>Feature sequence01 747 391 gene locus_tag LOCUS_00010 747 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1545 799 gene locus_tag LOCUS_00020 1545 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2696 1542 gene locus_tag LOCUS_00030 2696 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2816 4477 gene locus_tag LOCUS_00040 2816 4477 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742163.1 protein_id gnl|my_center|LOCUS_00040 4513 5778 gene locus_tag LOCUS_00050 4513 5778 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879085.1 protein_id gnl|my_center|LOCUS_00050 5871 7418 gene locus_tag LOCUS_00060 5871 7418 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205720.1 protein_id gnl|my_center|LOCUS_00060 7415 9058 gene locus_tag LOCUS_00070 7415 9058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9219 10124 gene locus_tag LOCUS_00080 9219 10124 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876665.1 protein_id gnl|my_center|LOCUS_00080 11995 10169 gene locus_tag LOCUS_00090 11995 10169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 13694 12036 gene locus_tag LOCUS_00100 gene betA 13694 12036 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229316.1 protein_id gnl|my_center|LOCUS_00100 15258 13750 gene locus_tag LOCUS_00110 15258 13750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 15373 16560 gene locus_tag LOCUS_00120 15373 16560 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224141.1 protein_id gnl|my_center|LOCUS_00120 16557 17495 gene locus_tag LOCUS_00130 16557 17495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 17861 18682 gene locus_tag LOCUS_00140 17861 18682 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485830.1 protein_id gnl|my_center|LOCUS_00140 18774 19433 gene locus_tag LOCUS_00150 18774 19433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 19516 20874 gene locus_tag LOCUS_00160 19516 20874 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729414.1 protein_id gnl|my_center|LOCUS_00160 21216 20929 gene locus_tag LOCUS_00170 21216 20929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 21207 23717 gene locus_tag LOCUS_00180 21207 23717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 23764 24570 gene locus_tag LOCUS_00190 23764 24570 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893143.1 protein_id gnl|my_center|LOCUS_00190 26131 24596 gene locus_tag LOCUS_00200 26131 24596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 26263 27723 gene locus_tag LOCUS_00210 26263 27723 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224852.1 protein_id gnl|my_center|LOCUS_00210 28737 27784 gene locus_tag LOCUS_00220 28737 27784 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 protein_id gnl|my_center|LOCUS_00220 29594 28749 gene locus_tag LOCUS_00230 29594 28749 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265741.1 protein_id gnl|my_center|LOCUS_00230 29565 31031 gene locus_tag LOCUS_00240 29565 31031 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879446.1 protein_id gnl|my_center|LOCUS_00240 31089 31478 gene locus_tag LOCUS_00250 31089 31478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 31554 32048 gene locus_tag LOCUS_00260 31554 32048 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841351.1 protein_id gnl|my_center|LOCUS_00260 33003 32092 gene locus_tag LOCUS_00270 33003 32092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 33781 33047 gene locus_tag LOCUS_00280 33781 33047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 34800 33877 gene locus_tag LOCUS_00290 gene mca 34800 33877 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229824.1 protein_id gnl|my_center|LOCUS_00290 34966 35568 gene locus_tag LOCUS_00300 34966 35568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 35684 36859 gene locus_tag LOCUS_00310 35684 36859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 36890 37849 gene locus_tag LOCUS_00320 gene ctaG 36890 37849 CDS product cytochrome c oxidase assembly factor CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069023.1 protein_id gnl|my_center|LOCUS_00320 39082 37859 gene locus_tag LOCUS_00330 39082 37859 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021450.1 protein_id gnl|my_center|LOCUS_00330 39734 39180 gene locus_tag LOCUS_00340 39734 39180 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974128.1 protein_id gnl|my_center|LOCUS_00340 39753 41075 gene locus_tag LOCUS_00350 39753 41075 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031025.1 protein_id gnl|my_center|LOCUS_00350 41173 43869 gene locus_tag LOCUS_00360 41173 43869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 44367 43939 gene locus_tag LOCUS_00370 44367 43939 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230197.1 protein_id gnl|my_center|LOCUS_00370 44446 45072 gene locus_tag LOCUS_00380 44446 45072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 45784 45053 gene locus_tag LOCUS_00390 45784 45053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 46986 45916 gene locus_tag LOCUS_00400 46986 45916 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000369.1 protein_id gnl|my_center|LOCUS_00400 50298 47098 gene locus_tag LOCUS_00410 50298 47098 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222728.1 protein_id gnl|my_center|LOCUS_00410 51750 50764 gene locus_tag LOCUS_00420 51750 50764 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792329.1 protein_id gnl|my_center|LOCUS_00420 51795 52964 gene locus_tag LOCUS_00430 gene ktrB 51795 52964 CDS product Ktr system potassium transporter KtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243582.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00430 52915 53157 gene locus_tag LOCUS_00440 52915 53157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00440 53700 53260 gene locus_tag LOCUS_00450 53700 53260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 53651 53833 gene locus_tag LOCUS_00460 53651 53833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 53842 54573 gene locus_tag LOCUS_00470 53842 54573 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978056.1 protein_id gnl|my_center|LOCUS_00470 54642 54881 gene locus_tag LOCUS_00480 54642 54881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 54878 55282 gene locus_tag LOCUS_00490 54878 55282 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060114.1 protein_id gnl|my_center|LOCUS_00490 55463 56833 gene locus_tag LOCUS_00500 55463 56833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 57485 56961 gene locus_tag LOCUS_00510 57485 56961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 59528 59253 gene locus_tag LOCUS_00520 59528 59253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 61419 61210 gene locus_tag LOCUS_00530 61419 61210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00530 61981 62271 gene locus_tag LOCUS_00540 61981 62271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 63090 62860 gene locus_tag LOCUS_00550 63090 62860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 64656 64462 gene locus_tag LOCUS_00560 64656 64462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 64612 65106 gene locus_tag LOCUS_00570 64612 65106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00570 65757 65143 gene locus_tag LOCUS_00580 65757 65143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00580 66305 65757 gene locus_tag LOCUS_00590 66305 65757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00590 66489 66710 gene locus_tag LOCUS_00600 66489 66710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 67347 66760 gene locus_tag LOCUS_00610 67347 66760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 68375 69718 gene locus_tag LOCUS_00620 68375 69718 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479620.1 protein_id gnl|my_center|LOCUS_00620 69867 69607 gene locus_tag LOCUS_00630 69867 69607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 69836 70240 gene locus_tag LOCUS_00640 69836 70240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 70240 70806 gene locus_tag LOCUS_00650 70240 70806 CDS product calcium homeostasis/redox stress adaptation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976436.1 protein_id gnl|my_center|LOCUS_00650 71796 72647 gene locus_tag LOCUS_00660 71796 72647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 72661 75441 gene locus_tag LOCUS_00670 72661 75441 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183697638.1 protein_id gnl|my_center|LOCUS_00670 76552 75452 gene locus_tag LOCUS_00680 76552 75452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00680 77787 76549 gene locus_tag LOCUS_00690 77787 76549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00690 79027 77831 gene locus_tag LOCUS_00700 79027 77831 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028308.1 protein_id gnl|my_center|LOCUS_00700 80406 79036 gene locus_tag LOCUS_00710 80406 79036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 81011 80433 gene locus_tag LOCUS_00720 81011 80433 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888851.1 protein_id gnl|my_center|LOCUS_00720 81481 82056 gene locus_tag LOCUS_00730 81481 82056 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888851.1 protein_id gnl|my_center|LOCUS_00730 82056 82622 gene locus_tag LOCUS_00740 82056 82622 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480360.1 protein_id gnl|my_center|LOCUS_00740 83974 82715 gene locus_tag LOCUS_00750 83974 82715 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029925.1 protein_id gnl|my_center|LOCUS_00750 85046 83958 gene locus_tag LOCUS_00760 85046 83958 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224327.1 protein_id gnl|my_center|LOCUS_00760 85213 86205 gene locus_tag LOCUS_00770 gene rarD 85213 86205 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029749.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00770 86269 88140 gene locus_tag LOCUS_00780 86269 88140 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404064.1 protein_id gnl|my_center|LOCUS_00780 88257 88703 gene locus_tag LOCUS_00790 88257 88703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 89320 88721 gene locus_tag LOCUS_00800 89320 88721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 90866 89466 gene locus_tag LOCUS_00810 90866 89466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 91610 90870 gene locus_tag LOCUS_00820 91610 90870 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230358.1 protein_id gnl|my_center|LOCUS_00820 93272 91659 gene locus_tag LOCUS_00830 93272 91659 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285994.1 protein_id gnl|my_center|LOCUS_00830 94281 93349 gene locus_tag LOCUS_00840 94281 93349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 94377 95381 gene locus_tag LOCUS_00850 94377 95381 CDS product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101381.1 protein_id gnl|my_center|LOCUS_00850 95410 96570 gene locus_tag LOCUS_00860 95410 96570 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409667.1 protein_id gnl|my_center|LOCUS_00860 97443 96613 gene locus_tag LOCUS_00870 97443 96613 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703884.1 protein_id gnl|my_center|LOCUS_00870 97720 98535 gene locus_tag LOCUS_00880 97720 98535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 98566 98862 gene locus_tag LOCUS_00890 98566 98862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 99199 98855 gene locus_tag LOCUS_00900 99199 98855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 99823 99218 gene locus_tag LOCUS_00910 99823 99218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 100020 100625 gene locus_tag LOCUS_00920 100020 100625 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140910.1 protein_id gnl|my_center|LOCUS_00920 100688 102256 gene locus_tag LOCUS_00930 100688 102256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 102657 102286 gene locus_tag LOCUS_00940 102657 102286 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730014.1 protein_id gnl|my_center|LOCUS_00940 103316 102726 gene locus_tag LOCUS_00950 103316 102726 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030525.1 protein_id gnl|my_center|LOCUS_00950 104001 103318 gene locus_tag LOCUS_00960 104001 103318 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977459.1 protein_id gnl|my_center|LOCUS_00960 105133 104048 gene locus_tag LOCUS_00970 105133 104048 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027750.1 protein_id gnl|my_center|LOCUS_00970 105559 105290 gene locus_tag LOCUS_00980 105559 105290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00980 106404 105946 gene locus_tag LOCUS_00990 106404 105946 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313409.1 protein_id gnl|my_center|LOCUS_00990 106468 107106 gene locus_tag LOCUS_01000 106468 107106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 107482 107150 gene locus_tag LOCUS_01010 107482 107150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 108452 107502 gene locus_tag LOCUS_01020 108452 107502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 109197 108475 gene locus_tag LOCUS_01030 109197 108475 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030471.1 protein_id gnl|my_center|LOCUS_01030 109627 109190 gene locus_tag LOCUS_01040 109627 109190 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258944.1 protein_id gnl|my_center|LOCUS_01040 109666 110307 gene locus_tag LOCUS_01050 109666 110307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 112616 110421 gene locus_tag LOCUS_01060 112616 110421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 113616 112609 gene locus_tag LOCUS_01070 113616 112609 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061547.1 protein_id gnl|my_center|LOCUS_01070 113784 114395 gene locus_tag LOCUS_01080 113784 114395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 114406 115224 gene locus_tag LOCUS_01090 114406 115224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 116114 115236 gene locus_tag LOCUS_01100 116114 115236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 116575 116147 gene locus_tag LOCUS_01110 116575 116147 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903622.1 protein_id gnl|my_center|LOCUS_01110 116818 117600 gene locus_tag LOCUS_01120 116818 117600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 117653 118300 gene locus_tag LOCUS_01130 117653 118300 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080706.1 protein_id gnl|my_center|LOCUS_01130 118294 119799 gene locus_tag LOCUS_01140 gene gltX 118294 119799 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973448.1 protein_id gnl|my_center|LOCUS_01140 119796 120404 gene locus_tag LOCUS_01150 119796 120404 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228374.1 protein_id gnl|my_center|LOCUS_01150 120497 120569 gene locus_tag LOCUS_t00010 120497 120569 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 120647 120720 gene locus_tag LOCUS_t00020 120647 120720 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 120873 122132 gene locus_tag LOCUS_01160 120873 122132 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080004.1 protein_id gnl|my_center|LOCUS_01160 122125 122535 gene locus_tag LOCUS_01170 122125 122535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 122604 123611 gene locus_tag LOCUS_01180 122604 123611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 124029 123634 gene locus_tag LOCUS_01190 124029 123634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 125871 124246 gene locus_tag LOCUS_01200 gene cimA 125871 124246 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223593.1 protein_id gnl|my_center|LOCUS_01200 126782 125868 gene locus_tag LOCUS_01210 126782 125868 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065043.1 protein_id gnl|my_center|LOCUS_01210 127903 126833 gene locus_tag LOCUS_01220 127903 126833 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899576.1 protein_id gnl|my_center|LOCUS_01220 128124 128597 gene locus_tag LOCUS_01230 gene greA 128124 128597 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776308.1 protein_id gnl|my_center|LOCUS_01230 128699 129076 gene locus_tag LOCUS_01240 gene mscL 128699 129076 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267011.1 protein_id gnl|my_center|LOCUS_01240 130725 129109 gene locus_tag LOCUS_01250 130725 129109 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249635.1 protein_id gnl|my_center|LOCUS_01250 130816 131862 gene locus_tag LOCUS_01260 gene rsgA 130816 131862 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030687.1 protein_id gnl|my_center|LOCUS_01260 131963 132874 gene locus_tag LOCUS_01270 131963 132874 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094646.1 protein_id gnl|my_center|LOCUS_01270 134357 132921 gene locus_tag LOCUS_01280 134357 132921 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_01280 135024 134350 gene locus_tag LOCUS_01290 gene ndgR 135024 134350 CDS product IclR family transcriptional regulator NdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030305.1 protein_id gnl|my_center|LOCUS_01290 135209 136567 gene locus_tag LOCUS_01300 gene leuC 135209 136567 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973442.1 protein_id gnl|my_center|LOCUS_01300 136636 137238 gene locus_tag LOCUS_01310 gene leuD 136636 137238 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030306.1 protein_id gnl|my_center|LOCUS_01310 137278 138123 gene locus_tag LOCUS_01320 137278 138123 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_01320 139084 138158 gene locus_tag LOCUS_01330 139084 138158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 140872 139310 gene locus_tag LOCUS_01340 gene serA 140872 139310 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973481.1 protein_id gnl|my_center|LOCUS_01340 141009 142490 gene locus_tag LOCUS_01350 141009 142490 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862091.1 protein_id gnl|my_center|LOCUS_01350 143315 142539 gene locus_tag LOCUS_01360 143315 142539 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225418.1 protein_id gnl|my_center|LOCUS_01360 143390 144286 gene locus_tag LOCUS_01370 143390 144286 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111794.1 protein_id gnl|my_center|LOCUS_01370 145393 144359 gene locus_tag LOCUS_01380 gene galE 145393 144359 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975823.1 protein_id gnl|my_center|LOCUS_01380 146050 145403 gene locus_tag LOCUS_01390 146050 145403 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327623.1 protein_id gnl|my_center|LOCUS_01390 146104 147816 gene locus_tag LOCUS_01400 146104 147816 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228394.1 protein_id gnl|my_center|LOCUS_01400 147818 148279 gene locus_tag LOCUS_01410 147818 148279 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846721.1 protein_id gnl|my_center|LOCUS_01410 148404 148850 gene locus_tag LOCUS_01420 148404 148850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 149533 148865 gene locus_tag LOCUS_01430 149533 148865 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314885.1 protein_id gnl|my_center|LOCUS_01430 150642 149644 gene locus_tag LOCUS_01440 150642 149644 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726658.1 protein_id gnl|my_center|LOCUS_01440 151777 150725 gene locus_tag LOCUS_01450 151777 150725 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229459.1 protein_id gnl|my_center|LOCUS_01450 152266 151841 gene locus_tag LOCUS_01460 152266 151841 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028660.1 protein_id gnl|my_center|LOCUS_01460 152312 152791 gene locus_tag LOCUS_01470 gene smpB 152312 152791 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728144.1 protein_id gnl|my_center|LOCUS_01470 152788 153609 gene locus_tag LOCUS_01480 152788 153609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 153726 154108 gene locus_tag LOCUS_tm00010 153726 154108 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 156016 154148 gene locus_tag LOCUS_01490 156016 154148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 156122 156868 gene locus_tag LOCUS_01500 156122 156868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 157761 156865 gene locus_tag LOCUS_01510 gene ftsX 157761 156865 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198720.1 protein_id gnl|my_center|LOCUS_01510 158513 157836 gene locus_tag LOCUS_01520 gene ftsE 158513 157836 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_01520 159738 158632 gene locus_tag LOCUS_01530 gene prfB 159738 158632 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101777569.1 protein_id gnl|my_center|LOCUS_01530 162540 159799 gene locus_tag LOCUS_01540 gene secA 162540 159799 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390085.1 protein_id gnl|my_center|LOCUS_01540 163162 162554 gene locus_tag LOCUS_01550 163162 162554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 163577 163323 gene locus_tag LOCUS_01560 gene rpmA 163577 163323 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669471.1 protein_id gnl|my_center|LOCUS_01560 163898 163593 gene locus_tag LOCUS_01570 gene rplU 163898 163593 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859302.1 protein_id gnl|my_center|LOCUS_01570 165752 163974 gene locus_tag LOCUS_01580 165752 163974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 166457 165765 gene locus_tag LOCUS_01590 166457 165765 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392092.1 protein_id gnl|my_center|LOCUS_01590 168442 166460 gene locus_tag LOCUS_01600 168442 166460 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976193.1 protein_id gnl|my_center|LOCUS_01600 169663 168503 gene locus_tag LOCUS_01610 gene rodA 169663 168503 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_01610 171771 169660 gene locus_tag LOCUS_01620 gene mrdA 171771 169660 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028453.1 protein_id gnl|my_center|LOCUS_01620 172353 171850 gene locus_tag LOCUS_01630 gene mreD 172353 171850 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392076.1 protein_id gnl|my_center|LOCUS_01630 173433 172372 gene locus_tag LOCUS_01640 173433 172372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 174475 173444 gene locus_tag LOCUS_01650 174475 173444 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_01650 175098 174691 gene locus_tag LOCUS_01660 gene ndk 175098 174691 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227764.1 protein_id gnl|my_center|LOCUS_01660 176571 175198 gene locus_tag LOCUS_01670 176571 175198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 177917 176613 gene locus_tag LOCUS_01680 gene clpX 177917 176613 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004562779.1 protein_id gnl|my_center|LOCUS_01680 178744 178052 gene locus_tag LOCUS_01690 gene clpP 178744 178052 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925383.1 protein_id gnl|my_center|LOCUS_01690 180239 178746 gene locus_tag LOCUS_01700 gene tig 180239 178746 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730000.1 protein_id gnl|my_center|LOCUS_01700 180539 180252 gene locus_tag LOCUS_01710 180539 180252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 180642 180716 gene locus_tag LOCUS_t00030 180642 180716 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 180799 181041 gene locus_tag LOCUS_01720 180799 181041 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058264.1 protein_id gnl|my_center|LOCUS_01720 181141 181213 gene locus_tag LOCUS_t00040 181141 181213 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 181532 181266 gene locus_tag LOCUS_01730 181532 181266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 182245 181580 gene locus_tag LOCUS_01740 182245 181580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01740 182742 182224 gene locus_tag LOCUS_01750 182742 182224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01750 182838 183986 gene locus_tag LOCUS_01760 182838 183986 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413981.1 protein_id gnl|my_center|LOCUS_01760 184098 184817 gene locus_tag LOCUS_01770 184098 184817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 184814 185806 gene locus_tag LOCUS_01780 184814 185806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 186013 185939 gene locus_tag LOCUS_t00050 186013 185939 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 186222 187877 gene locus_tag LOCUS_01790 186222 187877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 187958 188034 gene locus_tag LOCUS_t00060 187958 188034 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 188161 188235 gene locus_tag LOCUS_t00070 188161 188235 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 188706 188383 gene locus_tag LOCUS_01800 188706 188383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 188693 188890 gene locus_tag LOCUS_01810 188693 188890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 188978 189328 gene locus_tag LOCUS_01820 188978 189328 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079890.1 protein_id gnl|my_center|LOCUS_01820 190346 189345 gene locus_tag LOCUS_01830 190346 189345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 191950 190394 gene locus_tag LOCUS_01840 191950 190394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 191976 192137 gene locus_tag LOCUS_01850 191976 192137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 192320 192835 gene locus_tag LOCUS_01860 192320 192835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 192918 193103 gene locus_tag LOCUS_01870 192918 193103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 193214 194389 gene locus_tag LOCUS_01880 193214 194389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 194376 195401 gene locus_tag LOCUS_01890 194376 195401 CDS product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404642.1 protein_id gnl|my_center|LOCUS_01890 196170 195367 gene locus_tag LOCUS_01900 196170 195367 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965824.1 protein_id gnl|my_center|LOCUS_01900 197018 196167 gene locus_tag LOCUS_01910 197018 196167 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230213.1 protein_id gnl|my_center|LOCUS_01910 197097 197717 gene locus_tag LOCUS_01920 197097 197717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 198878 197736 gene locus_tag LOCUS_01930 198878 197736 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030522.1 protein_id gnl|my_center|LOCUS_01930 198759 198980 gene locus_tag LOCUS_01940 198759 198980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 198985 199743 gene locus_tag LOCUS_01950 gene rpe 198985 199743 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975097.1 protein_id gnl|my_center|LOCUS_01950 200377 199760 gene locus_tag LOCUS_01960 200377 199760 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859220.1 protein_id gnl|my_center|LOCUS_01960 200549 200634 gene locus_tag LOCUS_t00080 200549 200634 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 201695 200679 gene locus_tag LOCUS_01970 201695 200679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 202394 201813 gene locus_tag LOCUS_01980 202394 201813 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028487.1 protein_id gnl|my_center|LOCUS_01980 203141 202449 gene locus_tag LOCUS_01990 gene rdgB 203141 202449 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940412.1 protein_id gnl|my_center|LOCUS_01990 203953 203198 gene locus_tag LOCUS_02000 gene rph 203953 203198 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908180.1 protein_id gnl|my_center|LOCUS_02000 204695 203967 gene locus_tag LOCUS_02010 204695 203967 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229453.1 protein_id gnl|my_center|LOCUS_02010 206993 204837 gene locus_tag LOCUS_02020 206993 204837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 208248 207046 gene locus_tag LOCUS_02030 208248 207046 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_02030 208347 209510 gene locus_tag LOCUS_02040 gene serC 208347 209510 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029607.1 protein_id gnl|my_center|LOCUS_02040 210159 209512 gene locus_tag LOCUS_02050 210159 209512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 210294 212102 gene locus_tag LOCUS_02060 210294 212102 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_02060 212159 212947 gene locus_tag LOCUS_02070 212159 212947 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222909.1 protein_id gnl|my_center|LOCUS_02070 213002 213292 gene locus_tag LOCUS_02080 213002 213292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 214636 213311 gene locus_tag LOCUS_02090 214636 213311 CDS product bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229668.1 protein_id gnl|my_center|LOCUS_02090 214765 215508 gene locus_tag LOCUS_02100 214765 215508 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081822.1 protein_id gnl|my_center|LOCUS_02100 215505 216059 gene locus_tag LOCUS_02110 215505 216059 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256351.1 protein_id gnl|my_center|LOCUS_02110 216991 216089 gene locus_tag LOCUS_02120 216991 216089 CDS product TIGR03564 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205660833.1 protein_id gnl|my_center|LOCUS_02120 218154 217114 gene locus_tag LOCUS_02130 gene ilvC 218154 217114 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031465.1 protein_id gnl|my_center|LOCUS_02130 218398 219237 gene locus_tag LOCUS_02140 218398 219237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 219357 220175 gene locus_tag LOCUS_02150 219357 220175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 220698 220195 gene locus_tag LOCUS_02160 gene ilvN 220698 220195 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003080760.1 protein_id gnl|my_center|LOCUS_02160 222548 220698 gene locus_tag LOCUS_02170 222548 220698 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973484.1 protein_id gnl|my_center|LOCUS_02170 222850 223566 gene locus_tag LOCUS_02180 222850 223566 