRNA 1798125..1800998 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 rRNA 1801136..1801252 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 CDS complement(1801817..1802710) product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393238.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(1802720..1803058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(1803153..1804034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18180 note possible pseudo, frameshifted CDS complement(1804035..1805366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(1805923..1806618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18200 note possible pseudo, frameshifted CDS complement(1806662..1807216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(1807971..1808243) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021698.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(1808256..1808507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(1808846..1809160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 1809790..1810950 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 1810964..1811260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS complement(1811318..1811548) product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089200.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS 1811970..1812302 product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943454.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS complement(1812386..1813345) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878279.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS 1813531..1813683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(1813754..1814398) product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021972.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(1814383..1814979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(1815191..1816054) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023435.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(1816051..1817295) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583175.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS 1817478..1817930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020180.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(1817938..1819791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 1819925..1820839 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249816.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 1820885..1821949 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860150.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS 1822973..1823197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 1823194..1823340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(1824029..1824697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 note possible pseudo, frameshifted CDS complement(1824730..1825299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18420 note possible pseudo, frameshifted CDS complement(1825502..1825885) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064210.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(1825882..1826100) product antitoxin VapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878978.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS 1826508..1826840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS 1826899..1827846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18460 note possible pseudo, frameshifted CDS complement(1827982..1828809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS complement(1828820..1829491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS complement(1830269..1830433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(1830704..1831861) product DUF2117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869557.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(1832264..1832545) product DUF2098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060902.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(1832629..1833096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023265.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(1833168..1833320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(1833380..1834690) product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020367.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(1834677..1835090) product molybdopterin dinucleotide binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020366.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(1835087..1835893) product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066575.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(1835881..1837683) product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024063.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(1837683..1838714) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020363.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(1838906..1839064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(1839055..1839903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18600 note possible pseudo, frameshifted CDS complement(1839914..1842478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS complement(1842475..1842987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(1842990..1843484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18630 note possible pseudo, frameshifted CDS complement(1843459..1843746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 1843930..1844709 product archaeosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064816.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene artA CDS 1844706..1845173 product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020174.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 note possible pseudo, frameshifted CDS 1845176..1845394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS 1845391..1846062 product archaetidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020175.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS 1846158..1846307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(1846425..1847339) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024387.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 gene guaA CDS 1847636..1848901 product methanogenesis marker 16 metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023232.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS 1849245..1849772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 1849939..1851117 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029637.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(1851137..1851610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS complement(1851703..1852074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(1852288..1853331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS complement(1853764..1854063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS 1854252..1855409 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870834.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(1855410..1855655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 1857241..1857618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18800 note possible pseudo, internal stop codon, frameshifted CDS 1857801..1857920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 1857993..1858181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(1858285..1859322) product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085150668.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(1859721..1860164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18840 note possible pseudo, frameshifted CDS complement(1860137..1860457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 1860718..1860969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(1862090..1862947) product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929150.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS 1864066..1864695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 sequence2 source 1..494935 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..597 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066032.1:TatD family hydrolase locus_tag LOCUS_18890 CDS 622..840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS 828..1322 product TIGR00288 family NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065830.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 1347..2102 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148183444.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 2272..2688 product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365680.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 2783..3652 product geranylfarnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024038.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS 3625..4788 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065913.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS complement(4891..6600) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941764.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 6756..7814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS 7966..9162 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020758.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS 9188..9634 product DUF61 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870736.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 9675..10226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 10263..11693 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023132.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene thiD CDS 11772..11987 product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878411.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS 11980..12855 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024349.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene dapA CDS 12852..13646 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024350.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 gene dapB CDS 13643..14068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(14668..15168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(15783..16664) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140081.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(16661..16990) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140080.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 17190..20129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(20779..21216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19100 note possible pseudo, frameshifted CDS 21912..22334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS 22335..27632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(28249..28416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(28362..28970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(28937..31333) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021621.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 gene leuS note possible pseudo, frameshifted CDS complement(31335..32519) product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546563.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 32728..35100 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023138.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 35097..36371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS 36346..37224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS 37228..37857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS 37924..38421 product sulfopyruvate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876830.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene comD CDS 38418..38978 product sulfopyruvate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876831.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene comE CDS complement(38947..40263) product methanogenesis marker 16 metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023232.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 40535..41530 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020124.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 41661..42455 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020123.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 42499..43689 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020274.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS complement(43724..44584) product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582908.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(44628..45557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS 45726..46670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(46730..47437) product NrpR regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020866.