>Feature sequence1 356 529 gene locus_tag LOCUS_00010 356 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00010 555 881 gene locus_tag LOCUS_00020 555 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00020 893 1069 gene locus_tag LOCUS_00030 893 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 985 1335 gene locus_tag LOCUS_00040 985 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00040 1328 2062 gene locus_tag LOCUS_00050 1328 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00050 3232 3480 gene locus_tag LOCUS_00060 3232 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00060 3471 3740 gene locus_tag LOCUS_00070 3471 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00070 3784 4455 gene locus_tag LOCUS_00080 3784 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00080 5965 6342 gene locus_tag LOCUS_00090 5965 6342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 6503 7480 gene locus_tag LOCUS_00100 6503 7480 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808328.1 protein_id gnl|my_center|LOCUS_00100 7574 8221 gene locus_tag LOCUS_00110 7574 8221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00110 8211 8522 gene locus_tag LOCUS_00120 8211 8522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 8516 8833 gene locus_tag LOCUS_00130 8516 8833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 8830 9267 gene locus_tag LOCUS_00140 gene pssD 8830 9267 CDS product PssD/Cps14F family polysaccharide biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065325.1 protein_id gnl|my_center|LOCUS_00140 9269 9733 gene locus_tag LOCUS_00150 gene pssE 9269 9733 CDS product PssE/Cps14G family polysaccharide biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990828.1 protein_id gnl|my_center|LOCUS_00150 9862 11037 gene locus_tag LOCUS_00160 9862 11037 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021091.1 protein_id gnl|my_center|LOCUS_00160 11208 12986 gene locus_tag LOCUS_00170 gene asnB 11208 12986 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868273.1 protein_id gnl|my_center|LOCUS_00170 14442 13120 gene locus_tag LOCUS_00180 14442 13120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 14860 14657 gene locus_tag LOCUS_00190 14860 14657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 14938 16209 gene locus_tag LOCUS_00200 14938 16209 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147032.1 protein_id gnl|my_center|LOCUS_00200 16326 16829 gene locus_tag LOCUS_00210 16326 16829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 19208 16986 gene locus_tag LOCUS_00220 19208 16986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 19714 19274 gene locus_tag LOCUS_00230 19714 19274 CDS product UPF0146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878243.1 protein_id gnl|my_center|LOCUS_00230 19926 19711 gene locus_tag LOCUS_00240 19926 19711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 20028 21089 gene locus_tag LOCUS_00250 gene ftsZ 20028 21089 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023772.1 protein_id gnl|my_center|LOCUS_00250 22602 21343 gene locus_tag LOCUS_00260 22602 21343 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020304.1 protein_id gnl|my_center|LOCUS_00260 23447 22746 gene locus_tag LOCUS_00270 23447 22746 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064937.1 protein_id gnl|my_center|LOCUS_00270 23601 24668 gene locus_tag LOCUS_00280 23601 24668 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024465.1 protein_id gnl|my_center|LOCUS_00280 24655 25320 gene locus_tag LOCUS_00290 gene aroD 24655 25320 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024466.1 protein_id gnl|my_center|LOCUS_00290 25678 26694 gene locus_tag LOCUS_00300 25678 26694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 26862 27620 gene locus_tag LOCUS_00310 26862 27620 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393323.1 protein_id gnl|my_center|LOCUS_00310 27614 28363 gene locus_tag LOCUS_00320 27614 28363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 28470 29480 gene locus_tag LOCUS_00330 28470 29480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 31139 29481 gene locus_tag LOCUS_00340 31139 29481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 31647 31315 gene locus_tag LOCUS_00350 31647 31315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 32431 31964 gene locus_tag LOCUS_00360 32431 31964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 32635 32471 gene locus_tag LOCUS_00370 32635 32471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 34919 34134 gene locus_tag LOCUS_00380 34919 34134 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022865.1 protein_id gnl|my_center|LOCUS_00380 35161 34964 gene locus_tag LOCUS_00390 35161 34964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 35246 35638 gene locus_tag LOCUS_00400 35246 35638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 35695 37161 gene locus_tag LOCUS_00410 35695 37161 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064974.1 protein_id gnl|my_center|LOCUS_00410 37563 37144 gene locus_tag LOCUS_00420 37563 37144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 38512 37613 gene locus_tag LOCUS_00430 gene dapF 38512 37613 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878250.1 protein_id gnl|my_center|LOCUS_00430 38593 39852 gene locus_tag LOCUS_00440 38593 39852 CDS product bifunctional hexulose-6-phosphate synthase/ribonuclease regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860554.1 protein_id gnl|my_center|LOCUS_00440 40046 40972 gene locus_tag LOCUS_00450 40046 40972 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020197.1 protein_id gnl|my_center|LOCUS_00450 40969 42651 gene locus_tag LOCUS_00460 40969 42651 CDS product preprotein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020198.1 protein_id gnl|my_center|LOCUS_00460 43675 42698 gene locus_tag LOCUS_00470 43675 42698 CDS product flippase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013683404.1 protein_id gnl|my_center|LOCUS_00470 44677 43709 gene locus_tag LOCUS_00480 44677 43709 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879224.1 protein_id gnl|my_center|LOCUS_00480 47865 44902 gene locus_tag LOCUS_00490 47865 44902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 48749 47937 gene locus_tag LOCUS_00500 gene xth 48749 47937 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_00500 49418 49582 gene locus_tag LOCUS_00510 49418 49582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 49994 50914 gene locus_tag LOCUS_00520 49994 50914 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868810.1 protein_id gnl|my_center|LOCUS_00520 50941 51420 gene locus_tag LOCUS_00530 50941 51420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 51465 52547 gene locus_tag LOCUS_00540 51465 52547 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860150.1 protein_id gnl|my_center|LOCUS_00540 52843 53601 gene locus_tag LOCUS_00550 52843 53601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 53709 54071 gene locus_tag LOCUS_00560 53709 54071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 54095 57898 gene locus_tag LOCUS_00570 gene bchH 54095 57898 CDS product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272597.1 protein_id gnl|my_center|LOCUS_00570 58409 57930 gene locus_tag LOCUS_00580 58409 57930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 58833 58393 gene locus_tag LOCUS_00590 58833 58393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00590 59864 58899 gene locus_tag LOCUS_00600 59864 58899 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860152.1 protein_id gnl|my_center|LOCUS_00600 60603 59968 gene locus_tag LOCUS_00610 60603 59968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 60861 62006 gene locus_tag LOCUS_00620 60861 62006 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990611.1 protein_id gnl|my_center|LOCUS_00620 62231 62500 gene locus_tag LOCUS_00630 62231 62500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 62597 63085 gene locus_tag LOCUS_00640 62597 63085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 63591 63394 gene locus_tag LOCUS_00650 63591 63394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 64298 64621 gene locus_tag LOCUS_00660 64298 64621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 64642 65430 gene locus_tag LOCUS_00670 64642 65430 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589532.1 protein_id gnl|my_center|LOCUS_00670 66760 65504 gene locus_tag LOCUS_00680 66760 65504 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860152.1 protein_id gnl|my_center|LOCUS_00680 67819 66800 gene locus_tag LOCUS_00690 67819 66800 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860152.1 protein_id gnl|my_center|LOCUS_00690 68228 68854 gene locus_tag LOCUS_00700 68228 68854 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024140.1 protein_id gnl|my_center|LOCUS_00700 69786 68935 gene locus_tag LOCUS_00710 gene nifH 69786 68935 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870393.1 protein_id gnl|my_center|LOCUS_00710 70952 69804 gene locus_tag LOCUS_00720 70952 69804 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106010848.1 protein_id gnl|my_center|LOCUS_00720 72420 70954 gene locus_tag LOCUS_00730 72420 70954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 73314 74282 gene locus_tag LOCUS_00740 73314 74282 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860152.1 protein_id gnl|my_center|LOCUS_00740 74279 75109 gene locus_tag LOCUS_00750 74279 75109 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990611.1 protein_id gnl|my_center|LOCUS_00750 75142 76164 gene locus_tag LOCUS_00760 75142 76164 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860152.1 protein_id gnl|my_center|LOCUS_00760 77434 76214 gene locus_tag LOCUS_00770 77434 76214 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932105.1 protein_id gnl|my_center|LOCUS_00770 79138 77435 gene locus_tag LOCUS_00780 79138 77435 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992488.1 protein_id gnl|my_center|LOCUS_00780 79245 83081 gene locus_tag LOCUS_00790 gene cobN 79245 83081 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932109.1 protein_id gnl|my_center|LOCUS_00790 83099 84193 gene locus_tag LOCUS_00800 83099 84193 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496656.1 protein_id gnl|my_center|LOCUS_00800 84583 84248 gene locus_tag LOCUS_00810 84583 84248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 84980 85381 gene locus_tag LOCUS_00820 84980 85381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 85375 86157 gene locus_tag LOCUS_00830 85375 86157 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065716.1 protein_id gnl|my_center|LOCUS_00830 86166 88190 gene locus_tag LOCUS_00840 86166 88190 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020921.1 protein_id gnl|my_center|LOCUS_00840 88195 89064 gene locus_tag LOCUS_00850 88195 89064 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546238.1 protein_id gnl|my_center|LOCUS_00850 89066 89800 gene locus_tag LOCUS_00860 89066 89800 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211328137.1 protein_id gnl|my_center|LOCUS_00860 90129 89950 gene locus_tag LOCUS_00870 90129 89950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00870 90972 90493 gene locus_tag LOCUS_00880 90972 90493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00880 91544 91176 gene locus_tag LOCUS_00890 91544 91176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 92066 91731 gene locus_tag LOCUS_00900 92066 91731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 92701 92507 gene locus_tag LOCUS_00910 92701 92507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 92848 93036 gene locus_tag LOCUS_00920 92848 93036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 93215 93667 gene locus_tag LOCUS_00930 93215 93667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 93664 100269 gene locus_tag LOCUS_00940 93664 100269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 100320 101588 gene locus_tag LOCUS_00950 100320 101588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 101678 104005 gene locus_tag LOCUS_00960 101678 104005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 104059 105315 gene locus_tag LOCUS_00970 104059 105315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 105317 113410 gene locus_tag LOCUS_00980 105317 113410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 114114 113716 gene locus_tag LOCUS_00990 114114 113716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 114358 115395 gene locus_tag LOCUS_01000 114358 115395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 116502 115429 gene locus_tag LOCUS_01010 116502 115429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 116753 116980 gene locus_tag LOCUS_01020 116753 116980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 118554 117166 gene locus_tag LOCUS_01030 118554 117166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 119051 118821 gene locus_tag LOCUS_01040 119051 118821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 119400 119185 gene locus_tag LOCUS_01050 119400 119185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 119357 119995 gene locus_tag LOCUS_01060 119357 119995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 121106 120126 gene locus_tag LOCUS_01070 121106 120126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 121985 121173 gene locus_tag LOCUS_01080 121985 121173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 123960 122017 gene locus_tag LOCUS_01090 gene speA 123960 122017 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767598.1 protein_id gnl|my_center|LOCUS_01090 124335 125309 gene locus_tag LOCUS_01100 124335 125309 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022952.1 protein_id gnl|my_center|LOCUS_01100 125942 125349 gene locus_tag LOCUS_01110 125942 125349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 126198 126013 gene locus_tag LOCUS_01120 126198 126013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 126294 126217 gene locus_tag LOCUS_t00010 126294 126217 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 126666 126304 gene locus_tag LOCUS_01130 126666 126304 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249594.1 protein_id gnl|my_center|LOCUS_01130 126890 126663 gene locus_tag LOCUS_01140 126890 126663 CDS product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021744.1 protein_id gnl|my_center|LOCUS_01140 127297 126887 gene locus_tag LOCUS_01150 127297 126887 CDS product rRNA maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021745.1 protein_id gnl|my_center|LOCUS_01150 127434 127297 gene locus_tag LOCUS_01160 127434 127297 CDS product DNA-directed RNA polymerase subunit P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021777.1 protein_id gnl|my_center|LOCUS_01160 128511 127735 gene locus_tag LOCUS_01170 gene rrp42 128511 127735 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878001.1 protein_id gnl|my_center|LOCUS_01170 129265 128504 gene locus_tag LOCUS_01180 gene rrp41 129265 128504 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878000.1 protein_id gnl|my_center|LOCUS_01180 129927 129262 gene locus_tag LOCUS_01190 gene rrp4 129927 129262 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021780.1 protein_id gnl|my_center|LOCUS_01190 130644 129946 gene locus_tag LOCUS_01200 130644 129946 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021781.1 protein_id gnl|my_center|LOCUS_01200 131420 130647 gene locus_tag LOCUS_01210 gene psmA 131420 130647 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065214.1 protein_id gnl|my_center|LOCUS_01210 131889 131392 gene locus_tag LOCUS_01220 131889 131392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 132605 131928 gene locus_tag LOCUS_01230 132605 131928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 133018 132602 gene locus_tag LOCUS_01240 133018 132602 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755897.1 protein_id gnl|my_center|LOCUS_01240 133636 133049 gene locus_tag LOCUS_01250 133636 133049 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870497.1 protein_id gnl|my_center|LOCUS_01250 134375 134103 gene locus_tag LOCUS_01260 134375 134103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 134772 134554 gene locus_tag LOCUS_01270 134772 134554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 135368 134895 gene locus_tag LOCUS_01280 135368 134895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 135599 136294 gene locus_tag LOCUS_01290 135599 136294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 137000 136314 gene locus_tag LOCUS_01300 137000 136314 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023459.1 protein_id gnl|my_center|LOCUS_01300 137828 137085 gene locus_tag LOCUS_01310 137828 137085 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022348.1 protein_id gnl|my_center|LOCUS_01310 138259 137912 gene locus_tag LOCUS_01320 138259 137912 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061058.1 protein_id gnl|my_center|LOCUS_01320 138610 139866 gene locus_tag LOCUS_01330 gene ahcY 138610 139866 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880742.1 protein_id gnl|my_center|LOCUS_01330 139885 140970 gene locus_tag LOCUS_01340 139885 140970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 140983 141999 gene locus_tag LOCUS_01350 140983 141999 CDS product TRM11 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020267.1 protein_id gnl|my_center|LOCUS_01350 142408 142166 gene locus_tag LOCUS_01360 142408 142166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 143383 142787 gene locus_tag LOCUS_01370 143383 142787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 143485 143940 gene locus_tag LOCUS_01380 143485 143940 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065945.1 protein_id gnl|my_center|LOCUS_01380 143952 144428 gene locus_tag LOCUS_01390 143952 144428 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024155.1 protein_id gnl|my_center|LOCUS_01390 144513 145145 gene locus_tag LOCUS_01400 144513 145145 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024156.1 protein_id gnl|my_center|LOCUS_01400 145146 146123 gene locus_tag LOCUS_01410 145146 146123 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024157.1 protein_id gnl|my_center|LOCUS_01410 146146 146463 gene locus_tag LOCUS_01420 gene rpl12p 146146 146463 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250366.1 protein_id gnl|my_center|LOCUS_01420 146827 146555 gene locus_tag LOCUS_01430 146827 146555 CDS product non-histone chromosomal MC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024392.1 protein_id gnl|my_center|LOCUS_01430 146967 147509 gene locus_tag LOCUS_01440 gene cysC 146967 147509 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963430.1 protein_id gnl|my_center|LOCUS_01440 147727 148881 gene locus_tag LOCUS_01450 147727 148881 CDS product type II glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013682815.1 protein_id gnl|my_center|LOCUS_01450 148882 149949 gene locus_tag LOCUS_01460 gene endA 148882 149949 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023532.1 protein_id gnl|my_center|LOCUS_01460 150093 149902 gene locus_tag LOCUS_01470 150093 149902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 150271 151131 gene locus_tag LOCUS_01480 150271 151131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 151197 151529 gene locus_tag LOCUS_01490 151197 151529 CDS product CGGC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018214298.1 protein_id gnl|my_center|LOCUS_01490 152260 151613 gene locus_tag LOCUS_01500 152260 151613 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249655.1 protein_id gnl|my_center|LOCUS_01500 153089 152619 gene locus_tag LOCUS_01510 153089 152619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 153885 153400 gene locus_tag LOCUS_01520 gene bcp 153885 153400 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582794.1 protein_id gnl|my_center|LOCUS_01520 154673 154059 gene locus_tag LOCUS_01530 154673 154059 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879779.1 protein_id gnl|my_center|LOCUS_01530 156798 155212 gene locus_tag LOCUS_01540 156798 155212 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021497.1 protein_id gnl|my_center|LOCUS_01540 158184 156871 gene locus_tag LOCUS_01550 gene trkA 158184 156871 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021494.1 protein_id gnl|my_center|LOCUS_01550 158360 159577 gene locus_tag LOCUS_01560 gene larC 158360 159577 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020481.1 protein_id gnl|my_center|LOCUS_01560 159909 161129 gene locus_tag LOCUS_01570 gene hemL 159909 161129 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020630.1 protein_id gnl|my_center|LOCUS_01570 161132 162049 gene locus_tag LOCUS_01580 gene hemC 161132 162049 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020631.1 protein_id gnl|my_center|LOCUS_01580 162036 163538 gene locus_tag LOCUS_01590 gene cobA 162036 163538 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460180.1 protein_id gnl|my_center|LOCUS_01590 163549 164715 gene locus_tag LOCUS_01600 163549 164715 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978063.1 protein_id gnl|my_center|LOCUS_01600 164912 164763 gene locus_tag LOCUS_01610 164912 164763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 165327 166427 gene locus_tag LOCUS_01620 165327 166427 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022968.1 protein_id gnl|my_center|LOCUS_01620 166528 166980 gene locus_tag LOCUS_01630 166528 166980 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021413.1 protein_id gnl|my_center|LOCUS_01630 167455 168393 gene locus_tag LOCUS_01640 gene ala 167455 168393 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023186.1 protein_id gnl|my_center|LOCUS_01640 168554 168787 gene locus_tag LOCUS_01650 168554 168787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 169784 168876 gene locus_tag LOCUS_01660 gene nifB 169784 168876 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024080.1 protein_id gnl|my_center|LOCUS_01660 170010 170324 gene locus_tag LOCUS_01670 170010 170324 CDS product signal recognition particle protein Srp19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066074.1 protein_id gnl|my_center|LOCUS_01670 170334 170966 gene locus_tag LOCUS_01680 170334 170966 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065077.1 protein_id gnl|my_center|LOCUS_01680 171093 171419 gene locus_tag LOCUS_01690 171093 171419 CDS product DUF2209 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023531.1 protein_id gnl|my_center|LOCUS_01690 171492 172739 gene locus_tag LOCUS_01700 gene hflX 171492 172739 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755955.1 protein_id gnl|my_center|LOCUS_01700 172771 173493 gene locus_tag LOCUS_01710 172771 173493 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021719.1 protein_id gnl|my_center|LOCUS_01710 173803 174135 gene locus_tag LOCUS_01720 173803 174135 CDS product non-histone chromosomal MC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024392.1 protein_id gnl|my_center|LOCUS_01720 174828 174145 gene locus_tag LOCUS_01730 gene cofC 174828 174145 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879553.1 protein_id gnl|my_center|LOCUS_01730 175599 174859 gene locus_tag LOCUS_01740 175599 174859 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903932.1 protein_id gnl|my_center|LOCUS_01740 175889 175665 gene locus_tag LOCUS_01750 175889 175665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 176528 175899 gene locus_tag LOCUS_01760 176528 175899 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020240.1 protein_id gnl|my_center|LOCUS_01760 177049 176534 gene locus_tag LOCUS_01770 177049 176534 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020241.1 protein_id gnl|my_center|LOCUS_01770 178403 177162 gene locus_tag LOCUS_01780 gene gatD 178403 177162 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021336.1 protein_id gnl|my_center|LOCUS_01780 178533 179354 gene locus_tag LOCUS_01790 178533 179354 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021804.1 protein_id gnl|my_center|LOCUS_01790 179389 179922 gene locus_tag LOCUS_01800 179389 179922 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251061.1 protein_id gnl|my_center|LOCUS_01800 180259 179996 gene locus_tag LOCUS_01810 180259 179996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 180454 180675 gene locus_tag LOCUS_01820 180454 180675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 180688 180855 gene locus_tag LOCUS_01830 180688 180855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 181292 180873 gene locus_tag LOCUS_01840 181292 180873 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876110.1 protein_id gnl|my_center|LOCUS_01840 181445 182191 gene locus_tag LOCUS_01850 181445 182191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 182269 182751 gene locus_tag LOCUS_01860 182269 182751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 184752 182776 gene locus_tag LOCUS_01870 184752 182776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 185012 185503 gene locus_tag LOCUS_01880 185012 185503 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143524.1 protein_id gnl|my_center|LOCUS_01880 185775 185500 gene locus_tag LOCUS_01890 185775 185500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 185959 186516 gene locus_tag LOCUS_01900 185959 186516 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_01900 187449 188174 gene locus_tag LOCUS_01910 187449 188174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 188320 189300 gene locus_tag LOCUS_01920 188320 189300 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478452.1 protein_id gnl|my_center|LOCUS_01920 189497 190828 gene locus_tag LOCUS_01930 189497 190828 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022225.1 protein_id gnl|my_center|LOCUS_01930 191031 191261 gene locus_tag LOCUS_01940 191031 191261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 194136 191296 gene locus_tag LOCUS_01950 194136 191296 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020807.1 protein_id gnl|my_center|LOCUS_01950 194794 194114 gene locus_tag LOCUS_01960 194794 194114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 195455 194928 gene locus_tag LOCUS_01970 195455 194928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 195645 195460 gene locus_tag LOCUS_01980 195645 195460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 195903 196970 gene locus_tag LOCUS_01990 195903 196970 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023154.1 protein_id gnl|my_center|LOCUS_01990 196979 197449 gene locus_tag LOCUS_02000 196979 197449 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420437.1 protein_id gnl|my_center|LOCUS_02000 198122 197427 gene locus_tag LOCUS_02010 198122 197427 CDS product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024314.1 protein_id gnl|my_center|LOCUS_02010 198158 198847 gene locus_tag LOCUS_02020 198158 198847 CDS product HisA/HisF-related TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024313.1 protein_id gnl|my_center|LOCUS_02020 199023 202184 gene locus_tag LOCUS_02030 199023 202184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02030 202181 202399 gene locus_tag LOCUS_02040 202181 202399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 202755 203099 gene locus_tag LOCUS_02050 202755 203099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 203096 203383 gene locus_tag LOCUS_02060 203096 203383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 204668 204123 gene locus_tag LOCUS_02070 204668 204123 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_02070 204815 205261 gene locus_tag LOCUS_02080 204815 205261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 205802 205458 gene locus_tag LOCUS_02090 205802 205458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 206061 206834 gene locus_tag LOCUS_02100 206061 206834 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037361.1 protein_id gnl|my_center|LOCUS_02100 207709 206912 gene locus_tag LOCUS_02110 207709 206912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 208168 207908 gene locus_tag LOCUS_02120 208168 207908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 209781 208369 gene locus_tag LOCUS_02130 209781 208369 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943636.1 protein_id gnl|my_center|LOCUS_02130 209774 210838 gene locus_tag LOCUS_02140 209774 210838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 210838 211734 gene locus_tag LOCUS_02150 210838 211734 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878595.1 protein_id gnl|my_center|LOCUS_02150 211731 212270 gene locus_tag LOCUS_02160 211731 212270 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867611.1 protein_id gnl|my_center|LOCUS_02160 212309 212941 gene locus_tag LOCUS_02170 212309 212941 CDS product DUF434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023187.1 protein_id gnl|my_center|LOCUS_02170 213199 213624 gene locus_tag LOCUS_02180 213199 213624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 213924 214643 gene locus_tag LOCUS_02190 213924 214643 CDS product glucose-6-phosphate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020865.1 protein_id gnl|my_center|LOCUS_02190 214714 215652 gene locus_tag LOCUS_02200 214714 215652 CDS product UbiA prenyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065984.1 protein_id gnl|my_center|LOCUS_02200 216439 215684 gene locus_tag LOCUS_02210 216439 215684 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065422.1 protein_id gnl|my_center|LOCUS_02210 216755 216447 gene locus_tag LOCUS_02220 216755 216447 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876568.1 protein_id gnl|my_center|LOCUS_02220 217268 218329 gene locus_tag LOCUS_02230 217268 218329 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167388862.1 protein_id gnl|my_center|LOCUS_02230 219332 218484 gene locus_tag LOCUS_02240 219332 218484 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393681.1 protein_id gnl|my_center|LOCUS_02240 221319 219745 gene locus_tag LOCUS_02250 221319 219745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 221893 221294 gene locus_tag LOCUS_02260 221893 221294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 225556 221951 gene locus_tag LOCUS_02270 225556 221951 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022493.1 protein_id gnl|my_center|LOCUS_02270 226430 225708 gene locus_tag LOCUS_02280 226430 225708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 226884 226705 gene locus_tag LOCUS_02290 226884 226705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 227122 226877 gene locus_tag LOCUS_02300 227122 226877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 228410 227484 gene locus_tag LOCUS_02310 228410 227484 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393027.1 protein_id gnl|my_center|LOCUS_02310 228780 230180 gene locus_tag LOCUS_02320 gene gltA 228780 230180 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272418.1 protein_id gnl|my_center|LOCUS_02320 231758 230250 gene locus_tag LOCUS_02330 231758 230250 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021977.1 protein_id gnl|my_center|LOCUS_02330 232645 231773 gene locus_tag LOCUS_02340 232645 231773 CDS product DUF1743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021976.1 protein_id gnl|my_center|LOCUS_02340 232938 233102 gene locus_tag LOCUS_02350 232938 233102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 233473 233108 gene locus_tag LOCUS_02360 233473 233108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02360 234417 233488 gene locus_tag LOCUS_02370 234417 233488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02370 234777 234424 gene locus_tag LOCUS_02380 gene pth2 234777 234424 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023203.1 protein_id gnl|my_center|LOCUS_02380 236157 234835 gene locus_tag LOCUS_02390 gene dnaG 236157 234835 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250361.1 protein_id gnl|my_center|LOCUS_02390 237613 236576 gene locus_tag LOCUS_02400 237613 236576 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023765.1 protein_id gnl|my_center|LOCUS_02400 237993 237613 gene locus_tag LOCUS_02410 237993 237613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 240088 238004 gene locus_tag LOCUS_02420 240088 238004 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020726.1 protein_id gnl|my_center|LOCUS_02420 241428 240160 gene locus_tag LOCUS_02430 241428 240160 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020953.1 protein_id gnl|my_center|LOCUS_02430 242326 241541 gene locus_tag LOCUS_02440 242326 241541 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020954.1 protein_id gnl|my_center|LOCUS_02440 242708 242526 gene locus_tag LOCUS_02450 242708 242526 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878609.1 protein_id gnl|my_center|LOCUS_02450 243017 242709 gene locus_tag LOCUS_02460 243017 242709 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023602.1 protein_id gnl|my_center|LOCUS_02460 243550 243020 gene locus_tag LOCUS_02470 243550 243020 CDS product GTP-dependent dephospho-CoA kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023601.1 protein_id gnl|my_center|LOCUS_02470 243737 243552 gene locus_tag LOCUS_02480 243737 243552 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878612.1 protein_id gnl|my_center|LOCUS_02480 244318 243734 gene locus_tag LOCUS_02490 244318 243734 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023599.1 protein_id gnl|my_center|LOCUS_02490 244725 244318 gene locus_tag LOCUS_02500 244725 244318 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023598.1 protein_id gnl|my_center|LOCUS_02500 246025 244730 gene locus_tag LOCUS_02510 246025 244730 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064633.1 protein_id gnl|my_center|LOCUS_02510 247142 246327 gene locus_tag LOCUS_02520 247142 246327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 247371 248321 gene locus_tag LOCUS_02530 gene thiL 247371 248321 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066048.1 protein_id gnl|my_center|LOCUS_02530 248505 248768 gene locus_tag LOCUS_02540 248505 248768 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943587.1 protein_id gnl|my_center|LOCUS_02540 248778 249206 gene locus_tag LOCUS_02550 248778 249206 CDS product putative zinc-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065848.1 protein_id gnl|my_center|LOCUS_02550 249203 250378 gene locus_tag LOCUS_02560 249203 250378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 250362 251972 gene locus_tag LOCUS_02570 250362 251972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 252084 252770 gene locus_tag LOCUS_02580 252084 252770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 252770 252922 gene locus_tag LOCUS_02590 252770 252922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 253013 253354 gene locus_tag LOCUS_02600 253013 253354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 253589 255001 gene locus_tag LOCUS_02610 253589 255001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 255369 255905 gene locus_tag LOCUS_02620 255369 255905 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_02620 255905 256162 gene locus_tag LOCUS_02630 255905 256162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 256162 257385 gene locus_tag LOCUS_02640 gene porA 256162 257385 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020091.1 protein_id gnl|my_center|LOCUS_02640 257399 258274 gene locus_tag LOCUS_02650 gene porB 257399 258274 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020090.1 protein_id gnl|my_center|LOCUS_02650 258277 258888 gene locus_tag LOCUS_02660 gene purO 258277 258888 CDS product IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876651.1 protein_id gnl|my_center|LOCUS_02660 258921 259811 gene locus_tag LOCUS_02670 gene fhcD 258921 259811 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020069.1 protein_id gnl|my_center|LOCUS_02670 260761 260060 gene locus_tag LOCUS_02680 260761 260060 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719585.1 protein_id gnl|my_center|LOCUS_02680 261495 260797 gene locus_tag LOCUS_02690 261495 260797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 261683 261519 gene locus_tag LOCUS_02700 261683 261519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 261787 262584 gene locus_tag LOCUS_02710 261787 262584 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020491.1 protein_id gnl|my_center|LOCUS_02710 264109 263093 gene locus_tag LOCUS_02720 264109 263093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 264929 264240 gene locus_tag LOCUS_02730 264929 264240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 265026 266234 gene locus_tag LOCUS_02740 265026 266234 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022964.1 protein_id gnl|my_center|LOCUS_02740 266581 267681 gene locus_tag LOCUS_02750 266581 267681 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_02750 267685 268626 gene locus_tag LOCUS_02760 267685 268626 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925382.1 protein_id gnl|my_center|LOCUS_02760 268658 269359 gene locus_tag LOCUS_02770 268658 269359 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868278.1 protein_id gnl|my_center|LOCUS_02770 269440 270642 gene locus_tag LOCUS_02780 269440 270642 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868281.1 protein_id gnl|my_center|LOCUS_02780 270662 271819 gene locus_tag LOCUS_02790 gene wecB 270662 271819 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_02790 271816 272811 gene locus_tag LOCUS_02800 271816 272811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 274741 272936 gene locus_tag LOCUS_02810 gene glmS 274741 272936 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022962.1 protein_id gnl|my_center|LOCUS_02810 275970 274741 gene locus_tag LOCUS_02820 275970 274741 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022961.1 protein_id gnl|my_center|LOCUS_02820 276094 277221 gene locus_tag LOCUS_02830 276094 277221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 277714 278433 gene locus_tag LOCUS_02840 277714 278433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 278598 279464 gene locus_tag LOCUS_02850 278598 279464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 280479 279472 gene locus_tag LOCUS_02860 280479 279472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 280771 280454 gene locus_tag LOCUS_02870 280771 280454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 281328 280726 gene locus_tag LOCUS_02880 281328 280726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 281564 281743 gene locus_tag LOCUS_02890 281564 281743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 283214 281748 gene locus_tag LOCUS_02900 283214 281748 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060802.1 protein_id gnl|my_center|LOCUS_02900 283721 283221 gene locus_tag LOCUS_02910 283721 283221 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877830.1 protein_id gnl|my_center|LOCUS_02910 284825 283947 gene locus_tag LOCUS_02920 284825 283947 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980041.1 protein_id gnl|my_center|LOCUS_02920 285845 284838 gene locus_tag LOCUS_02930 gene rfbB 285845 284838 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868293.1 protein_id gnl|my_center|LOCUS_02930 286897 285845 gene locus_tag LOCUS_02940 286897 285845 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868292.1 protein_id gnl|my_center|LOCUS_02940 288191 287007 gene locus_tag LOCUS_02950 288191 287007 CDS product homocitrate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023272.1 protein_id gnl|my_center|LOCUS_02950 288836 288264 gene locus_tag LOCUS_02960 288836 288264 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867925.1 protein_id gnl|my_center|LOCUS_02960 289513 288833 gene locus_tag LOCUS_02970 289513 288833 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876071.1 protein_id gnl|my_center|LOCUS_02970 291072 289528 gene locus_tag LOCUS_02980 291072 289528 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023184.1 protein_id gnl|my_center|LOCUS_02980 291282 291839 gene locus_tag LOCUS_02990 291282 291839 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020390.1 protein_id gnl|my_center|LOCUS_02990 293015 291975 gene locus_tag LOCUS_03000 gene dinB 293015 291975 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172312.1 protein_id gnl|my_center|LOCUS_03000 293604 293026 gene locus_tag LOCUS_03010 293604 293026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 293936 294817 gene locus_tag LOCUS_03020 293936 294817 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583014.1 protein_id gnl|my_center|LOCUS_03020 296071 294848 gene locus_tag LOCUS_03030 296071 294848 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889176.1 protein_id gnl|my_center|LOCUS_03030 297189 296140 gene locus_tag LOCUS_03040 297189 296140 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892607.1 protein_id gnl|my_center|LOCUS_03040 297590 297276 gene locus_tag LOCUS_03050 297590 297276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 297580 297768 gene locus_tag LOCUS_03060 297580 297768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 298442 297828 gene locus_tag LOCUS_03070 298442 297828 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060758.1 protein_id gnl|my_center|LOCUS_03070 299261 298557 gene locus_tag LOCUS_03080 299261 298557 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545081.1 protein_id gnl|my_center|LOCUS_03080 299396 299890 gene locus_tag LOCUS_03090 299396 299890 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021008.1 protein_id gnl|my_center|LOCUS_03090 300682 299936 gene locus_tag LOCUS_03100 gene htpX 300682 299936 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024415.1 protein_id gnl|my_center|LOCUS_03100 301005 301433 gene locus_tag LOCUS_03110 301005 301433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03110 301457 301711 gene locus_tag LOCUS_03120 301457 301711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03120 301858 302007 gene locus_tag LOCUS_03130 301858 302007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 302022 302489 gene locus_tag LOCUS_03140 302022 302489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 303330 302842 gene locus_tag LOCUS_03150 303330 302842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 303865 303275 gene locus_tag LOCUS_03160 303865 303275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 305506 305126 gene locus_tag LOCUS_03170 305506 305126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03170 306297 305506 gene locus_tag LOCUS_03180 306297 305506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03180 307788 307174 gene locus_tag LOCUS_03190 307788 307174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 308651 308031 gene locus_tag LOCUS_03200 308651 308031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 309040 309357 gene locus_tag LOCUS_03210 309040 309357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 309871 309653 gene locus_tag LOCUS_03220 