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947958.1 protein_id gnl|my_center|LOCUS_02180 223828 224082 gene locus_tag LOCUS_02190 223828 224082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 225790 224123 gene locus_tag LOCUS_02200 225790 224123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 226548 225787 gene locus_tag LOCUS_02210 226548 225787 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029631.1 protein_id gnl|my_center|LOCUS_02210 227087 226608 gene locus_tag LOCUS_02220 227087 226608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 227143 227766 gene locus_tag LOCUS_02230 227143 227766 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242965.1 protein_id gnl|my_center|LOCUS_02230 227874 228383 gene locus_tag LOCUS_02240 227874 228383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02240 228585 228899 gene locus_tag LOCUS_02250 228585 228899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 229666 229965 gene locus_tag LOCUS_02260 229666 229965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 230450 229998 gene locus_tag LOCUS_02270 230450 229998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 230836 231489 gene locus_tag LOCUS_02280 230836 231489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02280 231517 231792 gene locus_tag LOCUS_02290 231517 231792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 232542 231913 gene locus_tag LOCUS_02300 232542 231913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02300 233388 232699 gene locus_tag LOCUS_02310 233388 232699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02310 233938 233381 gene locus_tag LOCUS_02320 233938 233381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 234363 234073 gene locus_tag LOCUS_02330 234363 234073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 235834 234296 gene locus_tag LOCUS_02340 235834 234296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 236139 235840 gene locus_tag LOCUS_02350 236139 235840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 236934 236218 gene locus_tag LOCUS_02360 236934 236218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 237741 237247 gene locus_tag LOCUS_02370 237741 237247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 238332 240062 gene locus_tag LOCUS_02380 238332 240062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02380 240028 241686 gene locus_tag LOCUS_02390 240028 241686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02390 241898 241737 gene locus_tag LOCUS_02400 241898 241737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 242376 242071 gene locus_tag LOCUS_02410 242376 242071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 242553 242425 gene locus_tag LOCUS_02420 242553 242425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 243478 242525 gene locus_tag LOCUS_02430 243478 242525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 245568 243604 gene locus_tag LOCUS_02440 245568 243604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 247086 245572 gene locus_tag LOCUS_02450 247086 245572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 247273 247413 gene locus_tag LOCUS_02460 247273 247413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 247566 247820 gene locus_tag LOCUS_02470 247566 247820 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403244.1 protein_id gnl|my_center|LOCUS_02470 247814 248239 gene locus_tag LOCUS_02480 247814 248239 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403246.1 protein_id gnl|my_center|LOCUS_02480 249267 248347 gene locus_tag LOCUS_02490 249267 248347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02490 250041 249277 gene locus_tag LOCUS_02500 250041 249277 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227029.1 protein_id gnl|my_center|LOCUS_02500 250346 251257 gene locus_tag LOCUS_02510 250346 251257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 252149 251331 gene locus_tag LOCUS_02520 252149 251331 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039137.1 protein_id gnl|my_center|LOCUS_02520 253028 252168 gene locus_tag LOCUS_02530 253028 252168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 254313 253060 gene locus_tag LOCUS_02540 254313 253060 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877816.1 protein_id gnl|my_center|LOCUS_02540 256138 254345 gene locus_tag LOCUS_02550 256138 254345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 257621 256116 gene locus_tag LOCUS_02560 257621 256116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 259105 257678 gene locus_tag LOCUS_02570 gene lpdA 259105 257678 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873385.1 protein_id gnl|my_center|LOCUS_02570 259364 261283 gene locus_tag LOCUS_02580 259364 261283 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730604.1 protein_id gnl|my_center|LOCUS_02580 261329 262240 gene locus_tag LOCUS_02590 261329 262240 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870932.1 protein_id gnl|my_center|LOCUS_02590 262334 262768 gene locus_tag LOCUS_02600 262334 262768 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079984.1 protein_id gnl|my_center|LOCUS_02600 262768 263412 gene locus_tag LOCUS_02610 262768 263412 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640373.1 protein_id gnl|my_center|LOCUS_02610 263765 263457 gene locus_tag LOCUS_02620 263765 263457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 265482 264013 gene locus_tag LOCUS_02630 265482 264013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 266343 265558 gene locus_tag LOCUS_02640 266343 265558 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891557.1 protein_id gnl|my_center|LOCUS_02640 269896 266432 gene locus_tag LOCUS_02650 269896 266432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 270902 269982 gene locus_tag LOCUS_02660 270902 269982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 273744 271000 gene locus_tag LOCUS_02670 gene aceE 273744 271000 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976432.1 protein_id gnl|my_center|LOCUS_02670 274592 273834 gene locus_tag LOCUS_02680 274592 273834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 274862 274644 gene locus_tag LOCUS_02690 274862 274644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 275361 274909 gene locus_tag LOCUS_02700 275361 274909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 276533 275418 gene locus_tag LOCUS_02710 276533 275418 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225715.1 protein_id gnl|my_center|LOCUS_02710 276699 276995 gene locus_tag LOCUS_02720 276699 276995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 276992 277411 gene locus_tag LOCUS_02730 276992 277411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 278062 277466 gene locus_tag LOCUS_02740 gene tpx 278062 277466 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894924.1 protein_id gnl|my_center|LOCUS_02740 279631 278081 gene locus_tag LOCUS_02750 gene cysS 279631 278081 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_02750 279739 280365 gene locus_tag LOCUS_02760 279739 280365 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976859.1 protein_id gnl|my_center|LOCUS_02760 280498 281754 gene locus_tag LOCUS_02770 280498 281754 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259320.1 protein_id gnl|my_center|LOCUS_02770 281820 282305 gene locus_tag LOCUS_02780 281820 282305 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_02780 284343 282331 gene locus_tag LOCUS_02790 284343 282331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 284405 285964 gene locus_tag LOCUS_02800 gene guaB 284405 285964 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080651.1 protein_id gnl|my_center|LOCUS_02800 286048 287091 gene locus_tag LOCUS_02810 286048 287091 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728397.1 protein_id gnl|my_center|LOCUS_02810 287452 287132 gene locus_tag LOCUS_02820 287452 287132 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528817.1 protein_id gnl|my_center|LOCUS_02820 287755 290262 gene locus_tag LOCUS_02830 287755 290262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 290395 291432 gene locus_tag LOCUS_02840 290395 291432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 291508 292041 gene locus_tag LOCUS_02850 291508 292041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870791.1 protein_id gnl|my_center|LOCUS_02850 292099 293955 gene locus_tag LOCUS_02860 292099 293955 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144121.1 protein_id gnl|my_center|LOCUS_02860 295438 294020 gene locus_tag LOCUS_02870 295438 294020 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972723.1 protein_id gnl|my_center|LOCUS_02870 295750 295514 gene locus_tag LOCUS_02880 295750 295514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 296341 295811 gene locus_tag LOCUS_02890 296341 295811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 296667 296320 gene locus_tag LOCUS_02900 296667 296320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 296800 297309 gene locus_tag LOCUS_02910 296800 297309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 297872 297342 gene locus_tag LOCUS_02920 297872 297342 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223643.1 protein_id gnl|my_center|LOCUS_02920 298431 297877 gene locus_tag LOCUS_02930 298431 297877 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224396.1 protein_id gnl|my_center|LOCUS_02930 299485 298517 gene locus_tag LOCUS_02940 299485 298517 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_02940 299721 301169 gene locus_tag LOCUS_02950 299721 301169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 301166 301501 gene locus_tag LOCUS_02960 301166 301501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 301523 301762 gene locus_tag LOCUS_02970 301523 301762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 301788 302096 gene locus_tag LOCUS_02980 301788 302096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 302195 303637 gene locus_tag LOCUS_02990 302195 303637 CDS product lipase maturation factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893142.1 protein_id gnl|my_center|LOCUS_02990 304032 303622 gene locus_tag LOCUS_03000 304032 303622 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223930.1 protein_id gnl|my_center|LOCUS_03000 304913 304089 gene locus_tag LOCUS_03010 304913 304089 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223929.1 protein_id gnl|my_center|LOCUS_03010 305852 304935 gene locus_tag LOCUS_03020 305852 304935 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257325.1 protein_id gnl|my_center|LOCUS_03020 306697 305849 gene locus_tag LOCUS_03030 306697 305849 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417461.1 protein_id gnl|my_center|LOCUS_03030 308715 306829 gene locus_tag LOCUS_03040 308715 306829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 308914 310530 gene locus_tag LOCUS_03050 308914 310530 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274139.1 protein_id gnl|my_center|LOCUS_03050 312930 310933 gene locus_tag LOCUS_03060 312930 310933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 313099 313266 gene locus_tag LOCUS_03070 313099 313266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 313236 313787 gene locus_tag LOCUS_03080 313236 313787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 314469 313768 gene locus_tag LOCUS_03090 314469 313768 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222893.1 protein_id gnl|my_center|LOCUS_03090 316559 314469 gene locus_tag LOCUS_03100 316559 314469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 316688 317572 gene locus_tag LOCUS_03110 316688 317572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 317584 317853 gene locus_tag LOCUS_03120 317584 317853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 318210 317926 gene locus_tag LOCUS_03130 318210 317926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 318524 318231 gene locus_tag LOCUS_03140 318524 318231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03140 318881 318543 gene locus_tag LOCUS_03150 318881 318543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 319121 320065 gene locus_tag LOCUS_03160 319121 320065 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931024.1 protein_id gnl|my_center|LOCUS_03160 320544 320257 gene locus_tag LOCUS_03170 320544 320257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 320739 321341 gene locus_tag LOCUS_03180 320739 321341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 321484 322182 gene locus_tag LOCUS_03190 321484 322182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 323932 322514 gene locus_tag LOCUS_03200 323932 322514 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531929.1 protein_id gnl|my_center|LOCUS_03200 325381 324278 gene locus_tag LOCUS_03210 325381 324278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971889.1 protein_id gnl|my_center|LOCUS_03210 325552 326910 gene locus_tag LOCUS_03220 325552 326910 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_03220 328852 326945 gene locus_tag LOCUS_03230 328852 326945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 328978 329781 gene locus_tag LOCUS_03240 328978 329781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 329820 330245 gene locus_tag LOCUS_03250 329820 330245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 330277 330585 gene locus_tag LOCUS_03260 330277 330585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 330788 331240 gene locus_tag LOCUS_03270 330788 331240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 331808 332329 gene locus_tag LOCUS_03280 331808 332329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 332986 333180 gene locus_tag LOCUS_03290 332986 333180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 333660 334235 gene locus_tag LOCUS_03300 333660 334235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 334441 334656 gene locus_tag LOCUS_03310 334441 334656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 335678 334932 gene locus_tag LOCUS_03320 335678 334932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 335923 336351 gene locus_tag LOCUS_03330 335923 336351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 336439 338109 gene locus_tag LOCUS_03340 336439 338109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 338776 338318 gene locus_tag LOCUS_03350 338776 338318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 339045 338776 gene locus_tag LOCUS_03360 339045 338776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 339659 339246 gene locus_tag LOCUS_03370 339659 339246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410114.1 protein_id gnl|my_center|LOCUS_03370 340356 339634 gene locus_tag LOCUS_03380 340356 339634 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410108.1 protein_id gnl|my_center|LOCUS_03380 340783 340406 gene locus_tag LOCUS_03390 340783 340406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 341764 341498 gene locus_tag LOCUS_03400 341764 341498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 342341 341877 gene locus_tag LOCUS_03410 342341 341877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 342861 343199 gene locus_tag LOCUS_03420 342861 343199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 343385 345466 gene locus_tag LOCUS_03430 343385 345466 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918506.1 protein_id gnl|my_center|LOCUS_03430 345778 346089 gene locus_tag LOCUS_03440 345778 346089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 348277 350145 gene locus_tag LOCUS_03450 348277 350145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03450 350664 350170 gene locus_tag LOCUS_03460 350664 350170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 351169 350654 gene locus_tag LOCUS_03470 351169 350654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 351265 351435 gene locus_tag LOCUS_03480 351265 351435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 351662 351432 gene locus_tag LOCUS_03490 351662 351432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 351805 351969 gene locus_tag LOCUS_03500 351805 351969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 352446 352042 gene locus_tag LOCUS_03510 352446 352042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 352342 352632 gene locus_tag LOCUS_03520 352342 352632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 352962 354161 gene locus_tag LOCUS_03530 352962 354161 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_03530 356817 354277 gene locus_tag LOCUS_03540 356817 354277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 356906 357052 gene locus_tag LOCUS_03550 356906 357052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 357081 357218 gene locus_tag LOCUS_03560 357081 357218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 357660 357259 gene locus_tag LOCUS_03570 357660 357259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 358316 359455 gene locus_tag LOCUS_03580 358316 359455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 359528 359773 gene locus_tag LOCUS_03590 359528 359773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 359963 360397 gene locus_tag LOCUS_03600 359963 360397 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974357.1 protein_id gnl|my_center|LOCUS_03600 360410 361099 gene locus_tag LOCUS_03610 360410 361099 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113386.1 protein_id gnl|my_center|LOCUS_03610 361416 361240 gene locus_tag LOCUS_03620 361416 361240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 361539 362375 gene locus_tag LOCUS_03630 361539 362375 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898616.1 protein_id gnl|my_center|LOCUS_03630 362442 364145 gene locus_tag LOCUS_03640 362442 364145 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879591.1 protein_id gnl|my_center|LOCUS_03640 364621 365178 gene locus_tag LOCUS_03650 364621 365178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03650 365881 365666 gene locus_tag LOCUS_03660 365881 365666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 366166 367101 gene locus_tag LOCUS_03670 366166 367101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 367467 367207 gene locus_tag LOCUS_03680 367467 367207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 370193 368067 gene locus_tag LOCUS_03690 370193 368067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 370623 370186 gene locus_tag LOCUS_03700 370623 370186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 371008 372135 gene locus_tag LOCUS_03710 371008 372135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 372164 373018 gene locus_tag LOCUS_03720 gene ppk2 372164 373018 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460167.1 protein_id gnl|my_center|LOCUS_03720 377474 373065 gene locus_tag LOCUS_03730 377474 373065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 379972 377519 gene locus_tag LOCUS_03740 379972 377519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 381147 379987 gene locus_tag LOCUS_03750 381147 379987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 382961 381144 gene locus_tag LOCUS_03760 382961 381144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 384506 383031 gene locus_tag LOCUS_03770 384506 383031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 384621 386342 gene locus_tag LOCUS_03780 384621 386342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 386339 387592 gene locus_tag LOCUS_03790 386339 387592 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401260.1 protein_id gnl|my_center|LOCUS_03790 387589 388407 gene locus_tag LOCUS_03800 387589 388407 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897816.1 protein_id gnl|my_center|LOCUS_03800 388933 388463 gene locus_tag LOCUS_03810 388933 388463 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081451.1 protein_id gnl|my_center|LOCUS_03810 389853 389026 gene locus_tag LOCUS_03820 389853 389026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 389984 390466 gene locus_tag LOCUS_03830 389984 390466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 391942 390509 gene locus_tag LOCUS_03840 391942 390509 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326400.1 protein_id gnl|my_center|LOCUS_03840 392115 393293 gene locus_tag LOCUS_03850 392115 393293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 393755 393342 gene locus_tag LOCUS_03860 393755 393342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 394534 393812 gene locus_tag LOCUS_03870 394534 393812 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976828.1 protein_id gnl|my_center|LOCUS_03870 394636 395331 gene locus_tag LOCUS_03880 394636 395331 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014086.1 protein_id gnl|my_center|LOCUS_03880 395385 395864 gene locus_tag LOCUS_03890 395385 395864 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257527.1 protein_id gnl|my_center|LOCUS_03890 395879 396616 gene locus_tag LOCUS_03900 395879 396616 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257528.1 protein_id gnl|my_center|LOCUS_03900 397610 396630 gene locus_tag LOCUS_03910 397610 396630 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027564.1 protein_id gnl|my_center|LOCUS_03910 398574 397621 gene locus_tag LOCUS_03920 398574 397621 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_03920 398510 399604 gene locus_tag LOCUS_03930 398510 399604 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030131.1 protein_id gnl|my_center|LOCUS_03930 400238 399510 gene locus_tag LOCUS_03940 400238 399510 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887187.1 protein_id gnl|my_center|LOCUS_03940 400506 400796 gene locus_tag LOCUS_03950 400506 400796 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776066.1 protein_id gnl|my_center|LOCUS_03950 402382 400862 gene locus_tag LOCUS_03960 402382 400862 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_03960 403554 402379 gene locus_tag LOCUS_03970 403554 402379 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_03970 404572 403601 gene locus_tag LOCUS_03980 404572 403601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 404818 404588 gene locus_tag LOCUS_03990 404818 404588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 405037 406128 gene locus_tag LOCUS_04000 405037 406128 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919898.1 protein_id gnl|my_center|LOCUS_04000 406209 407645 gene locus_tag LOCUS_04010 406209 407645 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093260.1 protein_id gnl|my_center|LOCUS_04010 408786 407632 gene locus_tag LOCUS_04020 408786 407632 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286318.1 protein_id gnl|my_center|LOCUS_04020 408902 410038 gene locus_tag LOCUS_04030 408902 410038 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257333.1 protein_id gnl|my_center|LOCUS_04030 410362 410850 gene locus_tag LOCUS_04040 410362 410850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 410963 412291 gene locus_tag LOCUS_04050 410963 412291 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225685.1 protein_id gnl|my_center|LOCUS_04050 413744 412377 gene locus_tag LOCUS_04060 413744 412377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 414255 413737 gene locus_tag LOCUS_04070 414255 413737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 414901 414239 gene locus_tag LOCUS_04080 414901 414239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 416943 414898 gene locus_tag LOCUS_04090 416943 414898 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_04090 417448 416963 gene locus_tag LOCUS_04100 gene ccmE 417448 416963 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085910.1 protein_id gnl|my_center|LOCUS_04100 417671 417441 gene locus_tag LOCUS_04110 417671 417441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 418525 417668 gene locus_tag LOCUS_04120 418525 417668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 419193 418522 gene locus_tag LOCUS_04130 419193 418522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 419977 419207 gene locus_tag LOCUS_04140 419977 419207 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973614.1 protein_id gnl|my_center|LOCUS_04140 420035 421036 gene locus_tag LOCUS_04150 420035 421036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 421122 421634 gene locus_tag LOCUS_04160 421122 421634 CDS product septum formation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013921.1 protein_id gnl|my_center|LOCUS_04160 422453 421692 gene locus_tag LOCUS_04170 422453 421692 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404702.1 protein_id gnl|my_center|LOCUS_04170 423262 422450 gene locus_tag LOCUS_04180 423262 422450 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088784.1 protein_id gnl|my_center|LOCUS_04180 423321 425192 gene locus_tag LOCUS_04190 423321 425192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 425208 426104 gene locus_tag LOCUS_04200 gene folP 425208 426104 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225731.1 protein_id gnl|my_center|LOCUS_04200 426398 426135 gene locus_tag LOCUS_04210 426398 426135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 427411 426395 gene locus_tag LOCUS_04220 427411 426395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 427509 428090 gene locus_tag LOCUS_04230 427509 428090 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973808.1 protein_id gnl|my_center|LOCUS_04230 428126 428614 gene locus_tag LOCUS_04240 428126 428614 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975424.1 protein_id gnl|my_center|LOCUS_04240 429310 428642 gene locus_tag LOCUS_04250 429310 428642 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227889.1 protein_id gnl|my_center|LOCUS_04250 429476 430552 gene locus_tag LOCUS_04260 429476 430552 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184731.1 protein_id gnl|my_center|LOCUS_04260 430617 431147 gene locus_tag LOCUS_04270 430617 431147 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015609.1 protein_id gnl|my_center|LOCUS_04270 431161 432606 gene locus_tag LOCUS_04280 431161 432606 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259342.1 protein_id gnl|my_center|LOCUS_04280 432735 433361 gene locus_tag LOCUS_04290 432735 433361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896963.1 protein_id gnl|my_center|LOCUS_04290 433396 433998 gene locus_tag LOCUS_04300 433396 433998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 434846 434211 gene locus_tag LOCUS_04310 434846 434211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 435744 434848 gene locus_tag LOCUS_04320 435744 434848 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918242.1 protein_id gnl|my_center|LOCUS_04320 435826 438387 gene locus_tag LOCUS_04330 435826 438387 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975721.1 protein_id gnl|my_center|LOCUS_04330 438472 440127 gene locus_tag LOCUS_04340 438472 440127 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530132.1 protein_id gnl|my_center|LOCUS_04340 440171 441073 gene locus_tag LOCUS_04350 440171 441073 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222820.1 protein_id gnl|my_center|LOCUS_04350 441070 442398 gene locus_tag LOCUS_04360 441070 442398 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113433.1 protein_id gnl|my_center|LOCUS_04360 442510 443052 gene locus_tag LOCUS_04370 442510 443052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 443931 443086 gene locus_tag LOCUS_04380 443931 443086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 446221 444056 gene locus_tag LOCUS_04390 446221 444056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 447227 446325 gene locus_tag LOCUS_04400 447227 446325 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228840.1 protein_id gnl|my_center|LOCUS_04400 449080 447419 gene locus_tag LOCUS_04410 449080 447419 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742163.1 protein_id gnl|my_center|LOCUS_04410 449160 450029 gene locus_tag LOCUS_04420 449160 450029 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893604.1 protein_id gnl|my_center|LOCUS_04420 450060 450266 gene locus_tag LOCUS_04430 450060 450266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 451607 450609 gene locus_tag LOCUS_04440 451607 450609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 452281 451682 gene locus_tag LOCUS_04450 gene kstR 452281 451682 CDS product cholesterol catabolism transcriptional regulator KstR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224372.1 protein_id gnl|my_center|LOCUS_04450 453567 452263 gene locus_tag LOCUS_04460 453567 452263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 454409 453564 gene locus_tag LOCUS_04470 454409 453564 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976247.1 protein_id gnl|my_center|LOCUS_04470 455404 454487 gene locus_tag LOCUS_04480 455404 454487 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730964.1 protein_id gnl|my_center|LOCUS_04480 456463 455528 gene locus_tag LOCUS_04490 gene coaA 456463 455528 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023081.1 protein_id gnl|my_center|LOCUS_04490 456991 456497 gene locus_tag LOCUS_04500 456991 456497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 457140 457601 gene locus_tag LOCUS_04510 457140 457601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 458563 457604 gene locus_tag LOCUS_04520 458563 457604 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729508.1 protein_id gnl|my_center|LOCUS_04520 459737 458628 gene locus_tag LOCUS_04530 459737 458628 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727442.1 protein_id gnl|my_center|LOCUS_04530 460559 459822 gene locus_tag LOCUS_04540 460559 459822 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223909.1 protein_id gnl|my_center|LOCUS_04540 460673 462247 gene locus_tag LOCUS_04550 460673 462247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 462659 462264 