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS 47559..48272 product RNA ligase partner protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021001.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(48442..48936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19320 note possible pseudo, frameshifted CDS complement(49025..50593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19330 note possible pseudo, frameshifted CDS 50948..51292 product DUF555 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021390.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS complement(51346..53661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(54030..54209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS 54304..54456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS 54585..55886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 55934..56650 product Dna2/Cas4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879670.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS 56728..57369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 57751..58854 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496792.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS 59033..59371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(59429..60205) product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064991.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(60338..61132) product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064991.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(61352..62110) product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021299.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(62103..62996) product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066198.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(62993..64189) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065075.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 gene coaBC CDS 64506..64652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19480 repeat_region 64914..65315 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtatccatgtctgaaaggacgtggcccaattgaaac CDS complement(67392..67883) product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020492.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 68107..68802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(68837..69232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS 69886..70656 product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021309.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 70695..70973 product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249515.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene albA CDS 71042..72355 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250059.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 gene glmM CDS 72556..73467 product S-layer glycoprotein N-glycosyltransferase AglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024210.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 gene aglJ CDS complement(73499..77833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(77830..79410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS 79612..80055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS 80065..80196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 80174..80482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(80486..80635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS 80733..82127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS 82124..83584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 83670..84386 product alanyl-tRNA editing protein AlaXM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022008.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene alaXM CDS complement(84518..84694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 84753..85067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19660 note possible pseudo, frameshifted CDS 85064..85246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS complement(85566..85847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS complement(85904..86296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS complement(86747..87247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(87693..88001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS 88000..88701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 89500..89868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 89865..90689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS 90968..91924 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023086.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 91943..92800 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023085.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 92822..94063 product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860456.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 gene larA CDS 94179..94682 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066037.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 gene rimI CDS complement(94831..95388) product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860416.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 gene radB note possible pseudo, frameshifted CDS complement(95404..96003) product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020740.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(96000..97010) product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020739.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(97017..97988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS 98269..98718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 98802..99272 product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064945.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(99342..99701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS 99930..100439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 100526..100939 product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868448.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 101467..101772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 101800..102588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS 102864..103145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS 103199..104098 product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066118.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS 104071..104865 product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020633.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 105017..105733 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879714.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(105787..106584) product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024464.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(106675..106794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS 108307..109761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19960 note possible pseudo, frameshifted CDS 109871..111520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19970 note possible pseudo, frameshifted CDS 112205..112381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS 114101..117139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 note possible pseudo, frameshifted CDS 118759..119394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS complement(119532..119843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 121390..121776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS 121836..122738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS 123622..124974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 125654..126310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS 126319..126663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS 126750..126959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS 126956..127216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20080 note possible pseudo, frameshifted CDS 128708..132289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS 132883..133107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(133051..133266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(133427..133915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(133945..134430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(134497..135003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(135112..135375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 135496..136578 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942946.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS 136809..137798 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393185.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS 137815..138285 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022482.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS 138658..140124 product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787371.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS 140180..140755 product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392800.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS 140905..141294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(141396..142115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS 142535..143485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(143606..144364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS complement(144601..145302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(146105..146542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20260 note possible pseudo, frameshifted CDS complement(146721..147128) product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024057.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(147394..148386) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020113.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(148425..149768) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene thrC CDS complement(149773..150633) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023985.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS complement(150630..151067) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022818.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(151088..151894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS 151862..152254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS 152417..153100 product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023984.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS 153138..153314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS 153416..153796 product tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065620.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS 153956..155212 product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249826.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 155230..155988 product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024199.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS 155989..156954 product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023637.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 gene mer CDS 157070..157624 product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065785.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(157741..158841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 note possible pseudo, frameshifted CDS complement(158745..160253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20420 note possible pseudo, frameshifted CDS 161002..163197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS complement(163292..165712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(165784..166194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(166191..166451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(166726..167775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 167979..168875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 168869..169681 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083333.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS 170512..170706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS 170703..170870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS complement(171563..171865) product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940736.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 gene cas2 CDS complement(171865..173526) product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 gene cas1 CDS complement(173935..174894) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066119.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(174926..176263) product RNase J family beta-CASP ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020654.