309871 309653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03220 310445 310008 gene locus_tag LOCUS_03230 310445 310008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03230 310805 311212 gene locus_tag LOCUS_03240 310805 311212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 311911 311330 gene locus_tag LOCUS_03250 311911 311330 CDS product Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066022.1 protein_id gnl|my_center|LOCUS_03250 312256 311912 gene locus_tag LOCUS_03260 312256 311912 CDS product DUF2073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064681.1 protein_id gnl|my_center|LOCUS_03260 312915 312277 gene locus_tag LOCUS_03270 312915 312277 CDS product Era-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878677.1 protein_id gnl|my_center|LOCUS_03270 314426 313332 gene locus_tag LOCUS_03280 314426 313332 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020233.1 protein_id gnl|my_center|LOCUS_03280 314530 315705 gene locus_tag LOCUS_03290 314530 315705 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022128.1 protein_id gnl|my_center|LOCUS_03290 315757 316173 gene locus_tag LOCUS_03300 315757 316173 CDS product DUF2111 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589540.1 protein_id gnl|my_center|LOCUS_03300 316170 316631 gene locus_tag LOCUS_03310 gene rimI 316170 316631 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876630.1 protein_id gnl|my_center|LOCUS_03310 316998 316816 gene locus_tag LOCUS_03320 316998 316816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 318387 317173 gene locus_tag LOCUS_03330 gene ftsY 318387 317173 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024000.1 protein_id gnl|my_center|LOCUS_03330 318835 318380 gene locus_tag LOCUS_03340 gene pfdA 318835 318380 CDS product prefoldin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868641.1 protein_id gnl|my_center|LOCUS_03340 319016 318828 gene locus_tag LOCUS_03350 gene rpl18a 319016 318828 CDS product 50S ribosomal protein L18Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024002.1 protein_id gnl|my_center|LOCUS_03350 319703 319032 gene locus_tag LOCUS_03360 319703 319032 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024003.1 protein_id gnl|my_center|LOCUS_03360 319983 319687 gene locus_tag LOCUS_03370 319983 319687 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024004.1 protein_id gnl|my_center|LOCUS_03370 320703 320047 gene locus_tag LOCUS_03380 320703 320047 CDS product alpha hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024006.1 protein_id gnl|my_center|LOCUS_03380 321066 320725 gene locus_tag LOCUS_03390 321066 320725 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024007.1 protein_id gnl|my_center|LOCUS_03390 321548 321081 gene locus_tag LOCUS_03400 321548 321081 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877224.1 protein_id gnl|my_center|LOCUS_03400 324461 323181 gene locus_tag LOCUS_03410 324461 323181 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925421.1 protein_id gnl|my_center|LOCUS_03410 325547 324690 gene locus_tag LOCUS_03420 325547 324690 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404480.1 protein_id gnl|my_center|LOCUS_03420 325705 326595 gene locus_tag LOCUS_03430 gene pyrB 325705 326595 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024378.1 protein_id gnl|my_center|LOCUS_03430 326597 327115 gene locus_tag LOCUS_03440 gene pyrI 326597 327115 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060913.1 protein_id gnl|my_center|LOCUS_03440 327270 328112 gene locus_tag LOCUS_03450 327270 328112 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022767.1 protein_id gnl|my_center|LOCUS_03450 328898 328485 gene locus_tag LOCUS_03460 328898 328485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 329907 329299 gene locus_tag LOCUS_03470 329907 329299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 331693 330065 gene locus_tag LOCUS_03480 331693 330065 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021660.1 protein_id gnl|my_center|LOCUS_03480 332582 331740 gene locus_tag LOCUS_03490 gene pheA 332582 331740 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066451.1 protein_id gnl|my_center|LOCUS_03490 333529 332579 gene locus_tag LOCUS_03500 333529 332579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03500 333849 333529 gene locus_tag LOCUS_03510 333849 333529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03510 333916 334974 gene locus_tag LOCUS_03520 333916 334974 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065828.1 protein_id gnl|my_center|LOCUS_03520 335872 335441 gene locus_tag LOCUS_03530 335872 335441 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_03530 336308 335919 gene locus_tag LOCUS_03540 336308 335919 CDS product AIR carboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021394.1 protein_id gnl|my_center|LOCUS_03540 336593 336345 gene locus_tag LOCUS_03550 336593 336345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 337498 336644 gene locus_tag LOCUS_03560 337498 336644 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021396.1 protein_id gnl|my_center|LOCUS_03560 338034 337510 gene locus_tag LOCUS_03570 338034 337510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 339157 338081 gene locus_tag LOCUS_03580 339157 338081 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024300.1 protein_id gnl|my_center|LOCUS_03580 339122 339271 gene locus_tag LOCUS_03590 339122 339271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 339871 339464 gene locus_tag LOCUS_03600 339871 339464 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024057.1 protein_id gnl|my_center|LOCUS_03600 340327 342042 gene locus_tag LOCUS_03610 gene oadA 340327 342042 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020719.1 protein_id gnl|my_center|LOCUS_03610 342073 342948 gene locus_tag LOCUS_03620 gene argB 342073 342948 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024391.1 protein_id gnl|my_center|LOCUS_03620 343555 343112 gene locus_tag LOCUS_03630 gene nifU 343555 343112 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877697.1 protein_id gnl|my_center|LOCUS_03630 343742 344428 gene locus_tag LOCUS_03640 343742 344428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03640 345020 344823 gene locus_tag LOCUS_03650 345020 344823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 345605 345970 gene locus_tag LOCUS_03660 345605 345970 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013196.1 protein_id gnl|my_center|LOCUS_03660 345960 346169 gene locus_tag LOCUS_03670 345960 346169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 346901 347131 gene locus_tag LOCUS_03680 346901 347131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 347454 347170 gene locus_tag LOCUS_03690 347454 347170 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902003.1 protein_id gnl|my_center|LOCUS_03690 347660 347451 gene locus_tag LOCUS_03700 347660 347451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 350307 349216 gene locus_tag LOCUS_03710 gene dph2 350307 349216 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020763.1 protein_id gnl|my_center|LOCUS_03710 351295 350276 gene locus_tag LOCUS_03720 gene fen 351295 350276 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023899.1 protein_id gnl|my_center|LOCUS_03720 351377 351772 gene locus_tag LOCUS_03730 351377 351772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 352572 351943 gene locus_tag LOCUS_03740 352572 351943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 352707 353552 gene locus_tag LOCUS_03750 352707 353552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 353552 356116 gene locus_tag LOCUS_03760 353552 356116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 356123 356569 gene locus_tag LOCUS_03770 356123 356569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 356566 357564 gene locus_tag LOCUS_03780 356566 357564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 357561 358355 gene locus_tag LOCUS_03790 357561 358355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 358352 360508 gene locus_tag LOCUS_03800 358352 360508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 360711 361094 gene locus_tag LOCUS_03810 360711 361094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 361091 361792 gene locus_tag LOCUS_03820 361091 361792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 362319 362047 gene locus_tag LOCUS_03830 362319 362047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03830 363616 363197 gene locus_tag LOCUS_03840 363616 363197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 364263 364484 gene locus_tag LOCUS_03850 364263 364484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 364481 364747 gene locus_tag LOCUS_03860 364481 364747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 364859 368272 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgcaacgtactcgaaaacccgatagggattgaaac 370327 368627 gene locus_tag LOCUS_03870 370327 368627 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869281.1 protein_id gnl|my_center|LOCUS_03870 370693 371157 gene locus_tag LOCUS_03880 370693 371157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 372087 374084 gene locus_tag LOCUS_03890 372087 374084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 374262 375287 gene locus_tag LOCUS_03900 374262 375287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 375878 375384 gene locus_tag LOCUS_03910 375878 375384 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020126.1 protein_id gnl|my_center|LOCUS_03910 376123 377343 gene locus_tag LOCUS_03920 376123 377343 CDS product cysteate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066469.1 protein_id gnl|my_center|LOCUS_03920 377343 378182 gene locus_tag LOCUS_03930 377343 378182 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869614.1 protein_id gnl|my_center|LOCUS_03930 378179 378877 gene locus_tag LOCUS_03940 378179 378877 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869613.1 protein_id gnl|my_center|LOCUS_03940 379044 379679 gene locus_tag LOCUS_03950 379044 379679 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877278.1 protein_id gnl|my_center|LOCUS_03950 379830 379991 gene locus_tag LOCUS_03960 379830 379991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 380437 380793 gene locus_tag LOCUS_03970 380437 380793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 380990 383266 gene locus_tag LOCUS_03980 380990 383266 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021816.1 protein_id gnl|my_center|LOCUS_03980 383586 383963 gene locus_tag LOCUS_03990 383586 383963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 383957 384865 gene locus_tag LOCUS_04000 383957 384865 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065217.1 protein_id gnl|my_center|LOCUS_04000 384946 385227 gene locus_tag LOCUS_04010 384946 385227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 385413 385580 gene locus_tag LOCUS_04020 385413 385580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 386195 385725 gene locus_tag LOCUS_04030 386195 385725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 386813 388159 gene locus_tag LOCUS_04040 386813 388159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 388188 388598 gene locus_tag LOCUS_04050 388188 388598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 388834 389883 gene locus_tag LOCUS_04060 388834 389883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 390485 389943 gene locus_tag LOCUS_04070 390485 389943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 391261 390866 gene locus_tag LOCUS_04080 391261 390866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04080 391659 391189 gene locus_tag LOCUS_04090 391659 391189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04090 392088 393008 gene locus_tag LOCUS_04100 392088 393008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 394159 394314 gene locus_tag LOCUS_04110 394159 394314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 395279 394590 gene locus_tag LOCUS_04120 395279 394590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 395713 395438 gene locus_tag LOCUS_04130 395713 395438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 396409 396927 gene locus_tag LOCUS_04140 396409 396927 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065441.1 protein_id gnl|my_center|LOCUS_04140 396924 397931 gene locus_tag LOCUS_04150 396924 397931 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022537.1 protein_id gnl|my_center|LOCUS_04150 397989 399647 gene locus_tag LOCUS_04160 397989 399647 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022536.1 protein_id gnl|my_center|LOCUS_04160 399784 401070 gene locus_tag LOCUS_04170 gene hisD 399784 401070 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023136.1 protein_id gnl|my_center|LOCUS_04170 401120 402001 gene locus_tag LOCUS_04180 401120 402001 CDS product DUF2099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022201.1 protein_id gnl|my_center|LOCUS_04180 404019 402055 gene locus_tag LOCUS_04190 404019 402055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 404941 404312 gene locus_tag LOCUS_04200 404941 404312 CDS product winged helix-turn-helix domain-containing protein/riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319832.1 protein_id gnl|my_center|LOCUS_04200 405710 405045 gene locus_tag LOCUS_04210 405710 405045 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_04210 406954 405707 gene locus_tag LOCUS_04220 gene hacA 406954 405707 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066440.1 protein_id gnl|my_center|LOCUS_04220 408907 407012 gene locus_tag LOCUS_04230 408907 407012 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932766.1 protein_id gnl|my_center|LOCUS_04230 410169 408904 gene locus_tag LOCUS_04240 410169 408904 CDS product ATP citrate lyase citrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932767.1 protein_id gnl|my_center|LOCUS_04240 410281 411279 gene locus_tag LOCUS_04250 410281 411279 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024418.1 protein_id gnl|my_center|LOCUS_04250 411388 411312 gene locus_tag LOCUS_t00020 411388 411312 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 412492 411419 gene locus_tag LOCUS_04260 412492 411419 CDS product UPF0104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876885.1 protein_id gnl|my_center|LOCUS_04260 412613 412792 gene locus_tag LOCUS_04270 412613 412792 CDS product DUF5350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879682.1 protein_id gnl|my_center|LOCUS_04270 412807 414036 gene locus_tag LOCUS_04280 gene thiI 412807 414036 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877292.1 protein_id gnl|my_center|LOCUS_04280 414284 414481 gene locus_tag LOCUS_04290 414284 414481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 416571 414628 gene locus_tag LOCUS_04300 416571 414628 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021214.1 protein_id gnl|my_center|LOCUS_04300 417284 416583 gene locus_tag LOCUS_04310 417284 416583 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022642.1 protein_id gnl|my_center|LOCUS_04310 417604 418527 gene locus_tag LOCUS_04320 gene arcC 417604 418527 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393446.1 protein_id gnl|my_center|LOCUS_04320 418708 419052 gene locus_tag LOCUS_04330 418708 419052 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060879.1 protein_id gnl|my_center|LOCUS_04330 422035 419255 gene locus_tag LOCUS_04340 422035 419255 CDS product S-layer protein domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023471.1 protein_id gnl|my_center|LOCUS_04340 422067 422240 gene locus_tag LOCUS_04350 422067 422240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 422364 422675 gene locus_tag LOCUS_04360 422364 422675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 423009 424175 gene locus_tag LOCUS_04370 423009 424175 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066146.1 protein_id gnl|my_center|LOCUS_04370 424172 424957 gene locus_tag LOCUS_04380 424172 424957 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020890.1 protein_id gnl|my_center|LOCUS_04380 425117 425671 gene locus_tag LOCUS_04390 425117 425671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 425816 426649 gene locus_tag LOCUS_04400 gene arsM 425816 426649 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023683.1 protein_id gnl|my_center|LOCUS_04400 426863 426726 gene locus_tag LOCUS_04410 426863 426726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 427347 426853 gene locus_tag LOCUS_04420 427347 426853 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_04420 427771 430740 gene locus_tag LOCUS_04430 427771 430740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 430915 432087 gene locus_tag LOCUS_04440 430915 432087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 434861 433065 gene locus_tag LOCUS_04450 434861 433065 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870139.1 protein_id gnl|my_center|LOCUS_04450 436804 435197 gene locus_tag LOCUS_04460 436804 435197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 437279 436872 gene locus_tag LOCUS_04470 437279 436872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 437822 437547 gene locus_tag LOCUS_04480 437822 437547 CDS product DNA-directed RNA polymerase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020766.1 protein_id gnl|my_center|LOCUS_04480 438383 437823 gene locus_tag LOCUS_04490 438383 437823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 439196 438549 gene locus_tag LOCUS_04500 439196 438549 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020764.1 protein_id gnl|my_center|LOCUS_04500 441693 439225 gene locus_tag LOCUS_04510 441693 439225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 441961 443202 gene locus_tag LOCUS_04520 gene prf1 441961 443202 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020101.1 protein_id gnl|my_center|LOCUS_04520 443208 443645 gene locus_tag LOCUS_04530 443208 443645 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066042.1 protein_id gnl|my_center|LOCUS_04530 443638 444405 gene locus_tag LOCUS_04540 443638 444405 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024526.1 protein_id gnl|my_center|LOCUS_04540 444402 445052 gene locus_tag LOCUS_04550 444402 445052 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020150.1 protein_id gnl|my_center|LOCUS_04550 445207 446817 gene locus_tag LOCUS_04560 gene sepS 445207 446817 CDS product O-phosphoserine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020149.1 protein_id gnl|my_center|LOCUS_04560 446930 447622 gene locus_tag LOCUS_04570 gene rpiA 446930 447622 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021687.1 protein_id gnl|my_center|LOCUS_04570 447995 447657 gene locus_tag LOCUS_04580 447995 447657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 448149 448343 gene locus_tag LOCUS_04590 448149 448343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 448400 448984 gene locus_tag LOCUS_04600 448400 448984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 448993 450636 gene locus_tag LOCUS_04610 448993 450636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 450827 451180 gene locus_tag LOCUS_04620 450827 451180 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250923.1 protein_id gnl|my_center|LOCUS_04620 451225 452460 gene locus_tag LOCUS_04630 451225 452460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 452532 452984 gene locus_tag LOCUS_04640 452532 452984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 453660 453247 gene locus_tag LOCUS_04650 453660 453247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 454690 453779 gene locus_tag LOCUS_04660 454690 453779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 454775 455977 gene locus_tag LOCUS_04670 gene pscS 454775 455977 CDS product O-phospho-L-seryl-tRNA:Cys-tRNA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877542.1 protein_id gnl|my_center|LOCUS_04670 456799 456023 gene locus_tag LOCUS_04680 456799 456023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 457707 456916 gene locus_tag LOCUS_04690 457707 456916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 457994 459052 gene locus_tag LOCUS_04700 457994 459052 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023783.1 protein_id gnl|my_center|LOCUS_04700 459057 460142 gene locus_tag LOCUS_04710 459057 460142 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_04710 460196 461335 gene locus_tag LOCUS_04720 gene trpD 460196 461335 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869732.1 protein_id gnl|my_center|LOCUS_04720 462227 463255 gene locus_tag LOCUS_04730 462227 463255 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879296.1 protein_id gnl|my_center|LOCUS_04730 463265 464620 gene locus_tag LOCUS_04740 463265 464620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 464875 465045 gene locus_tag LOCUS_04750 464875 465045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 465053 466921 gene locus_tag LOCUS_04760 gene acs 465053 466921 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319494.1 protein_id gnl|my_center|LOCUS_04760 467380 469398 gene locus_tag LOCUS_04770 gene acs 467380 469398 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319494.1 protein_id gnl|my_center|LOCUS_04770 469504 469665 gene locus_tag LOCUS_04780 469504 469665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 470095 471573 gene locus_tag LOCUS_04790 470095 471573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04790 471548 472078 gene locus_tag LOCUS_04800 471548 472078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04800 472300 474330 gene locus_tag LOCUS_04810 472300 474330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 475218 477188 gene locus_tag LOCUS_04820 gene acs 475218 477188 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319494.1 protein_id gnl|my_center|LOCUS_04820 477397 478281 gene locus_tag LOCUS_04830 gene mptN 477397 478281 CDS product tetrahydromethanopterin:alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023202.1 protein_id gnl|my_center|LOCUS_04830 478326 479603 gene locus_tag LOCUS_04840 478326 479603 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024009.1 protein_id gnl|my_center|LOCUS_04840 481484 479949 gene locus_tag LOCUS_04850 481484 479949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 482346 481864 gene locus_tag LOCUS_04860 482346 481864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 482812 482976 gene locus_tag LOCUS_04870 482812 482976 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081114.1 protein_id gnl|my_center|LOCUS_04870 483009 484208 gene locus_tag LOCUS_04880 483009 484208 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584117.1 protein_id gnl|my_center|LOCUS_04880 484383 485201 gene locus_tag LOCUS_04890 484383 485201 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066246.1 protein_id gnl|my_center|LOCUS_04890 485836 485273 gene locus_tag LOCUS_04900 485836 485273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022099.1 protein_id gnl|my_center|LOCUS_04900 486678 485839 gene locus_tag LOCUS_04910 gene htpX 486678 485839 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022098.1 protein_id gnl|my_center|LOCUS_04910 486873 487331 gene locus_tag LOCUS_04920 486873 487331 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404934.1 protein_id gnl|my_center|LOCUS_04920 487401 487955 gene locus_tag LOCUS_04930 487401 487955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 487972 489189 gene locus_tag LOCUS_04940 gene ilvA 487972 489189 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272642.1 protein_id gnl|my_center|LOCUS_04940 490477 489482 gene locus_tag LOCUS_04950 490477 489482 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021133.1 protein_id gnl|my_center|LOCUS_04950 491214 490690 gene locus_tag LOCUS_04960 491214 490690 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879393.1 protein_id gnl|my_center|LOCUS_04960 491825 491217 gene locus_tag LOCUS_04970 491825 491217 CDS product DUF106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021131.1 protein_id gnl|my_center|LOCUS_04970 493435 491822 gene locus_tag LOCUS_04980 gene secY 493435 491822 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021124.1 protein_id gnl|my_center|LOCUS_04980 493809 493432 gene locus_tag LOCUS_04990 493809 493432 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021123.1 protein_id gnl|my_center|LOCUS_04990 494270 493815 gene locus_tag LOCUS_05000 494270 493815 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021122.1 protein_id gnl|my_center|LOCUS_05000 494896 494273 gene locus_tag LOCUS_05010 494896 494273 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021121.1 protein_id gnl|my_center|LOCUS_05010 495410 494901 gene locus_tag LOCUS_05020 495410 494901 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021120.1 protein_id gnl|my_center|LOCUS_05020 495873 495412 gene locus_tag LOCUS_05030 495873 495412 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021119.1 protein_id gnl|my_center|LOCUS_05030 496250 495876 gene locus_tag LOCUS_05040 496250 495876 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879401.1 protein_id gnl|my_center|LOCUS_05040 496382 496257 gene locus_tag LOCUS_05050 496382 496257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05050 497180 496797 gene locus_tag LOCUS_05060 497180 496797 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021116.1 protein_id gnl|my_center|LOCUS_05060 497348 497196 gene locus_tag LOCUS_05070 497348 497196 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879404.1 protein_id gnl|my_center|LOCUS_05070 497860 497345 gene locus_tag LOCUS_05080 497860 497345 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021114.1 protein_id gnl|my_center|LOCUS_05080 498438 497857 gene locus_tag LOCUS_05090 498438 497857 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021113.1 protein_id gnl|my_center|LOCUS_05090 498845 498558 gene locus_tag LOCUS_05100 gene rplX 498845 498558 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250481.1 protein_id gnl|my_center|LOCUS_05100 499323 498925 gene locus_tag LOCUS_05110 gene rpl14p 499323 498925 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021111.1 protein_id gnl|my_center|LOCUS_05110 499640 499320 gene locus_tag LOCUS_05120 499640 499320 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011696863.1 protein_id gnl|my_center|LOCUS_05120 499930 499637 gene locus_tag LOCUS_05130 499930 499637 CDS product ribonuclease P protein component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021109.1 protein_id gnl|my_center|LOCUS_05130 500127 499927 gene locus_tag LOCUS_05140 gene rpmC 500127 499927 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021108.1 protein_id gnl|my_center|LOCUS_05140 500960 500133 gene locus_tag LOCUS_05150 500960 500133 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021107.1 protein_id gnl|my_center|LOCUS_05150 501370 500960 gene locus_tag LOCUS_05160 gene rplV 501370 500960 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875649.1 protein_id gnl|my_center|LOCUS_05160 501841 501431 gene locus_tag LOCUS_05170 501841 501431 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021105.1 protein_id gnl|my_center|LOCUS_05170 502426 501851 gene locus_tag LOCUS_05180 502426 501851 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875647.1 protein_id gnl|my_center|LOCUS_05180 502823 502575 gene locus_tag LOCUS_05190 502823 502575 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722494.1 protein_id gnl|my_center|LOCUS_05190 503593 502820 gene locus_tag LOCUS_05200 gene rpl4p 503593 502820 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021102.1 protein_id gnl|my_center|LOCUS_05200 504601 503597 gene locus_tag LOCUS_05210 gene rpl3p 504601 503597 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879418.1 protein_id gnl|my_center|LOCUS_05210 505378 504602 gene locus_tag LOCUS_05220 505378 504602 CDS product putative RNA uridine N3 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879419.1 protein_id gnl|my_center|LOCUS_05220 506746 505772 gene locus_tag LOCUS_05230 506746 505772 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928941.1 protein_id gnl|my_center|LOCUS_05230 507752 506811 gene locus_tag LOCUS_05240 507752 506811 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023440.1 protein_id gnl|my_center|LOCUS_05240 507789 509210 gene locus_tag LOCUS_05250 507789 509210 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066507.1 protein_id gnl|my_center|LOCUS_05250 510321 509332 gene locus_tag LOCUS_05260 510321 509332 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878259.1 protein_id gnl|my_center|LOCUS_05260 510626 511318 gene locus_tag LOCUS_05270 gene tmk 510626 511318 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024311.1 protein_id gnl|my_center|LOCUS_05270 512080 511439 gene locus_tag LOCUS_05280 512080 511439 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022401.1 protein_id gnl|my_center|LOCUS_05280 513131 512211 gene locus_tag LOCUS_05290 513131 512211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 514033 514893 gene locus_tag LOCUS_05300 514033 514893 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024306.1 protein_id gnl|my_center|LOCUS_05300 515229 514999 gene locus_tag LOCUS_05310 515229 514999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 515212 515598 gene locus_tag LOCUS_05320 515212 515598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 515627 516226 gene locus_tag LOCUS_05330 515627 516226 CDS product DUF2150 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023591.1 protein_id gnl|my_center|LOCUS_05330 517169 516282 gene locus_tag LOCUS_05340 gene map 517169 516282 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020270.1 protein_id gnl|my_center|LOCUS_05340 518402 517257 gene locus_tag LOCUS_05350 518402 517257 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020271.1 protein_id gnl|my_center|LOCUS_05350 519167 518409 gene locus_tag LOCUS_05360 519167 518409 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023864.1 protein_id gnl|my_center|LOCUS_05360 519324 519175 gene locus_tag LOCUS_05370 519324 519175 CDS product 50S ribosomal protein L40e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065861.1 protein_id gnl|my_center|LOCUS_05370 519602 520855 gene locus_tag LOCUS_05380 gene maeB 519602 520855 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229415.1 protein_id gnl|my_center|LOCUS_05380 520932 521078 gene locus_tag LOCUS_05390 520932 521078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 522098 521130 gene locus_tag LOCUS_05400 522098 521130 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023652.1 protein_id gnl|my_center|LOCUS_05400 522928 522101 gene locus_tag LOCUS_05410 522928 522101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023654.1 protein_id gnl|my_center|LOCUS_05410 523421 522930 gene locus_tag LOCUS_05420 gene hacB 523421 522930 CDS product homoaconitase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065791.1 protein_id gnl|my_center|LOCUS_05420 523717 523920 gene locus_tag LOCUS_05430 523717 523920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 524074 524688 gene locus_tag LOCUS_05440 524074 524688 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879016.1 protein_id gnl|my_center|LOCUS_05440 524691 525278 gene locus_tag LOCUS_05450 gene afpA 524691 525278 CDS product archaeoflavoprotein AfpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064401.1 protein_id gnl|my_center|LOCUS_05450 525340 525735 gene locus_tag LOCUS_05460 gene cfbA 525340 525735 CDS product sirohydrochlorin nickelochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061042.1 protein_id gnl|my_center|LOCUS_05460 525687 526940 gene locus_tag LOCUS_05470 gene cfbE 525687 526940 CDS product coenzyme F430 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023538.1 protein_id gnl|my_center|LOCUS_05470 526948 528048 gene locus_tag LOCUS_05480 gene cfbD 526948 528048 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023536.1 protein_id gnl|my_center|LOCUS_05480 528407 528117 gene locus_tag LOCUS_05490 528407 528117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 528605 528802 gene locus_tag LOCUS_05500 528605 528802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 529531 529277 gene locus_tag LOCUS_05510 529531 529277 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_05510 532403 529659 gene locus_tag LOCUS_05520 gene alaS 532403 529659 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020252.1 protein_id gnl|my_center|LOCUS_05520 533131 532514 gene locus_tag LOCUS_05530 533131 532514 CDS product orotate phosphoribosyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020957.1 protein_id gnl|my_center|LOCUS_05530 533526 533128 gene locus_tag LOCUS_05540 533526 533128 CDS product NOB1 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066159.1 protein_id gnl|my_center|LOCUS_05540 533668 534111 gene locus_tag LOCUS_05550 533668 534111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990637.1 protein_id gnl|my_center|LOCUS_05550 534120 535880 gene locus_tag LOCUS_05560 534120 535880 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023139.1 protein_id gnl|my_center|LOCUS_05560 535893 536990 gene locus_tag LOCUS_05570 535893 536990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 537675 537058 gene locus_tag LOCUS_05580 537675 537058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 538537 537890 gene locus_tag LOCUS_05590 538537 537890 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855217.1 protein_id gnl|my_center|LOCUS_05590 539310 538534 gene locus_tag LOCUS_05600 gene trpA 539310 538534 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022930.1 protein_id gnl|my_center|LOCUS_05600 540478 539297 gene locus_tag LOCUS_05610 gene trpB 540478 539297 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022931.1 protein_id gnl|my_center|LOCUS_05610 540860 540651 gene locus_tag LOCUS_05620 540860 540651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 541569 540877 gene locus_tag LOCUS_05630 541569 540877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05630 542083 541559 gene locus_tag LOCUS_05640 542083 541559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05640 542202 542897 gene locus_tag LOCUS_05650 542202 542897 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023469.1 protein_id gnl|my_center|LOCUS_05650 542894 543217 gene locus_tag LOCUS_05660 542894 543217 CDS product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023468.1 protein_id gnl|my_center|LOCUS_05660 543210 543992 gene locus_tag LOCUS_05670 gene cbiQ 543210 543992 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065744.1 protein_id gnl|my_center|LOCUS_05670 544018 545253 gene locus_tag LOCUS_05680 544018 545253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 546274 545498 gene locus_tag LOCUS_05690 gene larB 546274 545498 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020480.1 protein_id gnl|my_center|LOCUS_05690 546352 547617 gene locus_tag LOCUS_05700 546352 547617 CDS product endonuclease Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020688.1 protein_id gnl|my_center|LOCUS_05700 547916 548809 gene locus_tag LOCUS_05710 547916 548809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 550473 548854 gene locus_tag LOCUS_05720 550473 548854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 550546 550755 gene locus_tag LOCUS_05730 550546 550755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 551170 551481 gene locus_tag LOCUS_05740 551170 551481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 551606 552235 gene locus_tag LOCUS_05750 551606 552235 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024449.1 protein_id gnl|my_center|LOCUS_05750 552388 554538 gene locus_tag LOCUS_05760 552388 554538 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_05760 554630 556534 gene locus_tag LOCUS_05770 gene lonB 554630 556534 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023222.1 protein_id gnl|my_center|LOCUS_05770 556539 557858 gene locus_tag LOCUS_05780 556539 557858 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990640.1 protein_id gnl|my_center|LOCUS_05780 558492 557914 gene locus_tag LOCUS_05790 558492 557914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 559007 558639 gene locus_tag LOCUS_05800 559007 558639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 559984 559139 gene locus_tag LOCUS_05810 559984 559139 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_05810 560511 559981 gene locus_tag LOCUS_05820 560511 559981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 561617 560511 gene locus_tag LOCUS_05830 561617 560511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05830 561946 561614 gene locus_tag LOCUS_05840 561946 561614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05840 564452 561933 gene locus_tag LOCUS_05850 gene hdrA2 564452 561933 CDS product CoB-CoM heterodisulfide reductase HdrA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022820.1 protein_id gnl|my_center|LOCUS_05850 565010 565309 gene locus_tag LOCUS_05860 565010 565309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 566013 565375 gene locus_tag LOCUS_05870 566013 565375 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173254069.1 protein_id gnl|my_center|LOCUS_05870 566269 567525 gene locus_tag LOCUS_05880 566269 567525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 567570 568184 gene locus_tag LOCUS_05890 gene trmY 567570 568184 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066221.1 protein_id gnl|my_center|LOCUS_05890 571664 568305 gene locus_tag LOCUS_05900 571664 568305 CDS product Swt1 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258561.1 protein_id gnl|my_center|LOCUS_05900 572344 571700 gene locus_tag LOCUS_05910 572344 571700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 573491 572346 gene locus_tag LOCUS_05920 573491 572346 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530160.1 protein_id gnl|my_center|LOCUS_05920 576350 573570 gene locus_tag LOCUS_05930 576350 573570 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 protein_id gnl|my_center|LOCUS_05930 576291 576440 gene locus_tag LOCUS_05940 576291 576440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 576650 577972 gene locus_tag LOCUS_05950 576650 577972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 577950 578120 gene locus_tag LOCUS_05960 577950 578120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 581719 578192 gene locus_tag LOCUS_05970 581719 578192 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258557.1 protein_id gnl|my_center|LOCUS_05970 582072 582416 gene locus_tag LOCUS_05980 582072 582416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 582997 582524 gene locus_tag LOCUS_05990 582997 582524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 583800 582991 gene locus_tag LOCUS_06000 583800 582991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 585215 583797 gene locus_tag LOCUS_06010 585215 583797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06010 586129 585194 gene locus_tag LOCUS_06020 586129 585194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06020 586297 587073 gene locus_tag LOCUS_06030 586297 587073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 587346 587873 gene locus_tag LOCUS_06040 587346 587873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 587958 588506 gene locus_tag LOCUS_06050 587958 588506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 588609 589271 gene locus_tag LOCUS_06060 588609 589271 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496756.1 protein_id gnl|my_center|LOCUS_06060 590075 589278 gene locus_tag LOCUS_06070 590075 589278 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877350.1 protein_id gnl|my_center|LOCUS_06070 590884 589985 gene locus_tag LOCUS_06080 590884 589985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 592479 590965 gene locus_tag LOCUS_06090 592479 590965 CDS product AMP phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023176.1 protein_id gnl|my_center|LOCUS_06090 593420 592482 gene locus_tag LOCUS_06100 593420 592482 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065056.1 protein_id gnl|my_center|LOCUS_06100 594007 593417 gene locus_tag LOCUS_06110 594007 593417 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903724.1 protein_id gnl|my_center|LOCUS_06110 594499 594011 gene locus_tag LOCUS_06120 594499 594011 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065943.1 protein_id gnl|my_center|LOCUS_06120 594563 595780 gene locus_tag LOCUS_06130 gene pan 594563 595780 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879468.1 protein_id gnl|my_center|LOCUS_06130 595795 596283 gene locus_tag LOCUS_06140 595795 596283 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022308.1 protein_id gnl|my_center|LOCUS_06140 596358 597281 gene locus_tag LOCUS_06150 596358 597281 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876019.1 protein_id gnl|my_center|LOCUS_06150 597563 597721 gene locus_tag LOCUS_06160 597563 597721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 598337 599224 gene locus_tag LOCUS_06170 gene rfaD 598337 599224 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880173.1 protein_id gnl|my_center|LOCUS_06170 599407 599880 gene locus_tag LOCUS_06180 599407 599880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 600461 601348 gene locus_tag LOCUS_06190 gene rfaD 600461 601348 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880173.1 protein_id gnl|my_center|LOCUS_06190 601574 603121 gene locus_tag LOCUS_06200 601574 603121 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886617.1 protein_id gnl|my_center|LOCUS_06200 606249 604993 gene locus_tag LOCUS_06210 606249 604993 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296319.1 protein_id gnl|my_center|LOCUS_06210 607544 607320 gene locus_tag LOCUS_06220 607544 607320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 608485 609000 gene locus_tag LOCUS_06230 608485 609000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 609094 609732 gene locus_tag LOCUS_06240 609094 609732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 610103 609960 gene locus_tag LOCUS_06250 610103 609960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 611257 610118 gene locus_tag LOCUS_06260 611257 610118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 612482 611529 gene locus_tag LOCUS_06270 612482 611529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 614321 612957 gene locus_tag LOCUS_06280 614321 612957 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081170.1 protein_id gnl|my_center|LOCUS_06280 615608 614610 gene locus_tag LOCUS_06290 615608 614610 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060801.1 protein_id gnl|my_center|LOCUS_06290 615823 615638 gene locus_tag LOCUS_06300 615823 615638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 616731 615796 gene locus_tag LOCUS_06310 616731 615796 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060800.1 protein_id gnl|my_center|LOCUS_06310 617145 616945 gene locus_tag LOCUS_06320 617145 