gene locus_tag LOCUS_04560 462659 462264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 462985 462683 gene locus_tag LOCUS_04570 462985 462683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 463800 462982 gene locus_tag LOCUS_04580 463800 462982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 464348 463968 gene locus_tag LOCUS_04590 464348 463968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 466412 464694 gene locus_tag LOCUS_04600 466412 464694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 467721 466534 gene locus_tag LOCUS_04610 467721 466534 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_04610 469130 467787 gene locus_tag LOCUS_04620 469130 467787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 470834 469224 gene locus_tag LOCUS_04630 470834 469224 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285120.1 protein_id gnl|my_center|LOCUS_04630 472648 470831 gene locus_tag LOCUS_04640 472648 470831 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530887.1 protein_id gnl|my_center|LOCUS_04640 473593 472724 gene locus_tag LOCUS_04650 473593 472724 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448626.1 protein_id gnl|my_center|LOCUS_04650 473996 473577 gene locus_tag LOCUS_04660 473996 473577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 474038 474493 gene locus_tag LOCUS_04670 474038 474493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 474602 476221 gene locus_tag LOCUS_04680 474602 476221 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030040.1 protein_id gnl|my_center|LOCUS_04680 476233 476802 gene locus_tag LOCUS_04690 476233 476802 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140673.1 protein_id gnl|my_center|LOCUS_04690 477374 476826 gene locus_tag LOCUS_04700 477374 476826 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974562.1 protein_id gnl|my_center|LOCUS_04700 479110 477455 gene locus_tag LOCUS_04710 479110 477455 CDS product FadD3 family acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225243.1 protein_id gnl|my_center|LOCUS_04710 479711 479145 gene locus_tag LOCUS_04720 479711 479145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 480163 479807 gene locus_tag LOCUS_04730 480163 479807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 481508 480267 gene locus_tag LOCUS_04740 481508 480267 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812784.1 protein_id gnl|my_center|LOCUS_04740 481667 482911 gene locus_tag LOCUS_04750 481667 482911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 482942 483757 gene locus_tag LOCUS_04760 482942 483757 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_04760 484476 483793 gene locus_tag LOCUS_04770 484476 483793 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975933.1 protein_id gnl|my_center|LOCUS_04770 484818 484522 gene locus_tag LOCUS_04780 484818 484522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 485524 484976 gene locus_tag LOCUS_04790 485524 484976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 486585 485749 gene locus_tag LOCUS_04800 486585 485749 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730131.1 protein_id gnl|my_center|LOCUS_04800 486911 486636 gene locus_tag LOCUS_04810 486911 486636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 490052 486930 gene locus_tag LOCUS_04820 490052 486930 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225383.1 protein_id gnl|my_center|LOCUS_04820 492366 490222 gene locus_tag LOCUS_04830 492366 490222 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395834.1 protein_id gnl|my_center|LOCUS_04830 492440 493762 gene locus_tag LOCUS_04840 492440 493762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 495331 493802 gene locus_tag LOCUS_04850 495331 493802 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229396.1 protein_id gnl|my_center|LOCUS_04850 495461 496258 gene locus_tag LOCUS_04860 495461 496258 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228963.1 protein_id gnl|my_center|LOCUS_04860 496262 497875 gene locus_tag LOCUS_04870 496262 497875 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031160740.1 protein_id gnl|my_center|LOCUS_04870 497872 498603 gene locus_tag LOCUS_04880 497872 498603 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141632568.1 protein_id gnl|my_center|LOCUS_04880 498661 499428 gene locus_tag LOCUS_04890 498661 499428 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226289.1 protein_id gnl|my_center|LOCUS_04890 500541 499477 gene locus_tag LOCUS_04900 500541 499477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 501409 500942 gene locus_tag LOCUS_04910 501409 500942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 501426 502004 gene locus_tag LOCUS_04920 501426 502004 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122936.1 protein_id gnl|my_center|LOCUS_04920 502054 502368 gene locus_tag LOCUS_04930 502054 502368 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223228.1 protein_id gnl|my_center|LOCUS_04930 503278 502358 gene locus_tag LOCUS_04940 503278 502358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 503437 503739 gene locus_tag LOCUS_04950 503437 503739 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003889857.1 protein_id gnl|my_center|LOCUS_04950 504222 504506 gene locus_tag LOCUS_04960 504222 504506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 505403 504510 gene locus_tag LOCUS_04970 505403 504510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 505963 505400 gene locus_tag LOCUS_04980 505963 505400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 506949 506161 gene locus_tag LOCUS_04990 506949 506161 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039642892.1 protein_id gnl|my_center|LOCUS_04990 507206 507015 gene locus_tag LOCUS_05000 507206 507015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 507478 507242 gene locus_tag LOCUS_05010 507478 507242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 507598 508470 gene locus_tag LOCUS_05020 507598 508470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 509799 508975 gene locus_tag LOCUS_05030 509799 508975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 510755 509802 gene locus_tag LOCUS_05040 510755 509802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 512123 510885 gene locus_tag LOCUS_05050 512123 510885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 512722 513894 gene locus_tag LOCUS_05060 512722 513894 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728499.1 protein_id gnl|my_center|LOCUS_05060 514706 515272 gene locus_tag LOCUS_05070 514706 515272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 517409 515634 gene locus_tag LOCUS_05080 517409 515634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 517712 518281 gene locus_tag LOCUS_05090 517712 518281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 518446 518368 gene locus_tag LOCUS_t00090 518446 518368 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 519029 518487 gene locus_tag LOCUS_05100 519029 518487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 520166 519627 gene locus_tag LOCUS_05110 gene moaC 520166 519627 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393624.1 protein_id gnl|my_center|LOCUS_05110 521179 520184 gene locus_tag LOCUS_05120 gene moaA 521179 520184 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230243.1 protein_id gnl|my_center|LOCUS_05120 522401 521190 gene locus_tag LOCUS_05130 522401 521190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 523270 522398 gene locus_tag LOCUS_05140 gene galU 523270 522398 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975635.1 protein_id gnl|my_center|LOCUS_05140 523412 523798 gene locus_tag LOCUS_05150 523412 523798 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975630.1 protein_id gnl|my_center|LOCUS_05150 523829 524791 gene locus_tag LOCUS_05160 gene map 523829 524791 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976546.1 protein_id gnl|my_center|LOCUS_05160 526164 524812 gene locus_tag LOCUS_05170 526164 524812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 526419 527180 gene locus_tag LOCUS_05180 526419 527180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 528549 527191 gene locus_tag LOCUS_05190 528549 527191 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393050.1 protein_id gnl|my_center|LOCUS_05190 530024 528636 gene locus_tag LOCUS_05200 530024 528636 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942701.1 protein_id gnl|my_center|LOCUS_05200 531412 530021 gene locus_tag LOCUS_05210 531412 530021 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393051.1 protein_id gnl|my_center|LOCUS_05210 531621 531998 gene locus_tag LOCUS_05220 531621 531998 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357588.1 protein_id gnl|my_center|LOCUS_05220 532034 533038 gene locus_tag LOCUS_05230 532034 533038 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448968.1 protein_id gnl|my_center|LOCUS_05230 533035 534156 gene locus_tag LOCUS_05240 533035 534156 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140943.1 protein_id gnl|my_center|LOCUS_05240 534220 536082 gene locus_tag LOCUS_05250 gene dxs 534220 536082 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224488.1 protein_id gnl|my_center|LOCUS_05250 536657 536151 gene locus_tag LOCUS_05260 536657 536151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 536994 538826 gene locus_tag LOCUS_05270 536994 538826 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972723.1 protein_id gnl|my_center|LOCUS_05270 539787 538852 gene locus_tag LOCUS_05280 539787 538852 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479550.1 protein_id gnl|my_center|LOCUS_05280 539892 540500 gene locus_tag LOCUS_05290 539892 540500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 540573 541358 gene locus_tag LOCUS_05300 540573 541358 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228058.1 protein_id gnl|my_center|LOCUS_05300 541358 541870 gene locus_tag LOCUS_05310 541358 541870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 542601 541888 gene locus_tag LOCUS_05320 542601 541888 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087759.1 protein_id gnl|my_center|LOCUS_05320 542776 543228 gene locus_tag LOCUS_05330 542776 543228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 543273 545228 gene locus_tag LOCUS_05340 543273 545228 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229973.1 protein_id gnl|my_center|LOCUS_05340 545333 546049 gene locus_tag LOCUS_05350 gene nfuA 545333 546049 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088034.1 protein_id gnl|my_center|LOCUS_05350 546107 546646 gene locus_tag LOCUS_05360 546107 546646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 547550 546669 gene locus_tag LOCUS_05370 547550 546669 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101591.1 protein_id gnl|my_center|LOCUS_05370 547690 548901 gene locus_tag LOCUS_05380 547690 548901 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225242.1 protein_id gnl|my_center|LOCUS_05380 549010 549747 gene locus_tag LOCUS_05390 549010 549747 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225241.1 protein_id gnl|my_center|LOCUS_05390 549833 550354 gene locus_tag LOCUS_05400 549833 550354 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_05400 550556 550368 gene locus_tag LOCUS_05410 550556 550368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 550678 551250 gene locus_tag LOCUS_05420 550678 551250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 551388 552590 gene locus_tag LOCUS_05430 551388 552590 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730434.1 protein_id gnl|my_center|LOCUS_05430 552848 553858 gene locus_tag LOCUS_05440 552848 553858 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111493.1 protein_id gnl|my_center|LOCUS_05440 553855 555216 gene locus_tag LOCUS_05450 553855 555216 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029150.1 protein_id gnl|my_center|LOCUS_05450 555282 556958 gene locus_tag LOCUS_05460 555282 556958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 557092 557895 gene locus_tag LOCUS_05470 557092 557895 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106646.1 protein_id gnl|my_center|LOCUS_05470 558358 557945 gene locus_tag LOCUS_05480 gene sodN 558358 557945 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 protein_id gnl|my_center|LOCUS_05480 558442 558906 gene locus_tag LOCUS_05490 558442 558906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 558974 559633 gene locus_tag LOCUS_05500 558974 559633 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231017.1 protein_id gnl|my_center|LOCUS_05500 559701 561734 gene locus_tag LOCUS_05510 559701 561734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 563108 561747 gene locus_tag LOCUS_05520 563108 561747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 563096 564241 gene locus_tag LOCUS_05530 563096 564241 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809994.1 protein_id gnl|my_center|LOCUS_05530 564331 565554 gene locus_tag LOCUS_05540 564331 565554 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228819.1 protein_id gnl|my_center|LOCUS_05540 565593 566597 gene locus_tag LOCUS_05550 565593 566597 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776829.1 protein_id gnl|my_center|LOCUS_05550 566740 567729 gene locus_tag LOCUS_05560 566740 567729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 567778 568605 gene locus_tag LOCUS_05570 567778 568605 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922383.1 protein_id gnl|my_center|LOCUS_05570 569448 568648 gene locus_tag LOCUS_05580 569448 568648 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975878.1 protein_id gnl|my_center|LOCUS_05580 570713 569445 gene locus_tag LOCUS_05590 570713 569445 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975879.1 protein_id gnl|my_center|LOCUS_05590 571481 570822 gene locus_tag LOCUS_05600 571481 570822 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975880.1 protein_id gnl|my_center|LOCUS_05600 572450 571530 gene locus_tag LOCUS_05610 572450 571530 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728692.1 protein_id gnl|my_center|LOCUS_05610 575580 574297 gene locus_tag LOCUS_05620 575580 574297 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966466.1 protein_id gnl|my_center|LOCUS_05620 576555 575662 gene locus_tag LOCUS_05630 576555 575662 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940938.1 protein_id gnl|my_center|LOCUS_05630 577448 576597 gene locus_tag LOCUS_05640 577448 576597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 578911 577466 gene locus_tag LOCUS_05650 578911 577466 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730872.1 protein_id gnl|my_center|LOCUS_05650 580154 579021 gene locus_tag LOCUS_05660 gene mmuM 580154 579021 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911868.1 protein_id gnl|my_center|LOCUS_05660 581025 580129 gene locus_tag LOCUS_05670 581025 580129 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977273.1 protein_id gnl|my_center|LOCUS_05670 581144 582913 gene locus_tag LOCUS_05680 581144 582913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 583302 583000 gene locus_tag LOCUS_05690 gene arsC 583302 583000 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314592.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05690 584176 583421 gene locus_tag LOCUS_05700 584176 583421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 584282 585064 gene locus_tag LOCUS_05710 584282 585064 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225546.1 protein_id gnl|my_center|LOCUS_05710 585072 586502 gene locus_tag LOCUS_05720 585072 586502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 586542 588518 gene locus_tag LOCUS_05730 586542 588518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 588596 589981 gene locus_tag LOCUS_05740 588596 589981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 591750 589996 gene locus_tag LOCUS_05750 591750 589996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 592456 591848 gene locus_tag LOCUS_05760 592456 591848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 592573 594105 gene locus_tag LOCUS_05770 592573 594105 CDS product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967081.1 protein_id gnl|my_center|LOCUS_05770 594179 594871 gene locus_tag LOCUS_05780 594179 594871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 594921 596018 gene locus_tag LOCUS_05790 594921 596018 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727442.1 protein_id gnl|my_center|LOCUS_05790 596558 596061 gene locus_tag LOCUS_05800 596558 596061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 596610 596987 gene locus_tag LOCUS_05810 596610 596987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 597437 597048 gene locus_tag LOCUS_05820 597437 597048 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804865.1 protein_id gnl|my_center|LOCUS_05820 598223 597465 gene locus_tag LOCUS_05830 gene pgl 598223 597465 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_05830 599740 598223 gene locus_tag LOCUS_05840 gene zwf 599740 598223 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528919.1 protein_id gnl|my_center|LOCUS_05840 600771 599737 gene locus_tag LOCUS_05850 gene gnd 600771 599737 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405880.1 protein_id gnl|my_center|LOCUS_05850 602515 600830 gene locus_tag LOCUS_05860 602515 600830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 602535 603179 gene locus_tag LOCUS_05870 602535 603179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 603317 603162 gene locus_tag LOCUS_05880 603317 603162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 603353 604360 gene locus_tag LOCUS_05890 603353 604360 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081490.1 protein_id gnl|my_center|LOCUS_05890 604386 605381 gene locus_tag LOCUS_05900 604386 605381 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804603.1 protein_id gnl|my_center|LOCUS_05900 605724 605281 gene locus_tag LOCUS_05910 605724 605281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 605969 607240 gene locus_tag LOCUS_05920 605969 607240 CDS product DUF3089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918560.1 protein_id gnl|my_center|LOCUS_05920 607244 607981 gene locus_tag LOCUS_05930 607244 607981 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978857.1 protein_id gnl|my_center|LOCUS_05930 607982 608701 gene locus_tag LOCUS_05940 607982 608701 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326218.1 protein_id gnl|my_center|LOCUS_05940 609573 608698 gene locus_tag LOCUS_05950 609573 608698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 610643 609570 gene locus_tag LOCUS_05960 610643 609570 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730637.1 protein_id gnl|my_center|LOCUS_05960 611203 610640 gene locus_tag LOCUS_05970 611203 610640 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978086.1 protein_id gnl|my_center|LOCUS_05970 611106 612098 gene locus_tag LOCUS_05980 611106 612098 CDS product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086856.1 protein_id gnl|my_center|LOCUS_05980 612157 613170 gene locus_tag LOCUS_05990 612157 613170 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141923.1 protein_id gnl|my_center|LOCUS_05990 613985 613239 gene locus_tag LOCUS_06000 613985 613239 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013630.1 protein_id gnl|my_center|LOCUS_06000 615127 613982 gene locus_tag LOCUS_06010 615127 613982 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285858.1 protein_id gnl|my_center|LOCUS_06010 615891 615124 gene locus_tag LOCUS_06020 gene phoU 615891 615124 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974747.1 protein_id gnl|my_center|LOCUS_06020 616841 615888 gene locus_tag LOCUS_06030 gene pstB 616841 615888 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_06030 617818 616838 gene locus_tag LOCUS_06040 gene pstA 617818 616838 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405019.1 protein_id gnl|my_center|LOCUS_06040 618768 617830 gene locus_tag LOCUS_06050 gene pstC 618768 617830 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830936.1 protein_id gnl|my_center|LOCUS_06050 619658 618765 gene locus_tag LOCUS_06060 619658 618765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 620446 620691 gene locus_tag LOCUS_06070 620446 620691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 621695 621039 gene locus_tag LOCUS_06080 621695 621039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 622110 622583 gene locus_tag LOCUS_06090 622110 622583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 624195 622672 gene locus_tag LOCUS_06100 624195 622672 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879446.1 protein_id gnl|my_center|LOCUS_06100 626773 624200 gene locus_tag LOCUS_06110 626773 624200 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674247.1 protein_id gnl|my_center|LOCUS_06110 626894 627742 gene locus_tag LOCUS_06120 626894 627742 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726700.1 protein_id gnl|my_center|LOCUS_06120 627949 628230 gene locus_tag LOCUS_06130 627949 628230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 630909 628252 gene locus_tag LOCUS_06140 630909 628252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 631399 630902 gene locus_tag LOCUS_06150 631399 630902 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416053.1 protein_id gnl|my_center|LOCUS_06150 632327 631410 gene locus_tag LOCUS_06160 632327 631410 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731198.1 protein_id gnl|my_center|LOCUS_06160 632440 633066 gene locus_tag LOCUS_06170 632440 633066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 633381 633881 gene locus_tag LOCUS_06180 633381 633881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 633875 634372 gene locus_tag LOCUS_06190 633875 634372 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101907.1 protein_id gnl|my_center|LOCUS_06190 634369 635022 gene locus_tag LOCUS_06200 634369 635022 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528076.1 protein_id gnl|my_center|LOCUS_06200 635213 636298 gene locus_tag LOCUS_06210 635213 636298 CDS product IS982 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158889249.1 protein_id gnl|my_center|LOCUS_06210 637568 636195 gene locus_tag LOCUS_06220 637568 636195 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969771.1 protein_id gnl|my_center|LOCUS_06220 638529 637702 gene locus_tag LOCUS_06230 638529 637702 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728951.1 protein_id gnl|my_center|LOCUS_06230 639818 638571 gene locus_tag LOCUS_06240 gene rfbH 639818 638571 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227240.1 protein_id gnl|my_center|LOCUS_06240 640690 639830 gene locus_tag LOCUS_06250 640690 639830 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728655.1 protein_id gnl|my_center|LOCUS_06250 640856 640695 gene locus_tag LOCUS_06260 640856 640695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 640878 641558 gene locus_tag LOCUS_06270 640878 641558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 641729 641562 gene locus_tag LOCUS_06280 641729 641562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 641728 642870 gene locus_tag LOCUS_06290 641728 642870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 644896 642941 gene locus_tag LOCUS_06300 644896 642941 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227096.1 protein_id gnl|my_center|LOCUS_06300 646623 644893 gene locus_tag LOCUS_06310 646623 644893 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227095.1 protein_id gnl|my_center|LOCUS_06310 648292 646787 gene locus_tag LOCUS_06320 648292 646787 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618874.1 protein_id gnl|my_center|LOCUS_06320 648448 649872 gene locus_tag LOCUS_06330 648448 649872 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412717.1 protein_id gnl|my_center|LOCUS_06330 650050 650205 gene locus_tag LOCUS_06340 650050 650205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 650910 650485 gene locus_tag LOCUS_06350 650910 650485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 651159 652688 gene locus_tag LOCUS_06360 651159 652688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 653079 652792 gene locus_tag LOCUS_06370 653079 652792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 654945 653665 gene locus_tag LOCUS_06380 654945 653665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 659300 654942 gene locus_tag LOCUS_06390 659300 654942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 660712 659297 gene locus_tag LOCUS_06400 660712 659297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 662316 660709 gene locus_tag LOCUS_06410 662316 660709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 663558 662383 gene locus_tag LOCUS_06420 663558 662383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 665016 663838 gene locus_tag LOCUS_06430 gene tcmP 665016 663838 CDS product three-Cys-motif partner protein TcmP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115511.1 protein_id gnl|my_center|LOCUS_06430 665772 665023 gene locus_tag LOCUS_06440 665772 665023 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899455.1 protein_id gnl|my_center|LOCUS_06440 666030 666638 gene locus_tag LOCUS_06450 666030 666638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06450 666635 666844 gene locus_tag LOCUS_06460 666635 666844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06460 668319 666853 gene locus_tag LOCUS_06470 668319 666853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 668520 671273 gene locus_tag LOCUS_06480 668520 671273 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950658.1 protein_id gnl|my_center|LOCUS_06480 671320 672162 gene locus_tag LOCUS_06490 671320 672162 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899172.1 protein_id gnl|my_center|LOCUS_06490 672171 672749 gene locus_tag LOCUS_06500 672171 672749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 675136 672821 gene locus_tag LOCUS_06510 675136 672821 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028805.1 protein_id gnl|my_center|LOCUS_06510 675886 675353 gene locus_tag LOCUS_06520 675886 675353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 675947 677911 gene locus_tag LOCUS_06530 675947 677911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 678664 677930 gene locus_tag LOCUS_06540 678664 677930 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411707.1 protein_id gnl|my_center|LOCUS_06540 678816 680336 gene locus_tag LOCUS_06550 678816 680336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 680992 680504 gene locus_tag LOCUS_06560 680992 680504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 681542 681057 gene locus_tag LOCUS_06570 681542 681057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 681688 682338 gene locus_tag LOCUS_06580 681688 682338 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029782.1 protein_id gnl|my_center|LOCUS_06580 682436 682951 gene locus_tag LOCUS_06590 682436 682951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 682984 685407 gene locus_tag LOCUS_06600 682984 685407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 686981 685383 gene locus_tag LOCUS_06610 686981 685383 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920425.1 protein_id gnl|my_center|LOCUS_06610 687125 687904 gene locus_tag LOCUS_06620 687125 687904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 687954 688952 gene locus_tag LOCUS_06630 687954 688952 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224041.1 protein_id gnl|my_center|LOCUS_06630 688952 689692 gene locus_tag LOCUS_06640 688952 689692 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731411.1 protein_id gnl|my_center|LOCUS_06640 690360 689683 gene locus_tag LOCUS_06650 690360 689683 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328180.1 protein_id gnl|my_center|LOCUS_06650 690659 690429 gene locus_tag LOCUS_06660 690659 690429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 690813 691838 gene locus_tag LOCUS_06670 690813 691838 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226183.1 protein_id gnl|my_center|LOCUS_06670 692173 691823 gene locus_tag LOCUS_06680 692173 691823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 692940 692149 gene locus_tag LOCUS_06690 692940 692149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06690 693118 694341 gene locus_tag LOCUS_06700 693118 694341 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088916.1 protein_id gnl|my_center|LOCUS_06700 695307 694342 gene locus_tag LOCUS_06710 695307 694342 CDS product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900096.1 protein_id gnl|my_center|LOCUS_06710 695885 695190 gene locus_tag LOCUS_06720 695885 695190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 696771 695941 gene locus_tag LOCUS_06730 696771 695941 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729165.1 protein_id gnl|my_center|LOCUS_06730 697580 696768 gene locus_tag LOCUS_06740 697580 696768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 698807 697668 gene locus_tag LOCUS_06750 698807 697668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 699940 698804 gene locus_tag LOCUS_06760 699940 698804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 700673 700047 gene locus_tag LOCUS_06770 700673 700047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 701806 700670 gene locus_tag LOCUS_06780 701806 700670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 702824 701880 gene locus_tag LOCUS_06790 gene rfbD 702824 701880 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877394.1 protein_id gnl|my_center|LOCUS_06790 703720 702821 gene locus_tag LOCUS_06800 703720 702821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 704765 703707 gene locus_tag LOCUS_06810 