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS complement(176260..177357) product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020653.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 gene fni CDS complement(177354..178106) product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020652.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(178123..178344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(178316..179077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20590 note possible pseudo, frameshifted CDS complement(179090..179806) product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020650.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS complement(179886..180488) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020649.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 gene rpsB CDS complement(180521..180700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20620 tRNA complement(180727..180801) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS complement(180805..180990) product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020647.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(180997..181395) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020646.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS complement(181406..181825) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020645.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS complement(181831..182190) product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064921.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS 182472..183743 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021968.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS complement(183892..184545) product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860472.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(184978..185880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS complement(185870..186139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS complement(186136..186462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022118.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS complement(186569..187546) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066456.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(187743..188015) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065637.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 gene trxA CDS complement(188015..188497) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785477.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS complement(188499..189464) product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 gene ahbD CDS complement(189494..190522) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020482.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 gene asd CDS complement(190619..191188) product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459982.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS 191551..192831 product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544926.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS 192958..193158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(193234..193962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20800 note possible pseudo, internal stop codon CDS complement(193966..194127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20810 note possible pseudo, internal stop codon CDS complement(194155..195681) product alternate F1F0 ATPase, F1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022405.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(195647..196459) product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022406.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS complement(196469..196747) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328511.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS complement(196760..197461) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022408.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(197449..197751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS complement(197748..198065) product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022410.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS complement(198065..198451) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120166.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS complement(198448..199788) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065404.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 gene atpD CDS complement(199979..200431) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022482.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(200515..201924) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065634.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 gene purF CDS complement(202196..202414) product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023130.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS 202506..202988 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023779.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 202990..203697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20940 note possible pseudo, frameshifted CDS 203906..204187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS 204277..204750 product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545207.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS 204734..206074 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020936.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 206115..206573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS complement(206779..206958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 206908..207720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS 208021..208269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21010 tRNA complement(208325..208398) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS complement(208586..208834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS 208998..210155 product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 gene nifS CDS 210646..210897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS complement(211033..212070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS 212259..214373 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065884.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene metG CDS 214386..216119 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060755.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS 216126..217241 product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024513.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS 217521..218264 product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023460.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 gene radA note possible pseudo, frameshifted CDS 218546..220069 product methanogenesis marker 14 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024395.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS 220164..220832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(221051..221716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS 221839..222645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS complement(222833..225274) product DUF5814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021427.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS complement(225296..226084) product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589532.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS complement(226084..226602) product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022953.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS complement(226666..228573) product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023770.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS complement(228594..229214) product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023769.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 gene psmB CDS 229476..230219 product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066525.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(230461..231924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21200 note possible pseudo, frameshifted CDS complement(231917..232969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21210 note possible pseudo, frameshifted CDS complement(232995..233525) product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065175.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(233522..233800) product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021663.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(234086..234817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS 236258..237397 product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061240.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS 237484..238359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS 238506..239645 product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060968.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS 239854..241059 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061302.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS 241056..241694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS complement(241790..244306) product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402038.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 gene mgtA CDS complement(244522..245646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990679.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 245810..246694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS complement(246887..247708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(247854..248252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 248394..249002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 249238..249654 product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061251.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 tRNA 249911..249984 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS complement(249995..251554) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023256.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 gene uvrC CDS complement(252398..252997) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022682.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 gene thiE CDS complement(252994..253815) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022683.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 gene thiM CDS complement(253948..255525) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020641.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 gene serA CDS complement(255816..257048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(257136..259061) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS 259835..261517 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064797.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 gene argS CDS 261916..262611 product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021474.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS 262608..262886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021475.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS 262918..263853 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941155.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(263957..265297) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020186.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 265644..265925 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024398.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 gene gatC CDS 265922..267346 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066007.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 gene gatA CDS 267347..268762 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024400.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 gene gatB CDS 268940..269161 product heavy metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707532.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS 269306..269599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS complement(269578..269781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS 270364..271143 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211328137.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS complement(271415..271633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(272142..272435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS 272755..272931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS 272937..273233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(273994..275547) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868685.