616945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06320 618007 617312 gene locus_tag LOCUS_06330 618007 617312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 618264 618037 gene locus_tag LOCUS_06340 618264 618037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06340 619114 618335 gene locus_tag LOCUS_06350 619114 618335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06350 620265 619558 gene locus_tag LOCUS_06360 620265 619558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 620858 620574 gene locus_tag LOCUS_06370 620858 620574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 621160 620864 gene locus_tag LOCUS_06380 621160 620864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 621543 621283 gene locus_tag LOCUS_06390 621543 621283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 622084 621719 gene locus_tag LOCUS_06400 622084 621719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 622382 622035 gene locus_tag LOCUS_06410 622382 622035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 623147 622698 gene locus_tag LOCUS_06420 623147 622698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 623346 623098 gene locus_tag LOCUS_06430 623346 623098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 623692 623444 gene locus_tag LOCUS_06440 623692 623444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 625107 624175 gene locus_tag LOCUS_06450 625107 624175 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022154.1 protein_id gnl|my_center|LOCUS_06450 626345 626260 gene locus_tag LOCUS_t00030 626345 626260 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 626901 626542 gene locus_tag LOCUS_06460 626901 626542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 626794 627054 gene locus_tag LOCUS_06470 626794 627054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 627576 627145 gene locus_tag LOCUS_06480 627576 627145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 628736 627591 gene locus_tag LOCUS_06490 628736 627591 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023596.1 protein_id gnl|my_center|LOCUS_06490 629167 628967 gene locus_tag LOCUS_06500 629167 628967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 629240 629734 gene locus_tag LOCUS_06510 629240 629734 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020260.1 protein_id gnl|my_center|LOCUS_06510 629731 630855 gene locus_tag LOCUS_06520 629731 630855 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020259.1 protein_id gnl|my_center|LOCUS_06520 631117 631323 gene locus_tag LOCUS_06530 631117 631323 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296894.1 protein_id gnl|my_center|LOCUS_06530 631334 632824 gene locus_tag LOCUS_06540 631334 632824 CDS product DNA-directed RNA polymerase subunit B'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755883.1 protein_id gnl|my_center|LOCUS_06540 632808 633914 gene locus_tag LOCUS_06550 632808 633914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06550 633907 634647 gene locus_tag LOCUS_06560 633907 634647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06560 634656 637283 gene locus_tag LOCUS_06570 634656 637283 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021284.1 protein_id gnl|my_center|LOCUS_06570 637280 638419 gene locus_tag LOCUS_06580 gene rpoA2 637280 638419 CDS product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066196.1 protein_id gnl|my_center|LOCUS_06580 638425 638733 gene locus_tag LOCUS_06590 638425 638733 CDS product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065070.1 protein_id gnl|my_center|LOCUS_06590 638730 639161 gene locus_tag LOCUS_06600 638730 639161 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021281.1 protein_id gnl|my_center|LOCUS_06600 639209 639637 gene locus_tag LOCUS_06610 639209 639637 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064744.1 protein_id gnl|my_center|LOCUS_06610 639634 640200 gene locus_tag LOCUS_06620 639634 640200 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021279.1 protein_id gnl|my_center|LOCUS_06620 640312 640968 gene locus_tag LOCUS_06630 640312 640968 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020584.1 protein_id gnl|my_center|LOCUS_06630 643114 640901 gene locus_tag LOCUS_06640 643114 640901 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035498.1 protein_id gnl|my_center|LOCUS_06640 643593 643120 gene locus_tag LOCUS_06650 643593 643120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 643702 644889 gene locus_tag LOCUS_06660 643702 644889 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022460.1 protein_id gnl|my_center|LOCUS_06660 644899 646059 gene locus_tag LOCUS_06670 644899 646059 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021679.1 protein_id gnl|my_center|LOCUS_06670 646046 646792 gene locus_tag LOCUS_06680 646046 646792 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021673.1 protein_id gnl|my_center|LOCUS_06680 646896 647510 gene locus_tag LOCUS_06690 646896 647510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 647746 648714 gene locus_tag LOCUS_06700 gene mch 647746 648714 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021714.1 protein_id gnl|my_center|LOCUS_06700 648827 649081 gene locus_tag LOCUS_06710 648827 649081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 650150 649092 gene locus_tag LOCUS_06720 650150 649092 CDS product EF-Tu/IF-2/RF-3 family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869822.1 protein_id gnl|my_center|LOCUS_06720 650408 650659 gene locus_tag LOCUS_06730 650408 650659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 651514 650753 gene locus_tag LOCUS_06740 651514 650753 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392949.1 protein_id gnl|my_center|LOCUS_06740 651712 652737 gene locus_tag LOCUS_06750 gene trpD 651712 652737 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022929.1 protein_id gnl|my_center|LOCUS_06750 652734 653360 gene locus_tag LOCUS_06760 652734 653360 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065580.1 protein_id gnl|my_center|LOCUS_06760 653351 654793 gene locus_tag LOCUS_06770 gene trpE 653351 654793 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022927.1 protein_id gnl|my_center|LOCUS_06770 654790 655371 gene locus_tag LOCUS_06780 654790 655371 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022926.1 protein_id gnl|my_center|LOCUS_06780 655359 656090 gene locus_tag LOCUS_06790 655359 656090 CDS product indole-3-glycerol-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022932.1 protein_id gnl|my_center|LOCUS_06790 657818 656157 gene locus_tag LOCUS_06800 gene gapN 657818 656157 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249656.1 protein_id gnl|my_center|LOCUS_06800 658032 659324 gene locus_tag LOCUS_06810 658032 659324 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023956.1 protein_id gnl|my_center|LOCUS_06810 659321 660064 gene locus_tag LOCUS_06820 659321 660064 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023957.1 protein_id gnl|my_center|LOCUS_06820 661255 660110 gene locus_tag LOCUS_06830 661255 660110 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065228.1 protein_id gnl|my_center|LOCUS_06830 661922 661290 gene locus_tag LOCUS_06840 gene rnhB 661922 661290 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021954.1 protein_id gnl|my_center|LOCUS_06840 662045 662119 gene locus_tag LOCUS_t00040 662045 662119 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 662205 662486 gene locus_tag LOCUS_06850 662205 662486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 662689 663480 gene locus_tag LOCUS_06860 662689 663480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 663653 665005 gene locus_tag LOCUS_06870 663653 665005 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545858.1 protein_id gnl|my_center|LOCUS_06870 665029 666153 gene locus_tag LOCUS_06880 665029 666153 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072974.1 protein_id gnl|my_center|LOCUS_06880 666587 666354 gene locus_tag LOCUS_06890 666587 666354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 667248 666550 gene locus_tag LOCUS_06900 667248 666550 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024048.1 protein_id gnl|my_center|LOCUS_06900 668641 667253 gene locus_tag LOCUS_06910 668641 667253 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024047.1 protein_id gnl|my_center|LOCUS_06910 670283 668655 gene locus_tag LOCUS_06920 670283 668655 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024046.1 protein_id gnl|my_center|LOCUS_06920 670675 670376 gene locus_tag LOCUS_06930 670675 670376 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024045.1 protein_id gnl|my_center|LOCUS_06930 671690 670677 gene locus_tag LOCUS_06940 671690 670677 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024044.1 protein_id gnl|my_center|LOCUS_06940 672280 671732 gene locus_tag LOCUS_06950 672280 671732 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878659.1 protein_id gnl|my_center|LOCUS_06950 672574 672308 gene locus_tag LOCUS_06960 672574 672308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 674582 672642 gene locus_tag LOCUS_06970 674582 672642 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589509.1 protein_id gnl|my_center|LOCUS_06970 672946 672874 gene locus_tag LOCUS_t00050 672946 672874 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 674994 674668 gene locus_tag LOCUS_06980 gene ahaH 674994 674668 CDS product ATP synthase archaeal subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015591748.1 protein_id gnl|my_center|LOCUS_06980 675163 674987 gene locus_tag LOCUS_06990 675163 674987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 676314 675151 gene locus_tag LOCUS_07000 gene rbcL 676314 675151 CDS product type III ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024428.1 protein_id gnl|my_center|LOCUS_07000 676655 677548 gene locus_tag LOCUS_07010 676655 677548 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942295.1 protein_id gnl|my_center|LOCUS_07010 677629 678426 gene locus_tag LOCUS_07020 677629 678426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07020 678341 679024 gene locus_tag LOCUS_07030 678341 679024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07030 679260 680375 gene locus_tag LOCUS_07040 gene fbp 679260 680375 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251114.1 protein_id gnl|my_center|LOCUS_07040 680505 681317 gene locus_tag LOCUS_07050 680505 681317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 682305 681481 gene locus_tag LOCUS_07060 682305 681481 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060749.1 protein_id gnl|my_center|LOCUS_07060 683106 682357 gene locus_tag LOCUS_07070 gene cbiQ 683106 682357 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545677.1 protein_id gnl|my_center|LOCUS_07070 683501 683166 gene locus_tag LOCUS_07080 683501 683166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 683898 683578 gene locus_tag LOCUS_07090 683898 683578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 684529 683900 gene locus_tag LOCUS_07100 gene cbiM 684529 683900 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546305.1 protein_id gnl|my_center|LOCUS_07100 685308 684538 gene locus_tag LOCUS_07110 685308 684538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 686216 685425 gene locus_tag LOCUS_07120 686216 685425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 686660 686430 gene locus_tag LOCUS_07130 686660 686430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 687511 686780 gene locus_tag LOCUS_07140 687511 686780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 688111 688275 gene locus_tag LOCUS_07150 688111 688275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 688677 689828 gene locus_tag LOCUS_07160 688677 689828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 690501 689947 gene locus_tag LOCUS_07170 690501 689947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 690645 691154 gene locus_tag LOCUS_07180 690645 691154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 691282 691536 gene locus_tag LOCUS_07190 691282 691536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 692886 691588 gene locus_tag LOCUS_07200 692886 691588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 693663 693295 gene locus_tag LOCUS_07210 693663 693295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 695175 694720 gene locus_tag LOCUS_07220 695175 694720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07220 695869 696381 gene locus_tag LOCUS_07230 695869 696381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 696449 697210 gene locus_tag LOCUS_07240 696449 697210 CDS product DUF1829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213043995.1 protein_id gnl|my_center|LOCUS_07240 698423 697461 gene locus_tag LOCUS_07250 gene ilvC 698423 697461 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879477.1 protein_id gnl|my_center|LOCUS_07250 698988 698497 gene locus_tag LOCUS_07260 gene ilvN 698988 698497 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_07260 699894 698989 gene locus_tag LOCUS_07270 699894 698989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07270 700787 699891 gene locus_tag LOCUS_07280 700787 699891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07280 702214 700772 gene locus_tag LOCUS_07290 702214 700772 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589535.1 protein_id gnl|my_center|LOCUS_07290 702495 703607 gene locus_tag LOCUS_07300 702495 703607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 703653 704309 gene locus_tag LOCUS_07310 703653 704309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 704331 704990 gene locus_tag LOCUS_07320 704331 704990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 705479 704997 gene locus_tag LOCUS_07330 gene rlmH 705479 704997 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704775.1 protein_id gnl|my_center|LOCUS_07330 706818 705676 gene locus_tag LOCUS_07340 706818 705676 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022426.1 protein_id gnl|my_center|LOCUS_07340 708495 706852 gene locus_tag LOCUS_07350 708495 706852 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022425.1 protein_id gnl|my_center|LOCUS_07350 709269 708520 gene locus_tag LOCUS_07360 709269 708520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022424.1 protein_id gnl|my_center|LOCUS_07360 709954 709502 gene locus_tag LOCUS_07370 709954 709502 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065868.1 protein_id gnl|my_center|LOCUS_07370 711030 710107 gene locus_tag LOCUS_07380 711030 710107 CDS product methanogenesis marker 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023887.1 protein_id gnl|my_center|LOCUS_07380 711595 711023 gene locus_tag LOCUS_07390 711595 711023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 712823 711597 gene locus_tag LOCUS_07400 712823 711597 CDS product methanogenesis marker 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023889.1 protein_id gnl|my_center|LOCUS_07400 713257 712820 gene locus_tag LOCUS_07410 713257 712820 CDS product methanogenesis marker 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869903.1 protein_id gnl|my_center|LOCUS_07410 713545 713273 gene locus_tag LOCUS_07420 713545 713273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 713685 713539 gene locus_tag LOCUS_07430 713685 713539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07430 715208 713685 gene locus_tag LOCUS_07440 715208 713685 CDS product methanogenesis marker 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023892.1 protein_id gnl|my_center|LOCUS_07440 716811 715210 gene locus_tag LOCUS_07450 gene atwA 716811 715210 CDS product methyl coenzyme M reductase system, component A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023893.1 protein_id gnl|my_center|LOCUS_07450 717143 717652 gene locus_tag LOCUS_07460 717143 717652 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064860.1 protein_id gnl|my_center|LOCUS_07460 718227 717637 gene locus_tag LOCUS_07470 718227 717637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 718713 718321 gene locus_tag LOCUS_07480 718713 718321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 718903 720174 gene locus_tag LOCUS_07490 718903 720174 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048415.1 protein_id gnl|my_center|LOCUS_07490 720495 720235 gene locus_tag LOCUS_07500 720495 720235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 720726 721103 gene locus_tag LOCUS_07510 720726 721103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 721936 721277 gene locus_tag LOCUS_07520 721936 721277 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064948.1 protein_id gnl|my_center|LOCUS_07520 722437 722144 gene locus_tag LOCUS_07530 722437 722144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 723405 722557 gene locus_tag LOCUS_07540 723405 722557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 723739 724164 gene locus_tag LOCUS_07550 723739 724164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 724219 724716 gene locus_tag LOCUS_07560 724219 724716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 725746 724943 gene locus_tag LOCUS_07570 725746 724943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 726795 727520 gene locus_tag LOCUS_07580 gene hisA 726795 727520 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020276.1 protein_id gnl|my_center|LOCUS_07580 727531 728097 gene locus_tag LOCUS_07590 gene hisB 727531 728097 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020277.1 protein_id gnl|my_center|LOCUS_07590 728958 728155 gene locus_tag LOCUS_07600 gene surE 728958 728155 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020163.1 protein_id gnl|my_center|LOCUS_07600 729368 729219 gene locus_tag LOCUS_07610 729368 729219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 729468 729695 gene locus_tag LOCUS_07620 729468 729695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 729809 729718 gene locus_tag LOCUS_t00060 729809 729718 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 730616 729846 gene locus_tag LOCUS_07630 gene uppS 730616 729846 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990666.1 protein_id gnl|my_center|LOCUS_07630 730748 730821 gene locus_tag LOCUS_t00070 730748 730821 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 731069 731239 gene locus_tag LOCUS_07640 731069 731239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 731256 732074 gene locus_tag LOCUS_07650 731256 732074 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020938.1 protein_id gnl|my_center|LOCUS_07650 732134 732676 gene locus_tag LOCUS_07660 732134 732676 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020937.1 protein_id gnl|my_center|LOCUS_07660 732712 734379 gene locus_tag LOCUS_07670 732712 734379 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878819.1 protein_id gnl|my_center|LOCUS_07670 734549 735649 gene locus_tag LOCUS_07680 734549 735649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065646.1 protein_id gnl|my_center|LOCUS_07680 735670 736242 gene locus_tag LOCUS_07690 735670 736242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 736682 736275 gene locus_tag LOCUS_07700 gene trxA 736682 736275 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173768.1 protein_id gnl|my_center|LOCUS_07700 737263 736685 gene locus_tag LOCUS_07710 737263 736685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 737644 739521 gene locus_tag LOCUS_07720 737644 739521 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065589.1 protein_id gnl|my_center|LOCUS_07720 739618 740808 gene locus_tag LOCUS_07730 739618 740808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 742258 741161 gene locus_tag LOCUS_07740 742258 741161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 742963 742712 gene locus_tag LOCUS_07750 742963 742712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07750 744566 743010 gene locus_tag LOCUS_07760 gene rqcH 744566 743010 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061171.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07760 744735 745199 gene locus_tag LOCUS_07770 744735 745199 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878928.1 protein_id gnl|my_center|LOCUS_07770 746018 745338 gene locus_tag LOCUS_07780 746018 745338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 746956 746525 gene locus_tag LOCUS_07790 746956 746525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 747162 747281 gene locus_tag LOCUS_07800 747162 747281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 748225 747290 gene locus_tag LOCUS_07810 gene moaA 748225 747290 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020164.1 protein_id gnl|my_center|LOCUS_07810 748825 748424 gene locus_tag LOCUS_07820 748825 748424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 749246 748866 gene locus_tag LOCUS_07830 749246 748866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 749960 749358 gene locus_tag LOCUS_07840 749960 749358 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024115.1 protein_id gnl|my_center|LOCUS_07840 750906 749953 gene locus_tag LOCUS_07850 750906 749953 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880521.1 protein_id gnl|my_center|LOCUS_07850 751270 751596 gene locus_tag LOCUS_07860 751270 751596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 752471 751569 gene locus_tag LOCUS_07870 752471 751569 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 protein_id gnl|my_center|LOCUS_07870 752575 752994 gene locus_tag LOCUS_07880 752575 752994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 753119 753541 gene locus_tag LOCUS_07890 753119 753541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 753716 755683 gene locus_tag LOCUS_07900 753716 755683 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022843.1 protein_id gnl|my_center|LOCUS_07900 755814 756008 gene locus_tag LOCUS_07910 755814 756008 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925387.1 protein_id gnl|my_center|LOCUS_07910 756155 758299 gene locus_tag LOCUS_07920 756155 758299 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939521.1 protein_id gnl|my_center|LOCUS_07920 759054 758407 gene locus_tag LOCUS_07930 gene pyrF 759054 758407 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065013.1 protein_id gnl|my_center|LOCUS_07930 759345 759163 gene locus_tag LOCUS_07940 759345 759163 CDS product preprotein translocase subunit Sec61beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064803.1 protein_id gnl|my_center|LOCUS_07940 761292 759430 gene locus_tag LOCUS_07950 761292 759430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 762017 762460 gene locus_tag LOCUS_07960 762017 762460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 762743 762997 gene locus_tag LOCUS_07970 762743 762997 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055429980.1 protein_id gnl|my_center|LOCUS_07970 763392 763207 gene locus_tag LOCUS_07980 763392 763207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 763976 766063 gene locus_tag LOCUS_07990 gene glgP 763976 766063 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880430.1 protein_id gnl|my_center|LOCUS_07990 766454 766032 gene locus_tag LOCUS_08000 766454 766032 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877139.1 protein_id gnl|my_center|LOCUS_08000 767641 766451 gene locus_tag LOCUS_08010 767641 766451 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020303.1 protein_id gnl|my_center|LOCUS_08010 768618 767695 gene locus_tag LOCUS_08020 gene mtrH 768618 767695 CDS product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021807.1 protein_id gnl|my_center|LOCUS_08020 769242 768622 gene locus_tag LOCUS_08030 769242 768622 CDS product tetrahydromethanopterin S-methyltransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021808.1 protein_id gnl|my_center|LOCUS_08030 769422 769808 gene locus_tag LOCUS_08040 769422 769808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 769814 771184 gene locus_tag LOCUS_08050 gene gvpD 769814 771184 CDS product gas vesicle protein GvpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904107.1 protein_id gnl|my_center|LOCUS_08050 771724 771200 gene locus_tag LOCUS_08060 771724 771200 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023216.1 protein_id gnl|my_center|LOCUS_08060 773590 771740 gene locus_tag LOCUS_08070 gene cooS 773590 771740 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066467.1 protein_id gnl|my_center|LOCUS_08070 775020 773830 gene locus_tag LOCUS_08080 gene serB 775020 773830 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064533.1 protein_id gnl|my_center|LOCUS_08080 776233 775442 gene locus_tag LOCUS_08090 776233 775442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08090 777415 776945 gene locus_tag LOCUS_08100 777415 776945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08100 777764 777420 gene locus_tag LOCUS_08110 777764 777420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08110 778427 778699 gene locus_tag LOCUS_08120 778427 778699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 778784 778915 gene locus_tag LOCUS_08130 778784 778915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 779069 778995 gene locus_tag LOCUS_t00080 779069 778995 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 779772 779098 gene locus_tag LOCUS_08140 779772 779098 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869727.1 protein_id gnl|my_center|LOCUS_08140 779865 781109 gene locus_tag LOCUS_08150 779865 781109 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003128157.1 protein_id gnl|my_center|LOCUS_08150 781203 781130 gene locus_tag LOCUS_t00090 781203 781130 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 782806 781256 gene locus_tag LOCUS_08160 782806 781256 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274408.1 protein_id gnl|my_center|LOCUS_08160 783150 783848 gene locus_tag LOCUS_08170 783150 783848 CDS product bifunctional fructose-bisphosphatase/inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023274.1 protein_id gnl|my_center|LOCUS_08170 783841 784674 gene locus_tag LOCUS_08180 783841 784674 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023273.1 protein_id gnl|my_center|LOCUS_08180 785831 784776 gene locus_tag LOCUS_08190 785831 784776 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733783.1 protein_id gnl|my_center|LOCUS_08190 786736 785828 gene locus_tag LOCUS_08200 786736 785828 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878506.1 protein_id gnl|my_center|LOCUS_08200 787848 786742 gene locus_tag LOCUS_08210 787848 786742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 789149 788055 gene locus_tag LOCUS_08220 789149 788055 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990827.1 protein_id gnl|my_center|LOCUS_08220 790043 789333 gene locus_tag LOCUS_08230 790043 789333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 791406 790225 gene locus_tag LOCUS_08240 791406 790225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 792227 791454 gene locus_tag LOCUS_08250 792227 791454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 793257 792442 gene locus_tag LOCUS_08260 793257 792442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 794212 793490 gene locus_tag LOCUS_08270 794212 793490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 795441 794719 gene locus_tag LOCUS_08280 795441 794719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 795971 795895 gene locus_tag LOCUS_t00100 795971 795895 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 796132 796059 gene locus_tag LOCUS_t00110 796132 796059 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 796233 797225 gene locus_tag LOCUS_08290 796233 797225 CDS product DUF128 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065980.1 protein_id gnl|my_center|LOCUS_08290 797488 797889 gene locus_tag LOCUS_08300 797488 797889 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021540.1 protein_id gnl|my_center|LOCUS_08300 799085 797934 gene locus_tag LOCUS_08310 799085 797934 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023790.1 protein_id gnl|my_center|LOCUS_08310 800974 799082 gene locus_tag LOCUS_08320 800974 799082 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020337.1 protein_id gnl|my_center|LOCUS_08320 801070 802725 gene locus_tag LOCUS_08330 gene ilvD 801070 802725 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021805.1 protein_id gnl|my_center|LOCUS_08330 802722 803267 gene locus_tag LOCUS_08340 gene thpR 802722 803267 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066123.1 protein_id gnl|my_center|LOCUS_08340 803281 804600 gene locus_tag LOCUS_08350 gene cca 803281 804600 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023473.1 protein_id gnl|my_center|LOCUS_08350 805647 804595 gene locus_tag LOCUS_08360 805647 804595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 806149 808242 gene locus_tag LOCUS_08370 806149 808242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 808495 809538 gene locus_tag LOCUS_08380 gene amrS 808495 809538 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546747.1 protein_id gnl|my_center|LOCUS_08380 809600 810805 gene locus_tag LOCUS_08390 809600 810805 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392434.1 protein_id gnl|my_center|LOCUS_08390 811411 810920 gene locus_tag LOCUS_08400 811411 810920 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582602.1 protein_id gnl|my_center|LOCUS_08400 811955 811464 gene locus_tag LOCUS_08410 811955 811464 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065425.1 protein_id gnl|my_center|LOCUS_08410 812029 814608 gene locus_tag LOCUS_08420 812029 814608 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022991.1 protein_id gnl|my_center|LOCUS_08420 814605 815168 gene locus_tag LOCUS_08430 gene cyaB 814605 815168 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879480.1 protein_id gnl|my_center|LOCUS_08430 815165 816040 gene locus_tag LOCUS_08440 815165 816040 CDS product presenilin family intramembrane aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065870.1 protein_id gnl|my_center|LOCUS_08440 816200 816397 gene locus_tag LOCUS_08450 816200 816397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 816394 817515 gene locus_tag LOCUS_08460 816394 817515 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224291.1 protein_id gnl|my_center|LOCUS_08460 818400 817588 gene locus_tag LOCUS_08470 818400 817588 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020996.1 protein_id gnl|my_center|LOCUS_08470 818441 819289 gene locus_tag LOCUS_08480 gene nadC 818441 819289 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020993.1 protein_id gnl|my_center|LOCUS_08480 819255 820496 gene locus_tag LOCUS_08490 819255 820496 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020992.1 protein_id gnl|my_center|LOCUS_08490 820582 821691 gene locus_tag LOCUS_08500 820582 821691 CDS product tubulin/FtsZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066160.1 protein_id gnl|my_center|LOCUS_08500 822575 821685 gene locus_tag LOCUS_08510 822575 821685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875877.1 protein_id gnl|my_center|LOCUS_08510 823685 822582 gene locus_tag LOCUS_08520 823685 822582 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066217.1 protein_id gnl|my_center|LOCUS_08520 823787 824254 gene locus_tag LOCUS_08530 823787 824254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 825534 824251 gene locus_tag LOCUS_08540 gene thiC 825534 824251 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024209.1 protein_id gnl|my_center|LOCUS_08540 825618 826808 gene locus_tag LOCUS_08550 825618 826808 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020737.1 protein_id gnl|my_center|LOCUS_08550 826925 827608 gene locus_tag LOCUS_08560 826925 827608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 827659 829476 gene locus_tag LOCUS_08570 827659 829476 CDS product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020947.1 protein_id gnl|my_center|LOCUS_08570 829530 830093 gene locus_tag LOCUS_08580 829530 830093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 830095 830787 gene locus_tag LOCUS_08590 830095 830787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 830925 832130 gene locus_tag LOCUS_08600 830925 832130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08600 832178 833545 gene locus_tag LOCUS_08610 832178 833545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08610 833551 835266 gene locus_tag LOCUS_08620 gene mutL 833551 835266 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732291.1 protein_id gnl|my_center|LOCUS_08620 835320 836630 gene locus_tag LOCUS_08630 835320 836630 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066157.1 protein_id gnl|my_center|LOCUS_08630 836782 837165 gene locus_tag LOCUS_08640 836782 837165 CDS product transcriptional regulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065665.1 protein_id gnl|my_center|LOCUS_08640 837387 838010 gene locus_tag LOCUS_08650 837387 838010 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066543.1 protein_id gnl|my_center|LOCUS_08650 838430 838029 gene locus_tag LOCUS_08660 838430 838029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022359.1 protein_id gnl|my_center|LOCUS_08660 838699 838427 gene locus_tag LOCUS_08670 838699 838427 CDS product DUF2551 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878713.1 protein_id gnl|my_center|LOCUS_08670 838926 839648 gene locus_tag LOCUS_08680 838926 839648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 840269 839829 gene locus_tag LOCUS_08690 840269 839829 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023990.1 protein_id gnl|my_center|LOCUS_08690 840611 840282 gene locus_tag LOCUS_08700 840611 840282 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066569.1 protein_id gnl|my_center|LOCUS_08700 840744 842096 gene locus_tag LOCUS_08710 gene purH 840744 842096 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941271.1 protein_id gnl|my_center|LOCUS_08710 842269 843588 gene locus_tag LOCUS_08720 842269 843588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 843589 844650 gene locus_tag LOCUS_08730 843589 844650 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021469.1 protein_id gnl|my_center|LOCUS_08730 844977 845648 gene locus_tag LOCUS_08740 gene npdG 844977 845648 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878392.1 protein_id gnl|my_center|LOCUS_08740 846951 845641 gene locus_tag LOCUS_08750 846951 845641 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020067.1 protein_id gnl|my_center|LOCUS_08750 848033 846957 gene locus_tag LOCUS_08760 848033 846957 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020066.1 protein_id gnl|my_center|LOCUS_08760 848864 848277 gene locus_tag LOCUS_08770 848864 848277 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020321.1 protein_id gnl|my_center|LOCUS_08770 850752 848866 gene locus_tag LOCUS_08780 850752 848866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 851022 850807 gene locus_tag LOCUS_08790 851022 850807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 852037 850973 gene locus_tag LOCUS_08800 852037 850973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 853439 852144 gene locus_tag LOCUS_08810 853439 852144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 854030 854626 gene locus_tag LOCUS_08820 854030 854626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 854786 854613 gene locus_tag LOCUS_08830 854786 854613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 854935 856128 gene locus_tag LOCUS_08840 854935 856128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 856194 857381 gene locus_tag LOCUS_08850 856194 857381 CDS product bifunctional 5,6,7,8-tetrahydromethanopterin hydro-lyase/3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024481.1 protein_id gnl|my_center|LOCUS_08850 857540 858844 gene locus_tag LOCUS_08860 857540 858844 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065684.1 protein_id gnl|my_center|LOCUS_08860 859787 860176 gene locus_tag LOCUS_08870 859787 860176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08870 860344 862116 gene locus_tag LOCUS_08880 860344 862116 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022845.1 protein_id gnl|my_center|LOCUS_08880 863351 862251 gene locus_tag LOCUS_08890 863351 862251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 863962 863645 gene locus_tag LOCUS_08900 863962 863645 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256599.1 protein_id gnl|my_center|LOCUS_08900 865932 863953 gene locus_tag LOCUS_08910 865932 863953 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980092.1 protein_id gnl|my_center|LOCUS_08910 866462 865968 gene locus_tag LOCUS_08920 866462 865968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 866602 867918 gene locus_tag LOCUS_08930 866602 867918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08930 868184 868035 gene locus_tag LOCUS_08940 868184 868035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 868289 868453 gene locus_tag LOCUS_08950 868289 868453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 868556 868741 gene locus_tag LOCUS_08960 868556 868741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 869669 868710 gene locus_tag LOCUS_08970 869669 868710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 870374 869682 gene locus_tag LOCUS_08980 gene gpmA 870374 869682 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870165.1 protein_id gnl|my_center|LOCUS_08980 871314 870397 gene locus_tag LOCUS_08990 871314 870397 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065835.1 protein_id gnl|my_center|LOCUS_08990 872262 871324 gene locus_tag LOCUS_09000 gene pfkB 872262 871324 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640844.1 protein_id gnl|my_center|LOCUS_09000 872643 873899 gene locus_tag LOCUS_09010 872643 873899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 873896 874669 gene locus_tag LOCUS_09020 873896 874669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 874647 876242 gene locus_tag LOCUS_09030 874647 876242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 876259 876332 gene locus_tag LOCUS_t00120 876259 876332 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 877184 876408 gene locus_tag LOCUS_09040 877184 876408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 877666 877274 gene locus_tag LOCUS_09050 877666 877274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 878962 877964 gene locus_tag LOCUS_09060 878962 877964 CDS product DUF1616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065996.1 protein_id gnl|my_center|LOCUS_09060 879851 879108 gene locus_tag LOCUS_09070 879851 879108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 881015 880572 gene locus_tag LOCUS_09080 881015 880572 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023936.1 protein_id gnl|my_center|LOCUS_09080 882181 881012 gene locus_tag LOCUS_09090 882181 881012 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 protein_id gnl|my_center|LOCUS_09090 883215 882178 gene locus_tag LOCUS_09100 883215 882178 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023934.1 protein_id gnl|my_center|LOCUS_09100 883941 883222 gene locus_tag LOCUS_09110 883941 883222 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023933.1 protein_id gnl|my_center|LOCUS_09110 884139 884042 gene locus_tag LOCUS_t00130 884139 884042 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 884468 884223 gene locus_tag LOCUS_09120 884468 884223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 884553 885107 gene locus_tag LOCUS_09130 884553 885107 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023239.1 protein_id gnl|my_center|LOCUS_09130 885257 886162 gene locus_tag LOCUS_09140 gene mtrE 885257 886162 CDS product tetrahydromethanopterin S-methyltransferase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020334.1 protein_id gnl|my_center|LOCUS_09140 886159 886845 gene locus_tag LOCUS_09150 gene mtrD 886159 886845 CDS product tetrahydromethanopterin S-methyltransferase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020333.1 protein_id gnl|my_center|LOCUS_09150 886847 887674 gene locus_tag LOCUS_09160 gene mtrC 886847 887674 CDS product tetrahydromethanopterin S-methyltransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020332.1 protein_id gnl|my_center|LOCUS_09160 887685 888038 gene locus_tag LOCUS_09170 887685 888038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 888041 888772 gene locus_tag LOCUS_09180 gene mtrA 888041 888772 CDS product tetrahydromethanopterin S-methyltransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020330.1 protein_id gnl|my_center|LOCUS_09180 888774 889001 gene locus_tag LOCUS_09190 888774 889001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 889005 889262 gene locus_tag LOCUS_09200 889005 889262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 889263 890198 gene locus_tag LOCUS_09210 gene mtrH 889263 890198 CDS product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020327.1 protein_id gnl|my_center|LOCUS_09210 890234 890881 gene locus_tag LOCUS_09220 890234 890881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 891341 891129 gene locus_tag LOCUS_09230 891341 891129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 892031 891786 gene locus_tag LOCUS_09240 892031 891786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 893018 892059 gene locus_tag LOCUS_09250 893018 892059 CDS product methanogenesis marker 12 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023754.1 protein_id gnl|my_center|LOCUS_09250 893902 893009 gene locus_tag LOCUS_09260 gene cofD 893902 893009 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066127.1 protein_id gnl|my_center|LOCUS_09260 894473 893904 gene locus_tag LOCUS_09270 894473 893904 CDS product ZPR1 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023781.1 protein_id gnl|my_center|LOCUS_09270 894772 894470 gene locus_tag LOCUS_09280 gene sepF 894772 894470 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878285.1 protein_id gnl|my_center|LOCUS_09280 895874 894873 gene locus_tag LOCUS_09290 gene cofG 895874 894873 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755891.1 protein_id gnl|my_center|LOCUS_09290 896324 895875 gene locus_tag LOCUS_09300 896324 895875 CDS product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023592.1 protein_id gnl|my_center|LOCUS_09300 896650 896486 gene locus_tag LOCUS_09310 896650 896486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09310 897518 896595 gene locus_tag LOCUS_09320 897518 896595 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023593.