704765 703707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 708952 704762 gene locus_tag LOCUS_06820 708952 704762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 709923 708949 gene locus_tag LOCUS_06830 709923 708949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 711473 709920 gene locus_tag LOCUS_06840 711473 709920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 712941 711466 gene locus_tag LOCUS_06850 712941 711466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 713965 712991 gene locus_tag LOCUS_06860 713965 712991 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 protein_id gnl|my_center|LOCUS_06860 714954 713965 gene locus_tag LOCUS_06870 714954 713965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 715870 715217 gene locus_tag LOCUS_06880 715870 715217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 717734 716049 gene locus_tag LOCUS_06890 717734 716049 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083665.1 protein_id gnl|my_center|LOCUS_06890 717733 718014 gene locus_tag LOCUS_06900 717733 718014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 718011 718751 gene locus_tag LOCUS_06910 718011 718751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 718748 719263 gene locus_tag LOCUS_06920 718748 719263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 719332 720306 gene locus_tag LOCUS_06930 719332 720306 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085629.1 protein_id gnl|my_center|LOCUS_06930 720479 721915 gene locus_tag LOCUS_06940 gene sufB 720479 721915 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_06940 721915 722661 gene locus_tag LOCUS_06950 gene sufC 721915 722661 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384245.1 protein_id gnl|my_center|LOCUS_06950 722664 724013 gene locus_tag LOCUS_06960 gene sufD 722664 724013 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087113.1 protein_id gnl|my_center|LOCUS_06960 724010 724579 gene locus_tag LOCUS_06970 gene sufT 724010 724579 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_06970 724956 724696 gene locus_tag LOCUS_06980 724956 724696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 725989 724943 gene locus_tag LOCUS_06990 725989 724943 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122566.1 protein_id gnl|my_center|LOCUS_06990 727310 726015 gene locus_tag LOCUS_07000 727310 726015 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110217.1 protein_id gnl|my_center|LOCUS_07000 727617 727375 gene locus_tag LOCUS_07010 727617 727375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 728284 727709 gene locus_tag LOCUS_07020 728284 727709 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776270.1 protein_id gnl|my_center|LOCUS_07020 728360 728737 gene locus_tag LOCUS_07030 728360 728737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415930.1 protein_id gnl|my_center|LOCUS_07030 728783 729664 gene locus_tag LOCUS_07040 728783 729664 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265741.1 protein_id gnl|my_center|LOCUS_07040 729723 730478 gene locus_tag LOCUS_07050 729723 730478 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403708.1 protein_id gnl|my_center|LOCUS_07050 731770 730511 gene locus_tag LOCUS_07060 731770 730511 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729152.1 protein_id gnl|my_center|LOCUS_07060 731902 732306 gene locus_tag LOCUS_07070 731902 732306 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388728.1 protein_id gnl|my_center|LOCUS_07070 732303 733094 gene locus_tag LOCUS_07080 732303 733094 CDS product family 1 encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388729.1 protein_id gnl|my_center|LOCUS_07080 733589 733134 gene locus_tag LOCUS_07090 733589 733134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 734364 733723 gene locus_tag LOCUS_07100 734364 733723 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079489.1 protein_id gnl|my_center|LOCUS_07100 734586 735152 gene locus_tag LOCUS_07110 734586 735152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 736204 735116 gene locus_tag LOCUS_07120 736204 735116 CDS product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050077838.1 protein_id gnl|my_center|LOCUS_07120 736361 736762 gene locus_tag LOCUS_07130 736361 736762 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145023062.1 protein_id gnl|my_center|LOCUS_07130 736762 737685 gene locus_tag LOCUS_07140 736762 737685 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229548.1 protein_id gnl|my_center|LOCUS_07140 738583 737747 gene locus_tag LOCUS_07150 738583 737747 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257864.1 protein_id gnl|my_center|LOCUS_07150 739423 738587 gene locus_tag LOCUS_07160 739423 738587 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325374.1 protein_id gnl|my_center|LOCUS_07160 740406 739420 gene locus_tag LOCUS_07170 740406 739420 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812034.1 protein_id gnl|my_center|LOCUS_07170 741064 740453 gene locus_tag LOCUS_07180 741064 740453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 742964 741231 gene locus_tag LOCUS_07190 742964 741231 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900995.1 protein_id gnl|my_center|LOCUS_07190 743162 745318 gene locus_tag LOCUS_07200 743162 745318 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902404.1 protein_id gnl|my_center|LOCUS_07200 745460 745723 gene locus_tag LOCUS_07210 745460 745723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 746494 745772 gene locus_tag LOCUS_07220 746494 745772 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405475.1 protein_id gnl|my_center|LOCUS_07220 746388 746630 gene locus_tag LOCUS_07230 746388 746630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 746596 747573 gene locus_tag LOCUS_07240 746596 747573 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325827.1 protein_id gnl|my_center|LOCUS_07240 747607 748677 gene locus_tag LOCUS_07250 747607 748677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 750105 748756 gene locus_tag LOCUS_07260 750105 748756 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222037.1 protein_id gnl|my_center|LOCUS_07260 750324 750740 gene locus_tag LOCUS_07270 750324 750740 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813590.1 protein_id gnl|my_center|LOCUS_07270 751913 750657 gene locus_tag LOCUS_07280 gene hutI 751913 750657 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892542.1 protein_id gnl|my_center|LOCUS_07280 753366 751948 gene locus_tag LOCUS_07290 753366 751948 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028749.1 protein_id gnl|my_center|LOCUS_07290 753874 753425 gene locus_tag LOCUS_07300 753874 753425 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029897.1 protein_id gnl|my_center|LOCUS_07300 754614 753997 gene locus_tag LOCUS_07310 gene def 754614 753997 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116243.1 protein_id gnl|my_center|LOCUS_07310 755479 754622 gene locus_tag LOCUS_07320 755479 754622 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948031.1 protein_id gnl|my_center|LOCUS_07320 757059 755476 gene locus_tag LOCUS_07330 gene hutU 757059 755476 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223168.1 protein_id gnl|my_center|LOCUS_07330 757286 758059 gene locus_tag LOCUS_07340 757286 758059 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228704.1 protein_id gnl|my_center|LOCUS_07340 758056 759585 gene locus_tag LOCUS_07350 gene hutH 758056 759585 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223167.1 protein_id gnl|my_center|LOCUS_07350 761461 759614 gene locus_tag LOCUS_07360 761461 759614 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729678.1 protein_id gnl|my_center|LOCUS_07360 761914 761543 gene locus_tag LOCUS_07370 761914 761543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 763456 761960 gene locus_tag LOCUS_07380 763456 761960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 763763 764092 gene locus_tag LOCUS_07390 763763 764092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 764969 764118 gene locus_tag LOCUS_07400 764969 764118 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095780.1 protein_id gnl|my_center|LOCUS_07400 765892 765053 gene locus_tag LOCUS_07410 765892 765053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 766269 765883 gene locus_tag LOCUS_07420 766269 765883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 766981 766331 gene locus_tag LOCUS_07430 766981 766331 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036824.1 protein_id gnl|my_center|LOCUS_07430 767070 768035 gene locus_tag LOCUS_07440 767070 768035 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891984.1 protein_id gnl|my_center|LOCUS_07440 768035 768853 gene locus_tag LOCUS_07450 768035 768853 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222374.1 protein_id gnl|my_center|LOCUS_07450 768977 769156 gene locus_tag LOCUS_07460 768977 769156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 770295 769135 gene locus_tag LOCUS_07470 770295 769135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07470 770701 770231 gene locus_tag LOCUS_07480 770701 770231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 771174 772334 gene locus_tag LOCUS_07490 771174 772334 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410070.1 protein_id gnl|my_center|LOCUS_07490 772729 773649 gene locus_tag LOCUS_07500 772729 773649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07500 773549 773929 gene locus_tag LOCUS_07510 773549 773929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07510 775016 774045 gene locus_tag LOCUS_07520 775016 774045 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141423.1 protein_id gnl|my_center|LOCUS_07520 775117 775476 gene locus_tag LOCUS_07530 775117 775476 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228531.1 protein_id gnl|my_center|LOCUS_07530 775489 776196 gene locus_tag LOCUS_07540 775489 776196 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612341.1 protein_id gnl|my_center|LOCUS_07540 776291 776677 gene locus_tag LOCUS_07550 776291 776677 CDS product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199254442.1 protein_id gnl|my_center|LOCUS_07550 777235 776771 gene locus_tag LOCUS_07560 777235 776771 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969185.1 protein_id gnl|my_center|LOCUS_07560 778606 777395 gene locus_tag LOCUS_07570 778606 777395 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113947.1 protein_id gnl|my_center|LOCUS_07570 778993 778724 gene locus_tag LOCUS_07580 778993 778724 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899012.1 protein_id gnl|my_center|LOCUS_07580 780111 779200 gene locus_tag LOCUS_07590 780111 779200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 781659 780193 gene locus_tag LOCUS_07600 781659 780193 CDS product putative Ig domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108613.1 protein_id gnl|my_center|LOCUS_07600 782137 781721 gene locus_tag LOCUS_07610 782137 781721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 782294 783118 gene locus_tag LOCUS_07620 782294 783118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 783058 784005 gene locus_tag LOCUS_07630 783058 784005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 787076 784152 gene locus_tag LOCUS_07640 787076 784152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 787218 787481 gene locus_tag LOCUS_07650 787218 787481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 787829 787449 gene locus_tag LOCUS_07660 787829 787449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 789241 787826 gene locus_tag LOCUS_07670 789241 787826 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027665.1 protein_id gnl|my_center|LOCUS_07670 790223 789414 gene locus_tag LOCUS_07680 790223 789414 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977203.1 protein_id gnl|my_center|LOCUS_07680 790644 790288 gene locus_tag LOCUS_07690 790644 790288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 792499 790700 gene locus_tag LOCUS_07700 792499 790700 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086638.1 protein_id gnl|my_center|LOCUS_07700 794189 792636 gene locus_tag LOCUS_07710 794189 792636 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337441.1 protein_id gnl|my_center|LOCUS_07710 795226 794192 gene locus_tag LOCUS_07720 795226 794192 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338635.1 protein_id gnl|my_center|LOCUS_07720 796214 795384 gene locus_tag LOCUS_07730 796214 795384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 797939 796233 gene locus_tag LOCUS_07740 gene ilvD 797939 796233 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079804.1 protein_id gnl|my_center|LOCUS_07740 798108 798611 gene locus_tag LOCUS_07750 798108 798611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030585.1 protein_id gnl|my_center|LOCUS_07750 798913 799497 gene locus_tag LOCUS_07760 gene kstR 798913 799497 CDS product cholesterol catabolism transcriptional regulator KstR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224372.1 protein_id gnl|my_center|LOCUS_07760 800479 799550 gene locus_tag LOCUS_07770 800479 799550 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172927.1 protein_id gnl|my_center|LOCUS_07770 801741 800476 gene locus_tag LOCUS_07780 801741 800476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 802040 802816 gene locus_tag LOCUS_07790 802040 802816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 803302 802835 gene locus_tag LOCUS_07800 803302 802835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 804020 803316 gene locus_tag LOCUS_07810 804020 803316 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225676.1 protein_id gnl|my_center|LOCUS_07810 804769 804017 gene locus_tag LOCUS_07820 804769 804017 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728923.1 protein_id gnl|my_center|LOCUS_07820 807080 804756 gene locus_tag LOCUS_07830 807080 804756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 808609 807086 gene locus_tag LOCUS_07840 808609 807086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 808689 809090 gene locus_tag LOCUS_07850 808689 809090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 809922 809227 gene locus_tag LOCUS_07860 809922 809227 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973149.1 protein_id gnl|my_center|LOCUS_07860 812462 809919 gene locus_tag LOCUS_07870 812462 809919 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030507.1 protein_id gnl|my_center|LOCUS_07870 813065 812472 gene locus_tag LOCUS_07880 813065 812472 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405322.1 protein_id gnl|my_center|LOCUS_07880 815176 813065 gene locus_tag LOCUS_07890 gene kdpB 815176 813065 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405320.1 protein_id gnl|my_center|LOCUS_07890 816921 815185 gene locus_tag LOCUS_07900 gene kdpA 816921 815185 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405318.1 protein_id gnl|my_center|LOCUS_07900 817106 816921 gene locus_tag LOCUS_07910 817106 816921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 817349 817990 gene locus_tag LOCUS_07920 817349 817990 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966112.1 protein_id gnl|my_center|LOCUS_07920 818063 818728 gene locus_tag LOCUS_07930 818063 818728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 818728 818949 gene locus_tag LOCUS_07940 818728 818949 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639890.1 protein_id gnl|my_center|LOCUS_07940 819058 819687 gene locus_tag LOCUS_07950 819058 819687 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 protein_id gnl|my_center|LOCUS_07950 821029 819752 gene locus_tag LOCUS_07960 821029 819752 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931723.1 protein_id gnl|my_center|LOCUS_07960 821868 821116 gene locus_tag LOCUS_07970 821868 821116 CDS product evbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135362122.1 protein_id gnl|my_center|LOCUS_07970 822968 821898 gene locus_tag LOCUS_07980 822968 821898 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729219.1 protein_id gnl|my_center|LOCUS_07980 824588 823020 gene locus_tag LOCUS_07990 824588 823020 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123435.1 protein_id gnl|my_center|LOCUS_07990 825643 824585 gene locus_tag LOCUS_08000 825643 824585 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729221.1 protein_id gnl|my_center|LOCUS_08000 827882 826161 gene locus_tag LOCUS_08010 827882 826161 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459981.1 protein_id gnl|my_center|LOCUS_08010 828616 827960 gene locus_tag LOCUS_08020 828616 827960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 829278 828886 gene locus_tag LOCUS_08030 829278 828886 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030828.1 protein_id gnl|my_center|LOCUS_08030 830145 829330 gene locus_tag LOCUS_08040 830145 829330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 832359 830218 gene locus_tag LOCUS_08050 gene atsD 832359 830218 CDS product arylsulfatase AtsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403397.1 protein_id gnl|my_center|LOCUS_08050 832641 834953 gene locus_tag LOCUS_08060 832641 834953 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097941806.1 protein_id gnl|my_center|LOCUS_08060 835106 837460 gene locus_tag LOCUS_08070 835106 837460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 837515 838225 gene locus_tag LOCUS_08080 837515 838225 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226228.1 protein_id gnl|my_center|LOCUS_08080 838201 838704 gene locus_tag LOCUS_08090 838201 838704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08090 838738 838935 gene locus_tag LOCUS_08100 838738 838935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 840056 838947 gene locus_tag LOCUS_08110 840056 838947 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919251.1 protein_id gnl|my_center|LOCUS_08110 841245 840049 gene locus_tag LOCUS_08120 841245 840049 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902856.1 protein_id gnl|my_center|LOCUS_08120 842636 841242 gene locus_tag LOCUS_08130 gene hemG 842636 841242 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224513.1 protein_id gnl|my_center|LOCUS_08130 842836 844044 gene locus_tag LOCUS_08140 842836 844044 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_08140 845554 844118 gene locus_tag LOCUS_08150 845554 844118 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296672.1 protein_id gnl|my_center|LOCUS_08150 846423 845551 gene locus_tag LOCUS_08160 846423 845551 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467188.1 protein_id gnl|my_center|LOCUS_08160 846519 847922 gene locus_tag LOCUS_08170 846519 847922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 849065 848037 gene locus_tag LOCUS_08180 849065 848037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 849829 849062 gene locus_tag LOCUS_08190 849829 849062 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104392.1 protein_id gnl|my_center|LOCUS_08190 849981 851327 gene locus_tag LOCUS_08200 849981 851327 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257876.1 protein_id gnl|my_center|LOCUS_08200 852098 851490 gene locus_tag LOCUS_08210 gene nfuA 852098 851490 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088034.1 protein_id gnl|my_center|LOCUS_08210 852465 852148 gene locus_tag LOCUS_08220 852465 852148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 854170 852467 gene locus_tag LOCUS_08230 854170 852467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 854250 854483 gene locus_tag LOCUS_08240 854250 854483 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963400.1 protein_id gnl|my_center|LOCUS_08240 854764 854507 gene locus_tag LOCUS_08250 854764 854507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 854959 855948 gene locus_tag LOCUS_08260 854959 855948 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122780.1 protein_id gnl|my_center|LOCUS_08260 856384 855956 gene locus_tag LOCUS_08270 856384 855956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 857001 856381 gene locus_tag LOCUS_08280 857001 856381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 857160 857978 gene locus_tag LOCUS_08290 857160 857978 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224298.1 protein_id gnl|my_center|LOCUS_08290 860514 858301 gene locus_tag LOCUS_08300 860514 858301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 861419 860526 gene locus_tag LOCUS_08310 861419 860526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 862615 861416 gene locus_tag LOCUS_08320 862615 861416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 864926 862617 gene locus_tag LOCUS_08330 864926 862617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 865189 866115 gene locus_tag LOCUS_08340 865189 866115 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220518.1 protein_id gnl|my_center|LOCUS_08340 866115 866432 gene locus_tag LOCUS_08350 866115 866432 CDS product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943042.1 protein_id gnl|my_center|LOCUS_08350 866425 867879 gene locus_tag LOCUS_08360 866425 867879 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087162.1 protein_id gnl|my_center|LOCUS_08360 868289 869647 gene locus_tag LOCUS_08370 868289 869647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 870180 869872 gene locus_tag LOCUS_08380 870180 869872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 870130 871002 gene locus_tag LOCUS_08390 870130 871002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 871100 871669 gene locus_tag LOCUS_08400 871100 871669 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258313.1 protein_id gnl|my_center|LOCUS_08400 871830 871751 gene locus_tag LOCUS_t00100 871830 871751 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 871949 872146 gene locus_tag LOCUS_08410 871949 872146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 873017 872133 gene locus_tag LOCUS_08420 873017 872133 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414409.1 protein_id gnl|my_center|LOCUS_08420 873700 873017 gene locus_tag LOCUS_08430 873700 873017 CDS product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414414.1 protein_id gnl|my_center|LOCUS_08430 874520 874083 gene locus_tag LOCUS_08440 874520 874083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 874900 874517 gene locus_tag LOCUS_08450 874900 874517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 875427 875128 gene locus_tag LOCUS_08460 875427 875128 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005643896.1 protein_id gnl|my_center|LOCUS_08460 875752 875676 gene locus_tag LOCUS_t00110 875752 875676 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 876194 875865 gene locus_tag LOCUS_08470 876194 875865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 876944 876471 gene locus_tag LOCUS_08480 876944 876471 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928641.1 protein_id gnl|my_center|LOCUS_08480 877442 876981 gene locus_tag LOCUS_08490 877442 876981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 877621 878592 gene locus_tag LOCUS_08500 877621 878592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 879045 878752 gene locus_tag LOCUS_08510 879045 878752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 879357 879052 gene locus_tag LOCUS_08520 879357 879052 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942689.1 protein_id gnl|my_center|LOCUS_08520 880386 879415 gene locus_tag LOCUS_08530 880386 879415 CDS product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101381.1 protein_id gnl|my_center|LOCUS_08530 880631 880885 gene locus_tag LOCUS_08540 880631 880885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 880924 881871 gene locus_tag LOCUS_08550 880924 881871 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088350.1 protein_id gnl|my_center|LOCUS_08550 882529 881873 gene locus_tag LOCUS_08560 gene hxpB 882529 881873 CDS product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705977.1 protein_id gnl|my_center|LOCUS_08560 882822 884015 gene locus_tag LOCUS_08570 882822 884015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 884025 885410 gene locus_tag LOCUS_08580 884025 885410 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404937.1 protein_id gnl|my_center|LOCUS_08580 885468 886379 gene locus_tag LOCUS_08590 885468 886379 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966304.1 protein_id gnl|my_center|LOCUS_08590 886463 887833 gene locus_tag LOCUS_08600 886463 887833 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803753.1 protein_id gnl|my_center|LOCUS_08600 889166 887877 gene locus_tag LOCUS_08610 889166 887877 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079861.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08610 889552 889109 gene locus_tag LOCUS_08620 889552 889109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 890456 889461 gene locus_tag LOCUS_08630 890456 889461 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877522.1 protein_id gnl|my_center|LOCUS_08630 890602 892146 gene locus_tag LOCUS_08640 gene metG 890602 892146 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975149.1 protein_id gnl|my_center|LOCUS_08640 892218 892520 gene locus_tag LOCUS_08650 892218 892520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 894017 892536 gene locus_tag LOCUS_08660 894017 892536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 894336 895973 gene locus_tag LOCUS_08670 894336 895973 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204354695.1 protein_id gnl|my_center|LOCUS_08670 896571 898283 gene locus_tag LOCUS_08680 896571 898283 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027201.1 protein_id gnl|my_center|LOCUS_08680 901244 898320 gene locus_tag LOCUS_08690 901244 898320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 903749 901437 gene locus_tag LOCUS_08700 903749 901437 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449634.1 protein_id gnl|my_center|LOCUS_08700 903999 904889 gene locus_tag LOCUS_08710 903999 904889 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405405.1 protein_id gnl|my_center|LOCUS_08710 907880 904899 gene locus_tag LOCUS_08720 907880 904899 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416795.1 protein_id gnl|my_center|LOCUS_08720 910365 908032 gene locus_tag LOCUS_08730 910365 908032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 911698 910442 gene locus_tag LOCUS_08740 911698 910442 CDS product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476281.1 protein_id gnl|my_center|LOCUS_08740 911697 912008 gene locus_tag LOCUS_08750 911697 912008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 912069 912746 gene locus_tag LOCUS_08760 912069 912746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 914096 912750 gene locus_tag LOCUS_08770 914096 912750 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966681.1 protein_id gnl|my_center|LOCUS_08770 915268 914093 gene locus_tag LOCUS_08780 915268 914093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 916191 915265 gene locus_tag LOCUS_08790 916191 915265 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069456655.1 protein_id gnl|my_center|LOCUS_08790 916907 916194 gene locus_tag LOCUS_08800 916907 916194 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069456656.1 protein_id gnl|my_center|LOCUS_08800 917662 916904 gene locus_tag LOCUS_08810 917662 916904 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090547.1 protein_id gnl|my_center|LOCUS_08810 918750 917785 gene locus_tag LOCUS_08820 918750 917785 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_08820 919136 918936 gene locus_tag LOCUS_08830 919136 918936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 919677 919189 gene locus_tag LOCUS_08840 919677 919189 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973775.1 protein_id gnl|my_center|LOCUS_08840 919789 920874 gene locus_tag LOCUS_08850 919789 920874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 922446 921712 gene locus_tag LOCUS_08860 922446 921712 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258317.1 protein_id gnl|my_center|LOCUS_08860 922813 923112 gene locus_tag LOCUS_08870 922813 923112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 923229 924557 gene locus_tag LOCUS_08880 923229 924557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 924780 925817 gene locus_tag LOCUS_08890 924780 925817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08890 926129 926497 gene locus_tag LOCUS_08900 926129 926497 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112711.1 protein_id gnl|my_center|LOCUS_08900 926600 927019 gene locus_tag LOCUS_08910 gene cadI 926600 927019 CDS product cadmium-induced metalloenzyme CadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413675.1 protein_id gnl|my_center|LOCUS_08910 927016 928095 gene locus_tag LOCUS_08920 gene arsB 927016 928095 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727470.1 protein_id gnl|my_center|LOCUS_08920 929308 928109 gene locus_tag LOCUS_08930 929308 928109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 929360 930655 gene locus_tag LOCUS_08940 929360 930655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 930725 931255 gene locus_tag LOCUS_08950 930725 931255 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085913.1 protein_id gnl|my_center|LOCUS_08950 932629 931244 gene locus_tag LOCUS_08960 932629 931244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 934742 932640 gene locus_tag LOCUS_08970 934742 932640 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270140.1 protein_id gnl|my_center|LOCUS_08970 935056 934775 gene locus_tag LOCUS_08980 935056 934775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 936316 935156 gene locus_tag LOCUS_08990 936316 935156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 936635 936883 gene locus_tag LOCUS_09000 936635 