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS complement(275563..275727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS complement(275849..276109) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021698.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS complement(276115..276279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS complement(276339..276608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21630 note possible pseudo, internal stop codon, frameshifted CDS complement(276605..276733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS complement(277210..277395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(277557..277898) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877824.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(277988..278173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS complement(278943..279092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21680 note possible pseudo, internal stop codon, frameshifted CDS complement(279503..280618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(280653..283739) product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966800.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS 283836..284147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS complement(284164..284376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS 284505..285959 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024491.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS 286155..287459 product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023751.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS 287528..287962 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023752.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS 288071..288508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21760 note possible pseudo, frameshifted CDS 288477..288896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21770 note possible pseudo, frameshifted CDS 289244..290914 product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878252.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS 290911..291762 product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878253.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS 291798..291959 product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869872.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 292014..292535 product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875797.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(292608..293045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS 293118..294491 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878982.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene tgt CDS 294572..295315 product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080883.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS 295510..296364 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021378.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS 296866..297318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21860 note possible pseudo, frameshifted CDS 297345..297914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21870 note possible pseudo, frameshifted CDS 298024..298644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS 298733..299944 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066555.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 gene purB CDS 300102..300548 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496456.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS 300542..300763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS 300895..301479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS 301494..302390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS 302909..303130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS 303157..303384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS 303326..303652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS 305367..306074 product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459339.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene istB CDS 306219..307076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(307317..307652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 307820..308080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS 308498..310069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS 310002..310652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS 310654..311157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(311183..311647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS 311773..312210 product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 gene mscL CDS 312449..313756 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140384.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 313806..314468 product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877949.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 gene queC CDS 314550..315092 product hypoxanthine/guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871179.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 gene hpt CDS 315103..315405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS 315689..316189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS 316237..317652 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021657.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS 317649..318620 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024160.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS 320975..321991 product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877877.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS 322077..322922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(322956..323216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(323557..324186) product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023341.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(324404..324652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS complement(324725..325636) product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903919.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS 325861..326109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS 326128..326673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS 326691..329549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS complement(329703..331877) product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064996.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS 331927..332655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 332915..333736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22240 note possible pseudo, frameshifted CDS 333882..335897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS 336176..336382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS 336379..337350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22270 note possible pseudo, frameshifted CDS complement(337385..337513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS 337694..338125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS 338115..338819 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024480.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 gene tpiA CDS 338820..339089 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545551.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS 339104..339274 product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065133.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS 339271..340446 product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021498.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(340505..340807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(340764..341054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS 341419..341808 product transcriptional regulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065665.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS complement(341940..342200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 342684..343931 product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927136.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS 344063..344839 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020590.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 gene hisF CDS complement(345066..346112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS complement(346109..346351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS 346929..347744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS complement(347874..348806) product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020436.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS 348960..350345 product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860393.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 repeat_region 350510..353920 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccttgttttcgtggaacttgctcttgatg CDS complement(354088..354738) product CRISPR-associated endonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065262.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS complement(354766..356514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22460 note possible pseudo, frameshifted CDS complement(356450..356740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(356763..357374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22480 note possible pseudo, frameshifted CDS 357675..358652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22490 repeat_region 359116..360689 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attgcaaagctcatcccgacgaaaagggaattgaaa repeat_region 360710..363937 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tgcaaagcacatcccgacgaaaagggaattgaaac CDS 364040..364273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS 364563..364889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22510 note possible pseudo, frameshifted repeat_region 365003..368008 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attgcaaagcacatcccgacgaaaagggaattgaaac CDS complement(368045..369421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS complement(371157..372242) product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258799.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 gene cas7i CDS complement(372256..372627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS 373881..374915 product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258803.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene cas1 CDS 374947..375225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS 375233..375844 product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879370.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 gene cas4 CDS 375876..376823 product type I-A CRISPR-associated protein Cas4/Csa1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977960.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 gene cas4a CDS complement(377048..378166) product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020662.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS complement(378175..378753) product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082088841.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(378767..380479) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020888.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS complement(380473..381495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(381485..382471) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020886.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS complement(382545..382976) product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082829.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 gene tsaA CDS complement(383177..384778) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860413.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS complement(384918..385538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 386319..387071 product disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064949.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS 387073..388443 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020733.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS complement(388499..389653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS complement(389658..390863) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065738.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 gene folP CDS complement(391016..391801) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095630.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS complement(391785..392765) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878797.