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09320 897944 897600 gene locus_tag LOCUS_09330 897944 897600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09330 898357 897941 gene locus_tag LOCUS_09340 898357 897941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09340 899411 898587 gene locus_tag LOCUS_09350 899411 898587 CDS product F420-dependent methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065986.1 protein_id gnl|my_center|LOCUS_09350 899646 899807 gene locus_tag LOCUS_09360 899646 899807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 900058 900252 gene locus_tag LOCUS_09370 900058 900252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 900436 900753 gene locus_tag LOCUS_09380 900436 900753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09380 901385 902074 gene locus_tag LOCUS_09390 901385 902074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 902093 902749 gene locus_tag LOCUS_09400 902093 902749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 903891 902947 gene locus_tag LOCUS_09410 903891 902947 CDS product IS5-like element ISMac22 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022661.1 protein_id gnl|my_center|LOCUS_09410 905047 904430 gene locus_tag LOCUS_09420 905047 904430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 905787 905194 gene locus_tag LOCUS_09430 905787 905194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 906034 905960 gene locus_tag LOCUS_t00140 906034 905960 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 906443 907153 gene locus_tag LOCUS_09440 906443 907153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 907438 908142 gene locus_tag LOCUS_09450 907438 908142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 908152 908682 gene locus_tag LOCUS_09460 908152 908682 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250569.1 protein_id gnl|my_center|LOCUS_09460 908679 909125 gene locus_tag LOCUS_09470 908679 909125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 910130 909126 gene locus_tag LOCUS_09480 910130 909126 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021397.1 protein_id gnl|my_center|LOCUS_09480 910799 910140 gene locus_tag LOCUS_09490 gene phoU 910799 910140 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461595.1 protein_id gnl|my_center|LOCUS_09490 911563 910817 gene locus_tag LOCUS_09500 gene pstB 911563 910817 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020934.1 protein_id gnl|my_center|LOCUS_09500 911881 913521 gene locus_tag LOCUS_09510 gene thsB 911881 913521 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879727.1 protein_id gnl|my_center|LOCUS_09510 913561 914190 gene locus_tag LOCUS_09520 gene grpE 913561 914190 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_09520 914319 916172 gene locus_tag LOCUS_09530 gene dnaK 914319 916172 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_09530 916243 917412 gene locus_tag LOCUS_09540 gene dnaJ 916243 917412 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021493.1 protein_id gnl|my_center|LOCUS_09540 917833 917393 gene locus_tag LOCUS_09550 917833 917393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 917753 917953 gene locus_tag LOCUS_09560 917753 917953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 918415 918921 gene locus_tag LOCUS_09570 gene fae 918415 918921 CDS product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022945.1 protein_id gnl|my_center|LOCUS_09570 919131 928523 gene locus_tag LOCUS_09580 919131 928523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 928707 929099 gene locus_tag LOCUS_09590 928707 929099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 930365 929175 gene locus_tag LOCUS_09600 930365 929175 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871084.1 protein_id gnl|my_center|LOCUS_09600 930605 930372 gene locus_tag LOCUS_09610 930605 930372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 931423 930800 gene locus_tag LOCUS_09620 931423 930800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 931774 931430 gene locus_tag LOCUS_09630 931774 931430 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021428.1 protein_id gnl|my_center|LOCUS_09630 932111 932186 gene locus_tag LOCUS_t00150 932111 932186 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 932192 932264 gene locus_tag LOCUS_t00160 932192 932264 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 934101 932611 gene locus_tag LOCUS_09640 934101 932611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 935166 934423 gene locus_tag LOCUS_09650 935166 934423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 935992 935354 gene locus_tag LOCUS_09660 935992 935354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 936236 936688 gene locus_tag LOCUS_09670 936236 936688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 937080 937280 gene locus_tag LOCUS_09680 937080 937280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 937799 937434 gene locus_tag LOCUS_09690 937799 937434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 937966 939138 gene locus_tag LOCUS_09700 937966 939138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 939140 940732 gene locus_tag LOCUS_09710 939140 940732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 942001 942411 gene locus_tag LOCUS_09720 942001 942411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 942487 942738 gene locus_tag LOCUS_09730 942487 942738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09730 942953 942774 gene locus_tag LOCUS_09740 942953 942774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 943667 945280 gene locus_tag LOCUS_09750 943667 945280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 945408 946595 gene locus_tag LOCUS_09760 945408 946595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 947893 946964 gene locus_tag LOCUS_09770 947893 946964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 949405 948311 gene locus_tag LOCUS_09780 949405 948311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 949887 949663 gene locus_tag LOCUS_09790 949887 949663 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496448.1 protein_id gnl|my_center|LOCUS_09790 950248 949877 gene locus_tag LOCUS_09800 950248 949877 CDS product DUF2178 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023877.1 protein_id gnl|my_center|LOCUS_09800 951498 951965 gene locus_tag LOCUS_09810 951498 951965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 951973 953205 gene locus_tag LOCUS_09820 951973 953205 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860152.1 protein_id gnl|my_center|LOCUS_09820 953343 954284 gene locus_tag LOCUS_09830 953343 954284 CDS product nucleoside recognition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023218.1 protein_id gnl|my_center|LOCUS_09830 954497 954859 gene locus_tag LOCUS_09840 954497 954859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 954860 955687 gene locus_tag LOCUS_09850 954860 955687 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860221.1 protein_id gnl|my_center|LOCUS_09850 956866 956429 gene locus_tag LOCUS_09860 956866 956429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09860 957040 958290 gene locus_tag LOCUS_09870 957040 958290 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860152.1 protein_id gnl|my_center|LOCUS_09870 958810 958400 gene locus_tag LOCUS_09880 958810 958400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 959745 959098 gene locus_tag LOCUS_09890 959745 959098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 960855 960007 gene locus_tag LOCUS_09900 960855 960007 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007204.1 protein_id gnl|my_center|LOCUS_09900 961568 960822 gene locus_tag LOCUS_09910 gene mntB 961568 960822 CDS product manganese ABC transporter ATP-binding protein MntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398644.1 protein_id gnl|my_center|LOCUS_09910 962034 961591 gene locus_tag LOCUS_09920 962034 961591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 963847 962309 gene locus_tag LOCUS_09930 963847 962309 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020360.1 protein_id gnl|my_center|LOCUS_09930 964622 963894 gene locus_tag LOCUS_09940 964622 963894 CDS product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020356.1 protein_id gnl|my_center|LOCUS_09940 965527 964595 gene locus_tag LOCUS_09950 965527 964595 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020357.1 protein_id gnl|my_center|LOCUS_09950 966431 965514 gene locus_tag LOCUS_09960 966431 965514 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020358.1 protein_id gnl|my_center|LOCUS_09960 967369 966428 gene locus_tag LOCUS_09970 967369 966428 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020359.1 protein_id gnl|my_center|LOCUS_09970 969211 967655 gene locus_tag LOCUS_09980 969211 967655 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020360.1 protein_id gnl|my_center|LOCUS_09980 971015 969474 gene locus_tag LOCUS_09990 971015 969474 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020360.1 protein_id gnl|my_center|LOCUS_09990 971795 971028 gene locus_tag LOCUS_10000 971795 971028 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020355.1 protein_id gnl|my_center|LOCUS_10000 973080 972130 gene locus_tag LOCUS_10010 973080 972130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 974865 973114 gene locus_tag LOCUS_10020 974865 973114 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141301.1 protein_id gnl|my_center|LOCUS_10020 975848 974862 gene locus_tag LOCUS_10030 975848 974862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10030 976672 975848 gene locus_tag LOCUS_10040 976672 975848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 977005 977277 gene locus_tag LOCUS_10050 977005 977277 CDS product non-histone chromosomal MC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023527.1 protein_id gnl|my_center|LOCUS_10050 977503 978774 gene locus_tag LOCUS_10060 977503 978774 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990611.1 protein_id gnl|my_center|LOCUS_10060 978848 980224 gene locus_tag LOCUS_10070 978848 980224 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860152.1 protein_id gnl|my_center|LOCUS_10070 980549 981820 gene locus_tag LOCUS_10080 980549 981820 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990611.1 protein_id gnl|my_center|LOCUS_10080 982439 982209 gene locus_tag LOCUS_10090 982439 982209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 982978 982529 gene locus_tag LOCUS_10100 982978 982529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 983320 983138 gene locus_tag LOCUS_10110 983320 983138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 983475 984554 gene locus_tag LOCUS_10120 983475 984554 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 protein_id gnl|my_center|LOCUS_10120 984580 984981 gene locus_tag LOCUS_10130 984580 984981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 985583 984972 gene locus_tag LOCUS_10140 985583 984972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 986995 985622 gene locus_tag LOCUS_10150 986995 985622 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022838.1 protein_id gnl|my_center|LOCUS_10150 988656 986986 gene locus_tag LOCUS_10160 988656 986986 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022839.1 protein_id gnl|my_center|LOCUS_10160 988951 989532 gene locus_tag LOCUS_10170 988951 989532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 989933 989703 gene locus_tag LOCUS_10180 989933 989703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 990591 990863 gene locus_tag LOCUS_10190 990591 990863 CDS product non-histone chromosomal MC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023527.1 protein_id gnl|my_center|LOCUS_10190 992239 990935 gene locus_tag LOCUS_10200 gene aspS 992239 990935 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021688.1 protein_id gnl|my_center|LOCUS_10200 992696 993205 gene locus_tag LOCUS_10210 992696 993205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 993208 993414 gene locus_tag LOCUS_10220 993208 993414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 993411 994139 gene locus_tag LOCUS_10230 993411 994139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10230 994251 996632 gene locus_tag LOCUS_10240 994251 996632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10240 996665 996853 gene locus_tag LOCUS_10250 996665 996853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 996955 996755 gene locus_tag LOCUS_10260 996955 996755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10260 998075 997173 gene locus_tag LOCUS_10270 998075 997173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 999240 998398 gene locus_tag LOCUS_10280 999240 998398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 999717 999400 gene locus_tag LOCUS_10290 999717 999400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 1000933 999818 gene locus_tag LOCUS_10300 1000933 999818 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860150.1 protein_id gnl|my_center|LOCUS_10300 1001931 1001356 gene locus_tag LOCUS_10310 1001931 1001356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 1004586 1002016 gene locus_tag LOCUS_10320 1004586 1002016 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877365.1 protein_id gnl|my_center|LOCUS_10320 1004802 1005854 gene locus_tag LOCUS_10330 1004802 1005854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023363.1 protein_id gnl|my_center|LOCUS_10330 1006665 1005928 gene locus_tag LOCUS_10340 1006665 1005928 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064947.1 protein_id gnl|my_center|LOCUS_10340 1008126 1006702 gene locus_tag LOCUS_10350 1008126 1006702 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020324.1 protein_id gnl|my_center|LOCUS_10350 1008658 1008230 gene locus_tag LOCUS_10360 1008658 1008230 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020323.1 protein_id gnl|my_center|LOCUS_10360 1009640 1008687 gene locus_tag LOCUS_10370 1009640 1008687 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_10370 1010700 1009870 gene locus_tag LOCUS_10380 1010700 1009870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10380 1012412 1010814 gene locus_tag LOCUS_10390 1012412 1010814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10390 1013029 1012712 gene locus_tag LOCUS_10400 1013029 1012712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10400 1014871 1013042 gene locus_tag LOCUS_10410 1014871 1013042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10410 1015085 1014903 gene locus_tag LOCUS_10420 1015085 1014903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 1017720 1015156 gene locus_tag LOCUS_10430 1017720 1015156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 1018991 1018116 gene locus_tag LOCUS_10440 1018991 1018116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10440 1019330 1019839 gene locus_tag LOCUS_10450 1019330 1019839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 1019924 1020613 gene locus_tag LOCUS_10460 1019924 1020613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 1022199 1020697 gene locus_tag LOCUS_10470 gene serS 1022199 1020697 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876746.1 protein_id gnl|my_center|LOCUS_10470 1022426 1022196 gene locus_tag LOCUS_10480 1022426 1022196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 1023745 1022423 gene locus_tag LOCUS_10490 1023745 1022423 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023357.1 protein_id gnl|my_center|LOCUS_10490 1024101 1023742 gene locus_tag LOCUS_10500 1024101 1023742 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020987.1 protein_id gnl|my_center|LOCUS_10500 1024338 1025033 gene locus_tag LOCUS_10510 1024338 1025033 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496950.1 protein_id gnl|my_center|LOCUS_10510 1025256 1025077 gene locus_tag LOCUS_10520 1025256 1025077 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020483.1 protein_id gnl|my_center|LOCUS_10520 1027605 1025329 gene locus_tag LOCUS_10530 gene nrdD 1027605 1025329 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020131.1 protein_id gnl|my_center|LOCUS_10530 1028026 1028098 gene locus_tag LOCUS_t00170 1028026 1028098 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1028169 1028834 gene locus_tag LOCUS_10540 1028169 1028834 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064923.1 protein_id gnl|my_center|LOCUS_10540 1028845 1029738 gene locus_tag LOCUS_10550 1028845 1029738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 1029772 1030365 gene locus_tag LOCUS_10560 1029772 1030365 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066526.1 protein_id gnl|my_center|LOCUS_10560 1030362 1031909 gene locus_tag LOCUS_10570 gene proS 1030362 1031909 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023782.1 protein_id gnl|my_center|LOCUS_10570 1031918 1032901 gene locus_tag LOCUS_10580 1031918 1032901 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085984847.1 protein_id gnl|my_center|LOCUS_10580 1032906 1033742 gene locus_tag LOCUS_10590 1032906 1033742 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022647.1 protein_id gnl|my_center|LOCUS_10590 1033836 1034498 gene locus_tag LOCUS_10600 1033836 1034498 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022466.1 protein_id gnl|my_center|LOCUS_10600 1034580 1035191 gene locus_tag LOCUS_10610 1034580 1035191 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879461.1 protein_id gnl|my_center|LOCUS_10610 1035532 1035939 gene locus_tag LOCUS_10620 1035532 1035939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 1035948 1036697 gene locus_tag LOCUS_10630 1035948 1036697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 1036764 1038122 gene locus_tag LOCUS_10640 gene hisS 1036764 1038122 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061190.1 protein_id gnl|my_center|LOCUS_10640 1038196 1038951 gene locus_tag LOCUS_10650 1038196 1038951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 1039337 1039122 gene locus_tag LOCUS_10660 1039337 1039122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1041257 1039371 gene locus_tag LOCUS_10670 1041257 1039371 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020139.1 protein_id gnl|my_center|LOCUS_10670 1041554 1042393 gene locus_tag LOCUS_10680 1041554 1042393 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020718.1 protein_id gnl|my_center|LOCUS_10680 1043232 1042840 gene locus_tag LOCUS_10690 1043232 1042840 CDS product transcriptional regulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065665.1 protein_id gnl|my_center|LOCUS_10690 1043560 1043739 gene locus_tag LOCUS_10700 1043560 1043739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 1043785 1045119 gene locus_tag LOCUS_10710 1043785 1045119 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020230.1 protein_id gnl|my_center|LOCUS_10710 1045690 1045421 gene locus_tag LOCUS_10720 1045690 1045421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 1045935 1046162 gene locus_tag LOCUS_10730 1045935 1046162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 1046418 1047128 gene locus_tag LOCUS_10740 1046418 1047128 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023580.1 protein_id gnl|my_center|LOCUS_10740 1049250 1047220 gene locus_tag LOCUS_10750 1049250 1047220 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402998.1 protein_id gnl|my_center|LOCUS_10750 1049381 1050142 gene locus_tag LOCUS_10760 1049381 1050142 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082088944.1 protein_id gnl|my_center|LOCUS_10760 1051213 1050218 gene locus_tag LOCUS_10770 gene purM 1051213 1050218 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066059.1 protein_id gnl|my_center|LOCUS_10770 1052595 1051210 gene locus_tag LOCUS_10780 1052595 1051210 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020190.1 protein_id gnl|my_center|LOCUS_10780 1052764 1054959 gene locus_tag LOCUS_10790 1052764 1054959 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021278.1 protein_id gnl|my_center|LOCUS_10790 1055029 1056303 gene locus_tag LOCUS_10800 gene tuf 1055029 1056303 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021277.1 protein_id gnl|my_center|LOCUS_10800 1056329 1056637 gene locus_tag LOCUS_10810 gene rpsJ 1056329 1056637 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021276.1 protein_id gnl|my_center|LOCUS_10810 1056738 1056811 gene locus_tag LOCUS_t00180 1056738 1056811 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1057096 1056881 gene locus_tag LOCUS_10820 1057096 1056881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 1057428 1057210 gene locus_tag LOCUS_10830 1057428 1057210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 1058056 1058865 gene locus_tag LOCUS_10840 1058056 1058865 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023894.1 protein_id gnl|my_center|LOCUS_10840 1059059 1059613 gene locus_tag LOCUS_10850 1059059 1059613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 1062172 1059845 gene locus_tag LOCUS_10860 1062172 1059845 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209617549.1 protein_id gnl|my_center|LOCUS_10860 1062282 1062764 gene locus_tag LOCUS_10870 1062282 1062764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 1063818 1062805 gene locus_tag LOCUS_10880 1063818 1062805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 1064557 1063868 gene locus_tag LOCUS_10890 1064557 1063868 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066013.1 protein_id gnl|my_center|LOCUS_10890 1064821 1064615 gene locus_tag LOCUS_10900 1064821 1064615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 1064951 1065541 gene locus_tag LOCUS_10910 1064951 1065541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 1065651 1066148 gene locus_tag LOCUS_10920 1065651 1066148 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943250.1 protein_id gnl|my_center|LOCUS_10920 1066200 1067306 gene locus_tag LOCUS_10930 1066200 1067306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 1067859 1067371 gene locus_tag LOCUS_10940 gene ribC 1067859 1067371 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021819.1 protein_id gnl|my_center|LOCUS_10940 1069184 1067940 gene locus_tag LOCUS_10950 1069184 1067940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 1070046 1069366 gene locus_tag LOCUS_10960 1070046 1069366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022686.1 protein_id gnl|my_center|LOCUS_10960 1070733 1071071 gene locus_tag LOCUS_10970 1070733 1071071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 1071842 1071663 gene locus_tag LOCUS_10980 1071842 1071663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 1072477 1071977 gene locus_tag LOCUS_10990 1072477 1071977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10990 1072683 1072474 gene locus_tag LOCUS_11000 1072683 1072474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 1073782 1072763 gene locus_tag LOCUS_11010 1073782 1072763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 1076061 1074613 gene locus_tag LOCUS_11020 1076061 1074613 CDS product funZ protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957049.1 protein_id gnl|my_center|LOCUS_11020 1076247 1077338 gene locus_tag LOCUS_11030 1076247 1077338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11030 1077304 1077819 gene locus_tag LOCUS_11040 1077304 1077819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11040 1078570 1078391 gene locus_tag LOCUS_11050 1078570 1078391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 1078664 1079404 gene locus_tag LOCUS_11060 1078664 1079404 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066008.1 protein_id gnl|my_center|LOCUS_11060 1079535 1080611 gene locus_tag LOCUS_11070 gene priS 1079535 1080611 CDS product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020695.1 protein_id gnl|my_center|LOCUS_11070 1080691 1081257 gene locus_tag LOCUS_11080 1080691 1081257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 1081270 1081545 gene locus_tag LOCUS_11090 1081270 1081545 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020693.1 protein_id gnl|my_center|LOCUS_11090 1081548 1081715 gene locus_tag LOCUS_11100 1081548 1081715 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878831.1 protein_id gnl|my_center|LOCUS_11100 1081758 1082495 gene locus_tag LOCUS_11110 1081758 1082495 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064935.1 protein_id gnl|my_center|LOCUS_11110 1082650 1083420 gene locus_tag LOCUS_11120 1082650 1083420 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878032.1 protein_id gnl|my_center|LOCUS_11120 1083395 1084729 gene locus_tag LOCUS_11130 1083395 1084729 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065661.1 protein_id gnl|my_center|LOCUS_11130 1084793 1085647 gene locus_tag LOCUS_11140 1084793 1085647 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021191.1 protein_id gnl|my_center|LOCUS_11140 1086071 1085733 gene locus_tag LOCUS_11150 1086071 1085733 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941431.1 protein_id gnl|my_center|LOCUS_11150 1086804 1086064 gene locus_tag LOCUS_11160 1086804 1086064 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941430.1 protein_id gnl|my_center|LOCUS_11160 1087744 1087028 gene locus_tag LOCUS_11170 1087744 1087028 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942367.1 protein_id gnl|my_center|LOCUS_11170 1090413 1087741 gene locus_tag LOCUS_11180 1090413 1087741 CDS product oligosaccharyl transferase, archaeosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065792.1 protein_id gnl|my_center|LOCUS_11180 1090758 1090685 gene locus_tag LOCUS_t00190 1090758 1090685 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1090914 1090744 gene locus_tag LOCUS_11190 1090914 1090744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 1090956 1091384 gene locus_tag LOCUS_11200 1090956 1091384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 1091771 1091412 gene locus_tag LOCUS_11210 gene queD 1091771 1091412 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065925.1 protein_id gnl|my_center|LOCUS_11210 1092750 1091935 gene locus_tag LOCUS_11220 gene dph5 1092750 1091935 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021388.1 protein_id gnl|my_center|LOCUS_11220 1092857 1093489 gene locus_tag LOCUS_11230 gene mcrC 1092857 1093489 CDS product methyl-coenzyme M reductase I operon protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024421.1 protein_id gnl|my_center|LOCUS_11230 1093524 1094699 gene locus_tag LOCUS_11240 1093524 1094699 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020191.1 protein_id gnl|my_center|LOCUS_11240 1094708 1095658 gene locus_tag LOCUS_11250 1094708 1095658 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879220.1 protein_id gnl|my_center|LOCUS_11250 1095697 1096722 gene locus_tag LOCUS_11260 gene argC 1095697 1096722 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065747.1 protein_id gnl|my_center|LOCUS_11260 1096766 1097254 gene locus_tag LOCUS_11270 1096766 1097254 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065746.1 protein_id gnl|my_center|LOCUS_11270 1097241 1098410 gene locus_tag LOCUS_11280 gene argJ 1097241 1098410 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023478.1 protein_id gnl|my_center|LOCUS_11280 1098412 1099872 gene locus_tag LOCUS_11290 gene argH 1098412 1099872 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021337.1 protein_id gnl|my_center|LOCUS_11290 1099897 1100796 gene locus_tag LOCUS_11300 gene rfaD 1099897 1100796 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880173.1 protein_id gnl|my_center|LOCUS_11300 1100965 1102065 gene locus_tag LOCUS_11310 1100965 1102065 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868579.1 protein_id gnl|my_center|LOCUS_11310 1102088 1103032 gene locus_tag LOCUS_11320 1102088 1103032 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877828.1 protein_id gnl|my_center|LOCUS_11320 1103144 1103917 gene locus_tag LOCUS_11330 1103144 1103917 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012940593.1 protein_id gnl|my_center|LOCUS_11330 1103919 1104743 gene locus_tag LOCUS_11340 1103919 1104743 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877555.1 protein_id gnl|my_center|LOCUS_11340 1105076 1105465 gene locus_tag LOCUS_11350 gene nikR 1105076 1105465 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023967.1 protein_id gnl|my_center|LOCUS_11350 1105576 1107045 gene locus_tag LOCUS_11360 1105576 1107045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 1107185 1108009 gene locus_tag LOCUS_11370 1107185 1108009 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065716.1 protein_id gnl|my_center|LOCUS_11370 1108318 1108091 gene locus_tag LOCUS_11380 1108318 1108091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 1108493 1108735 gene locus_tag LOCUS_11390 1108493 1108735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 1109995 1108763 gene locus_tag LOCUS_11400 1109995 1108763 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064787.1 protein_id gnl|my_center|LOCUS_11400 1111010 1110684 gene locus_tag LOCUS_11410 1111010 1110684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 1111541 1111750 gene locus_tag LOCUS_11420 1111541 1111750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1112452 1113249 gene locus_tag LOCUS_11430 1112452 1113249 CDS product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876426.1 protein_id gnl|my_center|LOCUS_11430 1113282 1114262 gene locus_tag LOCUS_11440 1113282 1114262 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108486.1 protein_id gnl|my_center|LOCUS_11440 1115347 1114427 gene locus_tag LOCUS_11450 1115347 1114427 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021489.1 protein_id gnl|my_center|LOCUS_11450 1115435 1115947 gene locus_tag LOCUS_11460 gene cbiT 1115435 1115947 CDS product precorrin-6Y C5,15-methyltransferase (decarboxylating) subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024144.1 protein_id gnl|my_center|LOCUS_11460 1115941 1116549 gene locus_tag LOCUS_11470 1115941 1116549 CDS product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024143.1 protein_id gnl|my_center|LOCUS_11470 1116546 1117256 gene locus_tag LOCUS_11480 1116546 1117256 CDS product cobalt-precorrin-4/precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024142.1 protein_id gnl|my_center|LOCUS_11480 1117367 1118134 gene locus_tag LOCUS_11490 gene cbiG 1117367 1118134 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903134.1 protein_id gnl|my_center|LOCUS_11490 1118136 1119539 gene locus_tag LOCUS_11500 1118136 1119539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 1119542 1120186 gene locus_tag LOCUS_11510 1119542 1120186 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024140.1 protein_id gnl|my_center|LOCUS_11510 1120167 1121192 gene locus_tag LOCUS_11520 1120167 1121192 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020570.1 protein_id gnl|my_center|LOCUS_11520 1121189 1121761 gene locus_tag LOCUS_11530 1121189 1121761 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020569.1 protein_id gnl|my_center|LOCUS_11530 1122958 1121813 gene locus_tag LOCUS_11540 1122958 1121813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 1123356 1123057 gene locus_tag LOCUS_11550 1123356 1123057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 1123689 1123949 gene locus_tag LOCUS_11560 1123689 1123949 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064806.1 protein_id gnl|my_center|LOCUS_11560 1124098 1124292 gene locus_tag LOCUS_11570 1124098 1124292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1125260 1124247 gene locus_tag LOCUS_11580 1125260 1124247 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020659.1 protein_id gnl|my_center|LOCUS_11580 1125523 1125248 gene locus_tag LOCUS_11590 1125523 1125248 CDS product Gar1/Naf1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867430.1 protein_id gnl|my_center|LOCUS_11590 1125768 1126622 gene locus_tag LOCUS_11600 1125768 1126622 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589523.1 protein_id gnl|my_center|LOCUS_11600 1127260 1126631 gene locus_tag LOCUS_11610 1127260 1126631 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021454.1 protein_id gnl|my_center|LOCUS_11610 1128101 1127316 gene locus_tag LOCUS_11620 1128101 1127316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1130057 1128390 gene locus_tag LOCUS_11630 gene thsB 1130057 1128390 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020145.1 protein_id gnl|my_center|LOCUS_11630 1130243 1130437 gene locus_tag LOCUS_11640 1130243 1130437 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331438.1 protein_id gnl|my_center|LOCUS_11640 1131267 1130611 gene locus_tag LOCUS_11650 1131267 1130611 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941521.1 protein_id gnl|my_center|LOCUS_11650 1131619 1131200 gene locus_tag LOCUS_11660 1131619 1131200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11660 1133009 1131561 gene locus_tag LOCUS_11670 1133009 1131561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11670 1133567 1133109 gene locus_tag LOCUS_11680 gene ndk 1133567 1133109 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_11680 1133749 1133570 gene locus_tag LOCUS_11690 1133749 1133570 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021537.1 protein_id gnl|my_center|LOCUS_11690 1133958 1133746 gene locus_tag LOCUS_11700 1133958 1133746 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065141.1 protein_id gnl|my_center|LOCUS_11700 1134337 1133969 gene locus_tag LOCUS_11710 gene rpl7ae 1134337 1133969 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053845.1 protein_id gnl|my_center|LOCUS_11710 1135306 1134452 gene locus_tag LOCUS_11720 1135306 1134452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 1136123 1135329 gene locus_tag LOCUS_11730 1136123 1135329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11730 1136443 1136180 gene locus_tag LOCUS_11740 1136443 1136180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11740 1136780 1136601 gene locus_tag LOCUS_11750 1136780 1136601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11750 1137222 1136833 gene locus_tag LOCUS_11760 1137222 1136833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 1137972 1137229 gene locus_tag LOCUS_11770 1137972 1137229 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066594.1 protein_id gnl|my_center|LOCUS_11770 1138184 1140265 gene locus_tag LOCUS_11780 1138184 1140265 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879431.1 protein_id gnl|my_center|LOCUS_11780 1140331 1140936 gene locus_tag LOCUS_11790 1140331 1140936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 1141100 1141834 gene locus_tag LOCUS_11800 1141100 1141834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 1143253 1141916 gene locus_tag LOCUS_11810 1143253 1141916 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024460.1 protein_id gnl|my_center|LOCUS_11810 1146942 1143325 gene locus_tag LOCUS_11820 1146942 1143325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 1147255 1146920 gene locus_tag LOCUS_11830 1147255 1146920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 1147940 1147353 gene locus_tag LOCUS_11840 1147940 1147353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 1148161 1149195 gene locus_tag LOCUS_11850 1148161 1149195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1149513 1149980 gene locus_tag LOCUS_11860 1149513 1149980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 1150505 1150143 gene locus_tag LOCUS_11870 1150505 1150143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990763.1 protein_id gnl|my_center|LOCUS_11870 1151089 1150502 gene locus_tag LOCUS_11880 1151089 1150502 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020976.1 protein_id gnl|my_center|LOCUS_11880 1151853 1151089 gene locus_tag LOCUS_11890 gene cobS 1151853 1151089 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020977.1 protein_id gnl|my_center|LOCUS_11890 1152329 1151850 gene locus_tag LOCUS_11900 gene cobZ 1152329 1151850 CDS product alpha-ribazole phosphatase CobZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065005.1 protein_id gnl|my_center|LOCUS_11900 1152422 1152772 gene locus_tag LOCUS_11910 1152422 1152772 CDS product MJ1244 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060970.1 protein_id gnl|my_center|LOCUS_11910 1152756 1152983 gene locus_tag LOCUS_11920 1152756 1152983 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791779.1 protein_id gnl|my_center|LOCUS_11920 1153004 1153228 gene locus_tag LOCUS_11930 1153004 1153228 CDS product Sm protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021429.1 protein_id gnl|my_center|LOCUS_11930 1153238 1153639 gene locus_tag LOCUS_11940 1153238 1153639 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589516.1 protein_id gnl|my_center|LOCUS_11940 1154029 1153721 gene locus_tag LOCUS_11950 gene yciH 1154029 1153721 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023951.1 protein_id gnl|my_center|LOCUS_11950 1156459 1154099 gene locus_tag LOCUS_11960 1156459 1154099 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023083.1 protein_id gnl|my_center|LOCUS_11960 1158198 1156456 gene locus_tag LOCUS_11970 1158198 1156456 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023084.1 protein_id gnl|my_center|LOCUS_11970 1158305 1158766 gene locus_tag LOCUS_11980 1158305 1158766 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022827.1 protein_id gnl|my_center|LOCUS_11980 1158784 1160016 gene locus_tag LOCUS_11990 1158784 1160016 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065549.1 protein_id gnl|my_center|LOCUS_11990 1160018 1160404 gene locus_tag LOCUS_12000 1160018 1160404 CDS product molybdopterin dinucleotide binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065550.1 protein_id gnl|my_center|LOCUS_12000 1160409 1161362 gene locus_tag LOCUS_12010 gene argF 1160409 1161362 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023243.1 protein_id gnl|my_center|LOCUS_12010 1161683 1161768 gene locus_tag LOCUS_t00200 1161683 1161768 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1163135 1162095 gene locus_tag LOCUS_12020 1163135 1162095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 1163542 1163093 gene locus_tag LOCUS_12030 1163542 1163093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 1164376 1164996 gene locus_tag LOCUS_12040 1164376 1164996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 1165467 1165784 gene locus_tag LOCUS_12050 1165467 1165784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 1166552 1166013 gene locus_tag LOCUS_12060 1166552 1166013 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877227.1 protein_id gnl|my_center|LOCUS_12060 1167609 1166554 gene locus_tag LOCUS_12070 gene hisC 1167609 1166554 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064817.1 protein_id gnl|my_center|LOCUS_12070 1168744 1167596 gene locus_tag LOCUS_12080 1168744 1167596 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066055.1 protein_id gnl|my_center|LOCUS_12080 1169402 1168764 gene locus_tag LOCUS_12090 1169402 1168764 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024487.1 protein_id gnl|my_center|LOCUS_12090 1169456 1170745 gene locus_tag LOCUS_12100 gene thiC 1169456 1170745 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021793.1 protein_id gnl|my_center|LOCUS_12100 1171088 1170789 gene locus_tag LOCUS_12110 1171088 1170789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 1171749 1171336 gene locus_tag LOCUS_12120 1171749 1171336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 1173256 1172096 gene locus_tag LOCUS_12130 1173256 1172096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 1173521 1173763 gene locus_tag LOCUS_12140 1173521 1173763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 1173763 1174527 gene locus_tag LOCUS_12150 1173763 1174527 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020095.1 protein_id gnl|my_center|LOCUS_12150 1175256 1174576 gene locus_tag LOCUS_12160 1175256 1174576 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020399.1 protein_id gnl|my_center|LOCUS_12160 1175696 1175289 gene locus_tag LOCUS_12170 gene nikR 1175696 1175289 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023967.1 protein_id gnl|my_center|LOCUS_12170 1175837 1176397 gene locus_tag LOCUS_12180 1175837 1176397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066058.1 protein_id gnl|my_center|LOCUS_12180 1176410 1176682 gene locus_tag LOCUS_12190 1176410 1176682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 1177984 1176848 gene locus_tag LOCUS_12200 1177984 1176848 CDS product DUF1646 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878290.1 protein_id gnl|my_center|LOCUS_12200 1178138 1177974 gene locus_tag LOCUS_12210 1178138 1177974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 1179347 1178484 gene locus_tag LOCUS_12220 1179347 1178484 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545447.1 protein_id gnl|my_center|LOCUS_12220 1180373 1179399 gene locus_tag LOCUS_12230 1180373 1179399 CDS product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878512.1 protein_id gnl|my_center|LOCUS_12230 1181290 1180391 gene locus_tag LOCUS_12240 gene trxB 1181290 1180391 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_12240 1181442 1181513 gene locus_tag LOCUS_t00210 1181442 1181513 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1181636 1181779 gene locus_tag LOCUS_12250 1181636 1181779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 1181795 1183093 gene locus_tag LOCUS_12260 1181795 1183093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 1184123 1183869 gene locus_tag LOCUS_12270 1184123 1183869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 1184623 1185132 gene locus_tag LOCUS_12280 1184623 1185132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 1185300 1185812 gene locus_tag LOCUS_12290 1185300 1185812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 1186135 1186398 gene locus_tag LOCUS_12300 1186135 1186398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 1186428 1187120 gene locus_tag LOCUS_12310 1186428 1187120 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_12310 1187121 1188041 gene locus_tag LOCUS_12320 1187121 1188041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 1188089 1189303 gene locus_tag LOCUS_12330 1188089 1189303 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393833.1 protein_id gnl|my_center|LOCUS_12330 1190421 1189597 gene locus_tag LOCUS_12340 1190421 1189597 CDS product DUF166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021826.1 protein_id gnl|my_center|LOCUS_12340 1191212 1190418 gene locus_tag LOCUS_12350 1191212 1190418 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939814.1 protein_id gnl|my_center|LOCUS_12350 1192527 1191214 gene locus_tag LOCUS_12360 gene hcp 1192527 1191214 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080194.1 protein_id gnl|my_center|LOCUS_12360 1192601 1192960 gene locus_tag LOCUS_12370 1192601 1192960 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056318.1 protein_id gnl|my_center|LOCUS_12370 1193489 1194367 gene locus_tag LOCUS_12380 1193489 1194367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 1194351 1194986 gene locus_tag LOCUS_12390 1194351 1194986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 1196470 1195244 gene locus_tag LOCUS_12400 1196470 1195244 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 protein_id gnl|my_center|LOCUS_12400 1196499 1196696 gene locus_tag LOCUS_12410 1196499 1196696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1197078 1196872 gene locus_tag LOCUS_12420 1197078 1196872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 1198355 1197159 gene locus_tag LOCUS_12430 1198355 1197159 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060795.1 protein_id gnl|my_center|LOCUS_12430 1199483 1198359 gene locus_tag LOCUS_12440 1199483 1198359 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021211.1 protein_id gnl|my_center|LOCUS_12440 1199804 1199568 gene locus_tag LOCUS_12450 1199804 1199568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 1200548 1199907 gene locus_tag LOCUS_12460 1200548 1199907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 1201152 1200565 gene locus_tag LOCUS_12470 1201152 1200565 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021058.1 protein_id gnl|my_center|LOCUS_12470 1202933 1201149 gene locus_tag LOCUS_12480 gene iorA 1202933 1201149 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065029.1 protein_id gnl|my_center|LOCUS_12480 1203105 1204130 gene locus_tag LOCUS_12490 1203105 1204130 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023617.1 protein_id gnl|my_center|LOCUS_12490 1204168 1204470 gene locus_tag LOCUS_12500 1204168 1204470 CDS product DUF2551 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023626.1 protein_id gnl|my_center|LOCUS_12500 1206131 1204629 gene locus_tag LOCUS_12510 1206131 1204629 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052292216.1 protein_id gnl|my_center|LOCUS_12510 1206308 1207723 gene locus_tag LOCUS_12520 1206308 1207723 CDS product L-aspartate semialdehyde sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021823.1 protein_id gnl|my_center|LOCUS_12520 1207726 1208112 gene locus_tag LOCUS_12530 1207726 1208112 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065229.1 protein_id gnl|my_center|LOCUS_12530 1208239 1208406 gene locus_tag LOCUS_12540 1208239 1208406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 1208390 1208860 gene locus_tag LOCUS_12550 1208390 1208860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 1208814 1212248 gene locus_tag LOCUS_12560 1208814 1212248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 1212895 1212245 gene locus_tag LOCUS_12570 1212895 1212245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 1213921 1212995 gene locus_tag LOCUS_12580 1213921 1212995 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020979.1 protein_id gnl|my_center|LOCUS_12580 1214160 1213918 gene locus_tag LOCUS_12590 1214160 1213918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12590 1215242 1214148 gene locus_tag LOCUS_12600 gene cobD 1215242 1214148 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020980.