936883 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094330.1 protein_id gnl|my_center|LOCUS_09000 937224 937057 gene locus_tag LOCUS_09010 937224 937057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 937240 937896 gene locus_tag LOCUS_09020 937240 937896 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038365.1 protein_id gnl|my_center|LOCUS_09020 938238 937951 gene locus_tag LOCUS_09030 938238 937951 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975777.1 protein_id gnl|my_center|LOCUS_09030 940505 938490 gene locus_tag LOCUS_09040 940505 938490 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226763.1 protein_id gnl|my_center|LOCUS_09040 941917 940562 gene locus_tag LOCUS_09050 941917 940562 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226764.1 protein_id gnl|my_center|LOCUS_09050 941883 942122 gene locus_tag LOCUS_09060 941883 942122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 942285 942857 gene locus_tag LOCUS_09070 942285 942857 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776667.1 protein_id gnl|my_center|LOCUS_09070 943145 943903 gene locus_tag LOCUS_09080 943145 943903 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855465.1 protein_id gnl|my_center|LOCUS_09080 943914 945848 gene locus_tag LOCUS_09090 943914 945848 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_09090 945904 946674 gene locus_tag LOCUS_09100 945904 946674 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_09100 947124 946705 gene locus_tag LOCUS_09110 947124 946705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 947344 947877 gene locus_tag LOCUS_09120 947344 947877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 947989 948330 gene locus_tag LOCUS_09130 947989 948330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 948632 948378 gene locus_tag LOCUS_09140 948632 948378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 949055 948669 gene locus_tag LOCUS_09150 949055 948669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 949660 949052 gene locus_tag LOCUS_09160 949660 949052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 951041 949737 gene locus_tag LOCUS_09170 951041 949737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 951307 951041 gene locus_tag LOCUS_09180 951307 951041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 951519 952517 gene locus_tag LOCUS_09190 951519 952517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922267.1 protein_id gnl|my_center|LOCUS_09190 953205 952777 gene locus_tag LOCUS_09200 953205 952777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 954534 953542 gene locus_tag LOCUS_09210 954534 953542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 956300 954534 gene locus_tag LOCUS_09220 956300 954534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 956517 957113 gene locus_tag LOCUS_09230 956517 957113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 958056 957127 gene locus_tag LOCUS_09240 958056 957127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 958934 958080 gene locus_tag LOCUS_09250 958934 958080 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082947.1 protein_id gnl|my_center|LOCUS_09250 959348 958938 gene locus_tag LOCUS_09260 959348 958938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 960382 959393 gene locus_tag LOCUS_09270 960382 959393 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974145.1 protein_id gnl|my_center|LOCUS_09270 962309 960426 gene locus_tag LOCUS_09280 962309 960426 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776699.1 protein_id gnl|my_center|LOCUS_09280 964234 962306 gene locus_tag LOCUS_09290 964234 962306 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776700.1 protein_id gnl|my_center|LOCUS_09290 965692 964262 gene locus_tag LOCUS_09300 965692 964262 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527142.1 protein_id gnl|my_center|LOCUS_09300 966786 965848 gene locus_tag LOCUS_09310 966786 965848 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522101.1 protein_id gnl|my_center|LOCUS_09310 967268 966780 gene locus_tag LOCUS_09320 967268 966780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 968110 967265 gene locus_tag LOCUS_09330 gene metF 968110 967265 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880925.1 protein_id gnl|my_center|LOCUS_09330 969126 968227 gene locus_tag LOCUS_09340 969126 968227 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974148.1 protein_id gnl|my_center|LOCUS_09340 970735 969173 gene locus_tag LOCUS_09350 gene purH 970735 969173 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721490.1 protein_id gnl|my_center|LOCUS_09350 971503 974160 gene locus_tag LOCUS_09360 971503 974160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 974733 974167 gene locus_tag LOCUS_09370 gene purN 974733 974167 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878360.1 protein_id gnl|my_center|LOCUS_09370 975686 974790 gene locus_tag LOCUS_09380 gene sucD 975686 974790 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881050.1 protein_id gnl|my_center|LOCUS_09380 976868 975720 gene locus_tag LOCUS_09390 gene sucC 976868 975720 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109739.1 protein_id gnl|my_center|LOCUS_09390 977282 978061 gene locus_tag LOCUS_09400 977282 978061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 978282 979052 gene locus_tag LOCUS_09410 978282 979052 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325650.1 protein_id gnl|my_center|LOCUS_09410 979829 979059 gene locus_tag LOCUS_09420 979829 979059 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337268.1 protein_id gnl|my_center|LOCUS_09420 979917 980456 gene locus_tag LOCUS_09430 979917 980456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 981422 980502 gene locus_tag LOCUS_09440 981422 980502 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727131.1 protein_id gnl|my_center|LOCUS_09440 981877 981524 gene locus_tag LOCUS_09450 981877 981524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 983458 981887 gene locus_tag LOCUS_09460 983458 981887 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031160740.1 protein_id gnl|my_center|LOCUS_09460 985752 983455 gene locus_tag LOCUS_09470 gene pcrA 985752 983455 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_09470 987184 985817 gene locus_tag LOCUS_09480 987184 985817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 988651 987413 gene locus_tag LOCUS_09490 988651 987413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 990399 988837 gene locus_tag LOCUS_09500 gene guaA 990399 988837 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893015.1 protein_id gnl|my_center|LOCUS_09500 991529 990396 gene locus_tag LOCUS_09510 991529 990396 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052748.1 protein_id gnl|my_center|LOCUS_09510 992030 991641 gene locus_tag LOCUS_09520 992030 991641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 992831 992112 gene locus_tag LOCUS_09530 992831 992112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 994700 993060 gene locus_tag LOCUS_09540 gene groL 994700 993060 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974210.1 protein_id gnl|my_center|LOCUS_09540 995022 994732 gene locus_tag LOCUS_09550 gene groES 995022 994732 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559922.1 protein_id gnl|my_center|LOCUS_09550 996156 995119 gene locus_tag LOCUS_09560 gene tsaD 996156 995119 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393644.1 protein_id gnl|my_center|LOCUS_09560 996665 996153 gene locus_tag LOCUS_09570 gene rimI 996665 996153 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393645.1 protein_id gnl|my_center|LOCUS_09570 997362 997207 gene locus_tag LOCUS_09580 997362 997207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010059700.1 protein_id gnl|my_center|LOCUS_09580 997904 997614 gene locus_tag LOCUS_09590 997904 997614 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727888.1 protein_id gnl|my_center|LOCUS_09590 998056 998364 gene locus_tag LOCUS_09600 998056 998364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 999104 998403 gene locus_tag LOCUS_09610 gene tsaB 999104 998403 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860649.1 protein_id gnl|my_center|LOCUS_09610 999652 999098 gene locus_tag LOCUS_09620 999652 999098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 1000934 999747 gene locus_tag LOCUS_09630 gene alr 1000934 999747 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143807.1 protein_id gnl|my_center|LOCUS_09630 1002394 1000931 gene locus_tag LOCUS_09640 1002394 1000931 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969363.1 protein_id gnl|my_center|LOCUS_09640 1002978 1002430 gene locus_tag LOCUS_09650 1002978 1002430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 1006472 1002993 gene locus_tag LOCUS_09660 1006472 1002993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 1008068 1006689 gene locus_tag LOCUS_09670 gene glmM 1008068 1006689 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776320.1 protein_id gnl|my_center|LOCUS_09670 1008500 1008108 gene locus_tag LOCUS_09680 1008500 1008108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 1008985 1008521 gene locus_tag LOCUS_09690 gene rplM 1008985 1008521 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974239.1 protein_id gnl|my_center|LOCUS_09690 1010174 1009110 gene locus_tag LOCUS_09700 gene purM 1010174 1009110 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942402.1 protein_id gnl|my_center|LOCUS_09700 1011937 1010171 gene locus_tag LOCUS_09710 gene purF 1011937 1010171 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872463.1 protein_id gnl|my_center|LOCUS_09710 1012301 1012044 gene locus_tag LOCUS_09720 1012301 1012044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 1014636 1012348 gene locus_tag LOCUS_09730 gene purL 1014636 1012348 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 protein_id gnl|my_center|LOCUS_09730 1014796 1015743 gene locus_tag LOCUS_09740 1014796 1015743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 1016663 1015851 gene locus_tag LOCUS_09750 1016663 1015851 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776271.1 protein_id gnl|my_center|LOCUS_09750 1017381 1016701 gene locus_tag LOCUS_09760 gene purQ 1017381 1016701 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594882.1 protein_id gnl|my_center|LOCUS_09760 1017665 1017381 gene locus_tag LOCUS_09770 gene purS 1017665 1017381 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708154.1 protein_id gnl|my_center|LOCUS_09770 1019354 1017747 gene locus_tag LOCUS_09780 gene gpmI 1019354 1017747 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_09780 1020380 1019493 gene locus_tag LOCUS_09790 1020380 1019493 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938096.1 protein_id gnl|my_center|LOCUS_09790 1021842 1020409 gene locus_tag LOCUS_09800 gene purB 1021842 1020409 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027671.1 protein_id gnl|my_center|LOCUS_09800 1022399 1021839 gene locus_tag LOCUS_09810 gene purE 1022399 1021839 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222903.1 protein_id gnl|my_center|LOCUS_09810 1023696 1022425 gene locus_tag LOCUS_09820 1023696 1022425 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219537380.1 protein_id gnl|my_center|LOCUS_09820 1024961 1023699 gene locus_tag LOCUS_09830 gene purD 1024961 1023699 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388404.1 protein_id gnl|my_center|LOCUS_09830 1025031 1026281 gene locus_tag LOCUS_09840 1025031 1026281 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230672.1 protein_id gnl|my_center|LOCUS_09840 1027034 1026351 gene locus_tag LOCUS_09850 1027034 1026351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 1027653 1027153 gene locus_tag LOCUS_09860 1027653 1027153 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731312.1 protein_id gnl|my_center|LOCUS_09860 1028497 1027694 gene locus_tag LOCUS_09870 1028497 1027694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 1029891 1028608 gene locus_tag LOCUS_09880 1029891 1028608 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_09880 1031219 1029933 gene locus_tag LOCUS_09890 1031219 1029933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 1031306 1032898 gene locus_tag LOCUS_09900 1031306 1032898 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530132.1 protein_id gnl|my_center|LOCUS_09900 1034479 1033187 gene locus_tag LOCUS_09910 1034479 1033187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 1036134 1034842 gene locus_tag LOCUS_09920 1036134 1034842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 1037788 1036433 gene locus_tag LOCUS_09930 1037788 1036433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 1038452 1038150 gene locus_tag LOCUS_09940 1038452 1038150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 1039441 1038449 gene locus_tag LOCUS_09950 1039441 1038449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 1041097 1039805 gene locus_tag LOCUS_09960 1041097 1039805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 1041239 1041427 gene locus_tag LOCUS_09970 1041239 1041427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 1042326 1041424 gene locus_tag LOCUS_09980 1042326 1041424 CDS product ISAzo13 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218132780.1 protein_id gnl|my_center|LOCUS_09980 1042636 1042256 gene locus_tag LOCUS_09990 1042636 1042256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 1044673 1042823 gene locus_tag LOCUS_10000 1044673 1042823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 1044953 1045738 gene locus_tag LOCUS_10010 1044953 1045738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 1045738 1046916 gene locus_tag LOCUS_10020 gene csaB 1045738 1046916 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886807.1 protein_id gnl|my_center|LOCUS_10020 1047996 1046926 gene locus_tag LOCUS_10030 1047996 1046926 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230624.1 protein_id gnl|my_center|LOCUS_10030 1049048 1047993 gene locus_tag LOCUS_10040 1049048 1047993 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509752.1 protein_id gnl|my_center|LOCUS_10040 1050366 1049152 gene locus_tag LOCUS_10050 1050366 1049152 CDS product ISAzo13 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218132780.1 protein_id gnl|my_center|LOCUS_10050 1051914 1050475 gene locus_tag LOCUS_10060 1051914 1050475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 1054649 1052082 gene locus_tag LOCUS_10070 gene clpB 1054649 1052082 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230863.1 protein_id gnl|my_center|LOCUS_10070 1054848 1055528 gene locus_tag LOCUS_10080 1054848 1055528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 1055560 1056453 gene locus_tag LOCUS_10090 1055560 1056453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 1057416 1056472 gene locus_tag LOCUS_10100 1057416 1056472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 1059472 1057493 gene locus_tag LOCUS_10110 1059472 1057493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 1060803 1059469 gene locus_tag LOCUS_10120 1060803 1059469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 1060961 1061968 gene locus_tag LOCUS_10130 gene ligD 1060961 1061968 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972287.1 protein_id gnl|my_center|LOCUS_10130 1062927 1062046 gene locus_tag LOCUS_10140 1062927 1062046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 1065196 1062983 gene locus_tag LOCUS_10150 1065196 1062983 CDS product bifunctional glycosyltransferase/CDP-glycerol:glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028440.1 protein_id gnl|my_center|LOCUS_10150 1065848 1065417 gene locus_tag LOCUS_10160 1065848 1065417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 1067342 1066338 gene locus_tag LOCUS_10170 1067342 1066338 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989636.1 protein_id gnl|my_center|LOCUS_10170 1067645 1069057 gene locus_tag LOCUS_10180 1067645 1069057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 1069149 1070156 gene locus_tag LOCUS_10190 1069149 1070156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1070784 1071104 gene locus_tag LOCUS_10200 1070784 1071104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 1071247 1072224 gene locus_tag LOCUS_10210 1071247 1072224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 1072428 1073420 gene locus_tag LOCUS_10220 1072428 1073420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 1073799 1074173 gene locus_tag LOCUS_10230 1073799 1074173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10230 1074909 1075844 gene locus_tag LOCUS_10240 1074909 1075844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10240 1075917 1078469 gene locus_tag LOCUS_10250 1075917 1078469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10250 1078372 1078677 gene locus_tag LOCUS_10260 1078372 1078677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10260 1078866 1079672 gene locus_tag LOCUS_10270 1078866 1079672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1079691 1080800 gene locus_tag LOCUS_10280 1079691 1080800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1080904 1082985 gene locus_tag LOCUS_10290 1080904 1082985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 1083943 1083011 gene locus_tag LOCUS_10300 1083943 1083011 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172618.1 protein_id gnl|my_center|LOCUS_10300 1084019 1085773 gene locus_tag LOCUS_10310 gene argS 1084019 1085773 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804295.1 protein_id gnl|my_center|LOCUS_10310 1085776 1086747 gene locus_tag LOCUS_10320 1085776 1086747 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980841.1 protein_id gnl|my_center|LOCUS_10320 1086768 1088399 gene locus_tag LOCUS_10330 1086768 1088399 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529293.1 protein_id gnl|my_center|LOCUS_10330 1088432 1089760 gene locus_tag LOCUS_10340 1088432 1089760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 1089757 1091985 gene locus_tag LOCUS_10350 1089757 1091985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10350 1092000 1092170 gene locus_tag LOCUS_10360 1092000 1092170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 1092242 1092988 gene locus_tag LOCUS_10370 1092242 1092988 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_10370 1093105 1094370 gene locus_tag LOCUS_10380 1093105 1094370 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750457.1 protein_id gnl|my_center|LOCUS_10380 1094441 1095997 gene locus_tag LOCUS_10390 1094441 1095997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 1096204 1096917 gene locus_tag LOCUS_10400 1096204 1096917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 1096997 1098184 gene locus_tag LOCUS_10410 1096997 1098184 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225716.1 protein_id gnl|my_center|LOCUS_10410 1098276 1099358 gene locus_tag LOCUS_10420 1098276 1099358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 1100685 1099405 gene locus_tag LOCUS_10430 1100685 1099405 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920336.1 protein_id gnl|my_center|LOCUS_10430 1100802 1102331 gene locus_tag LOCUS_10440 1100802 1102331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 1102687 1104087 gene locus_tag LOCUS_10450 1102687 1104087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 1104187 1104684 gene locus_tag LOCUS_10460 1104187 1104684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 1105005 1105343 gene locus_tag LOCUS_10470 1105005 1105343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 1105909 1105250 gene locus_tag LOCUS_10480 1105909 1105250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 1106649 1105906 gene locus_tag LOCUS_10490 1106649 1105906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 1106707 1107525 gene locus_tag LOCUS_10500 1106707 1107525 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086373.1 protein_id gnl|my_center|LOCUS_10500 1109153 1107846 gene locus_tag LOCUS_10510 1109153 1107846 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731195.1 protein_id gnl|my_center|LOCUS_10510 1109259 1110293 gene locus_tag LOCUS_10520 1109259 1110293 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900084.1 protein_id gnl|my_center|LOCUS_10520 1110384 1110992 gene locus_tag LOCUS_10530 1110384 1110992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 1111104 1111712 gene locus_tag LOCUS_10540 1111104 1111712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 1111856 1114348 gene locus_tag LOCUS_10550 1111856 1114348 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030487.1 protein_id gnl|my_center|LOCUS_10550 1115410 1114391 gene locus_tag LOCUS_10560 1115410 1114391 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230730.1 protein_id gnl|my_center|LOCUS_10560 1115484 1116401 gene locus_tag LOCUS_10570 1115484 1116401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728926.1 protein_id gnl|my_center|LOCUS_10570 1116480 1118528 gene locus_tag LOCUS_10580 1116480 1118528 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805040.1 protein_id gnl|my_center|LOCUS_10580 1118873 1118547 gene locus_tag LOCUS_10590 1118873 1118547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 1119111 1118896 gene locus_tag LOCUS_10600 1119111 1118896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 1119847 1119212 gene locus_tag LOCUS_10610 1119847 1119212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 1120569 1119844 gene locus_tag LOCUS_10620 1120569 1119844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 1120633 1122957 gene locus_tag LOCUS_10630 1120633 1122957 CDS product acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071198.1 protein_id gnl|my_center|LOCUS_10630 1123935 1122964 gene locus_tag LOCUS_10640 gene gluQRS 1123935 1122964 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897726.1 protein_id gnl|my_center|LOCUS_10640 1123922 1125184 gene locus_tag LOCUS_10650 gene lhgO 1123922 1125184 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974860.1 protein_id gnl|my_center|LOCUS_10650 1125783 1125451 gene locus_tag LOCUS_10660 1125783 1125451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1126139 1126771 gene locus_tag LOCUS_10670 1126139 1126771 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 protein_id gnl|my_center|LOCUS_10670 1130745 1126768 gene locus_tag LOCUS_10680 1130745 1126768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 1130990 1131724 gene locus_tag LOCUS_10690 1130990 1131724 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975722.1 protein_id gnl|my_center|LOCUS_10690 1131753 1134389 gene locus_tag LOCUS_10700 1131753 1134389 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027530.1 protein_id gnl|my_center|LOCUS_10700 1134451 1134837 gene locus_tag LOCUS_10710 1134451 1134837 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284874.1 protein_id gnl|my_center|LOCUS_10710 1135580 1134900 gene locus_tag LOCUS_10720 gene pncA 1135580 1134900 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942927.1 protein_id gnl|my_center|LOCUS_10720 1135637 1137202 gene locus_tag LOCUS_10730 1135637 1137202 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228072.1 protein_id gnl|my_center|LOCUS_10730 1137539 1137150 gene locus_tag LOCUS_10740 1137539 1137150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 1138424 1137570 gene locus_tag LOCUS_10750 1138424 1137570 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836183.1 protein_id gnl|my_center|LOCUS_10750 1139790 1138510 gene locus_tag LOCUS_10760 1139790 1138510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 1141141 1139975 gene locus_tag LOCUS_10770 1141141 1139975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 1144577 1141149 gene locus_tag LOCUS_10780 1144577 1141149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 1145935 1144604 gene locus_tag LOCUS_10790 1145935 1144604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 1146987 1145932 gene locus_tag LOCUS_10800 1146987 1145932 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390838.1 protein_id gnl|my_center|LOCUS_10800 1148368 1147079 gene locus_tag LOCUS_10810 gene hemL 1148368 1147079 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929733.1 protein_id gnl|my_center|LOCUS_10810 1149360 1148422 gene locus_tag LOCUS_10820 gene hemB 1149360 1148422 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776657.1 protein_id gnl|my_center|LOCUS_10820 1150555 1149548 gene locus_tag LOCUS_10830 1150555 1149548 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222468.1 protein_id gnl|my_center|LOCUS_10830 1151430 1150684 gene locus_tag LOCUS_10840 1151430 1150684 CDS product decaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907849.1 protein_id gnl|my_center|LOCUS_10840 1152393 1151650 gene locus_tag LOCUS_10850 1152393 1151650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 1153393 1152482 gene locus_tag LOCUS_10860 gene hemC 1153393 1152482 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208189.1 protein_id gnl|my_center|LOCUS_10860 1154640 1153390 gene locus_tag LOCUS_10870 gene hemA 1154640 1153390 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392764.1 protein_id gnl|my_center|LOCUS_10870 1155489 1154770 gene locus_tag LOCUS_10880 1155489 1154770 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975516.1 protein_id gnl|my_center|LOCUS_10880 1157172 1155565 gene locus_tag LOCUS_10890 1157172 1155565 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228698.1 protein_id gnl|my_center|LOCUS_10890 1158269 1157277 gene locus_tag LOCUS_10900 1158269 1157277 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230769.1 protein_id gnl|my_center|LOCUS_10900 1159117 1158266 gene locus_tag LOCUS_10910 gene proC 1159117 1158266 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943177.1 protein_id gnl|my_center|LOCUS_10910 1159591 1159127 gene locus_tag LOCUS_10920 1159591 1159127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 1160881 1159652 gene locus_tag LOCUS_10930 gene mshA 1160881 1159652 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402367.1 protein_id gnl|my_center|LOCUS_10930 1161381 1160935 gene locus_tag LOCUS_10940 1161381 1160935 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222362.1 protein_id gnl|my_center|LOCUS_10940 1162569 1161454 gene locus_tag LOCUS_10950 1162569 1161454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 1162453 1162779 gene locus_tag LOCUS_10960 1162453 1162779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 1163108 1162941 gene locus_tag LOCUS_10970 1163108 1162941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 1163304 1163897 gene locus_tag LOCUS_10980 1163304 1163897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 1164124 1163936 gene locus_tag LOCUS_10990 1164124 1163936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 1164181 1164639 gene locus_tag LOCUS_11000 1164181 1164639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 1164714 1164790 gene locus_tag LOCUS_t00120 1164714 1164790 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1164867 1165433 gene locus_tag LOCUS_11010 1164867 1165433 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005123515.1 protein_id gnl|my_center|LOCUS_11010 1165385 1166674 gene locus_tag LOCUS_11020 1165385 1166674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 1167245 1166679 gene locus_tag LOCUS_11030 1167245 1166679 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226185.1 protein_id gnl|my_center|LOCUS_11030 1167395 1167805 gene locus_tag LOCUS_11040 1167395 1167805 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031862.1 protein_id gnl|my_center|LOCUS_11040 1167898 1168128 gene locus_tag LOCUS_11050 1167898 1168128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 1168241 1168612 gene locus_tag LOCUS_11060 1168241 1168612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 1168912 1169307 gene locus_tag LOCUS_11070 1168912 1169307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 1169906 1169238 gene locus_tag LOCUS_11080 1169906 1169238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 1170384 1170148 gene locus_tag LOCUS_11090 1170384 1170148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 1170532 1170846 gene locus_tag LOCUS_11100 1170532 1170846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 1170834 1171259 gene locus_tag LOCUS_11110 1170834 1171259 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403246.1 protein_id gnl|my_center|LOCUS_11110 1173751 1171286 gene locus_tag LOCUS_11120 1173751 1171286 CDS product acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071198.1 protein_id gnl|my_center|LOCUS_11120 1174034 1177000 gene locus_tag LOCUS_11130 1174034 1177000 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224374.1 protein_id gnl|my_center|LOCUS_11130 1176997 1178136 gene locus_tag LOCUS_11140 1176997 1178136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027625.1 protein_id gnl|my_center|LOCUS_11140 1178207 1178392 gene locus_tag LOCUS_11150 1178207 1178392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 1178430 1179239 gene locus_tag LOCUS_11160 1178430 1179239 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_11160 1180696 1179257 gene locus_tag LOCUS_11170 1180696 1179257 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284439.1 protein_id gnl|my_center|LOCUS_11170 1181532 1180795 gene locus_tag LOCUS_11180 1181532 1180795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1182536 1181529 gene locus_tag LOCUS_11190 1182536 1181529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 1182683 1183708 gene locus_tag LOCUS_11200 1182683 1183708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 1183757 1185322 gene locus_tag LOCUS_11210 1183757 1185322 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223097.1 protein_id gnl|my_center|LOCUS_11210 1185395 1186915 gene locus_tag LOCUS_11220 1185395 1186915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 1187016 1187534 gene locus_tag LOCUS_11230 1187016 1187534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 1187590 1187892 gene locus_tag LOCUS_11240 1187590 1187892 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726761.1 protein_id gnl|my_center|LOCUS_11240 1187938 1190307 gene locus_tag LOCUS_11250 1187938 1190307 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730259.1 protein_id gnl|my_center|LOCUS_11250 1191679 1190393 gene locus_tag LOCUS_11260 1191679 1190393 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466839.1 protein_id gnl|my_center|LOCUS_11260 1191895 1193097 gene locus_tag LOCUS_11270 1191895 1193097 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090103.1 protein_id gnl|my_center|LOCUS_11270 1193536 1193111 gene locus_tag LOCUS_11280 1193536 1193111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 1193665 1195932 gene locus_tag LOCUS_11290 1193665 1195932 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257680.1 protein_id gnl|my_center|LOCUS_11290 1196074 1196754 gene locus_tag LOCUS_11300 1196074 1196754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1196816 1196995 gene locus_tag LOCUS_11310 1196816 1196995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 1197811 1197242 gene locus_tag LOCUS_11320 gene dcd 1197811 1197242 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401638.1 protein_id gnl|my_center|LOCUS_11320 1198224 1197904 gene locus_tag LOCUS_11330 1198224 1197904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 1198625 1198290 gene locus_tag LOCUS_11340 1198625 1198290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 1198796 1200091 gene locus_tag LOCUS_11350 1198796 1200091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 1200088 1200507 gene locus_tag LOCUS_11360 1200088 1200507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 1200589 1202805 gene locus_tag LOCUS_11370 1200589 1202805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1204099 1202816 gene locus_tag LOCUS_11380 1204099 1202816 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804406.