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(392805..393803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS complement(395644..396450) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927154.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS complement(396450..397211) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(397208..398131) product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876243.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(398497..399318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(399853..401508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS complement(401423..401842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22790 note possible pseudo, frameshifted CDS 401808..401966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(402299..404710) product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932772.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS 405205..406599 product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS complement(406893..408095) product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279118.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS complement(408096..409283) product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279118.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS complement(409348..410304) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021156.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS complement(410301..411383) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065044.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS complement(411590..412627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS 412994..413239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(413281..414168) product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393027.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 repeat_region 414957..415211 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaattgggccacgacttttcagccatggatac repeat_region 416413..416730 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaattgggccacgtcctttcag CDS complement(417135..417290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(417435..417836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22910 repeat_region 417923..418701 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaattgggccacgacttttcagccatggaaat CDS 419675..420811 product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023374.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS complement(420753..420929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS 420928..421773 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066550.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS 421803..422585 product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020954.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS 422582..423712 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066493.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS 423709..424497 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065716.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS complement(424611..426551) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066516.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS 427322..428974 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020884.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS 428979..429842 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064977.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS 429880..430878 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020886.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS 430875..431858 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064978.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS 431855..433591 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020888.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS 433843..434829 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081632.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS 434835..435605 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224893.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS 435598..436620 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250918.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS 436674..437579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS complement(437646..438188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS complement(438236..438424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS complement(438885..439319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS complement(439396..439875) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065176.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS complement(439929..440480) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065176.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS complement(440565..440816) product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023444.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS complement(440897..442177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23140 note possible pseudo, frameshifted CDS complement(442153..443109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23150 note possible pseudo, frameshifted CDS 443286..444983 product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937748.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 gene ade CDS 445048..445323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS 445431..445706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 445703..445948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23190 note possible pseudo, frameshifted CDS 445881..446804 product TIGR04013 family B12-binding domain/radical SAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020300.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 note possible pseudo, frameshifted CDS complement(446801..447136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS complement(447178..448158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 448072..448383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 449422..449904 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755995.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS 449949..450209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(450454..450645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS 450554..450871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(451131..451982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS 452116..453600 product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS 453597..455453 product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064995.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS complement(455695..456360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23310 tRNA complement(456586..456671) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS complement(456719..457513) product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053732.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS complement(457517..457906) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021138.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS complement(457907..458443) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021137.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS complement(458352..458996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS complement(459178..459600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS complement(459666..460475) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065502.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS 460744..462150 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876966.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS complement(462445..464232) product archaeosine synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024500.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 gene arcS CDS complement(464393..465784) product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024298.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 gene tgtA CDS 465870..466361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS complement(466424..468376) product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393382.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS 468418..468570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23430 rRNA 468866..470330 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 tRNA 470455..470527 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 rRNA 470666..473552 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 rRNA 473686..473803 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00060 CDS 474525..474995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23440 note possible pseudo, frameshifted CDS 474923..475351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23450 note possible pseudo, frameshifted CDS complement(475616..478630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS complement(478627..481485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS complement(481688..482155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS 482616..483059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909402.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS 483586..486276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS 488067..489002 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022154.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS 489046..489318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS 491231..491608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS 491774..491893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS 491919..492908 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808328.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS 492917..493588 product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533115.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS 493566..493715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23570 sequence3 source 1..141151 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(765..1034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23580 note possible pseudo, internal stop codon, frameshifted CDS complement(1172..1321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23590 note possible pseudo, internal stop codon, frameshifted CDS complement(2452..2598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS complement(2756..2911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23610 tRNA complement(4015..4090) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS complement(7638..7835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS complement(8760..9005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS complement(9351..9524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS complement(9755..10273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23650 note possible pseudo, internal stop codon, frameshifted CDS 12492..12746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23660 note possible pseudo, frameshifted CDS complement(13660..14457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS 14755..17022 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878955.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS complement(17625..18365) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890732.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS complement(18518..18778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(18847..19008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(19043..19222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23720 tRNA 19534..19625 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS 19756..20697 product eukaryotic peptide chain release factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021302.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS 20802..21629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS complement(21803..22864) product 5-amino-6-(D-ribitylamino)uracil--L-tyrosine 4-hydroxyphenyl transferase CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878301.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 gene cofH CDS complement(22973..23461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902326.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS complement(23424..24329) product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902327.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS 24469..24696 product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011033302.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS 24827..25711 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064299.