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12600 1215541 1217958 gene locus_tag LOCUS_12610 gene cdhA 1215541 1217958 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879884.1 protein_id gnl|my_center|LOCUS_12610 1217979 1218542 gene locus_tag LOCUS_12620 gene cdhB 1217979 1218542 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879885.1 protein_id gnl|my_center|LOCUS_12620 1218582 1219988 gene locus_tag LOCUS_12630 gene cdhC 1218582 1219988 CDS product CO dehydrogenase/CO-methylating acetyl-CoA synthase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877886.1 protein_id gnl|my_center|LOCUS_12630 1220022 1220198 gene locus_tag LOCUS_12640 1220022 1220198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 1220284 1220460 gene locus_tag LOCUS_12650 1220284 1220460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 1220474 1221232 gene locus_tag LOCUS_12660 1220474 1221232 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023761.1 protein_id gnl|my_center|LOCUS_12660 1221244 1222596 gene locus_tag LOCUS_12670 gene cdhD 1221244 1222596 CDS product CO dehydrogenase/acetyl-CoA synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021047.1 protein_id gnl|my_center|LOCUS_12670 1222593 1224017 gene locus_tag LOCUS_12680 gene acsC 1222593 1224017 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021046.1 protein_id gnl|my_center|LOCUS_12680 1224270 1224704 gene locus_tag LOCUS_12690 1224270 1224704 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021802.1 protein_id gnl|my_center|LOCUS_12690 1225579 1224761 gene locus_tag LOCUS_12700 gene truA 1225579 1224761 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020266.1 protein_id gnl|my_center|LOCUS_12700 1226919 1225630 gene locus_tag LOCUS_12710 1226919 1225630 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589524.1 protein_id gnl|my_center|LOCUS_12710 1227548 1226916 gene locus_tag LOCUS_12720 gene udg 1227548 1226916 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762472.1 protein_id gnl|my_center|LOCUS_12720 1227630 1227866 gene locus_tag LOCUS_12730 1227630 1227866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 1228977 1227871 gene locus_tag LOCUS_12740 1228977 1227871 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978812.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12740 1230304 1229336 gene locus_tag LOCUS_12750 1230304 1229336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 1231519 1230797 gene locus_tag LOCUS_12760 1231519 1230797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 1231746 1231516 gene locus_tag LOCUS_12770 1231746 1231516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 1233405 1233217 gene locus_tag LOCUS_12780 1233405 1233217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 1234682 1233975 gene locus_tag LOCUS_12790 gene istB 1234682 1233975 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459339.1 protein_id gnl|my_center|LOCUS_12790 1236158 1234686 gene locus_tag LOCUS_12800 gene istA 1236158 1234686 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128955176.1 protein_id gnl|my_center|LOCUS_12800 1236873 1237955 gene locus_tag LOCUS_12810 gene glk 1236873 1237955 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022001.1 protein_id gnl|my_center|LOCUS_12810 1238106 1239323 gene locus_tag LOCUS_12820 1238106 1239323 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014128488.1 protein_id gnl|my_center|LOCUS_12820 1239425 1240219 gene locus_tag LOCUS_12830 1239425 1240219 CDS product serine/threonine-protein kinase RIO2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022486.1 protein_id gnl|my_center|LOCUS_12830 1240216 1242237 gene locus_tag LOCUS_12840 1240216 1242237 CDS product DUF460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990592.1 protein_id gnl|my_center|LOCUS_12840 1246403 1242597 gene locus_tag LOCUS_12850 gene cobN 1246403 1242597 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020926.1 protein_id gnl|my_center|LOCUS_12850 1247936 1246926 gene locus_tag LOCUS_12860 1247936 1246926 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860356.1 protein_id gnl|my_center|LOCUS_12860 1248272 1250287 gene locus_tag LOCUS_12870 1248272 1250287 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020921.1 protein_id gnl|my_center|LOCUS_12870 1250292 1251143 gene locus_tag LOCUS_12880 1250292 1251143 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546238.1 protein_id gnl|my_center|LOCUS_12880 1251145 1251882 gene locus_tag LOCUS_12890 1251145 1251882 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211328137.1 protein_id gnl|my_center|LOCUS_12890 1252887 1251907 gene locus_tag LOCUS_12900 1252887 1251907 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545174.1 protein_id gnl|my_center|LOCUS_12900 1253580 1253065 gene locus_tag LOCUS_12910 1253580 1253065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 1253905 1254735 gene locus_tag LOCUS_12920 1253905 1254735 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273465.1 protein_id gnl|my_center|LOCUS_12920 1254836 1256158 gene locus_tag LOCUS_12930 1254836 1256158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 1257180 1256389 gene locus_tag LOCUS_12940 1257180 1256389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12940 1258019 1258372 gene locus_tag LOCUS_12950 1258019 1258372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 1259031 1258573 gene locus_tag LOCUS_12960 1259031 1258573 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020196.1 protein_id gnl|my_center|LOCUS_12960 1259133 1260635 gene locus_tag LOCUS_12970 gene lysS 1259133 1260635 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066108.1 protein_id gnl|my_center|LOCUS_12970 1260650 1261084 gene locus_tag LOCUS_12980 1260650 1261084 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023482.1 protein_id gnl|my_center|LOCUS_12980 1261081 1261914 gene locus_tag LOCUS_12990 1261081 1261914 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020802.1 protein_id gnl|my_center|LOCUS_12990 1261972 1262532 gene locus_tag LOCUS_13000 gene pyrE 1261972 1262532 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057665.1 protein_id gnl|my_center|LOCUS_13000 1263234 1262599 gene locus_tag LOCUS_13010 1263234 1262599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 1263441 1264634 gene locus_tag LOCUS_13020 1263441 1264634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 1264606 1265640 gene locus_tag LOCUS_13030 1264606 1265640 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022056.1 protein_id gnl|my_center|LOCUS_13030 1265740 1265813 gene locus_tag LOCUS_t00220 1265740 1265813 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1265989 1265810 gene locus_tag LOCUS_13040 1265989 1265810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 1266353 1266027 gene locus_tag LOCUS_13050 1266353 1266027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 1266787 1267374 gene locus_tag LOCUS_13060 1266787 1267374 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762292.1 protein_id gnl|my_center|LOCUS_13060 1267592 1267371 gene locus_tag LOCUS_13070 1267592 1267371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 1267925 1268110 gene locus_tag LOCUS_13080 1267925 1268110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 1268232 1269977 gene locus_tag LOCUS_13090 gene glyS 1268232 1269977 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096515.1 protein_id gnl|my_center|LOCUS_13090 1270014 1270679 gene locus_tag LOCUS_13100 1270014 1270679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 1270808 1271455 gene locus_tag LOCUS_13110 1270808 1271455 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357697.1 protein_id gnl|my_center|LOCUS_13110 1271630 1272304 gene locus_tag LOCUS_13120 gene pyrH 1271630 1272304 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020429.1 protein_id gnl|my_center|LOCUS_13120 1273178 1272291 gene locus_tag LOCUS_13130 1273178 1272291 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021408.1 protein_id gnl|my_center|LOCUS_13130 1274445 1273300 gene locus_tag LOCUS_13140 1274445 1273300 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024301.1 protein_id gnl|my_center|LOCUS_13140 1274755 1274474 gene locus_tag LOCUS_13150 gene hisI 1274755 1274474 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020946.1 protein_id gnl|my_center|LOCUS_13150 1274860 1276029 gene locus_tag LOCUS_13160 1274860 1276029 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023953.1 protein_id gnl|my_center|LOCUS_13160 1278839 1276176 gene locus_tag LOCUS_13170 1278839 1276176 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257097.1 protein_id gnl|my_center|LOCUS_13170 1279315 1280877 gene locus_tag LOCUS_13180 1279315 1280877 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020229.1 protein_id gnl|my_center|LOCUS_13180 1280888 1282543 gene locus_tag LOCUS_13190 gene pheT 1280888 1282543 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021951.1 protein_id gnl|my_center|LOCUS_13190 1283088 1284404 gene locus_tag LOCUS_13200 1283088 1284404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 1284757 1284356 gene locus_tag LOCUS_13210 1284757 1284356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 1285114 1284884 gene locus_tag LOCUS_13220 1285114 1284884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 1285083 1285526 gene locus_tag LOCUS_13230 1285083 1285526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1285826 1285623 gene locus_tag LOCUS_13240 1285826 1285623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 1286022 1285771 gene locus_tag LOCUS_13250 1286022 1285771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 1286247 1286089 gene locus_tag LOCUS_13260 1286247 1286089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 1287907 1286693 gene locus_tag LOCUS_13270 1287907 1286693 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024286.1 protein_id gnl|my_center|LOCUS_13270 1288623 1287889 gene locus_tag LOCUS_13280 gene sufC 1288623 1287889 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876773.1 protein_id gnl|my_center|LOCUS_13280 1289340 1288663 gene locus_tag LOCUS_13290 1289340 1288663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 1290630 1289347 gene locus_tag LOCUS_13300 gene lysA 1290630 1289347 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878303.1 protein_id gnl|my_center|LOCUS_13300 1292238 1290754 gene locus_tag LOCUS_13310 1292238 1290754 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056580.1 protein_id gnl|my_center|LOCUS_13310 1292405 1292575 gene locus_tag LOCUS_13320 1292405 1292575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 1292776 1295103 gene locus_tag LOCUS_13330 1292776 1295103 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209617549.1 protein_id gnl|my_center|LOCUS_13330 1295093 1296145 gene locus_tag LOCUS_13340 1295093 1296145 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064850.1 protein_id gnl|my_center|LOCUS_13340 1296214 1296609 gene locus_tag LOCUS_13350 1296214 1296609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 1296687 1297031 gene locus_tag LOCUS_13360 1296687 1297031 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023100.1 protein_id gnl|my_center|LOCUS_13360 1297049 1297516 gene locus_tag LOCUS_13370 1297049 1297516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 1297533 1299032 gene locus_tag LOCUS_13380 1297533 1299032 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941860.1 protein_id gnl|my_center|LOCUS_13380 1299117 1300088 gene locus_tag LOCUS_13390 1299117 1300088 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066092.1 protein_id gnl|my_center|LOCUS_13390 1300477 1300392 gene locus_tag LOCUS_t00230 1300477 1300392 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1301190 1300828 gene locus_tag LOCUS_13400 1301190 1300828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1302015 1301530 gene locus_tag LOCUS_13410 1302015 1301530 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_13410 1302631 1302017 gene locus_tag LOCUS_13420 gene purN 1302631 1302017 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_13420 1302910 1302641 gene locus_tag LOCUS_13430 gene albA 1302910 1302641 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878567.1 protein_id gnl|my_center|LOCUS_13430 1303634 1303062 gene locus_tag LOCUS_13440 1303634 1303062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 1303749 1303964 gene locus_tag LOCUS_13450 1303749 1303964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 1303961 1304437 gene locus_tag LOCUS_13460 1303961 1304437 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064835.1 protein_id gnl|my_center|LOCUS_13460 1304541 1305095 gene locus_tag LOCUS_13470 1304541 1305095 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024515.1 protein_id gnl|my_center|LOCUS_13470 1305114 1305320 gene locus_tag LOCUS_13480 1305114 1305320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 1305295 1306074 gene locus_tag LOCUS_13490 1305295 1306074 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024516.1 protein_id gnl|my_center|LOCUS_13490 1306137 1307054 gene locus_tag LOCUS_13500 1306137 1307054 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048168954.1 protein_id gnl|my_center|LOCUS_13500 1307051 1307911 gene locus_tag LOCUS_13510 1307051 1307911 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024518.1 protein_id gnl|my_center|LOCUS_13510 1307911 1308690 gene locus_tag LOCUS_13520 1307911 1308690 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589511.1 protein_id gnl|my_center|LOCUS_13520 1308687 1309808 gene locus_tag LOCUS_13530 1308687 1309808 CDS product RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024521.1 protein_id gnl|my_center|LOCUS_13530 1309802 1311043 gene locus_tag LOCUS_13540 1309802 1311043 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878773.1 protein_id gnl|my_center|LOCUS_13540 1311336 1311887 gene locus_tag LOCUS_13550 1311336 1311887 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024211.1 protein_id gnl|my_center|LOCUS_13550 1311972 1314647 gene locus_tag LOCUS_13560 1311972 1314647 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064990.1 protein_id gnl|my_center|LOCUS_13560 1315374 1314727 gene locus_tag LOCUS_13570 1315374 1314727 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023336.1 protein_id gnl|my_center|LOCUS_13570 1315880 1316221 gene locus_tag LOCUS_13580 1315880 1316221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 1316218 1317885 gene locus_tag LOCUS_13590 1316218 1317885 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938901.1 protein_id gnl|my_center|LOCUS_13590 1318106 1319353 gene locus_tag LOCUS_13600 1318106 1319353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1319634 1320101 gene locus_tag LOCUS_13610 1319634 1320101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 1320232 1320921 gene locus_tag LOCUS_13620 1320232 1320921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 1321916 1320942 gene locus_tag LOCUS_13630 1321916 1320942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 1322917 1321949 gene locus_tag LOCUS_13640 1322917 1321949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 1323377 1324702 gene locus_tag LOCUS_13650 gene glnA 1323377 1324702 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392811.1 protein_id gnl|my_center|LOCUS_13650 1324843 1324917 gene locus_tag LOCUS_t00240 1324843 1324917 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1325197 1325505 gene locus_tag LOCUS_13660 1325197 1325505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 1325793 1326638 gene locus_tag LOCUS_13670 1325793 1326638 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_13670 1327016 1326624 gene locus_tag LOCUS_13680 1327016 1326624 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878970.1 protein_id gnl|my_center|LOCUS_13680 1327286 1327041 gene locus_tag LOCUS_13690 1327286 1327041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 1327939 1327358 gene locus_tag LOCUS_13700 1327939 1327358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13700 1328291 1328082 gene locus_tag LOCUS_13710 1328291 1328082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13710 1328503 1329840 gene locus_tag LOCUS_13720 1328503 1329840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 1329946 1330021 gene locus_tag LOCUS_t00250 1329946 1330021 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1330906 1330034 gene locus_tag LOCUS_13730 gene hisG 1330906 1330034 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_13730 1331116 1332057 gene locus_tag LOCUS_13740 1331116 1332057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 1332107 1332622 gene locus_tag LOCUS_13750 1332107 1332622 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877737.1 protein_id gnl|my_center|LOCUS_13750 1332610 1334157 gene locus_tag LOCUS_13760 1332610 1334157 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020870.1 protein_id gnl|my_center|LOCUS_13760 1334236 1334619 gene locus_tag LOCUS_13770 1334236 1334619 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020961.1 protein_id gnl|my_center|LOCUS_13770 1334635 1334847 gene locus_tag LOCUS_13780 1334635 1334847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 1335294 1334860 gene locus_tag LOCUS_13790 1335294 1334860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 1335401 1336297 gene locus_tag LOCUS_13800 1335401 1336297 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391812.1 protein_id gnl|my_center|LOCUS_13800 1336311 1337111 gene locus_tag LOCUS_13810 1336311 1337111 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021656.1 protein_id gnl|my_center|LOCUS_13810 1337873 1337253 gene locus_tag LOCUS_13820 1337873 1337253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 1338515 1338051 gene locus_tag LOCUS_13830 1338515 1338051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 1338677 1339204 gene locus_tag LOCUS_13840 1338677 1339204 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065212.1 protein_id gnl|my_center|LOCUS_13840 1339805 1339431 gene locus_tag LOCUS_13850 1339805 1339431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 1340307 1340477 gene locus_tag LOCUS_13860 1340307 1340477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 1340916 1342322 gene locus_tag LOCUS_13870 1340916 1342322 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990685.1 protein_id gnl|my_center|LOCUS_13870 1342839 1343609 gene locus_tag LOCUS_13880 1342839 1343609 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024130.1 protein_id gnl|my_center|LOCUS_13880 1343711 1344631 gene locus_tag LOCUS_13890 1343711 1344631 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024132.1 protein_id gnl|my_center|LOCUS_13890 1344618 1345454 gene locus_tag LOCUS_13900 1344618 1345454 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065941.1 protein_id gnl|my_center|LOCUS_13900 1345648 1346937 gene locus_tag LOCUS_13910 1345648 1346937 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860152.1 protein_id gnl|my_center|LOCUS_13910 1346986 1347726 gene locus_tag LOCUS_13920 1346986 1347726 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022138.1 protein_id gnl|my_center|LOCUS_13920 1347772 1349046 gene locus_tag LOCUS_13930 1347772 1349046 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250942.1 protein_id gnl|my_center|LOCUS_13930 1349336 1349635 gene locus_tag LOCUS_13940 1349336 1349635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 1350478 1352145 gene locus_tag LOCUS_13950 1350478 1352145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 1352410 1352922 gene locus_tag LOCUS_13960 1352410 1352922 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876052.1 protein_id gnl|my_center|LOCUS_13960 1353102 1353425 gene locus_tag LOCUS_13970 1353102 1353425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048124573.1 protein_id gnl|my_center|LOCUS_13970 1354077 1353928 gene locus_tag LOCUS_13980 1354077 1353928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 1354907 1354128 gene locus_tag LOCUS_13990 1354907 1354128 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460477.1 protein_id gnl|my_center|LOCUS_13990 1355617 1354904 gene locus_tag LOCUS_14000 1355617 1354904 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021850.1 protein_id gnl|my_center|LOCUS_14000 1357169 1355910 gene locus_tag LOCUS_14010 1357169 1355910 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860152.1 protein_id gnl|my_center|LOCUS_14010 1357356 1358291 gene locus_tag LOCUS_14020 1357356 1358291 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020923.1 protein_id gnl|my_center|LOCUS_14020 1358282 1358992 gene locus_tag LOCUS_14030 1358282 1358992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 1361286 1359073 gene locus_tag LOCUS_14040 1361286 1359073 CDS product oligosaccharyl transferase, archaeosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065054.1 protein_id gnl|my_center|LOCUS_14040 1361899 1361348 gene locus_tag LOCUS_14050 1361899 1361348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 1361867 1362016 gene locus_tag LOCUS_14060 1361867 1362016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 1362267 1362644 gene locus_tag LOCUS_14070 1362267 1362644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048124573.1 protein_id gnl|my_center|LOCUS_14070 1363193 1362717 gene locus_tag LOCUS_14080 1363193 1362717 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020591.1 protein_id gnl|my_center|LOCUS_14080 1363764 1363222 gene locus_tag LOCUS_14090 1363764 1363222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14090 1366384 1363775 gene locus_tag LOCUS_14100 gene ileS 1366384 1363775 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022402.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14100 1366513 1367484 gene locus_tag LOCUS_14110 1366513 1367484 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879552.1 protein_id gnl|my_center|LOCUS_14110 1370812 1367519 gene locus_tag LOCUS_14120 1370812 1367519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 1371357 1370809 gene locus_tag LOCUS_14130 1371357 1370809 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583290.1 protein_id gnl|my_center|LOCUS_14130 1371840 1371556 gene locus_tag LOCUS_14140 1371840 1371556 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938763.1 protein_id gnl|my_center|LOCUS_14140 1372112 1371906 gene locus_tag LOCUS_14150 1372112 1371906 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014310.1 protein_id gnl|my_center|LOCUS_14150 1372459 1372530 gene locus_tag LOCUS_t00260 1372459 1372530 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1372746 1375424 gene locus_tag LOCUS_14160 1372746 1375424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 1375433 1377319 gene locus_tag LOCUS_14170 1375433 1377319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14170 1377325 1377825 gene locus_tag LOCUS_14180 1377325 1377825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14180 1378518 1379828 gene locus_tag LOCUS_14190 1378518 1379828 CDS product IS66-like element ISH10B family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289081.1 protein_id gnl|my_center|LOCUS_14190 1380691 1379948 gene locus_tag LOCUS_14200 1380691 1379948 CDS product nitrogenase iron protein NifH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948411.1 protein_id gnl|my_center|LOCUS_14200 1381959 1380688 gene locus_tag LOCUS_14210 1381959 1380688 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065061.1 protein_id gnl|my_center|LOCUS_14210 1383289 1381961 gene locus_tag LOCUS_14220 1383289 1381961 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943674.1 protein_id gnl|my_center|LOCUS_14220 1384263 1383367 gene locus_tag LOCUS_14230 1384263 1383367 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065716.1 protein_id gnl|my_center|LOCUS_14230 1385356 1384265 gene locus_tag LOCUS_14240 1385356 1384265 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066493.1 protein_id gnl|my_center|LOCUS_14240 1386141 1385359 gene locus_tag LOCUS_14250 1386141 1385359 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020954.1 protein_id gnl|my_center|LOCUS_14250 1386921 1386148 gene locus_tag LOCUS_14260 1386921 1386148 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021378.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14260 1388356 1387118 gene locus_tag LOCUS_14270 1388356 1387118 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860152.1 protein_id gnl|my_center|LOCUS_14270 1389603 1388368 gene locus_tag LOCUS_14280 1389603 1388368 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869577.1 protein_id gnl|my_center|LOCUS_14280 1389811 1390116 gene locus_tag LOCUS_14290 1389811 1390116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 1390086 1390298 gene locus_tag LOCUS_14300 1390086 1390298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 1390364 1390795 gene locus_tag LOCUS_14310 1390364 1390795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 1390732 1391043 gene locus_tag LOCUS_14320 1390732 1391043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 1392856 1391873 gene locus_tag LOCUS_14330 1392856 1391873 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227876.1 protein_id gnl|my_center|LOCUS_14330 1392851 1392994 gene locus_tag LOCUS_14340 1392851 1392994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 1393266 1394024 gene locus_tag LOCUS_14350 gene zupT 1393266 1394024 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020444.1 protein_id gnl|my_center|LOCUS_14350 1394074 1395375 gene locus_tag LOCUS_14360 1394074 1395375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 1395506 1396000 gene locus_tag LOCUS_14370 1395506 1396000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 1396000 1396359 gene locus_tag LOCUS_14380 1396000 1396359 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065940.1 protein_id gnl|my_center|LOCUS_14380 1396381 1397229 gene locus_tag LOCUS_14390 1396381 1397229 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_14390 1397226 1398182 gene locus_tag LOCUS_14400 1397226 1398182 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_14400 1398182 1398769 gene locus_tag LOCUS_14410 1398182 1398769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 1399880 1398921 gene locus_tag LOCUS_14420 1399880 1398921 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249654.1 protein_id gnl|my_center|LOCUS_14420 1400793 1399939 gene locus_tag LOCUS_14430 1400793 1399939 CDS product 7,8-dihydropterin-6-methyl-4-(beta-D-ribofuranosyl)-aminobenzene-5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869799.1 protein_id gnl|my_center|LOCUS_14430 1402939 1400894 gene locus_tag LOCUS_14440 1402939 1400894 CDS product type B DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878196.1 protein_id gnl|my_center|LOCUS_14440 1403716 1403297 gene locus_tag LOCUS_14450 1403716 1403297 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023052.1 protein_id gnl|my_center|LOCUS_14450 1404005 1404196 gene locus_tag LOCUS_14460 1404005 1404196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 1404147 1404386 gene locus_tag LOCUS_14470 1404147 1404386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 1404391 1404861 gene locus_tag LOCUS_14480 1404391 1404861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14480 1404789 1405184 gene locus_tag LOCUS_14490 1404789 1405184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14490 1405715 1406476 gene locus_tag LOCUS_14500 1405715 1406476 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012940593.1 protein_id gnl|my_center|LOCUS_14500 1406612 1407289 gene locus_tag LOCUS_14510 1406612 1407289 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877555.1 protein_id gnl|my_center|LOCUS_14510 1407883 1407677 gene locus_tag LOCUS_14520 1407883 1407677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 1410041 1410796 gene locus_tag LOCUS_14530 1410041 1410796 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979881.1 protein_id gnl|my_center|LOCUS_14530 1411222 1410950 gene locus_tag LOCUS_14540 1411222 1410950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 1412184 1411387 gene locus_tag LOCUS_14550 1412184 1411387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 1412836 1413045 gene locus_tag LOCUS_14560 1412836 1413045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 1413215 1414198 gene locus_tag LOCUS_14570 1413215 1414198 CDS product UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980131.1 protein_id gnl|my_center|LOCUS_14570 1414222 1415040 gene locus_tag LOCUS_14580 1414222 1415040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 1416684 1416884 gene locus_tag LOCUS_14590 1416684 1416884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 1416874 1417797 gene locus_tag LOCUS_14600 1416874 1417797 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065032.1 protein_id gnl|my_center|LOCUS_14600 1417842 1418879 gene locus_tag LOCUS_14610 1417842 1418879 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524118.1 protein_id gnl|my_center|LOCUS_14610 1419679 1420146 gene locus_tag LOCUS_14620 1419679 1420146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 1420583 1421302 gene locus_tag LOCUS_14630 1420583 1421302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 1421268 1422434 gene locus_tag LOCUS_14640 1421268 1422434 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895560.1 protein_id gnl|my_center|LOCUS_14640 1423021 1422452 gene locus_tag LOCUS_14650 1423021 1422452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14650 1423473 1423033 gene locus_tag LOCUS_14660 1423473 1423033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14660 1424063 1423479 gene locus_tag LOCUS_14670 1424063 1423479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14670 1425614 1425309 gene locus_tag LOCUS_14680 1425614 1425309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 1427670 1427377 gene locus_tag LOCUS_14690 1427670 1427377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 1427707 1428153 gene locus_tag LOCUS_14700 1427707 1428153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 1428383 1430146 gene locus_tag LOCUS_14710 1428383 1430146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 1430440 1431168 gene locus_tag LOCUS_14720 1430440 1431168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 1431668 1434103 gene locus_tag LOCUS_14730 1431668 1434103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 1435627 1434308 gene locus_tag LOCUS_14740 1435627 1434308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 1437608 1437237 gene locus_tag LOCUS_14750 1437608 1437237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546344.1 protein_id gnl|my_center|LOCUS_14750 1438597 1437608 gene locus_tag LOCUS_14760 gene cmr4 1438597 1437608 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546538.1 protein_id gnl|my_center|LOCUS_14760 1438986 1438594 gene locus_tag LOCUS_14770 1438986 1438594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 1441494 1438993 gene locus_tag LOCUS_14780 1441494 1438993 CDS product CRISPR-associated protein Csx11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545561.1 protein_id gnl|my_center|LOCUS_14780 1442488 1441568 gene locus_tag LOCUS_14790 1442488 1441568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 1443516 1442485 gene locus_tag LOCUS_14800 1443516 1442485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 1444525 1446015 gene locus_tag LOCUS_14810 1444525 1446015 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932680.1 protein_id gnl|my_center|LOCUS_14810 1446371 1446042 gene locus_tag LOCUS_14820 1446371 1446042 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496854.1 protein_id gnl|my_center|LOCUS_14820 1446683 1447219 gene locus_tag LOCUS_14830 1446683 1447219 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978534.1 protein_id gnl|my_center|LOCUS_14830 1447243 1447539 gene locus_tag LOCUS_14840 1447243 1447539 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065930.1 protein_id gnl|my_center|LOCUS_14840 1447573 1447830 gene locus_tag LOCUS_14850 1447573 1447830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 1447802 1447957 gene locus_tag LOCUS_14860 1447802 1447957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 1448097 1448318 gene locus_tag LOCUS_14870 1448097 1448318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 1448456 1449784 gene locus_tag LOCUS_14880 1448456 1449784 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_14880 1450109 1451746 gene locus_tag LOCUS_14890 gene thsB 1450109 1451746 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020145.1 protein_id gnl|my_center|LOCUS_14890 1451828 1452742 gene locus_tag LOCUS_14900 1451828 1452742 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404262.1 protein_id gnl|my_center|LOCUS_14900 1452779 1453750 gene locus_tag LOCUS_14910 1452779 1453750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 1453825 1454325 gene locus_tag LOCUS_14920 1453825 1454325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 1454408 1454683 gene locus_tag LOCUS_14930 1454408 1454683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 1456613 1454757 gene locus_tag LOCUS_14940 1456613 1454757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 1458454 1456565 gene locus_tag LOCUS_14950 1458454 1456565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 1459210 1460913 gene locus_tag LOCUS_14960 1459210 1460913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 1461352 1461690 gene locus_tag LOCUS_14970 1461352 1461690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 1463045 1461813 gene locus_tag LOCUS_14980 1463045 1461813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 1464367 1463000 gene locus_tag LOCUS_14990 1464367 1463000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 1464746 1464333 gene locus_tag LOCUS_15000 1464746 1464333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 1465389 1464760 gene locus_tag LOCUS_15010 1465389 1464760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 1468056 1465729 gene locus_tag LOCUS_15020 1468056 1465729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 1468415 1468627 gene locus_tag LOCUS_15030 1468415 1468627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 1468970 1469161 gene locus_tag LOCUS_15040 1468970 1469161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 1469181 1469831 gene locus_tag LOCUS_15050 1469181 1469831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 1470489 1470307 gene locus_tag LOCUS_15060 1470489 1470307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 1472410 1470677 gene locus_tag LOCUS_15070 gene polX 1472410 1470677 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_15070 1473388 1472579 gene locus_tag LOCUS_15080 1473388 1472579 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020491.1 protein_id gnl|my_center|LOCUS_15080 1473583 1474614 gene locus_tag LOCUS_15090 1473583 1474614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 1475638 1474688 gene locus_tag LOCUS_15100 1475638 1474688 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065995.1 protein_id gnl|my_center|LOCUS_15100 1475849 1477624 gene locus_tag LOCUS_15110 1475849 1477624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 1477729 1478979 gene locus_tag LOCUS_15120 1477729 1478979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 1479218 1479739 gene locus_tag LOCUS_15130 1479218 1479739 CDS product Tfx family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868414.1 protein_id gnl|my_center|LOCUS_15130 1479753 1480478 gene locus_tag LOCUS_15140 1479753 1480478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 1480619 1482178 gene locus_tag LOCUS_15150 1480619 1482178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 1483028 1482288 gene locus_tag LOCUS_15160 gene rsmA 1483028 1482288 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990848.1 protein_id gnl|my_center|LOCUS_15160 1483606 1483025 gene locus_tag LOCUS_15170 1483606 1483025 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065124.1 protein_id gnl|my_center|LOCUS_15170 1483956 1483612 gene locus_tag LOCUS_15180 1483956 1483612 CDS product RNA polymerase Rpb4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021458.1 protein_id gnl|my_center|LOCUS_15180 1484248 1483958 gene locus_tag LOCUS_15190 1484248 1483958 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869531.1 protein_id gnl|my_center|LOCUS_15190 1485569 1484214 gene locus_tag LOCUS_15200 1485569 1484214 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021461.1 protein_id gnl|my_center|LOCUS_15200 1486088 1485861 gene locus_tag LOCUS_15210 1486088 1485861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 1487662 1486337 gene locus_tag LOCUS_15220 1487662 1486337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 1488341 1487655 gene locus_tag LOCUS_15230 1488341 1487655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 1489920 1488331 gene locus_tag LOCUS_15240 1489920 1488331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15240 1490397 1490050 gene locus_tag LOCUS_15250 1490397 1490050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 1490882 1492126 gene locus_tag LOCUS_15260 gene dadD 1490882 1492126 CDS product multifunctional 5'-deoxyadenosine/S-adenosyl-L-homocysteine/5'-methylthioadenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871065.1 protein_id gnl|my_center|LOCUS_15260 1493204 1492161 gene locus_tag LOCUS_15270 1493204 1492161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1493982 1493290 gene locus_tag LOCUS_15280 1493982 1493290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 1494014 1494583 gene locus_tag LOCUS_15290 gene engB 1494014 1494583 CDS product GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022535.1 protein_id gnl|my_center|LOCUS_15290 1495508 1494555 gene locus_tag LOCUS_15300 1495508 1494555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 1495716 1495534 gene locus_tag LOCUS_15310 1495716 1495534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 1496732 1495743 gene locus_tag LOCUS_15320 gene corA 1496732 1495743 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942048.1 protein_id gnl|my_center|LOCUS_15320 1496788 1496979 gene locus_tag LOCUS_15330 1496788 1496979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 1497233 1497742 gene locus_tag LOCUS_15340 1497233 1497742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 1497817 1498935 gene locus_tag LOCUS_15350 1497817 1498935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 1499031 1499501 gene locus_tag LOCUS_15360 1499031 1499501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 1499573 1500202 gene locus_tag LOCUS_15370 1499573 1500202 CDS product toll/interleukin-1 receptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022806.1 protein_id gnl|my_center|LOCUS_15370 1501335 1500199 gene locus_tag LOCUS_15380 gene mfnA 1501335 1500199 CDS product tyrosine decarboxylase MfnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020065.1 protein_id gnl|my_center|LOCUS_15380 1503670 1501400 gene locus_tag LOCUS_15390 gene ppsA 1503670 1501400 CDS product pyruvate, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878213.1 protein_id gnl|my_center|LOCUS_15390 1503862 1504971 gene locus_tag LOCUS_15400 1503862 1504971 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023979.1 protein_id gnl|my_center|LOCUS_15400 1505654 1506106 gene locus_tag LOCUS_15410 1505654 1506106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 1507176 1506205 gene locus_tag LOCUS_15420 1507176 1506205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 1508259 1507261 gene locus_tag LOCUS_15430 1508259 1507261 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755895.1 protein_id gnl|my_center|LOCUS_15430 1509087 1508299 gene locus_tag LOCUS_15440 1509087 1508299 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065716.1 protein_id gnl|my_center|LOCUS_15440 1510618 1509389 gene locus_tag LOCUS_15450 1510618 1509389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 1511083 1510998 gene locus_tag LOCUS_t00270 1511083 1510998 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1511924 1511325 gene locus_tag LOCUS_15460 1511924 1511325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 1512019 1512492 gene locus_tag LOCUS_15470 1512019 1512492 CDS product DUF123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902479.1 protein_id gnl|my_center|LOCUS_15470 1512941 1515463 gene locus_tag LOCUS_15480 1512941 1515463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 1515424 1516611 gene locus_tag LOCUS_15490 