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11380 1204968 1204207 gene locus_tag LOCUS_11390 1204968 1204207 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029304386.1 protein_id gnl|my_center|LOCUS_11390 1205073 1205768 gene locus_tag LOCUS_11400 1205073 1205768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 1205858 1206319 gene locus_tag LOCUS_11410 gene arfB 1205858 1206319 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776269.1 protein_id gnl|my_center|LOCUS_11410 1206845 1206345 gene locus_tag LOCUS_11420 1206845 1206345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1206917 1209124 gene locus_tag LOCUS_11430 gene scpA 1206917 1209124 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222826.1 protein_id gnl|my_center|LOCUS_11430 1209166 1209789 gene locus_tag LOCUS_11440 gene upp 1209166 1209789 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222797.1 protein_id gnl|my_center|LOCUS_11440 1209814 1210446 gene locus_tag LOCUS_11450 1209814 1210446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 1210591 1211382 gene locus_tag LOCUS_11460 1210591 1211382 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090906.1 protein_id gnl|my_center|LOCUS_11460 1211494 1212393 gene locus_tag LOCUS_11470 1211494 1212393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 1213526 1212390 gene locus_tag LOCUS_11480 1213526 1212390 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026954.1 protein_id gnl|my_center|LOCUS_11480 1214881 1213523 gene locus_tag LOCUS_11490 1214881 1213523 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026955.1 protein_id gnl|my_center|LOCUS_11490 1214955 1215968 gene locus_tag LOCUS_11500 gene meaB 1214955 1215968 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390231.1 protein_id gnl|my_center|LOCUS_11500 1216101 1216017 gene locus_tag LOCUS_t00130 1216101 1216017 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1216208 1216882 gene locus_tag LOCUS_11510 1216208 1216882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 1216929 1217393 gene locus_tag LOCUS_11520 1216929 1217393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 1217390 1218901 gene locus_tag LOCUS_11530 1217390 1218901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 1218898 1220229 gene locus_tag LOCUS_11540 1218898 1220229 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222006.1 protein_id gnl|my_center|LOCUS_11540 1220226 1221776 gene locus_tag LOCUS_11550 1220226 1221776 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776672.1 protein_id gnl|my_center|LOCUS_11550 1221883 1223952 gene locus_tag LOCUS_11560 gene ireK 1221883 1223952 CDS product serine/threonine protein kinase IreK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387383.1 protein_id gnl|my_center|LOCUS_11560 1223952 1224998 gene locus_tag LOCUS_11570 1223952 1224998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1224995 1226263 gene locus_tag LOCUS_11580 1224995 1226263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1226868 1226281 gene locus_tag LOCUS_11590 1226868 1226281 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257601.1 protein_id gnl|my_center|LOCUS_11590 1226916 1227335 gene locus_tag LOCUS_11600 1226916 1227335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 1227856 1227449 gene locus_tag LOCUS_11610 1227856 1227449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 1229132 1227924 gene locus_tag LOCUS_11620 1229132 1227924 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226452.1 protein_id gnl|my_center|LOCUS_11620 1229328 1231118 gene locus_tag LOCUS_11630 1229328 1231118 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229431.1 protein_id gnl|my_center|LOCUS_11630 1231607 1231131 gene locus_tag LOCUS_11640 1231607 1231131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 1231804 1232670 gene locus_tag LOCUS_11650 1231804 1232670 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085614.1 protein_id gnl|my_center|LOCUS_11650 1232853 1234370 gene locus_tag LOCUS_11660 1232853 1234370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1234367 1236055 gene locus_tag LOCUS_11670 gene sulP 1234367 1236055 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163161279.1 protein_id gnl|my_center|LOCUS_11670 1236178 1236104 gene locus_tag LOCUS_t00140 1236178 1236104 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1237190 1236294 gene locus_tag LOCUS_11680 1237190 1236294 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112523.1 protein_id gnl|my_center|LOCUS_11680 1237393 1238349 gene locus_tag LOCUS_11690 1237393 1238349 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208036286.1 protein_id gnl|my_center|LOCUS_11690 1239988 1238303 gene locus_tag LOCUS_11700 1239988 1238303 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727596.1 protein_id gnl|my_center|LOCUS_11700 1241357 1240734 gene locus_tag LOCUS_11710 1241357 1240734 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632821.1 protein_id gnl|my_center|LOCUS_11710 1242565 1241369 gene locus_tag LOCUS_11720 1242565 1241369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 1242840 1242595 gene locus_tag LOCUS_11730 1242840 1242595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 1243130 1244095 gene locus_tag LOCUS_11740 1243130 1244095 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_11740 1244128 1244775 gene locus_tag LOCUS_11750 1244128 1244775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1245134 1244871 gene locus_tag LOCUS_11760 1245134 1244871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 1246639 1245131 gene locus_tag LOCUS_11770 gene xseA 1246639 1245131 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113813.1 protein_id gnl|my_center|LOCUS_11770 1248586 1246703 gene locus_tag LOCUS_11780 1248586 1246703 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224732.1 protein_id gnl|my_center|LOCUS_11780 1250273 1248642 gene locus_tag LOCUS_11790 1250273 1248642 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742163.1 protein_id gnl|my_center|LOCUS_11790 1251705 1250428 gene locus_tag LOCUS_11800 1251705 1250428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 1251920 1253329 gene locus_tag LOCUS_11810 1251920 1253329 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899345.1 protein_id gnl|my_center|LOCUS_11810 1253825 1253364 gene locus_tag LOCUS_11820 1253825 1253364 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731391.1 protein_id gnl|my_center|LOCUS_11820 1255479 1253896 gene locus_tag LOCUS_11830 1255479 1253896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 1256041 1256379 gene locus_tag LOCUS_11840 1256041 1256379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 1257128 1256931 gene locus_tag LOCUS_11850 1257128 1256931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1257127 1257627 gene locus_tag LOCUS_11860 1257127 1257627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 1259531 1257567 gene locus_tag LOCUS_11870 1259531 1257567 CDS product chromosome condensation regulator RCC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258200.1 protein_id gnl|my_center|LOCUS_11870 1259608 1259979 gene locus_tag LOCUS_11880 1259608 1259979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 1264284 1261714 gene locus_tag LOCUS_11890 1264284 1261714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 1264647 1265072 gene locus_tag LOCUS_11900 1264647 1265072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 1265731 1265345 gene locus_tag LOCUS_11910 1265731 1265345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 1266355 1265840 gene locus_tag LOCUS_11920 1266355 1265840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 1266828 1266361 gene locus_tag LOCUS_11930 1266828 1266361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 1267284 1267199 gene locus_tag LOCUS_t00150 1267284 1267199 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1267906 1267505 gene locus_tag LOCUS_11940 1267906 1267505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 1268112 1267903 gene locus_tag LOCUS_11950 1268112 1267903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 1269135 1268539 gene locus_tag LOCUS_11960 1269135 1268539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 1269348 1269148 gene locus_tag LOCUS_11970 1269348 1269148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 1270038 1269953 gene locus_tag LOCUS_t00160 1270038 1269953 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1270747 1270535 gene locus_tag LOCUS_11980 1270747 1270535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 1271007 1270744 gene locus_tag LOCUS_11990 1271007 1270744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 1271612 1272085 gene locus_tag LOCUS_12000 1271612 1272085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 1273609 1272371 gene locus_tag LOCUS_12010 1273609 1272371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 1273918 1274364 gene locus_tag LOCUS_12020 1273918 1274364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 1275833 1274688 gene locus_tag LOCUS_12030 1275833 1274688 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531626.1 protein_id gnl|my_center|LOCUS_12030 1276050 1275965 gene locus_tag LOCUS_t00170 1276050 1275965 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1276694 1276356 gene locus_tag LOCUS_12040 1276694 1276356 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058065.1 protein_id gnl|my_center|LOCUS_12040 1276993 1276691 gene locus_tag LOCUS_12050 1276993 1276691 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921003.1 protein_id gnl|my_center|LOCUS_12050 1278583 1278290 gene locus_tag LOCUS_12060 1278583 1278290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 1279255 1279034 gene locus_tag LOCUS_12070 1279255 1279034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 1279542 1279457 gene locus_tag LOCUS_t00180 1279542 1279457 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1280254 1280466 gene locus_tag LOCUS_12080 1280254 1280466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 1281376 1280912 gene locus_tag LOCUS_12090 1281376 1280912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 1285081 1281671 gene locus_tag LOCUS_12100 1285081 1281671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 1285684 1285283 gene locus_tag LOCUS_12110 1285684 1285283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 1289608 1285919 gene locus_tag LOCUS_12120 1289608 1285919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 1290151 1290981 gene locus_tag LOCUS_12130 1290151 1290981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 1293011 1292682 gene locus_tag LOCUS_12140 1293011 1292682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 1293087 1293359 gene locus_tag LOCUS_12150 1293087 1293359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 1294795 1293698 gene locus_tag LOCUS_12160 1294795 1293698 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533549.1 protein_id gnl|my_center|LOCUS_12160 1295110 1294811 gene locus_tag LOCUS_12170 1295110 1294811 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533548.1 protein_id gnl|my_center|LOCUS_12170 1296790 1295294 gene locus_tag LOCUS_12180 1296790 1295294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 1297440 1297261 gene locus_tag LOCUS_12190 1297440 1297261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 1298092 1297661 gene locus_tag LOCUS_12200 1298092 1297661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1298385 1299023 gene locus_tag LOCUS_12210 1298385 1299023 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394499.1 protein_id gnl|my_center|LOCUS_12210 1303035 1299619 gene locus_tag LOCUS_12220 1303035 1299619 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022389.1 protein_id gnl|my_center|LOCUS_12220 1304234 1303032 gene locus_tag LOCUS_12230 1304234 1303032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 1305778 1304231 gene locus_tag LOCUS_12240 1305778 1304231 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778938.1 protein_id gnl|my_center|LOCUS_12240 1306219 1306389 gene locus_tag LOCUS_12250 1306219 1306389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 1306453 1307181 gene locus_tag LOCUS_12260 1306453 1307181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 1308273 1307512 gene locus_tag LOCUS_12270 1308273 1307512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 1308761 1309258 gene locus_tag LOCUS_12280 1308761 1309258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 1310574 1309585 gene locus_tag LOCUS_12290 1310574 1309585 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970282.1 protein_id gnl|my_center|LOCUS_12290 1311491 1310571 gene locus_tag LOCUS_12300 1311491 1310571 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764770.1 protein_id gnl|my_center|LOCUS_12300 1312705 1311488 gene locus_tag LOCUS_12310 1312705 1311488 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764772.1 protein_id gnl|my_center|LOCUS_12310 1313713 1312760 gene locus_tag LOCUS_12320 1313713 1312760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 1313926 1313837 gene locus_tag LOCUS_t00190 1313926 1313837 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1314795 1314112 gene locus_tag LOCUS_12330 1314795 1314112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 1315449 1314952 gene locus_tag LOCUS_12340 gene tadA 1315449 1314952 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974924.1 protein_id gnl|my_center|LOCUS_12340 1316748 1316038 gene locus_tag LOCUS_12350 gene ric 1316748 1316038 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401371.1 protein_id gnl|my_center|LOCUS_12350 1317672 1316800 gene locus_tag LOCUS_12360 1317672 1316800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 1317947 1317672 gene locus_tag LOCUS_12370 1317947 1317672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 1317946 1318599 gene locus_tag LOCUS_12380 1317946 1318599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 1319103 1318633 gene locus_tag LOCUS_12390 1319103 1318633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 1319528 1319100 gene locus_tag LOCUS_12400 1319528 1319100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 1319816 1319727 gene locus_tag LOCUS_t00200 1319816 1319727 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1320103 1319894 gene locus_tag LOCUS_12410 1320103 1319894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1320893 1320183 gene locus_tag LOCUS_12420 1320893 1320183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 1321668 1320898 gene locus_tag LOCUS_12430 1321668 1320898 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030982.1 protein_id gnl|my_center|LOCUS_12430 1322120 1321665 gene locus_tag LOCUS_12440 1322120 1321665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 1322450 1322124 gene locus_tag LOCUS_12450 1322450 1322124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 1323639 1322545 gene locus_tag LOCUS_12460 1323639 1322545 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257747.1 protein_id gnl|my_center|LOCUS_12460 1323750 1323956 gene locus_tag LOCUS_12470 1323750 1323956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 1324071 1327742 gene locus_tag LOCUS_12480 1324071 1327742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 1327742 1329091 gene locus_tag LOCUS_12490 1327742 1329091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 1329878 1329231 gene locus_tag LOCUS_12500 1329878 1329231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12500 1332332 1330671 gene locus_tag LOCUS_12510 1332332 1330671 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932359.1 protein_id gnl|my_center|LOCUS_12510 1333756 1333229 gene locus_tag LOCUS_12520 1333756 1333229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 1334445 1333798 gene locus_tag LOCUS_12530 1334445 1333798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 1335075 1334776 gene locus_tag LOCUS_12540 1335075 1334776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 1335369 1335728 gene locus_tag LOCUS_12550 1335369 1335728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 1336659 1336228 gene locus_tag LOCUS_12560 1336659 1336228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 1337096 1336656 gene locus_tag LOCUS_12570 1337096 1336656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 1338393 1337248 gene locus_tag LOCUS_12580 1338393 1337248 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531626.1 protein_id gnl|my_center|LOCUS_12580 1338612 1338525 gene locus_tag LOCUS_t00210 1338612 1338525 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1338728 1339483 gene locus_tag LOCUS_12590 1338728 1339483 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226852.1 protein_id gnl|my_center|LOCUS_12590 1339877 1341274 gene locus_tag LOCUS_12600 1339877 1341274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 1342655 1341186 gene locus_tag LOCUS_12610 1342655 1341186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 1343218 1342652 gene locus_tag LOCUS_12620 1343218 1342652 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896605.1 protein_id gnl|my_center|LOCUS_12620 1343394 1345415 gene locus_tag LOCUS_12630 1343394 1345415 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390233.1 protein_id gnl|my_center|LOCUS_12630 1345412 1346026 gene locus_tag LOCUS_12640 1345412 1346026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 1346248 1347186 gene locus_tag LOCUS_12650 1346248 1347186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 1347212 1347307 gene locus_tag LOCUS_t00220 1347212 1347307 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 1349042 1347390 gene locus_tag LOCUS_12660 1349042 1347390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 1349188 1349694 gene locus_tag LOCUS_12670 1349188 1349694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 1349691 1350320 gene locus_tag LOCUS_12680 1349691 1350320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 1351745 1350312 gene locus_tag LOCUS_12690 gene hemG 1351745 1350312 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224513.1 protein_id gnl|my_center|LOCUS_12690 1352741 1351776 gene locus_tag LOCUS_12700 gene hemH 1352741 1351776 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727378.1 protein_id gnl|my_center|LOCUS_12700 1353876 1352722 gene locus_tag LOCUS_12710 gene hemE 1353876 1352722 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972892.1 protein_id gnl|my_center|LOCUS_12710 1353992 1356370 gene locus_tag LOCUS_12720 1353992 1356370 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029575.1 protein_id gnl|my_center|LOCUS_12720 1356821 1356411 gene locus_tag LOCUS_12730 1356821 1356411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 1357060 1357998 gene locus_tag LOCUS_12740 1357060 1357998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12740 1358057 1358218 gene locus_tag LOCUS_12750 1358057 1358218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 1358334 1359122 gene locus_tag LOCUS_12760 1358334 1359122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 1359296 1359631 gene locus_tag LOCUS_12770 1359296 1359631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 1359635 1360039 gene locus_tag LOCUS_12780 1359635 1360039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12780 1360170 1360976 gene locus_tag LOCUS_12790 1360170 1360976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 1360969 1361727 gene locus_tag LOCUS_12800 1360969 1361727 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140371.1 protein_id gnl|my_center|LOCUS_12800 1361724 1362662 gene locus_tag LOCUS_12810 1361724 1362662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12810 1362647 1363057 gene locus_tag LOCUS_12820 1362647 1363057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12820 1363846 1363160 gene locus_tag LOCUS_12830 1363846 1363160 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224289.1 protein_id gnl|my_center|LOCUS_12830 1364066 1363848 gene locus_tag LOCUS_12840 1364066 1363848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 1364156 1364689 gene locus_tag LOCUS_12850 1364156 1364689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 1364764 1366230 gene locus_tag LOCUS_12860 1364764 1366230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 1366420 1367484 gene locus_tag LOCUS_12870 1366420 1367484 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229859.1 protein_id gnl|my_center|LOCUS_12870 1368557 1367526 gene locus_tag LOCUS_12880 gene bioB 1368557 1367526 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705387.1 protein_id gnl|my_center|LOCUS_12880 1368651 1369049 gene locus_tag LOCUS_12890 1368651 1369049 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728561.1 protein_id gnl|my_center|LOCUS_12890 1369165 1369091 gene locus_tag LOCUS_t00230 1369165 1369091 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1369637 1369215 gene locus_tag LOCUS_12900 1369637 1369215 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896644.1 protein_id gnl|my_center|LOCUS_12900 1369728 1372976 gene locus_tag LOCUS_12910 1369728 1372976 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027462.1 protein_id gnl|my_center|LOCUS_12910 1373707 1373030 gene locus_tag LOCUS_12920 1373707 1373030 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723280.1 protein_id gnl|my_center|LOCUS_12920 1374810 1373713 gene locus_tag LOCUS_12930 1374810 1373713 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990019.1 protein_id gnl|my_center|LOCUS_12930 1376037 1374868 gene locus_tag LOCUS_12940 1376037 1374868 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413230.1 protein_id gnl|my_center|LOCUS_12940 1376215 1377660 gene locus_tag LOCUS_12950 1376215 1377660 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228721.1 protein_id gnl|my_center|LOCUS_12950 1378843 1377683 gene locus_tag LOCUS_12960 gene lnrN 1378843 1377683 CDS product linearmycin resistance permease LnrN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243650.1 protein_id gnl|my_center|LOCUS_12960 1380024 1378840 gene locus_tag LOCUS_12970 1380024 1378840 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812266.1 protein_id gnl|my_center|LOCUS_12970 1380968 1380027 gene locus_tag LOCUS_12980 gene lnrL 1380968 1380027 CDS product linearmycin resistance ATP-binding protein LnrL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244346.1 protein_id gnl|my_center|LOCUS_12980 1381176 1381640 gene locus_tag LOCUS_12990 1381176 1381640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 1381685 1382479 gene locus_tag LOCUS_13000 1381685 1382479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 1385461 1382561 gene locus_tag LOCUS_13010 gene leuS 1385461 1382561 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231035.1 protein_id gnl|my_center|LOCUS_13010 1385680 1386510 gene locus_tag LOCUS_13020 1385680 1386510 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080038.1 protein_id gnl|my_center|LOCUS_13020 1386541 1387461 gene locus_tag LOCUS_13030 1386541 1387461 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030587.1 protein_id gnl|my_center|LOCUS_13030 1389000 1387633 gene locus_tag LOCUS_13040 1389000 1387633 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228765.1 protein_id gnl|my_center|LOCUS_13040 1390069 1389023 gene locus_tag LOCUS_13050 1390069 1389023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 1391951 1390089 gene locus_tag LOCUS_13060 1391951 1390089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13060 1392722 1393150 gene locus_tag LOCUS_13070 1392722 1393150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 1393241 1394215 gene locus_tag LOCUS_13080 1393241 1394215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 1394807 1395106 gene locus_tag LOCUS_13090 1394807 1395106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 1395651 1395088 gene locus_tag LOCUS_13100 1395651 1395088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 1395816 1399826 gene locus_tag LOCUS_13110 1395816 1399826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 1399948 1400199 gene locus_tag LOCUS_13120 1399948 1400199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1400193 1400516 gene locus_tag LOCUS_13130 1400193 1400516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 1401861 1400518 gene locus_tag LOCUS_13140 1401861 1400518 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899946.1 protein_id gnl|my_center|LOCUS_13140 1402560 1401904 gene locus_tag LOCUS_13150 1402560 1401904 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368844.1 protein_id gnl|my_center|LOCUS_13150 1402807 1402553 gene locus_tag LOCUS_13160 1402807 1402553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 1403346 1402804 gene locus_tag LOCUS_13170 1403346 1402804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 1403960 1403343 gene locus_tag LOCUS_13180 1403960 1403343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 1406248 1403957 gene locus_tag LOCUS_13190 gene nasC 1406248 1403957 CDS product assimilatory nitrate reductase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246484.1 protein_id gnl|my_center|LOCUS_13190 1407253 1406258 gene locus_tag LOCUS_13200 1407253 1406258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 1408366 1407878 gene locus_tag LOCUS_13210 1408366 1407878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 1409159 1409010 gene locus_tag LOCUS_13220 1409159 1409010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 1411135 1409360 gene locus_tag LOCUS_13230 1411135 1409360 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223119.1 protein_id gnl|my_center|LOCUS_13230 1412227 1411208 gene locus_tag LOCUS_13240 1412227 1411208 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028199.1 protein_id gnl|my_center|LOCUS_13240 1412396 1413739 gene locus_tag LOCUS_13250 gene glnA 1412396 1413739 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223124.1 protein_id gnl|my_center|LOCUS_13250 1413788 1414528 gene locus_tag LOCUS_13260 1413788 1414528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 1414697 1414539 gene locus_tag LOCUS_13270 1414697 1414539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 1415141 1414761 gene locus_tag LOCUS_13280 1415141 1414761 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788735.1 protein_id gnl|my_center|LOCUS_13280 1416196 1415183 gene locus_tag LOCUS_13290 1416196 1415183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082933.1 protein_id gnl|my_center|LOCUS_13290 1417739 1416204 gene locus_tag LOCUS_13300 1417739 1416204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 1418238 1417921 gene locus_tag LOCUS_13310 1418238 1417921 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976654.1 protein_id gnl|my_center|LOCUS_13310 1419934 1418432 gene locus_tag LOCUS_13320 1419934 1418432 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528938.1 protein_id gnl|my_center|LOCUS_13320 1420677 1419997 gene locus_tag LOCUS_13330 1420677 1419997 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727432.1 protein_id gnl|my_center|LOCUS_13330 1420762 1422102 gene locus_tag LOCUS_13340 1420762 1422102 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921045.1 protein_id gnl|my_center|LOCUS_13340 1422982 1422116 gene locus_tag LOCUS_13350 1422982 1422116 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230560.1 protein_id gnl|my_center|LOCUS_13350 1423066 1424382 gene locus_tag LOCUS_13360 gene selA 1423066 1424382 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256909.1 protein_id gnl|my_center|LOCUS_13360 1424432 1426192 gene locus_tag LOCUS_13370 gene selB 1424432 1426192 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256152.1 protein_id gnl|my_center|LOCUS_13370 1426487 1426218 gene locus_tag LOCUS_13380 1426487 