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS complement(25832..26236) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065151.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(26387..27775) product Ni-sirohydrochlorin a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023534.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene cfbB CDS complement(27810..28454) product Ni-sirohydrochlorin a,c-diamide reductive cyclase ATP-dependent reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023535.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 gene cfbC CDS 28401..28622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS 28823..31792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(31852..32379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS 32647..33717 product formate--phosphoribosylaminoimidazolecarboxamide ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064840.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS 33830..35098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS 35142..35705 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022955.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS complement(35712..36206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS 36347..36706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 36914..37120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS 37117..38712 product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877458.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS complement(38771..39928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS complement(40168..40383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS complement(40429..40614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS 40725..41396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS complement(41566..42741) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024280.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS complement(42773..43870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS 43945..44955 product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021488.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS 45032..45466 product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021802.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS 45706..46266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS complement(46344..47738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS complement(47775..49649) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 gene nuoF CDS complement(49731..50345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(50829..51185) product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS complement(51208..53286) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS 53794..54573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS complement(54576..55433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS complement(55430..55996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS complement(55986..56654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS complement(56644..58734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS complement(59411..59560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS 59535..59789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS complement(59883..60116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS complement(60513..61586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868135.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS 61580..61747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS complement(61903..62316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(62304..62483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24180 tRNA complement(62627..62698) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS complement(62776..63045) product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021485.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS complement(63253..63870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS 64374..64796 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020172.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS 64865..66556 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064918.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS complement(66691..67425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS complement(67561..67971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS complement(68320..68901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(69343..69762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS complement(69880..70818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 71031..71354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS complement(71527..72729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS complement(73151..73810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS complement(74462..74659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS complement(74709..75266) product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020756.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS complement(75347..76258) product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021005.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS 76405..76809 product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179273.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 gene nuoA CDS 76800..77372 product F(420)H(2) dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021510.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 gene fpoB CDS 77387..79099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS 79112..80164 product F420H2 dehydrogenase subunit FpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065137.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 gene fpoH CDS 80177..80758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS 80758..81186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24390 note possible pseudo, frameshifted CDS 81173..81436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS 81475..81777 product F420H2 dehydrogenase subunit FpoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589525.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 gene fpoK CDS 81781..83166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24420 note possible pseudo, frameshifted CDS 83163..83792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24430 note possible pseudo, frameshifted CDS 83789..85291 product F(420)H(2) dehydrogenase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021519.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene fpoM CDS 85293..86795 product F(420)H(2) dehydrogenase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021520.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 gene fpoN CDS 86892..88052 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022460.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS complement(87976..88779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS 89098..89421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS complement(89467..92397) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023257.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 gene uvrA CDS complement(92424..93059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS 93165..93344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS 93762..94784 product type III-B CRISPR module RAMP protein Cmr1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200855653.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 gene cmr1 CDS 94784..95977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS 95974..98898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS 99230..99976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS 99966..100397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546344.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS 100400..101266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545127.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS 101908..102444 product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979773.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS 102594..102872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS 103005..104144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS complement(104517..105911) product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903175.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 gene hmgB CDS 106045..106263 product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084181.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS 106435..106632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS complement(106649..108223) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878560.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS complement(108519..110441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS complement(111236..111640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS complement(111752..111946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS complement(112003..112770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS complement(112772..113377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS 113545..113982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24700 note possible pseudo, frameshifted CDS 113951..114337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24710 note possible pseudo, frameshifted CDS complement(114568..114777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(115372..116976) product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877763.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 gene pyrG CDS complement(116980..117138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS 117279..117542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS complement(117539..118201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS complement(118437..118679) product methytransferase partner Trm112 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023214.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS complement(118680..119816) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065160.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS complement(119873..121564) product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021597.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS complement(121726..121956) product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021598.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS complement(122005..122859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(122861..124090) product replication protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022958.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS 124456..125295 product NOP5/NOP56 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902847.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS 125392..126000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(126066..126977) product DUF2099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022219.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS 127184..128302 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064630.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 gene ftsZ CDS 128482..128790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289276.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS 128791..130428 product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320246.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS 130425..131276 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249143.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS 131577..132422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS 132374..132712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS 132995..133468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS complement(133565..134572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS complement(134615..135298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS 135180..135509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS complement(135487..136233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS complement(136397..137278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS 137907..138230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS 138154..138450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS 138566..138835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS 138855..139043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS complement(140289..140462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25020 note possible pseudo, internal stop codon, frameshifted