1515424 1516611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 1517042 1516686 gene locus_tag LOCUS_15500 1517042 1516686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 1518043 1517228 gene locus_tag LOCUS_15510 gene pdxS 1518043 1517228 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065155.1 protein_id gnl|my_center|LOCUS_15510 1521955 1518293 gene locus_tag LOCUS_15520 1521955 1518293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 1522495 1522301 gene locus_tag LOCUS_15530 1522495 1522301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 1522802 1524022 gene locus_tag LOCUS_15540 gene pgk 1522802 1524022 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022629.1 protein_id gnl|my_center|LOCUS_15540 1525038 1524028 gene locus_tag LOCUS_15550 1525038 1524028 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023750.1 protein_id gnl|my_center|LOCUS_15550 1526193 1525150 gene locus_tag LOCUS_15560 gene scpB 1526193 1525150 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065962.1 protein_id gnl|my_center|LOCUS_15560 1526346 1527986 gene locus_tag LOCUS_15570 1526346 1527986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 1528173 1530116 gene locus_tag LOCUS_15580 1528173 1530116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 1530936 1530217 gene locus_tag LOCUS_15590 1530936 1530217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 1534479 1530955 gene locus_tag LOCUS_15600 gene smc 1534479 1530955 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024214.1 protein_id gnl|my_center|LOCUS_15600 1534692 1535930 gene locus_tag LOCUS_15610 gene mmp10 1534692 1535930 CDS product methyl coenzyme M reductase-arginine methyltransferase Mmp10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024424.1 protein_id gnl|my_center|LOCUS_15610 1536030 1537166 gene locus_tag LOCUS_15620 1536030 1537166 CDS product TIGR04083 family peptide-modifying radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023249.1 protein_id gnl|my_center|LOCUS_15620 1537203 1537430 gene locus_tag LOCUS_15630 1537203 1537430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 1537360 1537812 gene locus_tag LOCUS_15640 1537360 1537812 CDS product DUF2124 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021715.1 protein_id gnl|my_center|LOCUS_15640 1537947 1538672 gene locus_tag LOCUS_15650 1537947 1538672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 1538814 1539521 gene locus_tag LOCUS_15660 1538814 1539521 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249502.1 protein_id gnl|my_center|LOCUS_15660 1540385 1539600 gene locus_tag LOCUS_15670 1540385 1539600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 1540888 1540505 gene locus_tag LOCUS_15680 1540888 1540505 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023881.1 protein_id gnl|my_center|LOCUS_15680 1542027 1540924 gene locus_tag LOCUS_15690 1542027 1540924 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021402.1 protein_id gnl|my_center|LOCUS_15690 1542530 1542024 gene locus_tag LOCUS_15700 1542530 1542024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065104.1 protein_id gnl|my_center|LOCUS_15700 1542596 1543039 gene locus_tag LOCUS_15710 1542596 1543039 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779558.1 protein_id gnl|my_center|LOCUS_15710 1543194 1544414 gene locus_tag LOCUS_15720 1543194 1544414 CDS product YcaO-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876618.1 protein_id gnl|my_center|LOCUS_15720 1544368 1545021 gene locus_tag LOCUS_15730 1544368 1545021 CDS product TfuA-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020222.1 protein_id gnl|my_center|LOCUS_15730 1545142 1546044 gene locus_tag LOCUS_15740 gene nadA 1545142 1546044 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020997.1 protein_id gnl|my_center|LOCUS_15740 1549712 1546152 gene locus_tag LOCUS_15750 1549712 1546152 CDS product DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024425.1 protein_id gnl|my_center|LOCUS_15750 1550137 1549709 gene locus_tag LOCUS_15760 1550137 1549709 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249520.1 protein_id gnl|my_center|LOCUS_15760 1550598 1551560 gene locus_tag LOCUS_15770 1550598 1551560 CDS product methanogenesis marker 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024078.1 protein_id gnl|my_center|LOCUS_15770 1551569 1552384 gene locus_tag LOCUS_15780 gene mtxX 1551569 1552384 CDS product methanogenesis marker protein Mmp4/MtxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065223.1 protein_id gnl|my_center|LOCUS_15780 1552865 1552419 gene locus_tag LOCUS_15790 1552865 1552419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 1554234 1553110 gene locus_tag LOCUS_15800 1554234 1553110 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 protein_id gnl|my_center|LOCUS_15800 1556328 1554808 gene locus_tag LOCUS_15810 gene gpmI 1556328 1554808 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_15810 1557015 1556359 gene locus_tag LOCUS_15820 1557015 1556359 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877550.1 protein_id gnl|my_center|LOCUS_15820 1557479 1556997 gene locus_tag LOCUS_15830 1557479 1556997 CDS product HVO_0476 family zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020594.1 protein_id gnl|my_center|LOCUS_15830 1557680 1557892 gene locus_tag LOCUS_15840 1557680 1557892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 1558265 1558876 gene locus_tag LOCUS_15850 1558265 1558876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 1559041 1559253 gene locus_tag LOCUS_15860 1559041 1559253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 1559901 1559212 gene locus_tag LOCUS_15870 1559901 1559212 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016533.1 protein_id gnl|my_center|LOCUS_15870 1560039 1562006 gene locus_tag LOCUS_15880 gene uvrB 1560039 1562006 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023255.1 protein_id gnl|my_center|LOCUS_15880 1562068 1563489 gene locus_tag LOCUS_15890 1562068 1563489 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485723.1 protein_id gnl|my_center|LOCUS_15890 1563851 1563696 gene locus_tag LOCUS_15900 1563851 1563696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1564021 1564140 gene locus_tag LOCUS_15910 1564021 1564140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 1564621 1564358 gene locus_tag LOCUS_15920 1564621 1564358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 1565200 1565670 gene locus_tag LOCUS_15930 1565200 1565670 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990736.1 protein_id gnl|my_center|LOCUS_15930 1566651 1565806 gene locus_tag LOCUS_15940 1566651 1565806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 1566816 1566980 gene locus_tag LOCUS_15950 1566816 1566980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 1568230 1567745 gene locus_tag LOCUS_15960 gene moaC 1568230 1567745 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249309.1 protein_id gnl|my_center|LOCUS_15960 1569651 1568233 gene locus_tag LOCUS_15970 1569651 1568233 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021194.1 protein_id gnl|my_center|LOCUS_15970 1569966 1570532 gene locus_tag LOCUS_15980 1569966 1570532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 1571612 1570698 gene locus_tag LOCUS_15990 1571612 1570698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 1572205 1571648 gene locus_tag LOCUS_16000 1572205 1571648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 1573079 1572213 gene locus_tag LOCUS_16010 1573079 1572213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 1573853 1573179 gene locus_tag LOCUS_16020 1573853 1573179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 1574171 1575574 gene locus_tag LOCUS_16030 1574171 1575574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 1578678 1575811 gene locus_tag LOCUS_16040 1578678 1575811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 1578820 1579005 gene locus_tag LOCUS_16050 1578820 1579005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 1579557 1579021 gene locus_tag LOCUS_16060 1579557 1579021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 1580373 1579567 gene locus_tag LOCUS_16070 1580373 1579567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 1581849 1580581 gene locus_tag LOCUS_16080 1581849 1580581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 1583169 1582186 gene locus_tag LOCUS_16090 1583169 1582186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 1583307 1583744 gene locus_tag LOCUS_16100 1583307 1583744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16100 1583713 1584099 gene locus_tag LOCUS_16110 1583713 1584099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16110 1584670 1585047 gene locus_tag LOCUS_16120 1584670 1585047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 1586160 1585069 gene locus_tag LOCUS_16130 1586160 1585069 CDS product DUF1646 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878290.1 protein_id gnl|my_center|LOCUS_16130 1586519 1586187 gene locus_tag LOCUS_16140 1586519 1586187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 1587527 1586871 gene locus_tag LOCUS_16150 1587527 1586871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 1587703 1588104 gene locus_tag LOCUS_16160 1587703 1588104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 1588458 1588246 gene locus_tag LOCUS_16170 1588458 1588246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 1588801 1589205 gene locus_tag LOCUS_16180 1588801 1589205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 1589796 1589353 gene locus_tag LOCUS_16190 1589796 1589353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 1589925 1590809 gene locus_tag LOCUS_16200 1589925 1590809 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869781.1 protein_id gnl|my_center|LOCUS_16200 1590905 1591180 gene locus_tag LOCUS_16210 1590905 1591180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 1591435 1592013 gene locus_tag LOCUS_16220 1591435 1592013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 1592161 1593453 gene locus_tag LOCUS_16230 1592161 1593453 CDS product methyl-coenzyme M reductase glutamine C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496936.1 protein_id gnl|my_center|LOCUS_16230 1595253 1593574 gene locus_tag LOCUS_16240 gene mcrA 1595253 1593574 CDS product coenzyme-B sulfoethylthiotransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024419.1 protein_id gnl|my_center|LOCUS_16240 1596035 1595268 gene locus_tag LOCUS_16250 gene mcrG 1596035 1595268 CDS product coenzyme-B sulfoethylthiotransferase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024420.1 protein_id gnl|my_center|LOCUS_16250 1596541 1596038 gene locus_tag LOCUS_16260 gene mcrD 1596541 1596038 CDS product methyl-coenzyme M reductase operon protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024422.1 protein_id gnl|my_center|LOCUS_16260 1597856 1596552 gene locus_tag LOCUS_16270 gene mcrB 1597856 1596552 CDS product coenzyme-B sulfoethylthiotransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024423.1 protein_id gnl|my_center|LOCUS_16270 1598515 1600086 gene locus_tag LOCUS_16280 1598515 1600086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16280 1600083 1600817 gene locus_tag LOCUS_16290 1600083 1600817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16290 1601014 1600940 gene locus_tag LOCUS_t00280 1601014 1600940 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1601112 1601024 gene locus_tag LOCUS_t00290 1601112 1601024 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1601170 1602207 gene locus_tag LOCUS_16300 1601170 1602207 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020699.1 protein_id gnl|my_center|LOCUS_16300 1602295 1602699 gene locus_tag LOCUS_16310 1602295 1602699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16310 1602741 1603154 gene locus_tag LOCUS_16320 1602741 1603154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 1603145 1603219 gene locus_tag LOCUS_t00300 1603145 1603219 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1603547 1604026 gene locus_tag LOCUS_16330 1603547 1604026 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020962.1 protein_id gnl|my_center|LOCUS_16330 1604023 1605231 gene locus_tag LOCUS_16340 1604023 1605231 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020963.1 protein_id gnl|my_center|LOCUS_16340 1605304 1605906 gene locus_tag LOCUS_16350 1605304 1605906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 1606623 1605937 gene locus_tag LOCUS_16360 1606623 1605937 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021712.1 protein_id gnl|my_center|LOCUS_16360 1608337 1606892 gene locus_tag LOCUS_16370 1608337 1606892 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060885.1 protein_id gnl|my_center|LOCUS_16370 1609381 1608338 gene locus_tag LOCUS_16380 gene vorB 1609381 1608338 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060884.1 protein_id gnl|my_center|LOCUS_16380 1611285 1609384 gene locus_tag LOCUS_16390 1611285 1609384 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065557.1 protein_id gnl|my_center|LOCUS_16390 1611888 1611307 gene locus_tag LOCUS_16400 1611888 1611307 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876339.1 protein_id gnl|my_center|LOCUS_16400 1612631 1612266 gene locus_tag LOCUS_16410 1612631 1612266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 1613532 1613119 gene locus_tag LOCUS_16420 1613532 1613119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 1613663 1614697 gene locus_tag LOCUS_16430 1613663 1614697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 1615220 1614747 gene locus_tag LOCUS_16440 1615220 1614747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 1616154 1615279 gene locus_tag LOCUS_16450 1616154 1615279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 1616317 1617135 gene locus_tag LOCUS_16460 1616317 1617135 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403240.1 protein_id gnl|my_center|LOCUS_16460 1618353 1617109 gene locus_tag LOCUS_16470 1618353 1617109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 1621791 1618645 gene locus_tag LOCUS_16480 1621791 1618645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 1623490 1622777 gene locus_tag LOCUS_16490 1623490 1622777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 1623791 1624867 gene locus_tag LOCUS_16500 1623791 1624867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 1624887 1625093 gene locus_tag LOCUS_16510 1624887 1625093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 1625853 1625149 gene locus_tag LOCUS_16520 1625853 1625149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 1626502 1627224 gene locus_tag LOCUS_16530 1626502 1627224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 1627737 1627270 gene locus_tag LOCUS_16540 1627737 1627270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 1628380 1628307 gene locus_tag LOCUS_t00310 1628380 1628307 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1629743 1628562 gene locus_tag LOCUS_16550 1629743 1628562 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065771.1 protein_id gnl|my_center|LOCUS_16550 1630170 1629937 gene locus_tag LOCUS_16560 1630170 1629937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 1631806 1630559 gene locus_tag LOCUS_16570 1631806 1630559 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871132.1 protein_id gnl|my_center|LOCUS_16570 1633755 1631971 gene locus_tag LOCUS_16580 1633755 1631971 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023586.1 protein_id gnl|my_center|LOCUS_16580 1634461 1633763 gene locus_tag LOCUS_16590 1634461 1633763 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146498.1 protein_id gnl|my_center|LOCUS_16590 1636039 1634579 gene locus_tag LOCUS_16600 1636039 1634579 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065226.1 protein_id gnl|my_center|LOCUS_16600 1636468 1636040 gene locus_tag LOCUS_16610 1636468 1636040 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022180.1 protein_id gnl|my_center|LOCUS_16610 1636623 1638107 gene locus_tag LOCUS_16620 1636623 1638107 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020720.1 protein_id gnl|my_center|LOCUS_16620 1638124 1638939 gene locus_tag LOCUS_16630 1638124 1638939 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877512.1 protein_id gnl|my_center|LOCUS_16630 1638954 1639352 gene locus_tag LOCUS_16640 1638954 1639352 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066255.1 protein_id gnl|my_center|LOCUS_16640 1639419 1639850 gene locus_tag LOCUS_16650 1639419 1639850 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064389.1 protein_id gnl|my_center|LOCUS_16650 1639880 1640158 gene locus_tag LOCUS_16660 1639880 1640158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16660 1640174 1640356 gene locus_tag LOCUS_16670 1640174 1640356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16670 1640694 1640497 gene locus_tag LOCUS_16680 1640694 1640497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 1641254 1640787 gene locus_tag LOCUS_16690 1641254 1640787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 1641351 1641899 gene locus_tag LOCUS_16700 1641351 1641899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16700 1643033 1641969 gene locus_tag LOCUS_16710 1643033 1641969 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262757.1 protein_id gnl|my_center|LOCUS_16710 1643200 1643628 gene locus_tag LOCUS_16720 gene rnhA 1643200 1643628 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978745.1 protein_id gnl|my_center|LOCUS_16720 1644121 1643765 gene locus_tag LOCUS_16730 1644121 1643765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 1645190 1644057 gene locus_tag LOCUS_16740 1645190 1644057 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022383.1 protein_id gnl|my_center|LOCUS_16740 1647354 1645879 gene locus_tag LOCUS_16750 1647354 1645879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16750 1649452 1647266 gene locus_tag LOCUS_16760 1649452 1647266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16760 1649896 1649453 gene locus_tag LOCUS_16770 1649896 1649453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909402.1 protein_id gnl|my_center|LOCUS_16770 1650448 1650266 gene locus_tag LOCUS_16780 1650448 1650266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 1651660 1651160 gene locus_tag LOCUS_16790 1651660 1651160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16790 1651866 1651657 gene locus_tag LOCUS_16800 1651866 1651657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 1652963 1652019 gene locus_tag LOCUS_16810 1652963 1652019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 1653975 1654922 gene locus_tag LOCUS_16820 1653975 1654922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 1654919 1655917 gene locus_tag LOCUS_16830 1654919 1655917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 1657783 1656836 gene locus_tag LOCUS_16840 gene hemB 1657783 1656836 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020627.1 protein_id gnl|my_center|LOCUS_16840 1659019 1657853 gene locus_tag LOCUS_16850 gene hemA 1659019 1657853 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020626.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16850 1659683 1658979 gene locus_tag LOCUS_16860 1659683 1658979 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020625.1 protein_id gnl|my_center|LOCUS_16860 1660163 1659693 gene locus_tag LOCUS_16870 gene ahbB 1660163 1659693 CDS product siroheme decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064915.1 protein_id gnl|my_center|LOCUS_16870 1662298 1660163 gene locus_tag LOCUS_16880 1662298 1660163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 1662417 1663685 gene locus_tag LOCUS_16890 1662417 1663685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 1663732 1664820 gene locus_tag LOCUS_16900 gene aroC 1663732 1664820 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020599.1 protein_id gnl|my_center|LOCUS_16900 1664853 1666622 gene locus_tag LOCUS_16910 1664853 1666622 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024230.1 protein_id gnl|my_center|LOCUS_16910 1666839 1666591 gene locus_tag LOCUS_16920 1666839 1666591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16920 1667614 1666745 gene locus_tag LOCUS_16930 1667614 1666745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16930 1668345 1667611 gene locus_tag LOCUS_16940 1668345 1667611 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020169.1 protein_id gnl|my_center|LOCUS_16940 1668657 1668397 gene locus_tag LOCUS_16950 1668657 1668397 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878730.1 protein_id gnl|my_center|LOCUS_16950 1668788 1669453 gene locus_tag LOCUS_16960 1668788 1669453 CDS product DUF5612 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878900.1 protein_id gnl|my_center|LOCUS_16960 1669698 1669450 gene locus_tag LOCUS_16970 1669698 1669450 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064801.1 protein_id gnl|my_center|LOCUS_16970 1670105 1669770 gene locus_tag LOCUS_16980 1670105 1669770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 1670380 1670610 gene locus_tag LOCUS_16990 gene hpkA 1670380 1670610 CDS product archaeal histone HpkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250364.1 protein_id gnl|my_center|LOCUS_16990 1670614 1672518 gene locus_tag LOCUS_17000 gene gatE 1670614 1672518 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022814.1 protein_id gnl|my_center|LOCUS_17000 1672545 1673645 gene locus_tag LOCUS_17010 1672545 1673645 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020144.1 protein_id gnl|my_center|LOCUS_17010 1673769 1674656 gene locus_tag LOCUS_17020 gene pstC 1673769 1674656 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020932.1 protein_id gnl|my_center|LOCUS_17020 1674658 1675905 gene locus_tag LOCUS_17030 1674658 1675905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 1676455 1675994 gene locus_tag LOCUS_17040 1676455 1675994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 1677067 1676786 gene locus_tag LOCUS_17050 1677067 1676786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 1677691 1677999 gene locus_tag LOCUS_17060 1677691 1677999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 1678002 1678346 gene locus_tag LOCUS_17070 1678002 1678346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 1679731 1679345 gene locus_tag LOCUS_17080 1679731 1679345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17080 1680137 1679700 gene locus_tag LOCUS_17090 1680137 1679700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17090 1680784 1681737 gene locus_tag LOCUS_17100 1680784 1681737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 1682052 1682972 gene locus_tag LOCUS_17110 gene rnz 1682052 1682972 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022970.1 protein_id gnl|my_center|LOCUS_17110 1683601 1683047 gene locus_tag LOCUS_17120 1683601 1683047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 1683867 1684967 gene locus_tag LOCUS_17130 1683867 1684967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 1684964 1686685 gene locus_tag LOCUS_17140 1684964 1686685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 1687067 1688614 gene locus_tag LOCUS_17150 1687067 1688614 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860413.1 protein_id gnl|my_center|LOCUS_17150 1688644 1689393 gene locus_tag LOCUS_17160 1688644 1689393 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065715.1 protein_id gnl|my_center|LOCUS_17160 1689401 1689967 gene locus_tag LOCUS_17170 1689401 1689967 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023254.1 protein_id gnl|my_center|LOCUS_17170 1690228 1692861 gene locus_tag LOCUS_17180 1690228 1692861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 1693320 1692967 gene locus_tag LOCUS_17190 1693320 1692967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 1696151 1693566 gene locus_tag LOCUS_17200 gene fdhF 1696151 1693566 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_17200 1696542 1697666 gene locus_tag LOCUS_17210 gene acuC 1696542 1697666 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092826.1 protein_id gnl|my_center|LOCUS_17210 1699540 1697648 gene locus_tag LOCUS_17220 1699540 1697648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 1699689 1699844 gene locus_tag LOCUS_17230 1699689 1699844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 1699991 1700076 gene locus_tag LOCUS_t00320 1699991 1700076 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1701494 1700544 gene locus_tag LOCUS_17240 gene glpQ 1701494 1700544 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482305.1 protein_id gnl|my_center|LOCUS_17240 1701883 1702962 gene locus_tag LOCUS_17250 1701883 1702962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 1703282 1703920 gene locus_tag LOCUS_17260 1703282 1703920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 1704113 1704328 gene locus_tag LOCUS_17270 1704113 1704328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 1704371 1705156 gene locus_tag LOCUS_17280 1704371 1705156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 1705547 1705212 gene locus_tag LOCUS_17290 1705547 1705212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 1706078 1705800 gene locus_tag LOCUS_17300 1706078 1705800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 1706188 1707738 gene locus_tag LOCUS_17310 1706188 1707738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 1709020 1707920 gene locus_tag LOCUS_17320 1709020 1707920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 1709243 1709037 gene locus_tag LOCUS_17330 1709243 1709037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 1709564 1709355 gene locus_tag LOCUS_17340 1709564 1709355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 1709921 1710181 gene locus_tag LOCUS_17350 1709921 1710181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 1710412 1711596 gene locus_tag LOCUS_17360 1710412 1711596 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066363.1 protein_id gnl|my_center|LOCUS_17360 1711893 1712351 gene locus_tag LOCUS_17370 1711893 1712351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 1712713 1721622 gene locus_tag LOCUS_17380 1712713 1721622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 1721777 1723030 gene locus_tag LOCUS_17390 gene eno 1721777 1723030 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065179.1 protein_id gnl|my_center|LOCUS_17390 1723130 1723441 gene locus_tag LOCUS_17400 1723130 1723441 CDS product DUF5611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065922.1 protein_id gnl|my_center|LOCUS_17400 1724556 1723453 gene locus_tag LOCUS_17410 1724556 1723453 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061035.1 protein_id gnl|my_center|LOCUS_17410 1724648 1725883 gene locus_tag LOCUS_17420 1724648 1725883 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289167.1 protein_id gnl|my_center|LOCUS_17420 1727684 1726011 gene locus_tag LOCUS_17430 gene thsB 1727684 1726011 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020145.1 protein_id gnl|my_center|LOCUS_17430 1728143 1729174 gene locus_tag LOCUS_17440 1728143 1729174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 1729380 1729126 gene locus_tag LOCUS_17450 1729380 1729126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 1729342 1730013 gene locus_tag LOCUS_17460 1729342 1730013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 1730650 1730922 gene locus_tag LOCUS_17470 1730650 1730922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 1730944 1731753 gene locus_tag LOCUS_17480 1730944 1731753 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020999.1 protein_id gnl|my_center|LOCUS_17480 1731868 1732983 gene locus_tag LOCUS_17490 1731868 1732983 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022844.1 protein_id gnl|my_center|LOCUS_17490 1733200 1734216 gene locus_tag LOCUS_17500 1733200 1734216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 1734268 1735896 gene locus_tag LOCUS_17510 1734268 1735896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17510 1735940 1737082 gene locus_tag LOCUS_17520 1735940 1737082 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583973.1 protein_id gnl|my_center|LOCUS_17520 1737072 1740251 gene locus_tag LOCUS_17530 1737072 1740251 CDS product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021188.1 protein_id gnl|my_center|LOCUS_17530 1740248 1740454 gene locus_tag LOCUS_17540 1740248 1740454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 1741337 1740624 gene locus_tag LOCUS_17550 1741337 1740624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17550 1741809 1741438 gene locus_tag LOCUS_17560 1741809 1741438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17560 1742207 1741797 gene locus_tag LOCUS_17570 1742207 1741797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 1742338 1743186 gene locus_tag LOCUS_17580 1742338 1743186 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392998.1 protein_id gnl|my_center|LOCUS_17580 1743183 1743716 gene locus_tag LOCUS_17590 1743183 1743716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17590 1743682 1744128 gene locus_tag LOCUS_17600 1743682 1744128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17600 1745727 1744294 gene locus_tag LOCUS_17610 gene gabD 1745727 1744294 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368063.1 protein_id gnl|my_center|LOCUS_17610 1745969 1746295 gene locus_tag LOCUS_17620 1745969 1746295 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990605.1 protein_id gnl|my_center|LOCUS_17620 1746612 1747421 gene locus_tag LOCUS_17630 gene larE 1746612 1747421 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080596.1 protein_id gnl|my_center|LOCUS_17630 1747418 1748677 gene locus_tag LOCUS_17640 1747418 1748677 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061297.1 protein_id gnl|my_center|LOCUS_17640 1748724 1749482 gene locus_tag LOCUS_17650 gene fdhD 1748724 1749482 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393662.1 protein_id gnl|my_center|LOCUS_17650 1749490 1750392 gene locus_tag LOCUS_17660 1749490 1750392 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879092.1 protein_id gnl|my_center|LOCUS_17660 1752744 1750573 gene locus_tag LOCUS_17670 1752744 1750573 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_17670 1753884 1753072 gene locus_tag LOCUS_17680 gene comER 1753884 1753072 CDS product late competence protein ComER inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020551.1 protein_id gnl|my_center|LOCUS_17680 1754249 1753881 gene locus_tag LOCUS_17690 1754249 1753881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065385.1 protein_id gnl|my_center|LOCUS_17690 1755083 1754322 gene locus_tag LOCUS_17700 1755083 1754322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 1755367 1755089 gene locus_tag LOCUS_17710 gene moaD 1755367 1755089 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251068.1 protein_id gnl|my_center|LOCUS_17710 1755888 1755505 gene locus_tag LOCUS_17720 1755888 1755505 CDS product DUF1894 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020188.1 protein_id gnl|my_center|LOCUS_17720 1756334 1755885 gene locus_tag LOCUS_17730 1756334 1755885 CDS product DUF1890 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020187.1 protein_id gnl|my_center|LOCUS_17730 1757337 1756516 gene locus_tag LOCUS_17740 1757337 1756516 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020313.1 protein_id gnl|my_center|LOCUS_17740 1757509 1757327 gene locus_tag LOCUS_17750 1757509 1757327 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061136.1 protein_id gnl|my_center|LOCUS_17750 1758116 1757637 gene locus_tag LOCUS_17760 1758116 1757637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 1758292 1758537 gene locus_tag LOCUS_17770 1758292 1758537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 1760437 1759676 gene locus_tag LOCUS_17780 1760437 1759676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 1761461 1760511 gene locus_tag LOCUS_17790 gene mptA 1761461 1760511 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066005.1 protein_id gnl|my_center|LOCUS_17790 1761653 1761462 gene locus_tag LOCUS_17800 1761653 1761462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 1761771 1762427 gene locus_tag LOCUS_17810 1761771 1762427 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877913.1 protein_id gnl|my_center|LOCUS_17810 1763102 1762491 gene locus_tag LOCUS_17820 1763102 1762491 CDS product undecaprenyl diphosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024281.1 protein_id gnl|my_center|LOCUS_17820 1763166 1764380 gene locus_tag LOCUS_17830 1763166 1764380 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021658.1 protein_id gnl|my_center|LOCUS_17830 1764524 1764925 gene locus_tag LOCUS_17840 1764524 1764925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17840 1764874 1765386 gene locus_tag LOCUS_17850 1764874 1765386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17850 1765517 1766398 gene locus_tag LOCUS_17860 1765517 1766398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 1767909 1766776 gene locus_tag LOCUS_17870 1767909 1766776 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021821.1 protein_id gnl|my_center|LOCUS_17870 1768359 1767913 gene locus_tag LOCUS_17880 gene ribH 1768359 1767913 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021820.1 protein_id gnl|my_center|LOCUS_17880 1768439 1769305 gene locus_tag LOCUS_17890 gene ilvE 1768439 1769305 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065968.1 protein_id gnl|my_center|LOCUS_17890 1769757 1769338 gene locus_tag LOCUS_17900 1769757 1769338 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868534.1 protein_id gnl|my_center|LOCUS_17900 1770386 1771195 gene locus_tag LOCUS_17910 1770386 1771195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 1771764 1772396 gene locus_tag LOCUS_17920 1771764 1772396 CDS product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261778.1 protein_id gnl|my_center|LOCUS_17920 1773426 1772539 gene locus_tag LOCUS_17930 1773426 1772539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 1773830 1775980 gene locus_tag LOCUS_17940 1773830 1775980 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_17940 1775964 1776182 gene locus_tag LOCUS_17950 1775964 1776182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 1776299 1776916 gene locus_tag LOCUS_17960 1776299 1776916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 1776909 1777904 gene locus_tag LOCUS_17970 1776909 1777904 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879792.1 protein_id gnl|my_center|LOCUS_17970 1777905 1778396 gene locus_tag LOCUS_17980 1777905 1778396 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879795.1 protein_id gnl|my_center|LOCUS_17980 1778403 1779608 gene locus_tag LOCUS_17990 1778403 1779608 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879796.1 protein_id gnl|my_center|LOCUS_17990 1779685 1781040 gene locus_tag LOCUS_18000 1779685 1781040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 1781159 1781491 gene locus_tag LOCUS_18010 1781159 1781491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 1783488 1782127 gene locus_tag LOCUS_18020 1783488 1782127 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066384.1 protein_id gnl|my_center|LOCUS_18020 1783754 1784098 gene locus_tag LOCUS_18030 1783754 1784098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 1784911 1785291 gene locus_tag LOCUS_18040 1784911 1785291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 1785429 1785770 gene locus_tag LOCUS_18050 1785429 1785770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 1786840 1786172 gene locus_tag LOCUS_18060 1786840 1786172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 1786920 1787438 gene locus_tag LOCUS_18070 1786920 1787438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 1787488 1788171 gene locus_tag LOCUS_18080 1787488 1788171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 1789344 1788295 gene locus_tag LOCUS_18090 gene rtcA 1789344 1788295 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024505.1 protein_id gnl|my_center|LOCUS_18090 1790772 1789438 gene locus_tag LOCUS_18100 1790772 1789438 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943960.1 protein_id gnl|my_center|LOCUS_18100 1791389 1790820 gene locus_tag LOCUS_18110 1791389 1790820 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023516.1 protein_id gnl|my_center|LOCUS_18110 1791526 1791786 gene locus_tag LOCUS_18120 1791526 1791786 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020862.1 protein_id gnl|my_center|LOCUS_18120 1791827 1792453 gene locus_tag LOCUS_18130 1791827 1792453 CDS product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 protein_id gnl|my_center|LOCUS_18130 1793263 1792580 gene locus_tag LOCUS_18140 1793263 1792580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 1793728 1795785 gene locus_tag LOCUS_18150 1793728 1795785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 1796323 1797785 gene locus_tag LOCUS_r00010 1796323 1797785 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1797909 1797981 gene locus_tag LOCUS_t00330 1797909 1797981 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1798125 1800998 gene locus_tag LOCUS_r00020 1798125 1800998 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1801136 1801252 gene locus_tag LOCUS_r00030 1801136 1801252 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1802710 1801817 gene locus_tag LOCUS_18160 1802710 1801817 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393238.1 protein_id gnl|my_center|LOCUS_18160 1803058 1802720 gene locus_tag LOCUS_18170 1803058 1802720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 1804034 1803153 gene locus_tag LOCUS_18180 1804034 1803153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18180 1805366 1804035 gene locus_tag LOCUS_18190 1805366 1804035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 1806618 1805923 gene locus_tag LOCUS_18200 1806618 1805923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18200 1807216 1806662 gene locus_tag LOCUS_18210 1807216 1806662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 1808243 1807971 gene locus_tag LOCUS_18220 1808243 1807971 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021698.1 protein_id gnl|my_center|LOCUS_18220 1808507 1808256 gene locus_tag LOCUS_18230 1808507 1808256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 1809160 1808846 gene locus_tag LOCUS_18240 1809160 1808846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 1809790 1810950 gene locus_tag LOCUS_18250 1809790 1810950 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_18250 1810964 1811260 gene locus_tag LOCUS_18260 1810964 1811260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 1811548 1811318 gene locus_tag LOCUS_18270 1811548 1811318 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089200.1 protein_id gnl|my_center|LOCUS_18270 1811970 1812302 gene locus_tag LOCUS_18280 1811970 1812302 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943454.1 protein_id gnl|my_center|LOCUS_18280 1813345 1812386 gene locus_tag LOCUS_18290 1813345 1812386 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878279.1 protein_id gnl|my_center|LOCUS_18290 1813531 1813683 gene locus_tag LOCUS_18300 1813531 1813683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 1814398 1813754 gene locus_tag LOCUS_18310 1814398 1813754 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021972.1 protein_id gnl|my_center|LOCUS_18310 1814979 1814383 gene locus_tag LOCUS_18320 1814979 1814383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 1816054 1815191 gene locus_tag LOCUS_18330 1816054 1815191 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023435.1 protein_id gnl|my_center|LOCUS_18330 1817295 1816051 gene locus_tag LOCUS_18340 1817295 1816051 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583175.1 protein_id gnl|my_center|LOCUS_18340 1817478 1817930 gene locus_tag LOCUS_18350 1817478 1817930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020180.1 protein_id gnl|my_center|LOCUS_18350 1819791 1817938 gene locus_tag LOCUS_18360 1819791 1817938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 1819925 1820839 gene locus_tag LOCUS_18370 1819925 1820839 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249816.1 protein_id gnl|my_center|LOCUS_18370 1820885 1821949 gene locus_tag LOCUS_18380 1820885 1821949 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860150.1 protein_id gnl|my_center|LOCUS_18380 1822973 1823197 gene locus_tag LOCUS_18390 1822973 1823197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 1823194 1823340 gene locus_tag LOCUS_18400 1823194 1823340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 1824697 1824029 gene locus_tag LOCUS_18410 1824697 1824029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18410 1825299 1824730 gene locus_tag LOCUS_18420 1825299 1824730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18420 1825885 1825502 gene locus_tag LOCUS_18430 1825885 1825502 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064210.1 protein_id gnl|my_center|LOCUS_18430 1826100 1825882 gene locus_tag LOCUS_18440 1826100 1825882 CDS product antitoxin VapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878978.1 protein_id gnl|my_center|LOCUS_18440 1826508 1826840 gene locus_tag LOCUS_18450 1826508 1826840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 1826899 1827846 gene locus_tag LOCUS_18460 1826899 1827846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18460 1828809 1827982 gene locus_tag LOCUS_18470 1828809 1827982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 1829491 1828820 gene locus_tag LOCUS_18480 1829491 1828820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 1830433 1830269 gene locus_tag LOCUS_18490 1830433 1830269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 1831861 1830704 gene locus_tag LOCUS_18500 1831861 1830704 CDS product DUF2117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869557.1 protein_id gnl|my_center|LOCUS_18500 1832545 1832264 gene locus_tag LOCUS_18510 1832545 1832264 CDS product DUF2098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060902.1 protein_id gnl|my_center|LOCUS_18510 1833096 1832629 gene locus_tag LOCUS_18520 1833096 1832629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023265.1 protein_id gnl|my_center|LOCUS_18520 1833320 1833168 gene locus_tag LOCUS_18530 1833320 1833168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 1834690 1833380 gene locus_tag LOCUS_18540 1834690 1833380 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020367.1 protein_id gnl|my_center|LOCUS_18540 1835090 1834677 gene locus_tag LOCUS_18550 1835090 1834677 CDS product molybdopterin dinucleotide binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020366.1 protein_id gnl|my_center|LOCUS_18550 1835893 1835087 gene locus_tag LOCUS_18560 1835893 1835087 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066575.1 protein_id gnl|my_center|LOCUS_18560 1837683 1835881 gene locus_tag LOCUS_18570 1837683 1835881 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024063.1 protein_id gnl|my_center|LOCUS_18570 1838714 1837683 gene locus_tag LOCUS_18580 1838714 1837683 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020363.1 protein_id gnl|my_center|LOCUS_18580 1839064 1838906 gene locus_tag LOCUS_18590 1839064 1838906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 1839903 1839055 gene locus_tag LOCUS_18600 1839903 1839055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18600 1842478 1839914 gene locus_tag LOCUS_18610 1842478 1839914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 1842987 1842475 gene locus_tag LOCUS_18620 1842987 1842475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 1843484 1842990 gene locus_tag LOCUS_18630 1843484 1842990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18630 1843746 1843459 gene locus_tag LOCUS_18640 1843746 1843459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 1843930 1844709 gene locus_tag LOCUS_18650 gene artA 1843930 1844709 CDS product archaeosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064816.1 protein_id gnl|my_center|LOCUS_18650 1844706 1845173 gene locus_tag LOCUS_18660 1844706 1845173 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020174.