1426218 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907698.1 protein_id gnl|my_center|LOCUS_13380 1427957 1426647 gene locus_tag LOCUS_13390 1427957 1426647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 1428062 1429030 gene locus_tag LOCUS_13400 1428062 1429030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1429042 1430196 gene locus_tag LOCUS_13410 1429042 1430196 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_13410 1430569 1430225 gene locus_tag LOCUS_13420 1430569 1430225 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081714.1 protein_id gnl|my_center|LOCUS_13420 1430806 1431234 gene locus_tag LOCUS_13430 1430806 1431234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 1432701 1431322 gene locus_tag LOCUS_13440 1432701 1431322 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974129.1 protein_id gnl|my_center|LOCUS_13440 1433566 1432676 gene locus_tag LOCUS_13450 1433566 1432676 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029901.1 protein_id gnl|my_center|LOCUS_13450 1434354 1433563 gene locus_tag LOCUS_13460 1434354 1433563 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228155.1 protein_id gnl|my_center|LOCUS_13460 1434543 1434618 gene locus_tag LOCUS_t00240 1434543 1434618 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1434702 1434956 gene locus_tag LOCUS_13470 1434702 1434956 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249651.1 protein_id gnl|my_center|LOCUS_13470 1435971 1434985 gene locus_tag LOCUS_13480 1435971 1434985 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028472.1 protein_id gnl|my_center|LOCUS_13480 1437327 1436086 gene locus_tag LOCUS_13490 1437327 1436086 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897679.1 protein_id gnl|my_center|LOCUS_13490 1437423 1438229 gene locus_tag LOCUS_13500 1437423 1438229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 1438917 1438240 gene locus_tag LOCUS_13510 1438917 1438240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 1439039 1439854 gene locus_tag LOCUS_13520 1439039 1439854 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_13520 1439887 1440651 gene locus_tag LOCUS_13530 gene aat 1439887 1440651 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705736.1 protein_id gnl|my_center|LOCUS_13530 1440662 1441210 gene locus_tag LOCUS_13540 1440662 1441210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 1441841 1441212 gene locus_tag LOCUS_13550 1441841 1441212 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729062.1 protein_id gnl|my_center|LOCUS_13550 1442109 1441843 gene locus_tag LOCUS_13560 1442109 1441843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 1442221 1442931 gene locus_tag LOCUS_13570 1442221 1442931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 1444560 1442968 gene locus_tag LOCUS_13580 1444560 1442968 CDS product cyclohexanecarboxylate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730669.1 protein_id gnl|my_center|LOCUS_13580 1446041 1444632 gene locus_tag LOCUS_13590 gene dnaB 1446041 1444632 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815191.1 protein_id gnl|my_center|LOCUS_13590 1446758 1446309 gene locus_tag LOCUS_13600 gene rplI 1446758 1446309 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391680.1 protein_id gnl|my_center|LOCUS_13600 1447210 1446755 gene locus_tag LOCUS_13610 1447210 1446755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 1447674 1447210 gene locus_tag LOCUS_13620 1447674 1447210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 1448021 1447686 gene locus_tag LOCUS_13630 gene rpsF 1448021 1447686 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101886572.1 protein_id gnl|my_center|LOCUS_13630 1449082 1448228 gene locus_tag LOCUS_13640 gene panB 1449082 1448228 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028153345.1 protein_id gnl|my_center|LOCUS_13640 1449223 1449432 gene locus_tag LOCUS_13650 1449223 1449432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 1451891 1449438 gene locus_tag LOCUS_13660 1451891 1449438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 1452382 1451960 gene locus_tag LOCUS_13670 1452382 1451960 CDS product DUF5318 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296823.1 protein_id gnl|my_center|LOCUS_13670 1452513 1453331 gene locus_tag LOCUS_13680 1452513 1453331 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227917.1 protein_id gnl|my_center|LOCUS_13680 1454727 1453345 gene locus_tag LOCUS_13690 1454727 1453345 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_13690 1455827 1454787 gene locus_tag LOCUS_13700 1455827 1454787 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141275.1 protein_id gnl|my_center|LOCUS_13700 1456075 1456728 gene locus_tag LOCUS_13710 1456075 1456728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 1456761 1458890 gene locus_tag LOCUS_13720 1456761 1458890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 1458961 1460496 gene locus_tag LOCUS_13730 1458961 1460496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 1460493 1461167 gene locus_tag LOCUS_13740 1460493 1461167 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325344.1 protein_id gnl|my_center|LOCUS_13740 1461164 1461718 gene locus_tag LOCUS_13750 1461164 1461718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 1461757 1462110 gene locus_tag LOCUS_13760 1461757 1462110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 1462107 1463072 gene locus_tag LOCUS_13770 gene trxB 1462107 1463072 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975041.1 protein_id gnl|my_center|LOCUS_13770 1463159 1463488 gene locus_tag LOCUS_13780 gene trxA 1463159 1463488 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191795.1 protein_id gnl|my_center|LOCUS_13780 1464450 1463572 gene locus_tag LOCUS_13790 1464450 1463572 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231063.1 protein_id gnl|my_center|LOCUS_13790 1465507 1464548 gene locus_tag LOCUS_13800 1465507 1464548 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029292.1 protein_id gnl|my_center|LOCUS_13800 1466511 1465612 gene locus_tag LOCUS_13810 1466511 1465612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 1467663 1466527 gene locus_tag LOCUS_13820 1467663 1466527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 1468158 1467916 gene locus_tag LOCUS_13830 1468158 1467916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 1468749 1470194 gene locus_tag LOCUS_13840 1468749 1470194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 1470521 1471525 gene locus_tag LOCUS_13850 gene dnaN 1470521 1471525 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221956.1 protein_id gnl|my_center|LOCUS_13850 1471542 1472657 gene locus_tag LOCUS_13860 gene recF 1471542 1472657 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975056.1 protein_id gnl|my_center|LOCUS_13860 1472654 1473013 gene locus_tag LOCUS_13870 1472654 1473013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 1473205 1475160 gene locus_tag LOCUS_13880 gene gyrB 1473205 1475160 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221960.1 protein_id gnl|my_center|LOCUS_13880 1475175 1477754 gene locus_tag LOCUS_13890 gene gyrA 1475175 1477754 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_13890 1477870 1478199 gene locus_tag LOCUS_13900 1477870 1478199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 1478273 1479112 gene locus_tag LOCUS_13910 1478273 1479112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 1479160 1479234 gene locus_tag LOCUS_t00250 1479160 1479234 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1479494 1480360 gene locus_tag LOCUS_13920 1479494 1480360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 1480597 1481100 gene locus_tag LOCUS_13930 1480597 1481100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 1481835 1481284 gene locus_tag LOCUS_13940 1481835 1481284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 1482358 1483194 gene locus_tag LOCUS_13950 1482358 1483194 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392315.1 protein_id gnl|my_center|LOCUS_13950 1484523 1483210 gene locus_tag LOCUS_13960 1484523 1483210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 1485386 1484598 gene locus_tag LOCUS_13970 1485386 1484598 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144270.1 protein_id gnl|my_center|LOCUS_13970 1486578 1485415 gene locus_tag LOCUS_13980 1486578 1485415 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043078326.1 protein_id gnl|my_center|LOCUS_13980 1488865 1486622 gene locus_tag LOCUS_13990 1488865 1486622 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031369.1 protein_id gnl|my_center|LOCUS_13990 1488944 1489903 gene locus_tag LOCUS_14000 1488944 1489903 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226289.1 protein_id gnl|my_center|LOCUS_14000 1489921 1490223 gene locus_tag LOCUS_14010 1489921 1490223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 1490226 1490609 gene locus_tag LOCUS_14020 1490226 1490609 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532314.1 protein_id gnl|my_center|LOCUS_14020 1490988 1491734 gene locus_tag LOCUS_14030 1490988 1491734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 1491749 1492726 gene locus_tag LOCUS_14040 1491749 1492726 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528694.1 protein_id gnl|my_center|LOCUS_14040 1492842 1493849 gene locus_tag LOCUS_14050 1492842 1493849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 1493968 1494402 gene locus_tag LOCUS_14060 1493968 1494402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 1495829 1494444 gene locus_tag LOCUS_14070 gene murA 1495829 1494444 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975861.1 protein_id gnl|my_center|LOCUS_14070 1496088 1495840 gene locus_tag LOCUS_14080 1496088 1495840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 1495970 1497430 gene locus_tag LOCUS_14090 1495970 1497430 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174854953.1 protein_id gnl|my_center|LOCUS_14090 1497811 1497491 gene locus_tag LOCUS_14100 1497811 1497491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 1497985 1498899 gene locus_tag LOCUS_14110 1497985 1498899 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920946.1 protein_id gnl|my_center|LOCUS_14110 1498896 1499678 gene locus_tag LOCUS_14120 gene hisN 1498896 1499678 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921412.1 protein_id gnl|my_center|LOCUS_14120 1500015 1502627 gene locus_tag LOCUS_14130 1500015 1502627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 1502721 1504841 gene locus_tag LOCUS_14140 1502721 1504841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 1504841 1506142 gene locus_tag LOCUS_14150 1504841 1506142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 1506154 1506615 gene locus_tag LOCUS_14160 1506154 1506615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 1506822 1506998 gene locus_tag LOCUS_14170 1506822 1506998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 1507973 1507002 gene locus_tag LOCUS_14180 1507973 1507002 CDS product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118502.1 protein_id gnl|my_center|LOCUS_14180 1507966 1508976 gene locus_tag LOCUS_14190 1507966 1508976 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328373.1 protein_id gnl|my_center|LOCUS_14190 1508973 1509932 gene locus_tag LOCUS_14200 1508973 1509932 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921398.1 protein_id gnl|my_center|LOCUS_14200 1510510 1510259 gene locus_tag LOCUS_14210 1510510 1510259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 1510542 1512020 gene locus_tag LOCUS_14220 1510542 1512020 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118296.1 protein_id gnl|my_center|LOCUS_14220 1512017 1512832 gene locus_tag LOCUS_14230 1512017 1512832 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328372.1 protein_id gnl|my_center|LOCUS_14230 1514640 1512967 gene locus_tag LOCUS_14240 1514640 1512967 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804422.1 protein_id gnl|my_center|LOCUS_14240 1516814 1514637 gene locus_tag LOCUS_14250 1516814 1514637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1518504 1516867 gene locus_tag LOCUS_14260 1518504 1516867 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261594.1 protein_id gnl|my_center|LOCUS_14260 1519379 1518501 gene locus_tag LOCUS_14270 1519379 1518501 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730998.1 protein_id gnl|my_center|LOCUS_14270 1520158 1519379 gene locus_tag LOCUS_14280 1520158 1519379 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730999.1 protein_id gnl|my_center|LOCUS_14280 1521033 1520155 gene locus_tag LOCUS_14290 1521033 1520155 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878542.1 protein_id gnl|my_center|LOCUS_14290 1521606 1521133 gene locus_tag LOCUS_14300 1521606 1521133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 1521728 1522075 gene locus_tag LOCUS_14310 1521728 1522075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 1522080 1523591 gene locus_tag LOCUS_14320 1522080 1523591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14320 1524134 1525465 gene locus_tag LOCUS_14330 1524134 1525465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 1526423 1525479 gene locus_tag LOCUS_14340 1526423 1525479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803834.1 protein_id gnl|my_center|LOCUS_14340 1526470 1527846 gene locus_tag LOCUS_14350 1526470 1527846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 1529709 1527856 gene locus_tag LOCUS_14360 1529709 1527856 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086638.1 protein_id gnl|my_center|LOCUS_14360 1529809 1530405 gene locus_tag LOCUS_14370 1529809 1530405 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073775.1 protein_id gnl|my_center|LOCUS_14370 1530541 1531566 gene locus_tag LOCUS_14380 1530541 1531566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 1531598 1532572 gene locus_tag LOCUS_14390 1531598 1532572 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974078.1 protein_id gnl|my_center|LOCUS_14390 1533779 1532619 gene locus_tag LOCUS_14400 1533779 1532619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 1534746 1533796 gene locus_tag LOCUS_14410 1534746 1533796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 1535729 1534743 gene locus_tag LOCUS_14420 1535729 1534743 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223936.1 protein_id gnl|my_center|LOCUS_14420 1536453 1535848 gene locus_tag LOCUS_14430 1536453 1535848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 1537055 1538032 gene locus_tag LOCUS_14440 1537055 1538032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 1538091 1538735 gene locus_tag LOCUS_14450 1538091 1538735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 1538771 1539712 gene locus_tag LOCUS_14460 1538771 1539712 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729126.1 protein_id gnl|my_center|LOCUS_14460 1539714 1541060 gene locus_tag LOCUS_14470 1539714 1541060 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466839.1 protein_id gnl|my_center|LOCUS_14470 1541312 1541569 gene locus_tag LOCUS_14480 1541312 1541569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 1541871 1542179 gene locus_tag LOCUS_14490 1541871 1542179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 1543020 1542298 gene locus_tag LOCUS_14500 1543020 1542298 CDS product NgoMIV family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951140.1 protein_id gnl|my_center|LOCUS_14500 1544226 1543030 gene locus_tag LOCUS_14510 1544226 1543030 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090649235.1 protein_id gnl|my_center|LOCUS_14510 1544760 1544383 gene locus_tag LOCUS_14520 1544760 1544383 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831429.1 protein_id gnl|my_center|LOCUS_14520 1545324 1544920 gene locus_tag LOCUS_14530 1545324 1544920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 1545718 1545326 gene locus_tag LOCUS_14540 1545718 1545326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 1545876 1548512 gene locus_tag LOCUS_14550 1545876 1548512 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225440415.1 protein_id gnl|my_center|LOCUS_14550 1548568 1550055 gene locus_tag LOCUS_14560 1548568 1550055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 1550724 1550161 gene locus_tag LOCUS_14570 1550724 1550161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047726.1 protein_id gnl|my_center|LOCUS_14570 1551235 1551864 gene locus_tag LOCUS_14580 1551235 1551864 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731458.1 protein_id gnl|my_center|LOCUS_14580 1551861 1552094 gene locus_tag LOCUS_14590 1551861 1552094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 1552433 1552170 gene locus_tag LOCUS_14600 1552433 1552170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 1552632 1553345 gene locus_tag LOCUS_14610 1552632 1553345 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097919.1 protein_id gnl|my_center|LOCUS_14610 1553547 1553864 gene locus_tag LOCUS_14620 1553547 1553864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14620 1554374 1554300 gene locus_tag LOCUS_t00260 1554374 1554300 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1555004 1554531 gene locus_tag LOCUS_14630 1555004 1554531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 1555253 1555759 gene locus_tag LOCUS_14640 1555253 1555759 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413345.1 protein_id gnl|my_center|LOCUS_14640 1555910 1555825 gene locus_tag LOCUS_t00270 1555910 1555825 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1556221 1558434 gene locus_tag LOCUS_14650 1556221 1558434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 1558527 1559015 gene locus_tag LOCUS_14660 1558527 1559015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 1559021 1559695 gene locus_tag LOCUS_14670 gene recR 1559021 1559695 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_14670 1561079 1559898 gene locus_tag LOCUS_14680 1561079 1559898 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223477.1 protein_id gnl|my_center|LOCUS_14680 1562169 1561180 gene locus_tag LOCUS_14690 1562169 1561180 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973708.1 protein_id gnl|my_center|LOCUS_14690 1562661 1562188 gene locus_tag LOCUS_14700 1562661 1562188 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224278.1 protein_id gnl|my_center|LOCUS_14700 1562804 1564153 gene locus_tag LOCUS_14710 gene ccrA 1562804 1564153 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283587.1 protein_id gnl|my_center|LOCUS_14710 1564201 1564602 gene locus_tag LOCUS_14720 gene mce 1564201 1564602 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_14720 1564676 1565065 gene locus_tag LOCUS_14730 1564676 1565065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 1565341 1565078 gene locus_tag LOCUS_14740 1565341 1565078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 1566967 1565693 gene locus_tag LOCUS_14750 1566967 1565693 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186962.1 protein_id gnl|my_center|LOCUS_14750 1567204 1566992 gene locus_tag LOCUS_14760 1567204 1566992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 1567722 1567408 gene locus_tag LOCUS_14770 1567722 1567408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 1568551 1568144 gene locus_tag LOCUS_14780 1568551 1568144 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467870.1 protein_id gnl|my_center|LOCUS_14780 1569702 1568575 gene locus_tag LOCUS_14790 gene dnaJ 1569702 1568575 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401821.1 protein_id gnl|my_center|LOCUS_14790 1570394 1569753 gene locus_tag LOCUS_14800 1570394 1569753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 1572220 1570391 gene locus_tag LOCUS_14810 gene dnaK 1572220 1570391 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975268.1 protein_id gnl|my_center|LOCUS_14810 1572446 1573198 gene locus_tag LOCUS_14820 1572446 1573198 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974762.1 protein_id gnl|my_center|LOCUS_14820 1573239 1574261 gene locus_tag LOCUS_14830 1573239 1574261 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869314.1 protein_id gnl|my_center|LOCUS_14830 1574319 1574918 gene locus_tag LOCUS_14840 1574319 1574918 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776270.1 protein_id gnl|my_center|LOCUS_14840 1576136 1575027 gene locus_tag LOCUS_14850 1576136 1575027 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742235.1 protein_id gnl|my_center|LOCUS_14850 1576291 1577832 gene locus_tag LOCUS_14860 1576291 1577832 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973461.1 protein_id gnl|my_center|LOCUS_14860 1578070 1579068 gene locus_tag LOCUS_14870 1578070 1579068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 1579055 1580236 gene locus_tag LOCUS_14880 1579055 1580236 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897714.1 protein_id gnl|my_center|LOCUS_14880 1581192 1580230 gene locus_tag LOCUS_14890 1581192 1580230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 1581742 1581281 gene locus_tag LOCUS_14900 1581742 1581281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 1583894 1581915 gene locus_tag LOCUS_14910 1583894 1581915 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030947.1 protein_id gnl|my_center|LOCUS_14910 1584038 1584337 gene locus_tag LOCUS_14920 1584038 1584337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 1584334 1585110 gene locus_tag LOCUS_14930 1584334 1585110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 1585107 1585823 gene locus_tag LOCUS_14940 1585107 1585823 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103312601.1 protein_id gnl|my_center|LOCUS_14940 1587046 1585877 gene locus_tag LOCUS_14950 1587046 1585877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 1587981 1587043 gene locus_tag LOCUS_14960 1587981 1587043 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888939.1 protein_id gnl|my_center|LOCUS_14960 1588313 1588128 gene locus_tag LOCUS_14970 1588313 1588128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 1588312 1588605 gene locus_tag LOCUS_14980 1588312 1588605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 1588714 1591272 gene locus_tag LOCUS_14990 1588714 1591272 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_14990 1591402 1592193 gene locus_tag LOCUS_15000 1591402 1592193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 1592250 1593131 gene locus_tag LOCUS_15010 1592250 1593131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 1593178 1593558 gene locus_tag LOCUS_15020 1593178 1593558 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939916.1 protein_id gnl|my_center|LOCUS_15020 1593706 1595118 gene locus_tag LOCUS_15030 gene radA 1593706 1595118 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719610.1 protein_id gnl|my_center|LOCUS_15030 1595493 1596362 gene locus_tag LOCUS_15040 1595493 1596362 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115465.1 protein_id gnl|my_center|LOCUS_15040 1596502 1597725 gene locus_tag LOCUS_15050 gene disA 1596502 1597725 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_15050 1597736 1598419 gene locus_tag LOCUS_15060 1597736 1598419 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410610.1 protein_id gnl|my_center|LOCUS_15060 1598448 1599605 gene locus_tag LOCUS_15070 1598448 1599605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 1599839 1599594 gene locus_tag LOCUS_15080 1599839 1599594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 1600511 1599855 gene locus_tag LOCUS_15090 gene crp 1600511 1599855 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908817.1 protein_id gnl|my_center|LOCUS_15090 1600755 1601927 gene locus_tag LOCUS_15100 gene ispD 1600755 1601927 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938747.1 protein_id gnl|my_center|LOCUS_15100 1602233 1603009 gene locus_tag LOCUS_15110 gene rlmB 1602233 1603009 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459087.1 protein_id gnl|my_center|LOCUS_15110 1603204 1603707 gene locus_tag LOCUS_15120 1603204 1603707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 1603736 1604779 gene locus_tag LOCUS_15130 1603736 1604779 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391945.1 protein_id gnl|my_center|LOCUS_15130 1605701 1604742 gene locus_tag LOCUS_15140 1605701 1604742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 1605750 1605986 gene locus_tag LOCUS_15150 1605750 1605986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 1605977 1606252 gene locus_tag LOCUS_15160 1605977 1606252 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974680.1 protein_id gnl|my_center|LOCUS_15160 1606335 1607924 gene locus_tag LOCUS_15170 gene groL 1606335 1607924 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974678.1 protein_id gnl|my_center|LOCUS_15170 1610423 1607997 gene locus_tag LOCUS_15180 1610423 1607997 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727490.1 protein_id gnl|my_center|LOCUS_15180 1610476 1611159 gene locus_tag LOCUS_15190 1610476 1611159 CDS product heme-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832113.1 protein_id gnl|my_center|LOCUS_15190 1611275 1612603 gene locus_tag LOCUS_15200 1611275 1612603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 1612603 1613598 gene locus_tag LOCUS_15210 1612603 1613598 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173609.1 protein_id gnl|my_center|LOCUS_15210 1613588 1614637 gene locus_tag LOCUS_15220 1613588 1614637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 1614637 1615536 gene locus_tag LOCUS_15230 1614637 1615536 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 protein_id gnl|my_center|LOCUS_15230 1617074 1615692 gene locus_tag LOCUS_15240 1617074 1615692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 1617380 1618639 gene locus_tag LOCUS_15250 1617380 1618639 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899540.1 protein_id gnl|my_center|LOCUS_15250 1618688 1619026 gene locus_tag LOCUS_15260 1618688 1619026 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893792.1 protein_id gnl|my_center|LOCUS_15260 1619016 1621391 gene locus_tag LOCUS_15270 1619016 1621391 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893793.1 protein_id gnl|my_center|LOCUS_15270 1621396 1622157 gene locus_tag LOCUS_15280 1621396 1622157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 1622150 1622584 gene locus_tag LOCUS_15290 1622150 1622584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 1623819 1622593 gene locus_tag LOCUS_15300 1623819 1622593 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031788.1 protein_id gnl|my_center|LOCUS_15300 1624488 1623829 gene locus_tag LOCUS_15310 1624488 1623829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 1625590 1624499 gene locus_tag LOCUS_15320 1625590 1624499 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609761.1 protein_id gnl|my_center|LOCUS_15320 1625724 1626347 gene locus_tag LOCUS_15330 1625724 1626347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 1626344 1626970 gene locus_tag LOCUS_15340 1626344 1626970 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192781106.1 protein_id gnl|my_center|LOCUS_15340 1627300 1626953 gene locus_tag LOCUS_15350 1627300 1626953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 1628535 1627480 gene locus_tag LOCUS_15360 1628535 1627480 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_15360 1629272 1628535 gene locus_tag LOCUS_15370 1629272 1628535 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976496.1 protein_id gnl|my_center|LOCUS_15370 1630587 1629259 gene locus_tag LOCUS_15380 1630587 1629259 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028276.1 protein_id gnl|my_center|LOCUS_15380 1633222 1630691 gene locus_tag LOCUS_15390 1633222 1630691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259586.1 protein_id gnl|my_center|LOCUS_15390 1633475 1634263 gene locus_tag LOCUS_15400 1633475 1634263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 1634265 1635482 gene locus_tag LOCUS_15410 1634265 1635482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 1635475 1636173 gene locus_tag LOCUS_15420 1635475 1636173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 1636170 1636937 gene locus_tag LOCUS_15430 1636170 1636937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 1637024 1637284 gene locus_tag LOCUS_15440 1637024 1637284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 1637281 1637667 gene locus_tag LOCUS_15450 1637281 1637667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 1638031 1637720 gene locus_tag LOCUS_15460 1638031 1637720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15460 1640687 1638234 gene locus_tag LOCUS_15470 1640687 1638234 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113919.1 protein_id gnl|my_center|LOCUS_15470 1640818 1641396 gene locus_tag LOCUS_15480 1640818 1641396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 1641559 1644213 gene locus_tag LOCUS_15490 1641559 1644213 CDS product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031336.