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18660 1845176 1845394 gene locus_tag LOCUS_18670 1845176 1845394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 1845391 1846062 gene locus_tag LOCUS_18680 1845391 1846062 CDS product archaetidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020175.1 protein_id gnl|my_center|LOCUS_18680 1846158 1846307 gene locus_tag LOCUS_18690 1846158 1846307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 1847339 1846425 gene locus_tag LOCUS_18700 gene guaA 1847339 1846425 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024387.1 protein_id gnl|my_center|LOCUS_18700 1847636 1848901 gene locus_tag LOCUS_18710 1847636 1848901 CDS product methanogenesis marker 16 metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023232.1 protein_id gnl|my_center|LOCUS_18710 1849245 1849772 gene locus_tag LOCUS_18720 1849245 1849772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 1849939 1851117 gene locus_tag LOCUS_18730 1849939 1851117 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029637.1 protein_id gnl|my_center|LOCUS_18730 1851610 1851137 gene locus_tag LOCUS_18740 1851610 1851137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 1852074 1851703 gene locus_tag LOCUS_18750 1852074 1851703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 1853331 1852288 gene locus_tag LOCUS_18760 1853331 1852288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 1854063 1853764 gene locus_tag LOCUS_18770 1854063 1853764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 1854252 1855409 gene locus_tag LOCUS_18780 1854252 1855409 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870834.1 protein_id gnl|my_center|LOCUS_18780 1855655 1855410 gene locus_tag LOCUS_18790 1855655 1855410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 1857241 1857618 gene locus_tag LOCUS_18800 1857241 1857618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18800 1857801 1857920 gene locus_tag LOCUS_18810 1857801 1857920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 1857993 1858181 gene locus_tag LOCUS_18820 1857993 1858181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 1859322 1858285 gene locus_tag LOCUS_18830 1859322 1858285 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085150668.1 protein_id gnl|my_center|LOCUS_18830 1860164 1859721 gene locus_tag LOCUS_18840 1860164 1859721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18840 1860457 1860137 gene locus_tag LOCUS_18850 1860457 1860137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 1860718 1860969 gene locus_tag LOCUS_18860 1860718 1860969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 1862947 1862090 gene locus_tag LOCUS_18870 1862947 1862090 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929150.1 protein_id gnl|my_center|LOCUS_18870 1864066 1864695 gene locus_tag LOCUS_18880 1864066 1864695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 >Feature sequence2 <1 597 gene locus_tag LOCUS_18890 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066032.1:TatD family hydrolase 622 840 gene locus_tag LOCUS_18900 622 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 828 1322 gene locus_tag LOCUS_18910 828 1322 CDS product TIGR00288 family NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065830.1 protein_id gnl|my_center|LOCUS_18910 1347 2102 gene locus_tag LOCUS_18920 1347 2102 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148183444.1 protein_id gnl|my_center|LOCUS_18920 2272 2688 gene locus_tag LOCUS_18930 2272 2688 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365680.1 protein_id gnl|my_center|LOCUS_18930 2783 3652 gene locus_tag LOCUS_18940 2783 3652 CDS product geranylfarnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024038.1 protein_id gnl|my_center|LOCUS_18940 3625 4788 gene locus_tag LOCUS_18950 3625 4788 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065913.1 protein_id gnl|my_center|LOCUS_18950 6600 4891 gene locus_tag LOCUS_18960 6600 4891 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941764.1 protein_id gnl|my_center|LOCUS_18960 6756 7814 gene locus_tag LOCUS_18970 6756 7814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 7966 9162 gene locus_tag LOCUS_18980 7966 9162 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020758.1 protein_id gnl|my_center|LOCUS_18980 9188 9634 gene locus_tag LOCUS_18990 9188 9634 CDS product DUF61 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870736.1 protein_id gnl|my_center|LOCUS_18990 9675 10226 gene locus_tag LOCUS_19000 9675 10226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 10263 11693 gene locus_tag LOCUS_19010 gene thiD 10263 11693 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023132.1 protein_id gnl|my_center|LOCUS_19010 11772 11987 gene locus_tag LOCUS_19020 11772 11987 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878411.1 protein_id gnl|my_center|LOCUS_19020 11980 12855 gene locus_tag LOCUS_19030 gene dapA 11980 12855 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024349.1 protein_id gnl|my_center|LOCUS_19030 12852 13646 gene locus_tag LOCUS_19040 gene dapB 12852 13646 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024350.1 protein_id gnl|my_center|LOCUS_19040 13643 14068 gene locus_tag LOCUS_19050 13643 14068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 15168 14668 gene locus_tag LOCUS_19060 15168 14668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 16664 15783 gene locus_tag LOCUS_19070 16664 15783 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140081.1 protein_id gnl|my_center|LOCUS_19070 16990 16661 gene locus_tag LOCUS_19080 16990 16661 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140080.1 protein_id gnl|my_center|LOCUS_19080 17190 20129 gene locus_tag LOCUS_19090 17190 20129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 21216 20779 gene locus_tag LOCUS_19100 21216 20779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19100 21912 22334 gene locus_tag LOCUS_19110 21912 22334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 22335 27632 gene locus_tag LOCUS_19120 22335 27632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 28416 28249 gene locus_tag LOCUS_19130 28416 28249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 28970 28362 gene locus_tag LOCUS_19140 28970 28362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 31333 28937 gene locus_tag LOCUS_19150 gene leuS 31333 28937 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021621.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19150 32519 31335 gene locus_tag LOCUS_19160 32519 31335 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546563.1 protein_id gnl|my_center|LOCUS_19160 32728 35100 gene locus_tag LOCUS_19170 32728 35100 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023138.1 protein_id gnl|my_center|LOCUS_19170 35097 36371 gene locus_tag LOCUS_19180 35097 36371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 36346 37224 gene locus_tag LOCUS_19190 36346 37224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 37228 37857 gene locus_tag LOCUS_19200 37228 37857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 37924 38421 gene locus_tag LOCUS_19210 gene comD 37924 38421 CDS product sulfopyruvate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876830.1 protein_id gnl|my_center|LOCUS_19210 38418 38978 gene locus_tag LOCUS_19220 gene comE 38418 38978 CDS product sulfopyruvate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876831.1 protein_id gnl|my_center|LOCUS_19220 40263 38947 gene locus_tag LOCUS_19230 40263 38947 CDS product methanogenesis marker 16 metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023232.1 protein_id gnl|my_center|LOCUS_19230 40535 41530 gene locus_tag LOCUS_19240 40535 41530 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020124.1 protein_id gnl|my_center|LOCUS_19240 41661 42455 gene locus_tag LOCUS_19250 41661 42455 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020123.1 protein_id gnl|my_center|LOCUS_19250 42499 43689 gene locus_tag LOCUS_19260 42499 43689 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020274.1 protein_id gnl|my_center|LOCUS_19260 44584 43724 gene locus_tag LOCUS_19270 44584 43724 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582908.1 protein_id gnl|my_center|LOCUS_19270 45557 44628 gene locus_tag LOCUS_19280 45557 44628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 45726 46670 gene locus_tag LOCUS_19290 45726 46670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 47437 46730 gene locus_tag LOCUS_19300 47437 46730 CDS product NrpR regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020866.1 protein_id gnl|my_center|LOCUS_19300 47559 48272 gene locus_tag LOCUS_19310 47559 48272 CDS product RNA ligase partner protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021001.1 protein_id gnl|my_center|LOCUS_19310 48936 48442 gene locus_tag LOCUS_19320 48936 48442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19320 50593 49025 gene locus_tag LOCUS_19330 50593 49025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19330 50948 51292 gene locus_tag LOCUS_19340 50948 51292 CDS product DUF555 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021390.1 protein_id gnl|my_center|LOCUS_19340 53661 51346 gene locus_tag LOCUS_19350 53661 51346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 54209 54030 gene locus_tag LOCUS_19360 54209 54030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 54304 54456 gene locus_tag LOCUS_19370 54304 54456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 54585 55886 gene locus_tag LOCUS_19380 54585 55886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 55934 56650 gene locus_tag LOCUS_19390 55934 56650 CDS product Dna2/Cas4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879670.1 protein_id gnl|my_center|LOCUS_19390 56728 57369 gene locus_tag LOCUS_19400 56728 57369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 57751 58854 gene locus_tag LOCUS_19410 57751 58854 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496792.1 protein_id gnl|my_center|LOCUS_19410 59033 59371 gene locus_tag LOCUS_19420 59033 59371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 60205 59429 gene locus_tag LOCUS_19430 60205 59429 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064991.1 protein_id gnl|my_center|LOCUS_19430 61132 60338 gene locus_tag LOCUS_19440 61132 60338 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064991.1 protein_id gnl|my_center|LOCUS_19440 62110 61352 gene locus_tag LOCUS_19450 62110 61352 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021299.1 protein_id gnl|my_center|LOCUS_19450 62996 62103 gene locus_tag LOCUS_19460 62996 62103 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066198.1 protein_id gnl|my_center|LOCUS_19460 64189 62993 gene locus_tag LOCUS_19470 gene coaBC 64189 62993 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065075.1 protein_id gnl|my_center|LOCUS_19470 64506 64652 gene locus_tag LOCUS_19480 64506 64652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 64914 65315 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtatccatgtctgaaaggacgtggcccaattgaaac 67883 67392 gene locus_tag LOCUS_19490 67883 67392 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020492.1 protein_id gnl|my_center|LOCUS_19490 68107 68802 gene locus_tag LOCUS_19500 68107 68802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 69232 68837 gene locus_tag LOCUS_19510 69232 68837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 69886 70656 gene locus_tag LOCUS_19520 69886 70656 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021309.1 protein_id gnl|my_center|LOCUS_19520 70695 70973 gene locus_tag LOCUS_19530 gene albA 70695 70973 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249515.1 protein_id gnl|my_center|LOCUS_19530 71042 72355 gene locus_tag LOCUS_19540 gene glmM 71042 72355 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250059.1 protein_id gnl|my_center|LOCUS_19540 72556 73467 gene locus_tag LOCUS_19550 gene aglJ 72556 73467 CDS product S-layer glycoprotein N-glycosyltransferase AglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024210.1 protein_id gnl|my_center|LOCUS_19550 77833 73499 gene locus_tag LOCUS_19560 77833 73499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 79410 77830 gene locus_tag LOCUS_19570 79410 77830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 79612 80055 gene locus_tag LOCUS_19580 79612 80055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 80065 80196 gene locus_tag LOCUS_19590 80065 80196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 80174 80482 gene locus_tag LOCUS_19600 80174 80482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 80635 80486 gene locus_tag LOCUS_19610 80635 80486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 80733 82127 gene locus_tag LOCUS_19620 80733 82127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 82124 83584 gene locus_tag LOCUS_19630 82124 83584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 83670 84386 gene locus_tag LOCUS_19640 gene alaXM 83670 84386 CDS product alanyl-tRNA editing protein AlaXM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022008.1 protein_id gnl|my_center|LOCUS_19640 84694 84518 gene locus_tag LOCUS_19650 84694 84518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 84753 85067 gene locus_tag LOCUS_19660 84753 85067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19660 85064 85246 gene locus_tag LOCUS_19670 85064 85246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 85847 85566 gene locus_tag LOCUS_19680 85847 85566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 86296 85904 gene locus_tag LOCUS_19690 86296 85904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 87247 86747 gene locus_tag LOCUS_19700 87247 86747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 88001 87693 gene locus_tag LOCUS_19710 88001 87693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 88000 88701 gene locus_tag LOCUS_19720 88000 88701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 89500 89868 gene locus_tag LOCUS_19730 89500 89868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 89865 90689 gene locus_tag LOCUS_19740 89865 90689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 90968 91924 gene locus_tag LOCUS_19750 90968 91924 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023086.1 protein_id gnl|my_center|LOCUS_19750 91943 92800 gene locus_tag LOCUS_19760 91943 92800 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023085.1 protein_id gnl|my_center|LOCUS_19760 92822 94063 gene locus_tag LOCUS_19770 gene larA 92822 94063 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860456.1 protein_id gnl|my_center|LOCUS_19770 94179 94682 gene locus_tag LOCUS_19780 gene rimI 94179 94682 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066037.1 protein_id gnl|my_center|LOCUS_19780 95388 94831 gene locus_tag LOCUS_19790 gene radB 95388 94831 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860416.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19790 96003 95404 gene locus_tag LOCUS_19800 96003 95404 CDS product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020740.1 protein_id gnl|my_center|LOCUS_19800 97010 96000 gene locus_tag LOCUS_19810 97010 96000 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020739.1 protein_id gnl|my_center|LOCUS_19810 97988 97017 gene locus_tag LOCUS_19820 97988 97017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 98269 98718 gene locus_tag LOCUS_19830 98269 98718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 98802 99272 gene locus_tag LOCUS_19840 98802 99272 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064945.1 protein_id gnl|my_center|LOCUS_19840 99701 99342 gene locus_tag LOCUS_19850 99701 99342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 99930 100439 gene locus_tag LOCUS_19860 99930 100439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 100526 100939 gene locus_tag LOCUS_19870 100526 100939 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868448.1 protein_id gnl|my_center|LOCUS_19870 101467 101772 gene locus_tag LOCUS_19880 101467 101772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 101800 102588 gene locus_tag LOCUS_19890 101800 102588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 102864 103145 gene locus_tag LOCUS_19900 102864 103145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 103199 104098 gene locus_tag LOCUS_19910 103199 104098 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066118.1 protein_id gnl|my_center|LOCUS_19910 104071 104865 gene locus_tag LOCUS_19920 104071 104865 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020633.1 protein_id gnl|my_center|LOCUS_19920 105017 105733 gene locus_tag LOCUS_19930 105017 105733 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879714.1 protein_id gnl|my_center|LOCUS_19930 106584 105787 gene locus_tag LOCUS_19940 106584 105787 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024464.1 protein_id gnl|my_center|LOCUS_19940 106794 106675 gene locus_tag LOCUS_19950 106794 106675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 108307 109761 gene locus_tag LOCUS_19960 108307 109761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19960 109871 111520 gene locus_tag LOCUS_19970 109871 111520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19970 112205 112381 gene locus_tag LOCUS_19980 112205 112381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 114101 117139 gene locus_tag LOCUS_19990 114101 117139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19990 118759 119394 gene locus_tag LOCUS_20000 118759 119394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 119843 119532 gene locus_tag LOCUS_20010 119843 119532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 121390 121776 gene locus_tag LOCUS_20020 121390 121776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 121836 122738 gene locus_tag LOCUS_20030 121836 122738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 123622 124974 gene locus_tag LOCUS_20040 123622 124974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 125654 126310 gene locus_tag LOCUS_20050 125654 126310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 126319 126663 gene locus_tag LOCUS_20060 126319 126663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 126750 126959 gene locus_tag LOCUS_20070 126750 126959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 126956 127216 gene locus_tag LOCUS_20080 126956 127216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20080 128708 132289 gene locus_tag LOCUS_20090 128708 132289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 132883 133107 gene locus_tag LOCUS_20100 132883 133107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 133266 133051 gene locus_tag LOCUS_20110 133266 133051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 133915 133427 gene locus_tag LOCUS_20120 133915 133427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 134430 133945 gene locus_tag LOCUS_20130 134430 133945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 135003 134497 gene locus_tag LOCUS_20140 135003 134497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 135375 135112 gene locus_tag LOCUS_20150 135375 135112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 135496 136578 gene locus_tag LOCUS_20160 135496 136578 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942946.1 protein_id gnl|my_center|LOCUS_20160 136809 137798 gene locus_tag LOCUS_20170 136809 137798 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393185.1 protein_id gnl|my_center|LOCUS_20170 137815 138285 gene locus_tag LOCUS_20180 137815 138285 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022482.1 protein_id gnl|my_center|LOCUS_20180 138658 140124 gene locus_tag LOCUS_20190 138658 140124 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787371.1 protein_id gnl|my_center|LOCUS_20190 140180 140755 gene locus_tag LOCUS_20200 140180 140755 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392800.1 protein_id gnl|my_center|LOCUS_20200 140905 141294 gene locus_tag LOCUS_20210 140905 141294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 142115 141396 gene locus_tag LOCUS_20220 142115 141396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 142535 143485 gene locus_tag LOCUS_20230 142535 143485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 144364 143606 gene locus_tag LOCUS_20240 144364 143606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 145302 144601 gene locus_tag LOCUS_20250 145302 144601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 146542 146105 gene locus_tag LOCUS_20260 146542 146105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20260 147128 146721 gene locus_tag LOCUS_20270 147128 146721 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024057.1 protein_id gnl|my_center|LOCUS_20270 148386 147394 gene locus_tag LOCUS_20280 148386 147394 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020113.1 protein_id gnl|my_center|LOCUS_20280 149768 148425 gene locus_tag LOCUS_20290 gene thrC 149768 148425 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_20290 150633 149773 gene locus_tag LOCUS_20300 150633 149773 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023985.1 protein_id gnl|my_center|LOCUS_20300 151067 150630 gene locus_tag LOCUS_20310 151067 150630 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022818.1 protein_id gnl|my_center|LOCUS_20310 151894 151088 gene locus_tag LOCUS_20320 151894 151088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 151862 152254 gene locus_tag LOCUS_20330 151862 152254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 152417 153100 gene locus_tag LOCUS_20340 152417 153100 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023984.1 protein_id gnl|my_center|LOCUS_20340 153138 153314 gene locus_tag LOCUS_20350 153138 153314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 153416 153796 gene locus_tag LOCUS_20360 153416 153796 CDS product tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065620.1 protein_id gnl|my_center|LOCUS_20360 153956 155212 gene locus_tag LOCUS_20370 153956 155212 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249826.1 protein_id gnl|my_center|LOCUS_20370 155230 155988 gene locus_tag LOCUS_20380 155230 155988 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024199.1 protein_id gnl|my_center|LOCUS_20380 155989 156954 gene locus_tag LOCUS_20390 gene mer 155989 156954 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023637.1 protein_id gnl|my_center|LOCUS_20390 157070 157624 gene locus_tag LOCUS_20400 157070 157624 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065785.1 protein_id gnl|my_center|LOCUS_20400 158841 157741 gene locus_tag LOCUS_20410 158841 157741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20410 160253 158745 gene locus_tag LOCUS_20420 160253 158745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20420 161002 163197 gene locus_tag LOCUS_20430 161002 163197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 165712 163292 gene locus_tag LOCUS_20440 165712 163292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 166194 165784 gene locus_tag LOCUS_20450 166194 165784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 166451 166191 gene locus_tag LOCUS_20460 166451 166191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 167775 166726 gene locus_tag LOCUS_20470 167775 166726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 167979 168875 gene locus_tag LOCUS_20480 167979 168875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 168869 169681 gene locus_tag LOCUS_20490 168869 169681 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083333.1 protein_id gnl|my_center|LOCUS_20490 170512 170706 gene locus_tag LOCUS_20500 170512 170706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 170703 170870 gene locus_tag LOCUS_20510 170703 170870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 171865 171563 gene locus_tag LOCUS_20520 gene cas2 171865 171563 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940736.1 protein_id gnl|my_center|LOCUS_20520 173526 171865 gene locus_tag LOCUS_20530 gene cas1 173526 171865 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 protein_id gnl|my_center|LOCUS_20530 174894 173935 gene locus_tag LOCUS_20540 174894 173935 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066119.1 protein_id gnl|my_center|LOCUS_20540 176263 174926 gene locus_tag LOCUS_20550 176263 174926 CDS product RNase J family beta-CASP ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020654.1 protein_id gnl|my_center|LOCUS_20550 177357 176260 gene locus_tag LOCUS_20560 gene fni 177357 176260 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020653.1 protein_id gnl|my_center|LOCUS_20560 178106 177354 gene locus_tag LOCUS_20570 178106 177354 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020652.1 protein_id gnl|my_center|LOCUS_20570 178344 178123 gene locus_tag LOCUS_20580 178344 178123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 179077 178316 gene locus_tag LOCUS_20590 179077 178316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20590 179806 179090 gene locus_tag LOCUS_20600 179806 179090 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020650.1 protein_id gnl|my_center|LOCUS_20600 180488 179886 gene locus_tag LOCUS_20610 gene rpsB 180488 179886 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020649.1 protein_id gnl|my_center|LOCUS_20610 180700 180521 gene locus_tag LOCUS_20620 180700 180521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 180801 180727 gene locus_tag LOCUS_t00340 180801 180727 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 180990 180805 gene locus_tag LOCUS_20630 180990 180805 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020647.1 protein_id gnl|my_center|LOCUS_20630 181395 180997 gene locus_tag LOCUS_20640 181395 180997 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020646.1 protein_id gnl|my_center|LOCUS_20640 181825 181406 gene locus_tag LOCUS_20650 181825 181406 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020645.1 protein_id gnl|my_center|LOCUS_20650 182190 181831 gene locus_tag LOCUS_20660 182190 181831 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064921.1 protein_id gnl|my_center|LOCUS_20660 182472 183743 gene locus_tag LOCUS_20670 182472 183743 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021968.1 protein_id gnl|my_center|LOCUS_20670 184545 183892 gene locus_tag LOCUS_20680 184545 183892 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860472.1 protein_id gnl|my_center|LOCUS_20680 185880 184978 gene locus_tag LOCUS_20690 185880 184978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 186139 185870 gene locus_tag LOCUS_20700 186139 185870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 186462 186136 gene locus_tag LOCUS_20710 186462 186136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022118.1 protein_id gnl|my_center|LOCUS_20710 187546 186569 gene locus_tag LOCUS_20720 187546 186569 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066456.1 protein_id gnl|my_center|LOCUS_20720 188015 187743 gene locus_tag LOCUS_20730 gene trxA 188015 187743 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065637.1 protein_id gnl|my_center|LOCUS_20730 188497 188015 gene locus_tag LOCUS_20740 188497 188015 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785477.1 protein_id gnl|my_center|LOCUS_20740 189464 188499 gene locus_tag LOCUS_20750 gene ahbD 189464 188499 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_20750 190522 189494 gene locus_tag LOCUS_20760 gene asd 190522 189494 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020482.1 protein_id gnl|my_center|LOCUS_20760 191188 190619 gene locus_tag LOCUS_20770 191188 190619 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459982.1 protein_id gnl|my_center|LOCUS_20770 191551 192831 gene locus_tag LOCUS_20780 191551 192831 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544926.1 protein_id gnl|my_center|LOCUS_20780 192958 193158 gene locus_tag LOCUS_20790 192958 193158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 193962 193234 gene locus_tag LOCUS_20800 193962 193234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20800 194127 193966 gene locus_tag LOCUS_20810 194127 193966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20810 195681 194155 gene locus_tag LOCUS_20820 195681 194155 CDS product alternate F1F0 ATPase, F1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022405.1 protein_id gnl|my_center|LOCUS_20820 196459 195647 gene locus_tag LOCUS_20830 196459 195647 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022406.1 protein_id gnl|my_center|LOCUS_20830 196747 196469 gene locus_tag LOCUS_20840 196747 196469 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328511.1 protein_id gnl|my_center|LOCUS_20840 197461 196760 gene locus_tag LOCUS_20850 197461 196760 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022408.1 protein_id gnl|my_center|LOCUS_20850 197751 197449 gene locus_tag LOCUS_20860 197751 197449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 198065 197748 gene locus_tag LOCUS_20870 198065 197748 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022410.1 protein_id gnl|my_center|LOCUS_20870 198451 198065 gene locus_tag LOCUS_20880 198451 198065 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120166.1 protein_id gnl|my_center|LOCUS_20880 199788 198448 gene locus_tag LOCUS_20890 gene atpD 199788 198448 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065404.1 protein_id gnl|my_center|LOCUS_20890 200431 199979 gene locus_tag LOCUS_20900 200431 199979 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022482.1 protein_id gnl|my_center|LOCUS_20900 201924 200515 gene locus_tag LOCUS_20910 gene purF 201924 200515 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065634.1 protein_id gnl|my_center|LOCUS_20910 202414 202196 gene locus_tag LOCUS_20920 202414 202196 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023130.1 protein_id gnl|my_center|LOCUS_20920 202506 202988 gene locus_tag LOCUS_20930 202506 202988 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023779.1 protein_id gnl|my_center|LOCUS_20930 202990 203697 gene locus_tag LOCUS_20940 202990 203697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20940 203906 204187 gene locus_tag LOCUS_20950 203906 204187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 204277 204750 gene locus_tag LOCUS_20960 204277 204750 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545207.1 protein_id gnl|my_center|LOCUS_20960 204734 206074 gene locus_tag LOCUS_20970 204734 206074 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020936.1 protein_id gnl|my_center|LOCUS_20970 206115 206573 gene locus_tag LOCUS_20980 206115 206573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 206958 206779 gene locus_tag LOCUS_20990 206958 206779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 206908 207720 gene locus_tag LOCUS_21000 206908 207720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 208021 208269 gene locus_tag LOCUS_21010 208021 208269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 208398 208325 gene locus_tag LOCUS_t00350 208398 208325 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 208834 208586 gene locus_tag LOCUS_21020 208834 208586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 208998 210155 gene locus_tag LOCUS_21030 gene nifS 208998 210155 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_21030 210646 210897 gene locus_tag LOCUS_21040 210646 210897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 212070 211033 gene locus_tag LOCUS_21050 212070 211033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 212259 214373 gene locus_tag LOCUS_21060 gene metG 212259 214373 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065884.1 protein_id gnl|my_center|LOCUS_21060 214386 216119 gene locus_tag LOCUS_21070 214386 216119 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060755.1 protein_id gnl|my_center|LOCUS_21070 216126 217241 gene locus_tag LOCUS_21080 216126 217241 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024513.1 protein_id gnl|my_center|LOCUS_21080 217521 218264 gene locus_tag LOCUS_21090 gene radA 217521 218264 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023460.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21090 218546 220069 gene locus_tag LOCUS_21100 218546 220069 CDS product methanogenesis marker 14 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024395.1 protein_id gnl|my_center|LOCUS_21100 220164 220832 gene locus_tag LOCUS_21110 220164 220832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 221716 221051 gene locus_tag LOCUS_21120 221716 221051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 221839 222645 gene locus_tag LOCUS_21130 221839 222645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 225274 222833 gene locus_tag LOCUS_21140 225274 222833 CDS product DUF5814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021427.1 protein_id gnl|my_center|LOCUS_21140 226084 225296 gene locus_tag LOCUS_21150 226084 225296 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589532.1 protein_id gnl|my_center|LOCUS_21150 226602 226084 gene locus_tag LOCUS_21160 226602 226084 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022953.1 protein_id gnl|my_center|LOCUS_21160 228573 226666 gene locus_tag LOCUS_21170 228573 226666 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023770.1 protein_id gnl|my_center|LOCUS_21170 229214 228594 gene locus_tag LOCUS_21180 gene psmB 229214 228594 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023769.1 protein_id gnl|my_center|LOCUS_21180 229476 230219 gene locus_tag LOCUS_21190 229476 230219 CDS product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066525.1 protein_id gnl|my_center|LOCUS_21190 231924 230461 gene locus_tag LOCUS_21200 231924 230461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21200 232969 231917 gene locus_tag LOCUS_21210 232969 231917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21210 233525 232995 gene locus_tag LOCUS_21220 233525 232995 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065175.1 protein_id gnl|my_center|LOCUS_21220 233800 233522 gene locus_tag LOCUS_21230 233800 233522 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021663.1 protein_id gnl|my_center|LOCUS_21230 234817 234086 gene locus_tag LOCUS_21240 234817 234086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 236258 237397 gene locus_tag LOCUS_21250 236258 237397 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061240.1 protein_id gnl|my_center|LOCUS_21250 237484 238359 gene locus_tag LOCUS_21260 237484 238359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 238506 239645 gene locus_tag LOCUS_21270 238506 239645 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060968.1 protein_id gnl|my_center|LOCUS_21270 239854 241059 gene locus_tag LOCUS_21280 239854 241059 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061302.1 protein_id gnl|my_center|LOCUS_21280 241056 241694 gene locus_tag LOCUS_21290 241056 241694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 244306 241790 gene locus_tag LOCUS_21300 gene mgtA 244306 241790 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402038.1 protein_id gnl|my_center|LOCUS_21300 245646 244522 gene locus_tag LOCUS_21310 245646 244522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990679.1 protein_id gnl|my_center|LOCUS_21310 245810 246694 gene locus_tag LOCUS_21320 245810 246694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 247708 246887 gene locus_tag LOCUS_21330 247708 246887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 248252 247854 gene locus_tag LOCUS_21340 248252 247854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 248394 249002 gene locus_tag LOCUS_21350 248394 249002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 249238 249654 gene locus_tag LOCUS_21360 249238 249654 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061251.1 protein_id gnl|my_center|LOCUS_21360 249911 249984 gene locus_tag LOCUS_t00360 249911 249984 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 251554 249995 gene locus_tag LOCUS_21370 gene uvrC 251554 249995 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023256.1 protein_id gnl|my_center|LOCUS_21370 252997 252398 gene locus_tag LOCUS_21380 gene thiE 252997 252398 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022682.1 protein_id gnl|my_center|LOCUS_21380 253815 252994 gene locus_tag LOCUS_21390 gene thiM 253815 252994 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022683.1 protein_id gnl|my_center|LOCUS_21390 255525 253948 gene locus_tag LOCUS_21400 gene serA 255525 253948 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020641.1 protein_id gnl|my_center|LOCUS_21400 257048 255816 gene locus_tag LOCUS_21410 257048 255816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 259061 257136 gene locus_tag LOCUS_21420 259061 257136 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_21420 259835 261517 gene locus_tag LOCUS_21430 gene argS 259835 261517 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064797.1 protein_id gnl|my_center|LOCUS_21430 261916 262611 gene locus_tag LOCUS_21440 261916 262611 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021474.1 protein_id gnl|my_center|LOCUS_21440 262608 262886 gene locus_tag LOCUS_21450 262608 262886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021475.1 protein_id gnl|my_center|LOCUS_21450 262918 263853 gene locus_tag LOCUS_21460 262918 263853 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941155.1 protein_id gnl|my_center|LOCUS_21460 265297 263957 gene locus_tag LOCUS_21470 265297 263957 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020186.1 protein_id gnl|my_center|LOCUS_21470 265644 265925 gene locus_tag LOCUS_21480 gene gatC 265644 265925 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024398.1 protein_id gnl|my_center|LOCUS_21480 265922 267346 gene locus_tag LOCUS_21490 gene gatA 265922 267346 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066007.1 protein_id gnl|my_center|LOCUS_21490 267347 268762 gene locus_tag LOCUS_21500 gene gatB 267347 268762 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024400.1 protein_id gnl|my_center|LOCUS_21500 268940 269161 gene locus_tag LOCUS_21510 268940 269161 CDS product heavy metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707532.1 protein_id gnl|my_center|LOCUS_21510 269306 269599 gene locus_tag LOCUS_21520 269306 269599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 269781 269578 gene locus_tag LOCUS_21530 269781 269578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 270364 271143 gene locus_tag LOCUS_21540 270364 271143 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211328137.1 protein_id gnl|my_center|LOCUS_21540 271633 271415 gene locus_tag LOCUS_21550 271633 271415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 272435 272142 gene locus_tag LOCUS_21560 272435 272142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 272755 272931 gene locus_tag LOCUS_21570 272755 272931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 272937 273233 gene locus_tag LOCUS_21580 272937 273233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 275547 273994 gene locus_tag LOCUS_21590 275547 273994 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868685.1 protein_id gnl|my_center|LOCUS_21590 275727 275563 gene locus_tag LOCUS_21600 275727 275563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 276109 275849 gene locus_tag LOCUS_21610 276109 275849 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021698.1 protein_id gnl|my_center|LOCUS_21610 276279 276115 gene locus_tag LOCUS_21620 276279 276115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 276608 276339 gene locus_tag LOCUS_21630 276608 276339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21630 276733 276605 gene locus_tag LOCUS_21640 276733 276605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 277395 277210 gene locus_tag LOCUS_21650 277395 277210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 277898 277557 gene locus_tag LOCUS_21660 277898 277557 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877824.1 protein_id gnl|my_center|LOCUS_21660 278173 277988 gene locus_tag LOCUS_21670 278173 277988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 279092 278943 gene locus_tag LOCUS_21680 279092 278943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21680 280618 279503 gene locus_tag LOCUS_21690 280618 279503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 283739 280653 gene locus_tag LOCUS_21700 283739 280653 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966800.1 protein_id gnl|my_center|LOCUS_21700 283836 284147 gene locus_tag LOCUS_21710 283836 284147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 284376 284164 gene locus_tag LOCUS_21720 284376 284164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 284505 285959 gene locus_tag LOCUS_21730 284505 285959 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024491.1 protein_id gnl|my_center|LOCUS_21730 286155 287459 gene locus_tag LOCUS_21740 286155 287459 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023751.1 protein_id gnl|my_center|LOCUS_21740 287528 287962 gene locus_tag LOCUS_21750 287528 287962 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023752.1 protein_id gnl|my_center|LOCUS_21750 288071 288508 gene locus_tag LOCUS_21760 288071 288508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21760 288477 288896 gene locus_tag LOCUS_21770 288477 288896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21770 289244 290914 gene locus_tag LOCUS_21780 289244 290914 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878252.1 protein_id gnl|my_center|LOCUS_21780 290911 291762 gene locus_tag LOCUS_21790 290911 291762 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878253.1 protein_id gnl|my_center|LOCUS_21790 291798 291959 gene locus_tag LOCUS_21800 291798 291959 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869872.1 protein_id gnl|my_center|LOCUS_21800 292014 292535 gene locus_tag LOCUS_21810 292014 292535 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875797.1 protein_id gnl|my_center|LOCUS_21810 293045 292608 gene locus_tag LOCUS_21820 293045 292608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 293118 294491 gene locus_tag LOCUS_21830 gene tgt 293118 294491 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878982.1 protein_id gnl|my_center|LOCUS_21830 294572 295315 gene locus_tag LOCUS_21840 294572 295315 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080883.1 protein_id gnl|my_center|LOCUS_21840 295510 296364 gene locus_tag LOCUS_21850 295510 296364 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021378.1 protein_id gnl|my_center|LOCUS_21850 296866 297318 gene locus_tag LOCUS_21860 296866 297318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21860 297345 297914 gene locus_tag LOCUS_21870 297345 297914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21870 298024 298644 gene locus_tag LOCUS_21880 298024 298644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 298733 299944 gene locus_tag LOCUS_21890 gene purB 298733 299944 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066555.1 protein_id gnl|my_center|LOCUS_21890 300102 300548 gene locus_tag LOCUS_21900 300102 300548 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496456.1 protein_id gnl|my_center|LOCUS_21900 300542 300763 gene locus_tag LOCUS_21910 300542 300763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 300895 301479 gene locus_tag LOCUS_21920 300895 301479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 301494 302390 gene locus_tag LOCUS_21930 301494 302390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 302909 303130 gene locus_tag LOCUS_21940 302909 303130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 303157 303384 gene locus_tag LOCUS_21950 303157 303384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 303326 303652 gene locus_tag LOCUS_21960 303326 303652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 305367 306074 gene locus_tag LOCUS_21970 gene istB 305367 306074 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459339.1 protein_id gnl|my_center|LOCUS_21970 306219 307076 gene locus_tag LOCUS_21980 306219 307076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 307652 307317 gene locus_tag LOCUS_21990 307652 307317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 307820 308080 gene locus_tag LOCUS_22000 307820 308080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 308498 310069 gene locus_tag LOCUS_22010 308498 310069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 310002 310652 gene locus_tag LOCUS_22020 310002 310652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 310654 311157 gene locus_tag LOCUS_22030 310654 311157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 311647 311183 gene locus_tag LOCUS_22040 311647 311183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 311773 312210 gene locus_tag LOCUS_22050 gene mscL 311773 312210 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_22050 312449 313756 gene locus_tag LOCUS_22060 312449 313756 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140384.1 protein_id gnl|my_center|LOCUS_22060 313806 314468 gene locus_tag LOCUS_22070 gene queC 313806 314468 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877949.1 protein_id gnl|my_center|LOCUS_22070 314550 315092 gene locus_tag LOCUS_22080 gene hpt 314550 315092 CDS product hypoxanthine/guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871179.1 protein_id gnl|my_center|LOCUS_22080 315103 315405 gene locus_tag LOCUS_22090 315103 315405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 315689 316189 gene locus_tag LOCUS_22100 315689 316189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 316237 317652 gene locus_tag LOCUS_22110 316237 317652 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021657.1 protein_id gnl|my_center|LOCUS_22110 317649 318620 gene locus_tag LOCUS_22120 317649 318620 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024160.1 protein_id gnl|my_center|LOCUS_22120 320975 321991 gene locus_tag LOCUS_22130 320975 321991 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877877.1 protein_id gnl|my_center|LOCUS_22130 322077 322922 gene locus_tag LOCUS_22140 322077 322922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 323216 322956 gene locus_tag LOCUS_22150 323216 322956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 324186 323557 gene locus_tag LOCUS_22160 324186 323557 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023341.1 protein_id gnl|my_center|LOCUS_22160 324652 324404 gene locus_tag LOCUS_22170 324652 324404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 325636 324725 gene locus_tag LOCUS_22180 325636 324725 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903919.1 protein_id gnl|my_center|LOCUS_22180 325861 326109 gene locus_tag LOCUS_22190 325861 326109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 326128 326673 gene locus_tag LOCUS_22200 326128 326673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 326691 329549 gene locus_tag LOCUS_22210 326691 329549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 331877 329703 gene locus_tag LOCUS_22220 331877 329703 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064996.1 protein_id gnl|my_center|LOCUS_22220 331927 332655 gene locus_tag LOCUS_22230 331927 332655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 332915 333736 gene locus_tag LOCUS_22240 332915 333736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22240 333882 335897 gene locus_tag LOCUS_22250 333882 335897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 336176 336382 gene locus_tag LOCUS_22260 336176 336382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 336379 337350 gene locus_tag LOCUS_22270 336379 337350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22270 337513 337385 gene locus_tag LOCUS_22280 337513 337385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 337694 338125 gene locus_tag LOCUS_22290 337694 338125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 338115 338819 gene locus_tag LOCUS_22300 gene tpiA 338115 338819 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024480.1 protein_id gnl|my_center|LOCUS_22300 338820 339089 gene locus_tag LOCUS_22310 338820 339089 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545551.1 protein_id gnl|my_center|LOCUS_22310 339104 339274 gene locus_tag LOCUS_22320 339104 339274 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065133.1 protein_id gnl|my_center|LOCUS_22320 339271 340446 gene locus_tag LOCUS_22330 339271 340446 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021498.1 protein_id gnl|my_center|LOCUS_22330 340807 340505 gene locus_tag LOCUS_22340 340807 340505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 341054 340764 gene locus_tag LOCUS_22350 341054 340764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 341419 341808 gene locus_tag LOCUS_22360 341419 341808 CDS product transcriptional regulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065665.1 protein_id gnl|my_center|LOCUS_22360 342200 341940 gene locus_tag LOCUS_22370 342200 341940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 342684 343931 gene locus_tag LOCUS_22380 342684 343931 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927136.1 protein_id gnl|my_center|LOCUS_22380 344063 344839 gene locus_tag LOCUS_22390 gene hisF 344063 344839 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020590.1 protein_id gnl|my_center|LOCUS_22390 346112 345066 gene locus_tag LOCUS_22400 346112 345066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 346351 346109 gene locus_tag LOCUS_22410 346351 346109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 346929 347744 gene locus_tag LOCUS_22420 346929 347744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 348806 347874 gene locus_tag LOCUS_22430 348806 347874 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020436.1 protein_id gnl|my_center|LOCUS_22430 348960 350345 gene locus_tag LOCUS_22440 348960 350345 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860393.1 protein_id gnl|my_center|LOCUS_22440 350510 353920 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccttgttttcgtggaacttgctcttgatg 354738 354088 gene locus_tag LOCUS_22450 354738 354088 CDS product CRISPR-associated endonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065262.1 protein_id gnl|my_center|LOCUS_22450 356514 354766 gene locus_tag LOCUS_22460 356514 354766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22460 356740 356450 gene locus_tag LOCUS_22470 356740 356450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 357374 356763 gene locus_tag LOCUS_22480 357374 356763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22480 357675 358652 gene locus_tag LOCUS_22490 357675 358652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 359116 360689 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attgcaaagctcatcccgacgaaaagggaattgaaa 360710 363937 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tgcaaagcacatcccgacgaaaagggaattgaaac 364040 364273 gene locus_tag LOCUS_22500 364040 364273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 364563 364889 gene locus_tag LOCUS_22510 364563 364889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22510 365003 368008 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attgcaaagcacatcccgacgaaaagggaattgaaac 369421 368045 gene locus_tag LOCUS_22520 369421 368045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 372242 371157 gene locus_tag LOCUS_22530 gene cas7i 372242 371157 CDS product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258799.1 protein_id gnl|my_center|LOCUS_22530 372627 372256 gene locus_tag LOCUS_22540 372627 372256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 373881 374915 gene locus_tag LOCUS_22550 gene cas1 373881 374915 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258803.1 protein_id gnl|my_center|LOCUS_22550 374947 375225 gene locus_tag LOCUS_22560 374947 375225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 375233 375844 gene locus_tag LOCUS_22570 gene cas4 375233 375844 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879370.1 protein_id gnl|my_center|LOCUS_22570 375876 376823 gene locus_tag LOCUS_22580 gene cas4a 375876 376823 CDS product type I-A CRISPR-associated protein Cas4/Csa1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977960.1 protein_id gnl|my_center|LOCUS_22580 378166 377048 gene locus_tag LOCUS_22590 378166 377048 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020662.1 protein_id gnl|my_center|LOCUS_22590 378753 378175 gene locus_tag LOCUS_22600 378753 378175 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082088841.1 protein_id gnl|my_center|LOCUS_22600 380479 378767 gene locus_tag LOCUS_22610 380479 378767 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020888.1 protein_id gnl|my_center|LOCUS_22610 381495 380473 gene locus_tag LOCUS_22620 381495 380473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 382471 381485 gene locus_tag LOCUS_22630 382471 381485 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020886.1 protein_id gnl|my_center|LOCUS_22630 382976 382545 gene locus_tag LOCUS_22640 gene tsaA 382976 382545 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082829.1 protein_id gnl|my_center|LOCUS_22640 384778 383177 gene locus_tag LOCUS_22650 384778 383177 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860413.1 protein_id gnl|my_center|LOCUS_22650 385538 384918 gene locus_tag LOCUS_22660 385538 384918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 386319 387071 gene locus_tag LOCUS_22670 386319 387071 CDS product disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064949.1 protein_id gnl|my_center|LOCUS_22670 387073 388443 gene locus_tag LOCUS_22680 387073 388443 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020733.1 protein_id gnl|my_center|LOCUS_22680 389653 388499 gene locus_tag LOCUS_22690 389653 388499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 390863 389658 gene locus_tag LOCUS_22700 gene folP 390863 389658 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065738.1 protein_id gnl|my_center|LOCUS_22700 391801 391016 gene locus_tag LOCUS_22710 391801 391016 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095630.1 protein_id gnl|my_center|LOCUS_22710 392765 391785 gene locus_tag LOCUS_22720 392765 391785 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878797.1 protein_id gnl|my_center|LOCUS_22720 393803 392805 gene locus_tag LOCUS_22730 393803 392805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 396450 395644 gene locus_tag LOCUS_22740 396450 395644 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927154.1 protein_id gnl|my_center|LOCUS_22740 397211 396450 gene locus_tag LOCUS_22750 397211 396450 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_22750 398131 397208 gene locus_tag LOCUS_22760 398131 397208 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876243.1 protein_id gnl|my_center|LOCUS_22760 399318 398497 gene locus_tag LOCUS_22770 399318 398497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 401508 399853 gene locus_tag LOCUS_22780 401508 399853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 401842 401423 gene locus_tag LOCUS_22790 401842 401423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22790 401808 401966 gene locus_tag LOCUS_22800 401808 401966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 404710 402299 gene locus_tag LOCUS_22810 404710 402299 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932772.1 protein_id gnl|my_center|LOCUS_22810 405205 406599 gene locus_tag LOCUS_22820 405205 406599 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_22820 408095 406893 gene locus_tag LOCUS_22830 408095 406893 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279118.1 protein_id gnl|my_center|LOCUS_22830 409283 408096 gene locus_tag LOCUS_22840 409283 408096 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279118.1 protein_id gnl|my_center|LOCUS_22840 410304 409348 gene locus_tag LOCUS_22850 410304 409348 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021156.1 protein_id gnl|my_center|LOCUS_22850 411383 410301 gene locus_tag LOCUS_22860 411383 410301 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065044.1 protein_id gnl|my_center|LOCUS_22860 412627 411590 gene locus_tag LOCUS_22870 412627 411590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 412994 413239 gene locus_tag LOCUS_22880 412994 413239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 414168 413281 gene locus_tag LOCUS_22890 414168 413281 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393027.1 protein_id gnl|my_center|LOCUS_22890 414957 415211 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaattgggccacgacttttcagccatggatac 416413 416730 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaattgggccacgtcctttcag 417290 417135 gene locus_tag LOCUS_22900 417290 417135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 417836 417435 gene locus_tag LOCUS_22910 417836 417435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 417923 418701 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaattgggccacgacttttcagccatggaaat 419675 420811 gene locus_tag LOCUS_22920 419675 420811 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023374.1 protein_id gnl|my_center|LOCUS_22920 420929 420753 gene locus_tag LOCUS_22930 420929 420753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 420928 421773 gene locus_tag LOCUS_22940 420928 421773 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066550.1 protein_id gnl|my_center|LOCUS_22940 421803 422585 gene locus_tag LOCUS_22950 421803 422585 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020954.1 protein_id gnl|my_center|LOCUS_22950 422582 423712 gene locus_tag LOCUS_22960 422582 423712 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066493.1 protein_id gnl|my_center|LOCUS_22960 423709 424497 gene locus_tag LOCUS_22970 423709 424497 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065716.1 protein_id gnl|my_center|LOCUS_22970 426551 424611 gene locus_tag LOCUS_22980 426551 424611 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066516.1 protein_id gnl|my_center|LOCUS_22980 427322 428974 gene locus_tag LOCUS_22990 427322 428974 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020884.1 protein_id gnl|my_center|LOCUS_22990 428979 429842 gene locus_tag LOCUS_23000 428979 429842 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064977.1 protein_id gnl|my_center|LOCUS_23000 429880 430878 gene locus_tag LOCUS_23010 429880 430878 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020886.1 protein_id gnl|my_center|LOCUS_23010 430875 431858 gene locus_tag LOCUS_23020 430875 431858 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064978.1 protein_id gnl|my_center|LOCUS_23020 431855 433591 gene locus_tag LOCUS_23030 431855 433591 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020888.1 protein_id gnl|my_center|LOCUS_23030 433843 434829 gene locus_tag LOCUS_23040 433843 434829 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081632.1 protein_id gnl|my_center|LOCUS_23040 434835 435605 gene locus_tag LOCUS_23050 434835 435605 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224893.1 protein_id gnl|my_center|LOCUS_23050 435598 436620 gene locus_tag LOCUS_23060 435598 436620 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250918.1 protein_id gnl|my_center|LOCUS_23060 436674 437579 gene locus_tag LOCUS_23070 436674 437579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 438188 437646 gene locus_tag LOCUS_23080 438188 437646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 438424 438236 gene locus_tag LOCUS_23090 438424 438236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 439319 438885 gene locus_tag LOCUS_23100 439319 438885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 439875 439396 gene locus_tag LOCUS_23110 439875 439396 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065176.1 protein_id gnl|my_center|LOCUS_23110 440480 439929 gene locus_tag LOCUS_23120 440480 439929 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065176.1 protein_id gnl|my_center|LOCUS_23120 440816 440565 gene locus_tag LOCUS_23130 440816 440565 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023444.1 protein_id gnl|my_center|LOCUS_23130 442177 440897 gene locus_tag LOCUS_23140 442177 440897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23140 443109 442153 gene locus_tag LOCUS_23150 443109 442153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23150 443286 444983 gene locus_tag LOCUS_23160 gene ade 443286 444983 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937748.1 protein_id gnl|my_center|LOCUS_23160 445048 445323 gene locus_tag LOCUS_23170 445048 445323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 445431 445706 gene locus_tag LOCUS_23180 445431 445706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 445703 445948 gene locus_tag LOCUS_23190 445703 445948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23190 445881 446804 gene locus_tag LOCUS_23200 445881 446804 CDS product TIGR04013 family B12-binding domain/radical SAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020300.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23200 447136 446801 gene locus_tag LOCUS_23210 447136 446801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 448158 447178 gene locus_tag LOCUS_23220 448158 447178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 448072 448383 gene locus_tag LOCUS_23230 448072 448383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 449422 449904 gene locus_tag LOCUS_23240 449422 449904 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755995.1 protein_id gnl|my_center|LOCUS_23240 449949 450209 gene locus_tag LOCUS_23250 449949 450209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 450645 450454 gene locus_tag LOCUS_23260 450645 450454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 450554 450871 gene locus_tag LOCUS_23270 450554 450871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 451982 451131 gene locus_tag LOCUS_23280 451982 451131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 452116 453600 gene locus_tag LOCUS_23290 452116 453600 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_23290 453597 455453 gene locus_tag LOCUS_23300 453597 455453 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064995.1 protein_id gnl|my_center|LOCUS_23300 456360 455695 gene locus_tag LOCUS_23310 456360 455695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 456671 456586 gene locus_tag LOCUS_t00370 456671 456586 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 457513 456719 gene locus_tag LOCUS_23320 457513 456719 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053732.1 protein_id gnl|my_center|LOCUS_23320 457906 457517 gene locus_tag LOCUS_23330 457906 457517 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021138.1 protein_id gnl|my_center|LOCUS_23330 458443 457907 gene locus_tag LOCUS_23340 458443 457907 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021137.1 protein_id gnl|my_center|LOCUS_23340 458996 458352 gene locus_tag LOCUS_23350 458996 458352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 459600 459178 gene locus_tag LOCUS_23360 459600 459178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 460475 459666 gene locus_tag LOCUS_23370 460475 459666 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065502.1 protein_id gnl|my_center|LOCUS_23370 460744 462150 gene locus_tag LOCUS_23380 460744 462150 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876966.1 protein_id gnl|my_center|LOCUS_23380 464232 462445 gene locus_tag LOCUS_23390 gene arcS 464232 462445 CDS product archaeosine synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024500.1 protein_id gnl|my_center|LOCUS_23390 465784 464393 gene locus_tag LOCUS_23400 gene tgtA 465784 464393 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024298.1 protein_id gnl|my_center|LOCUS_23400 465870 466361 gene locus_tag LOCUS_23410 465870 466361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 468376 466424 gene locus_tag LOCUS_23420 468376 466424 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393382.1 protein_id gnl|my_center|LOCUS_23420 468418 468570 gene locus_tag LOCUS_23430 468418 468570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 468866 470330 gene locus_tag LOCUS_r00040 468866 470330 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 470455 470527 gene locus_tag LOCUS_t00380 470455 470527 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 470666 473552 gene locus_tag LOCUS_r00050 470666 473552 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 473686 473803 gene locus_tag LOCUS_r00060 473686 473803 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 474525 474995 gene locus_tag LOCUS_23440 474525 474995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23440 474923 475351 gene locus_tag LOCUS_23450 474923 475351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23450 478630 475616 gene locus_tag LOCUS_23460 478630 475616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 481485 478627 gene locus_tag LOCUS_23470 481485 478627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 482155 481688 gene locus_tag LOCUS_23480 482155 481688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 482616 483059 gene locus_tag LOCUS_23490 482616 483059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909402.1 protein_id gnl|my_center|LOCUS_23490 483586 486276 gene locus_tag LOCUS_23500 483586 486276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 488067 489002 gene locus_tag LOCUS_23510 488067 489002 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022154.1 protein_id gnl|my_center|LOCUS_23510 489046 489318 gene locus_tag LOCUS_23520 489046 489318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 491231 491608 gene locus_tag LOCUS_23530 491231 491608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 491774 491893 gene locus_tag LOCUS_23540 491774 491893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 491919 492908 gene locus_tag LOCUS_23550 491919 492908 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808328.1 protein_id gnl|my_center|LOCUS_23550 492917 493588 gene locus_tag LOCUS_23560 492917 493588 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533115.1 protein_id gnl|my_center|LOCUS_23560 493566 493715 gene locus_tag LOCUS_23570 493566 493715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 >Feature sequence3 1034 765 gene locus_tag LOCUS_23580 1034 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23580 1321 1172 gene locus_tag LOCUS_23590 1321 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23590 2598 2452 gene locus_tag LOCUS_23600 2598 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 2911 2756 gene locus_tag LOCUS_23610 2911 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 4090 4015 gene locus_tag LOCUS_t00390 4090 4015 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 7835 7638 gene locus_tag LOCUS_23620 7835 7638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 9005 8760 gene locus_tag LOCUS_23630 9005 8760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 9524 9351 gene locus_tag LOCUS_23640 9524 9351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 10273 9755 gene locus_tag LOCUS_23650 10273 9755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23650 12492 12746 gene locus_tag LOCUS_23660 12492 12746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23660 14457 13660 gene locus_tag LOCUS_23670 14457 13660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 14755 17022 gene locus_tag LOCUS_23680 14755 17022 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878955.1 protein_id gnl|my_center|LOCUS_23680 18365 17625 gene locus_tag LOCUS_23690 18365 17625 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890732.1 protein_id gnl|my_center|LOCUS_23690 18778 18518 gene locus_tag LOCUS_23700 18778 18518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 19008 18847 gene locus_tag LOCUS_23710 19008 18847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 19222 19043 gene locus_tag LOCUS_23720 19222 19043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 19534 19625 gene locus_tag LOCUS_t00400 19534 19625 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 19756 20697 gene locus_tag LOCUS_23730 19756 20697 CDS product eukaryotic peptide chain release factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021302.1 protein_id gnl|my_center|LOCUS_23730 20802 21629 gene locus_tag LOCUS_23740 20802 21629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 22864 21803 gene locus_tag LOCUS_23750 gene cofH 22864 21803 CDS product 5-amino-6-(D-ribitylamino)uracil--L-tyrosine 4-hydroxyphenyl transferase CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878301.1 protein_id gnl|my_center|LOCUS_23750 23461 22973 gene locus_tag LOCUS_23760 23461 22973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902326.1 protein_id gnl|my_center|LOCUS_23760 24329 23424 gene locus_tag LOCUS_23770 24329 23424 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902327.1 protein_id gnl|my_center|LOCUS_23770 24469 24696 gene locus_tag LOCUS_23780 24469 24696 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011033302.1 protein_id gnl|my_center|LOCUS_23780 24827 25711 gene locus_tag LOCUS_23790 24827 25711 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064299.1 protein_id gnl|my_center|LOCUS_23790 26236 25832 gene locus_tag LOCUS_23800 26236 25832 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065151.1 protein_id gnl|my_center|LOCUS_23800 27775 26387 gene locus_tag LOCUS_23810 gene cfbB 27775 26387 CDS product Ni-sirohydrochlorin a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023534.1 protein_id gnl|my_center|LOCUS_23810 28454 27810 gene locus_tag LOCUS_23820 gene cfbC 28454 27810 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase ATP-dependent reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023535.1 protein_id gnl|my_center|LOCUS_23820 28401 28622 gene locus_tag LOCUS_23830 28401 28622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 28823 31792 gene locus_tag LOCUS_23840 28823 31792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 32379 31852 gene locus_tag LOCUS_23850 32379 31852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 32647 33717 gene locus_tag LOCUS_23860 32647 33717 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064840.1 protein_id gnl|my_center|LOCUS_23860 33830 35098 gene locus_tag LOCUS_23870 33830 35098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 35142 35705 gene locus_tag LOCUS_23880 35142 35705 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022955.1 protein_id gnl|my_center|LOCUS_23880 36206 35712 gene locus_tag LOCUS_23890 36206 35712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 36347 36706 gene locus_tag LOCUS_23900 36347 36706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 36914 37120 gene locus_tag LOCUS_23910 36914 37120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 37117 38712 gene locus_tag LOCUS_23920 37117 38712 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877458.1 protein_id gnl|my_center|LOCUS_23920 39928 38771 gene locus_tag LOCUS_23930 39928 38771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 40383 40168 gene locus_tag LOCUS_23940 40383 40168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 40614 40429 gene locus_tag LOCUS_23950 40614 40429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 40725 41396 gene locus_tag LOCUS_23960 40725 41396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 42741 41566 gene locus_tag LOCUS_23970 42741 41566 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024280.1 protein_id gnl|my_center|LOCUS_23970 43870 42773 gene locus_tag LOCUS_23980 43870 42773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 43945 44955 gene locus_tag LOCUS_23990 43945 44955 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021488.1 protein_id gnl|my_center|LOCUS_23990 45032 45466 gene locus_tag LOCUS_24000 45032 45466 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021802.1 protein_id gnl|my_center|LOCUS_24000 45706 46266 gene locus_tag LOCUS_24010 45706 46266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 47738 46344 gene locus_tag LOCUS_24020 47738 46344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 49649 47775 gene locus_tag LOCUS_24030 gene nuoF 49649 47775 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 protein_id gnl|my_center|LOCUS_24030 50345 49731 gene locus_tag LOCUS_24040 50345 49731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 51185 50829 gene locus_tag LOCUS_24050 51185 50829 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_24050 53286 51208 gene locus_tag LOCUS_24060 53286 51208 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 protein_id gnl|my_center|LOCUS_24060 53794 54573 gene locus_tag LOCUS_24070 53794 54573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 55433 54576 gene locus_tag LOCUS_24080 55433 54576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 55996 55430 gene locus_tag LOCUS_24090 55996 55430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 56654 55986 gene locus_tag LOCUS_24100 56654 55986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 58734 56644 gene locus_tag LOCUS_24110 58734 56644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 59560 59411 gene locus_tag LOCUS_24120 59560 59411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 59535 59789 gene locus_tag LOCUS_24130 59535 59789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 60116 59883 gene locus_tag LOCUS_24140 60116 59883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 61586 60513 gene locus_tag LOCUS_24150 61586 60513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868135.1 protein_id gnl|my_center|LOCUS_24150 61580 61747 gene locus_tag LOCUS_24160 61580 61747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 62316 61903 gene locus_tag LOCUS_24170 62316 61903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 62483 62304 gene locus_tag LOCUS_24180 62483 62304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 62698 62627 gene locus_tag LOCUS_t00410 62698 62627 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 63045 62776 gene locus_tag LOCUS_24190 63045 62776 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021485.1 protein_id gnl|my_center|LOCUS_24190 63870 63253 gene locus_tag LOCUS_24200 63870 63253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 64374 64796 gene locus_tag LOCUS_24210 64374 64796 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020172.1 protein_id gnl|my_center|LOCUS_24210 64865 66556 gene locus_tag LOCUS_24220 64865 66556 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064918.1 protein_id gnl|my_center|LOCUS_24220 67425 66691 gene locus_tag LOCUS_24230 67425 66691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 67971 67561 gene locus_tag LOCUS_24240 67971 67561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 68901 68320 gene locus_tag LOCUS_24250 68901 68320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 69762 69343 gene locus_tag LOCUS_24260 69762 69343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 70818 69880 gene locus_tag LOCUS_24270 70818 69880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 71031 71354 gene locus_tag LOCUS_24280 71031 71354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 72729 71527 gene locus_tag LOCUS_24290 72729 71527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 73810 73151 gene locus_tag LOCUS_24300 73810 73151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 74659 74462 gene locus_tag LOCUS_24310 74659 74462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 75266 74709 gene locus_tag LOCUS_24320 75266 74709 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020756.1 protein_id gnl|my_center|LOCUS_24320 76258 75347 gene locus_tag LOCUS_24330 76258 75347 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021005.1 protein_id gnl|my_center|LOCUS_24330 76405 76809 gene locus_tag LOCUS_24340 gene nuoA 76405 76809 CDS product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179273.1 protein_id gnl|my_center|LOCUS_24340 76800 77372 gene locus_tag LOCUS_24350 gene fpoB 76800 77372 CDS product F(420)H(2) dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021510.1 protein_id gnl|my_center|LOCUS_24350 77387 79099 gene locus_tag LOCUS_24360 77387 79099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 79112 80164 gene locus_tag LOCUS_24370 gene fpoH 79112 80164 CDS product F420H2 dehydrogenase subunit FpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065137.1 protein_id gnl|my_center|LOCUS_24370 80177 80758 gene locus_tag LOCUS_24380 80177 80758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 80758 81186 gene locus_tag LOCUS_24390 80758 81186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24390 81173 81436 gene locus_tag LOCUS_24400 81173 81436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 81475 81777 gene locus_tag LOCUS_24410 gene fpoK 81475 81777 CDS product F420H2 dehydrogenase subunit FpoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589525.1 protein_id gnl|my_center|LOCUS_24410 81781 83166 gene locus_tag LOCUS_24420 81781 83166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24420 83163 83792 gene locus_tag LOCUS_24430 83163 83792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24430 83789 85291 gene locus_tag LOCUS_24440 gene fpoM 83789 85291 CDS product F(420)H(2) dehydrogenase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021519.1 protein_id gnl|my_center|LOCUS_24440 85293 86795 gene locus_tag LOCUS_24450 gene fpoN 85293 86795 CDS product F(420)H(2) dehydrogenase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021520.1 protein_id gnl|my_center|LOCUS_24450 86892 88052 gene locus_tag LOCUS_24460 86892 88052 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022460.1 protein_id gnl|my_center|LOCUS_24460 88779 87976 gene locus_tag LOCUS_24470 88779 87976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 89098 89421 gene locus_tag LOCUS_24480 89098 89421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 92397 89467 gene locus_tag LOCUS_24490 gene uvrA 92397 89467 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023257.1 protein_id gnl|my_center|LOCUS_24490 93059 92424 gene locus_tag LOCUS_24500 93059 92424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 93165 93344 gene locus_tag LOCUS_24510 93165 93344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 93762 94784 gene locus_tag LOCUS_24520 gene cmr1 93762 94784 CDS product type III-B CRISPR module RAMP protein Cmr1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200855653.1 protein_id gnl|my_center|LOCUS_24520 94784 95977 gene locus_tag LOCUS_24530 94784 95977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 95974 98898 gene locus_tag LOCUS_24540 95974 98898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 99230 99976 gene locus_tag LOCUS_24550 99230 99976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 99966 100397 gene locus_tag LOCUS_24560 99966 100397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546344.1 protein_id gnl|my_center|LOCUS_24560 100400 101266 gene locus_tag LOCUS_24570 100400 101266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545127.1 protein_id gnl|my_center|LOCUS_24570 101908 102444 gene locus_tag LOCUS_24580 101908 102444 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979773.1 protein_id gnl|my_center|LOCUS_24580 102594 102872 gene locus_tag LOCUS_24590 102594 102872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 103005 104144 gene locus_tag LOCUS_24600 103005 104144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 105911 104517 gene locus_tag LOCUS_24610 gene hmgB 105911 104517 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903175.1 protein_id gnl|my_center|LOCUS_24610 106045 106263 gene locus_tag LOCUS_24620 106045 106263 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084181.1 protein_id gnl|my_center|LOCUS_24620 106435 106632 gene locus_tag LOCUS_24630 106435 106632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 108223 106649 gene locus_tag LOCUS_24640 108223 106649 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878560.1 protein_id gnl|my_center|LOCUS_24640 110441 108519 gene locus_tag LOCUS_24650 110441 108519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 111640 111236 gene locus_tag LOCUS_24660 111640 111236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 111946 111752 gene locus_tag LOCUS_24670 111946 111752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 112770 112003 gene locus_tag LOCUS_24680 112770 112003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 113377 112772 gene locus_tag LOCUS_24690 113377 112772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 113545 113982 gene locus_tag LOCUS_24700 113545 113982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24700 113951 114337 gene locus_tag LOCUS_24710 113951 114337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24710 114777 114568 gene locus_tag LOCUS_24720 114777 114568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 116976 115372 gene locus_tag LOCUS_24730 gene pyrG 116976 115372 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877763.1 protein_id gnl|my_center|LOCUS_24730 117138 116980 gene locus_tag LOCUS_24740 117138 116980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 117279 117542 gene locus_tag LOCUS_24750 117279 117542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 118201 117539 gene locus_tag LOCUS_24760 118201 117539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 118679 118437 gene locus_tag LOCUS_24770 118679 118437 CDS product methytransferase partner Trm112 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023214.1 protein_id gnl|my_center|LOCUS_24770 119816 118680 gene locus_tag LOCUS_24780 119816 118680 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065160.1 protein_id gnl|my_center|LOCUS_24780 121564 119873 gene locus_tag LOCUS_24790 121564 119873 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021597.1 protein_id gnl|my_center|LOCUS_24790 121956 121726 gene locus_tag LOCUS_24800 121956 121726 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021598.1 protein_id gnl|my_center|LOCUS_24800 122859 122005 gene locus_tag LOCUS_24810 122859 122005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 124090 122861 gene locus_tag LOCUS_24820 124090 122861 CDS product replication protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022958.1 protein_id gnl|my_center|LOCUS_24820 124456 125295 gene locus_tag LOCUS_24830 124456 125295 CDS product NOP5/NOP56 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902847.1 protein_id gnl|my_center|LOCUS_24830 125392 126000 gene locus_tag LOCUS_24840 125392 126000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 126977 126066 gene locus_tag LOCUS_24850 126977 126066 CDS product DUF2099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022219.1 protein_id gnl|my_center|LOCUS_24850 127184 128302 gene locus_tag LOCUS_24860 gene ftsZ 127184 128302 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064630.1 protein_id gnl|my_center|LOCUS_24860 128482 128790 gene locus_tag LOCUS_24870 128482 128790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289276.1 protein_id gnl|my_center|LOCUS_24870 128791 130428 gene locus_tag LOCUS_24880 128791 130428 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320246.1 protein_id gnl|my_center|LOCUS_24880 130425 131276 gene locus_tag LOCUS_24890 130425 131276 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249143.1 protein_id gnl|my_center|LOCUS_24890 131577 132422 gene locus_tag LOCUS_24900 131577 132422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 132374 132712 gene locus_tag LOCUS_24910 132374 132712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 132995 133468 gene locus_tag LOCUS_24920 132995 133468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 134572 133565 gene locus_tag LOCUS_24930 134572 133565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 135298 134615 gene locus_tag LOCUS_24940 135298 134615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 135180 135509 gene locus_tag LOCUS_24950 135180 135509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 136233 135487 gene locus_tag LOCUS_24960 136233 135487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 137278 136397 gene locus_tag LOCUS_24970 137278 136397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 137907 138230 gene locus_tag LOCUS_24980 137907 138230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 138154 138450 gene locus_tag LOCUS_24990 138154 138450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 138566 138835 gene locus_tag LOCUS_25000 138566 138835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 138855 139043 gene locus_tag LOCUS_25010 138855 139043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 140462 140289 gene locus_tag LOCUS_25020 140462 140289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25020