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15490 1644210 1644692 gene locus_tag LOCUS_15500 1644210 1644692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 1644689 1645219 gene locus_tag LOCUS_15510 1644689 1645219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 1645216 1646703 gene locus_tag LOCUS_15520 1645216 1646703 CDS product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031337.1 protein_id gnl|my_center|LOCUS_15520 1646703 1647278 gene locus_tag LOCUS_15530 1646703 1647278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 1647275 1647529 gene locus_tag LOCUS_15540 1647275 1647529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 1647544 1647897 gene locus_tag LOCUS_15550 gene mnhG 1647544 1647897 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727233.1 protein_id gnl|my_center|LOCUS_15550 1648051 1649373 gene locus_tag LOCUS_15560 1648051 1649373 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172378.1 protein_id gnl|my_center|LOCUS_15560 1649473 1652181 gene locus_tag LOCUS_15570 gene topA 1649473 1652181 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742226.1 protein_id gnl|my_center|LOCUS_15570 1652291 1653970 gene locus_tag LOCUS_15580 1652291 1653970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 1653967 1654608 gene locus_tag LOCUS_15590 1653967 1654608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 1654583 1655680 gene locus_tag LOCUS_15600 1654583 1655680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 1655913 1656887 gene locus_tag LOCUS_15610 1655913 1656887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 1657112 1657187 gene locus_tag LOCUS_t00280 1657112 1657187 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1657532 1658080 gene locus_tag LOCUS_15620 1657532 1658080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 1658077 1658940 gene locus_tag LOCUS_15630 1658077 1658940 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898703.1 protein_id gnl|my_center|LOCUS_15630 1660769 1659786 gene locus_tag LOCUS_15640 1660769 1659786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 1661868 1661167 gene locus_tag LOCUS_15650 1661868 1661167 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730514.1 protein_id gnl|my_center|LOCUS_15650 1662545 1662036 gene locus_tag LOCUS_15660 1662545 1662036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 1662945 1663136 gene locus_tag LOCUS_15670 1662945 1663136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 1663499 1663873 gene locus_tag LOCUS_15680 1663499 1663873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 1665466 1663964 gene locus_tag LOCUS_15690 1665466 1663964 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119293.1 protein_id gnl|my_center|LOCUS_15690 1666552 1665875 gene locus_tag LOCUS_15700 1666552 1665875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 1667070 1666549 gene locus_tag LOCUS_15710 1667070 1666549 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403827.1 protein_id gnl|my_center|LOCUS_15710 1667391 1667702 gene locus_tag LOCUS_15720 1667391 1667702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 1668590 1668078 gene locus_tag LOCUS_15730 1668590 1668078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 1668864 1670165 gene locus_tag LOCUS_15740 1668864 1670165 CDS product ISNCY family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085251832.1 protein_id gnl|my_center|LOCUS_15740 1670681 1671106 gene locus_tag LOCUS_15750 1670681 1671106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 1671081 1671221 gene locus_tag LOCUS_15760 1671081 1671221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 1671278 1671529 gene locus_tag LOCUS_15770 1671278 1671529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 1672376 1672597 gene locus_tag LOCUS_15780 1672376 1672597 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_15780 1673493 1674671 gene locus_tag LOCUS_15790 1673493 1674671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 1674816 1676429 gene locus_tag LOCUS_15800 1674816 1676429 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065424.1 protein_id gnl|my_center|LOCUS_15800 1676761 1677933 gene locus_tag LOCUS_15810 1676761 1677933 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728306.1 protein_id gnl|my_center|LOCUS_15810 1677947 1678231 gene locus_tag LOCUS_15820 1677947 1678231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 1678824 1679015 gene locus_tag LOCUS_15830 1678824 1679015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 1680354 1679257 gene locus_tag LOCUS_15840 1680354 1679257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416605.1 protein_id gnl|my_center|LOCUS_15840 1681027 1680338 gene locus_tag LOCUS_15850 1681027 1680338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 1682185 1681172 gene locus_tag LOCUS_15860 1682185 1681172 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104523.1 protein_id gnl|my_center|LOCUS_15860 1682824 1682282 gene locus_tag LOCUS_15870 1682824 1682282 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226147.1 protein_id gnl|my_center|LOCUS_15870 1683486 1684055 gene locus_tag LOCUS_15880 gene sigR 1683486 1684055 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15880 1684052 1684339 gene locus_tag LOCUS_15890 1684052 1684339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 1684417 1684554 gene locus_tag LOCUS_15900 1684417 1684554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1684597 1685727 gene locus_tag LOCUS_15910 1684597 1685727 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_15910 1685724 1686668 gene locus_tag LOCUS_15920 1685724 1686668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 1686715 1687320 gene locus_tag LOCUS_15930 gene hpt 1686715 1687320 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323640.1 protein_id gnl|my_center|LOCUS_15930 1687330 1689168 gene locus_tag LOCUS_15940 gene ftsH 1687330 1689168 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869596.1 protein_id gnl|my_center|LOCUS_15940 1689165 1689797 gene locus_tag LOCUS_15950 gene folE 1689165 1689797 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731040.1 protein_id gnl|my_center|LOCUS_15950 1689935 1690783 gene locus_tag LOCUS_15960 gene folP 1689935 1690783 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975435.1 protein_id gnl|my_center|LOCUS_15960 1690783 1691406 gene locus_tag LOCUS_15970 1690783 1691406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 1691414 1691794 gene locus_tag LOCUS_15980 1691414 1691794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15980 1691791 1692237 gene locus_tag LOCUS_15990 gene folK 1691791 1692237 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262835.1 protein_id gnl|my_center|LOCUS_15990 1692270 1693079 gene locus_tag LOCUS_16000 1692270 1693079 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804901.1 protein_id gnl|my_center|LOCUS_16000 1693067 1693936 gene locus_tag LOCUS_16010 gene panC 1693067 1693936 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_16010 1693933 1695600 gene locus_tag LOCUS_16020 1693933 1695600 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028946.1 protein_id gnl|my_center|LOCUS_16020 1695661 1696578 gene locus_tag LOCUS_16030 gene nadC 1695661 1696578 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973559.1 protein_id gnl|my_center|LOCUS_16030 1696783 1697490 gene locus_tag LOCUS_16040 1696783 1697490 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_16040 1698276 1697521 gene locus_tag LOCUS_16050 1698276 1697521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 1698396 1699886 gene locus_tag LOCUS_16060 1698396 1699886 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731135.1 protein_id gnl|my_center|LOCUS_16060 1699938 1700345 gene locus_tag LOCUS_16070 1699938 1700345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 1700388 1700648 gene locus_tag LOCUS_16080 1700388 1700648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 1701302 1700652 gene locus_tag LOCUS_16090 1701302 1700652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 1701460 1701684 gene locus_tag LOCUS_16100 1701460 1701684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 1701675 1702073 gene locus_tag LOCUS_16110 1701675 1702073 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227971.1 protein_id gnl|my_center|LOCUS_16110 1703319 1702105 gene locus_tag LOCUS_16120 1703319 1702105 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727867.1 protein_id gnl|my_center|LOCUS_16120 1704486 1703395 gene locus_tag LOCUS_16130 1704486 1703395 CDS product NADPH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950854.1 protein_id gnl|my_center|LOCUS_16130 1704911 1705579 gene locus_tag LOCUS_16140 1704911 1705579 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727865.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16140 1705608 1706438 gene locus_tag LOCUS_16150 1705608 1706438 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975453.1 protein_id gnl|my_center|LOCUS_16150 1706435 1707955 gene locus_tag LOCUS_16160 gene lysS 1706435 1707955 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242743.1 protein_id gnl|my_center|LOCUS_16160 1707983 1708867 gene locus_tag LOCUS_16170 1707983 1708867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 1709916 1708885 gene locus_tag LOCUS_16180 1709916 1708885 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350843.1 protein_id gnl|my_center|LOCUS_16180 1710670 1710017 gene locus_tag LOCUS_16190 1710670 1710017 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976695.1 protein_id gnl|my_center|LOCUS_16190 1710981 1710712 gene locus_tag LOCUS_16200 1710981 1710712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 1712164 1711124 gene locus_tag LOCUS_16210 gene nrfD 1712164 1711124 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727950.1 protein_id gnl|my_center|LOCUS_16210 1713018 1712161 gene locus_tag LOCUS_16220 1713018 1712161 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727951.1 protein_id gnl|my_center|LOCUS_16220 1716335 1713015 gene locus_tag LOCUS_16230 gene fdh 1716335 1713015 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225067.1 transl_except (pos:complement(1715727..1715729),aa:Sec) note codon on position 203 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_16230 1717512 1716463 gene locus_tag LOCUS_16240 1717512 1716463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 1718273 1717608 gene locus_tag LOCUS_16250 1718273 1717608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 1718790 1718323 gene locus_tag LOCUS_16260 1718790 1718323 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929081.1 protein_id gnl|my_center|LOCUS_16260 1719637 1718876 gene locus_tag LOCUS_16270 1719637 1718876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 1720305 1719634 gene locus_tag LOCUS_16280 1720305 1719634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 1721058 1720336 gene locus_tag LOCUS_16290 1721058 1720336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 1721670 1721599 gene locus_tag LOCUS_t00290 1721670 1721599 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1721803 1723437 gene locus_tag LOCUS_16300 1721803 1723437 CDS product DNA-3-methyladenine glycosylase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878186.1 protein_id gnl|my_center|LOCUS_16300 1723493 1724083 gene locus_tag LOCUS_16310 1723493 1724083 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086236.1 protein_id gnl|my_center|LOCUS_16310 1724561 1724109 gene locus_tag LOCUS_16320 gene bcp 1724561 1724109 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257872.1 protein_id gnl|my_center|LOCUS_16320 1724618 1725097 gene locus_tag LOCUS_16330 1724618 1725097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 1725795 1725175 gene locus_tag LOCUS_16340 1725795 1725175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 1726693 1726052 gene locus_tag LOCUS_16350 1726693 1726052 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727165.1 protein_id gnl|my_center|LOCUS_16350 1726833 1727315 gene locus_tag LOCUS_16360 1726833 1727315 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977232.1 protein_id gnl|my_center|LOCUS_16360 1727722 1727363 gene locus_tag LOCUS_16370 1727722 1727363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 1727829 1728365 gene locus_tag LOCUS_16380 1727829 1728365 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467644.1 protein_id gnl|my_center|LOCUS_16380 1728814 1728410 gene locus_tag LOCUS_16390 1728814 1728410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 1729850 1728915 gene locus_tag LOCUS_16400 gene yhjD 1729850 1728915 CDS product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369249.1 protein_id gnl|my_center|LOCUS_16400 1730783 1729971 gene locus_tag LOCUS_16410 1730783 1729971 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228058.1 protein_id gnl|my_center|LOCUS_16410 1730856 1731605 gene locus_tag LOCUS_16420 1730856 1731605 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258487.1 protein_id gnl|my_center|LOCUS_16420 1732496 1731639 gene locus_tag LOCUS_16430 1732496 1731639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 1732669 1733421 gene locus_tag LOCUS_16440 1732669 1733421 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729763.1 protein_id gnl|my_center|LOCUS_16440 1733951 1735129 gene locus_tag LOCUS_16450 1733951 1735129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16450 1736001 1735081 gene locus_tag LOCUS_16460 1736001 1735081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16460 1736138 1735938 gene locus_tag LOCUS_16470 1736138 1735938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16470 1736460 1736149 gene locus_tag LOCUS_16480 1736460 1736149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16480 1736475 1737239 gene locus_tag LOCUS_16490 1736475 1737239 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257279.1 protein_id gnl|my_center|LOCUS_16490 1737236 1738024 gene locus_tag LOCUS_16500 1737236 1738024 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893601.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16500 1737961 1738116 gene locus_tag LOCUS_16510 1737961 1738116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 1738107 1738183 gene locus_tag LOCUS_t00300 1738107 1738183 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1738623 1738387 gene locus_tag LOCUS_16520 1738623 1738387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 1741373 1740351 gene locus_tag LOCUS_16530 1741373 1740351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 1741694 1742245 gene locus_tag LOCUS_16540 1741694 1742245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 1742245 1742742 gene locus_tag LOCUS_16550 1742245 1742742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 1742838 1744382 gene locus_tag LOCUS_16560 1742838 1744382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 1744817 1745410 gene locus_tag LOCUS_16570 1744817 1745410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 1745335 1745505 gene locus_tag LOCUS_16580 1745335 1745505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 1746731 1747960 gene locus_tag LOCUS_16590 1746731 1747960 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900518.1 protein_id gnl|my_center|LOCUS_16590 1748188 1748421 gene locus_tag LOCUS_16600 1748188 1748421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 >Feature sequence02 1848 598 gene locus_tag LOCUS_16610 1848 598 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_16610 2561 4285 gene locus_tag LOCUS_16620 2561 4285 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898994.1 protein_id gnl|my_center|LOCUS_16620 4420 6987 gene locus_tag LOCUS_16630 4420 6987 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027530.1 protein_id gnl|my_center|LOCUS_16630 8542 7007 gene locus_tag LOCUS_16640 8542 7007 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930179.1 protein_id gnl|my_center|LOCUS_16640 8618 10162 gene locus_tag LOCUS_16650 8618 10162 CDS product alpha/beta hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742093.1 protein_id gnl|my_center|LOCUS_16650 10286 12055 gene locus_tag LOCUS_16660 10286 12055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 12102 12893 gene locus_tag LOCUS_16670 12102 12893 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390005.1 protein_id gnl|my_center|LOCUS_16670 13965 12895 gene locus_tag LOCUS_16680 13965 12895 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939164.1 protein_id gnl|my_center|LOCUS_16680 15288 13987 gene locus_tag LOCUS_16690 15288 13987 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899402.1 protein_id gnl|my_center|LOCUS_16690 16841 15285 gene locus_tag LOCUS_16700 16841 15285 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093260.1 protein_id gnl|my_center|LOCUS_16700 16977 17441 gene locus_tag LOCUS_16710 16977 17441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 18525 17926 gene locus_tag LOCUS_16720 18525 17926 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367926.1 protein_id gnl|my_center|LOCUS_16720 19860 18700 gene locus_tag LOCUS_16730 19860 18700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 23339 19962 gene locus_tag LOCUS_16740 gene cydD 23339 19962 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029332.1 protein_id gnl|my_center|LOCUS_16740 24463 23339 gene locus_tag LOCUS_16750 gene cydB 24463 23339 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227295.1 protein_id gnl|my_center|LOCUS_16750 25921 24473 gene locus_tag LOCUS_16760 25921 24473 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227294.1 protein_id gnl|my_center|LOCUS_16760 26140 27057 gene locus_tag LOCUS_16770 26140 27057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 28176 27088 gene locus_tag LOCUS_16780 28176 27088 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029178.1 protein_id gnl|my_center|LOCUS_16780 28979 28173 gene locus_tag LOCUS_16790 28979 28173 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029177.1 protein_id gnl|my_center|LOCUS_16790 29818 29018 gene locus_tag LOCUS_16800 gene modA 29818 29018 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029176.1 protein_id gnl|my_center|LOCUS_16800 32415 29944 gene locus_tag LOCUS_16810 32415 29944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 33062 32412 gene locus_tag LOCUS_16820 33062 32412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 33117 34778 gene locus_tag LOCUS_16830 gene lysS 33117 34778 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082221.1 protein_id gnl|my_center|LOCUS_16830 34778 36568 gene locus_tag LOCUS_16840 34778 36568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 38200 36629 gene locus_tag LOCUS_16850 38200 36629 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229626.1 protein_id gnl|my_center|LOCUS_16850 39644 38250 gene locus_tag LOCUS_16860 39644 38250 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229625.1 protein_id gnl|my_center|LOCUS_16860 41278 39641 gene locus_tag LOCUS_16870 gene mftF 41278 39641 CDS product mycofactocin biosynthesis glycosyltransferase MftF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403501.1 protein_id gnl|my_center|LOCUS_16870 42087 41275 gene locus_tag LOCUS_16880 42087 41275 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027324.1 protein_id gnl|my_center|LOCUS_16880 42820 42122 gene locus_tag LOCUS_16890 gene mftE 42820 42122 CDS product mycofactocin biosynthesis peptidyl-dipeptidase MftE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112045.1 protein_id gnl|my_center|LOCUS_16890 43823 42840 gene locus_tag LOCUS_16900 43823 42840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 44143 43820 gene locus_tag LOCUS_16910 44143 43820 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461381.1 protein_id gnl|my_center|LOCUS_16910 45554 44190 gene locus_tag LOCUS_16920 45554 44190 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461372.1 protein_id gnl|my_center|LOCUS_16920 45668 46930 gene locus_tag LOCUS_16930 45668 46930 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225726.1 protein_id gnl|my_center|LOCUS_16930 47924 46977 gene locus_tag LOCUS_16940 47924 46977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 49720 47921 gene locus_tag LOCUS_16950 49720 47921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 50534 49911 gene locus_tag LOCUS_16960 50534 49911 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731532.1 protein_id gnl|my_center|LOCUS_16960 50655 53237 gene locus_tag LOCUS_16970 gene hrpB 50655 53237 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405451.1 protein_id gnl|my_center|LOCUS_16970 53868 53260 gene locus_tag LOCUS_16980 53868 53260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 54251 53865 gene locus_tag LOCUS_16990 54251 53865 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724527.1 protein_id gnl|my_center|LOCUS_16990 54211 54549 gene locus_tag LOCUS_17000 54211 54549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 54746 56194 gene locus_tag LOCUS_17010 54746 56194 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230761.1 protein_id gnl|my_center|LOCUS_17010 56630 56220 gene locus_tag LOCUS_17020 56630 56220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 56706 57506 gene locus_tag LOCUS_17030 56706 57506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 58290 57541 gene locus_tag LOCUS_17040 58290 57541 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730006.1 protein_id gnl|my_center|LOCUS_17040 58418 58963 gene locus_tag LOCUS_17050 gene pyrE 58418 58963 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417034.1 protein_id gnl|my_center|LOCUS_17050 60947 59001 gene locus_tag LOCUS_17060 gene dgcA 60947 59001 CDS product dimethylglycine demethylation protein DgcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103128.1 protein_id gnl|my_center|LOCUS_17060 62991 61021 gene locus_tag LOCUS_17070 62991 61021 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395834.1 protein_id gnl|my_center|LOCUS_17070 64278 63058 gene locus_tag LOCUS_17080 gene mftC 64278 63058 CDS product mycofactocin radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727659.1 protein_id gnl|my_center|LOCUS_17080 64604 64275 gene locus_tag LOCUS_17090 64604 64275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 64771 64619 gene locus_tag LOCUS_17100 64771 64619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 64990 66105 gene locus_tag LOCUS_17110 64990 66105 CDS product NDMA-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897267.1 protein_id gnl|my_center|LOCUS_17110 66151 67212 gene locus_tag LOCUS_17120 66151 67212 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258828.1 protein_id gnl|my_center|LOCUS_17120 67230 68138 gene locus_tag LOCUS_17130 67230 68138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 69519 68191 gene locus_tag LOCUS_17140 69519 68191 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224376.1 protein_id gnl|my_center|LOCUS_17140 69655 71292 gene locus_tag LOCUS_17150 69655 71292 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224377.1 protein_id gnl|my_center|LOCUS_17150 73029 71284 gene locus_tag LOCUS_17160 73029 71284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 74318 73086 gene locus_tag LOCUS_17170 74318 73086 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257569.1 protein_id gnl|my_center|LOCUS_17170 74504 77092 gene locus_tag LOCUS_17180 74504 77092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 77093 78427 gene locus_tag LOCUS_17190 77093 78427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 79121 78462 gene locus_tag LOCUS_17200 79121 78462 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728788.1 protein_id gnl|my_center|LOCUS_17200 80415 79126 gene locus_tag LOCUS_17210 80415 79126 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229319.1 protein_id gnl|my_center|LOCUS_17210 80654 80463 gene locus_tag LOCUS_17220 80654 80463 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730111.1 protein_id gnl|my_center|LOCUS_17220 82206 80800 gene locus_tag LOCUS_17230 82206 80800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 82375 82851 gene locus_tag LOCUS_17240 82375 82851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 82888 83217 gene locus_tag LOCUS_17250 82888 83217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 83214 83663 gene locus_tag LOCUS_17260 83214 83663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250160.1 protein_id gnl|my_center|LOCUS_17260 86023 83696 gene locus_tag LOCUS_17270 gene atsA 86023 83696 CDS product arylsulfatase AtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898561.1 protein_id gnl|my_center|LOCUS_17270 86940 86050 gene locus_tag LOCUS_17280 86940 86050 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930475.1 protein_id gnl|my_center|LOCUS_17280 88835 87603 gene locus_tag LOCUS_17290 88835 87603 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977622.1 protein_id gnl|my_center|LOCUS_17290 88851 89048 gene locus_tag LOCUS_17300 88851 89048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 90543 89032 gene locus_tag LOCUS_17310 90543 89032 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204118.1 protein_id gnl|my_center|LOCUS_17310 90710 93358 gene locus_tag LOCUS_17320 gene valS 90710 93358 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804592.1 protein_id gnl|my_center|LOCUS_17320 94419 93373 gene locus_tag LOCUS_17330 94419 93373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 94630 94454 gene locus_tag LOCUS_17340 94630 94454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 95671 94727 gene locus_tag LOCUS_17350 95671 94727 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228591.1 protein_id gnl|my_center|LOCUS_17350 97551 95815 gene locus_tag LOCUS_17360 97551 95815 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730889.1 protein_id gnl|my_center|LOCUS_17360 98688 97561 gene locus_tag LOCUS_17370 98688 97561 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028324.1 protein_id gnl|my_center|LOCUS_17370 98936 98685 gene locus_tag LOCUS_17380 98936 98685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 99398 99099 gene locus_tag LOCUS_17390 99398 99099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 99790 100314 gene locus_tag LOCUS_17400 99790 100314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17400 100316 101047 gene locus_tag LOCUS_17410 100316 101047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17410 101343 101215 gene locus_tag LOCUS_17420 101343 101215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 102508 101600 gene locus_tag LOCUS_17430 102508 101600 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092227.1 protein_id gnl|my_center|LOCUS_17430 103228 102695 gene locus_tag LOCUS_17440 103228 102695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 106751 103311 gene locus_tag LOCUS_17450 106751 103311 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084830245.1 protein_id gnl|my_center|LOCUS_17450 108015 106801 gene locus_tag LOCUS_17460 gene cyp142 108015 106801 CDS product steroid C26-monooxygenase Cyp142 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900082.1 protein_id gnl|my_center|LOCUS_17460 108363 108040 gene locus_tag LOCUS_17470 108363 108040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 108655 108446 gene locus_tag LOCUS_17480 108655 108446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 109782 108793 gene locus_tag LOCUS_17490 109782 108793 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073061.1 protein_id gnl|my_center|LOCUS_17490 110246 109779 gene locus_tag LOCUS_17500 110246 109779 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894605.1 protein_id gnl|my_center|LOCUS_17500 111461 110355 gene locus_tag LOCUS_17510 111461 110355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 112403 111489 gene locus_tag LOCUS_17520 112403 111489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 113407 112400 gene locus_tag LOCUS_17530 113407 112400 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894135.1 protein_id gnl|my_center|LOCUS_17530 113760 114785 gene locus_tag LOCUS_17540 113760 114785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 114782 115549 gene locus_tag LOCUS_17550 114782 115549 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222372.1 protein_id gnl|my_center|LOCUS_17550 115542 116201 gene locus_tag LOCUS_17560 115542 116201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 116274 117203 gene locus_tag LOCUS_17570 116274 117203 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049743594.1 protein_id gnl|my_center|LOCUS_17570 117884 117357 gene locus_tag LOCUS_17580 117884 117357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 118552 117974 gene locus_tag LOCUS_17590 118552 117974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 118685 120358 gene locus_tag LOCUS_17600 118685 120358 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073255020.1 protein_id gnl|my_center|LOCUS_17600 120355 122052 gene locus_tag LOCUS_17610 120355 122052 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776426.1 protein_id gnl|my_center|LOCUS_17610 122120 123097 gene locus_tag LOCUS_17620 122120 123097 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266314.1 protein_id gnl|my_center|LOCUS_17620 123133 124590 gene locus_tag LOCUS_17630 123133 124590 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330314.1 protein_id gnl|my_center|LOCUS_17630 125129 124629 gene locus_tag LOCUS_17640 125129 124629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 125389 126417 gene locus_tag LOCUS_17650 125389 126417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 126683 126489 gene locus_tag LOCUS_17660 126683 126489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 126865 129324 gene locus_tag LOCUS_17670 126865 129324 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932772.1 protein_id gnl|my_center|LOCUS_17670 129423 131204 gene locus_tag LOCUS_17680 129423 131204 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921222.1 protein_id gnl|my_center|LOCUS_17680 132518 131238 gene locus_tag LOCUS_17690 gene aroA 132518 131238 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171024.1 protein_id gnl|my_center|LOCUS_17690 133511 132609 gene locus_tag LOCUS_17700 133511 132609 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036068.1 protein_id gnl|my_center|LOCUS_17700 135231 133582 gene locus_tag LOCUS_17710 gene ahpF 135231 133582 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389171.1 protein_id gnl|my_center|LOCUS_17710 135936 135373 gene locus_tag LOCUS_17720 gene ahpC 135936 135373 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501015.1 protein_id gnl|my_center|LOCUS_17720 136199 137938 gene locus_tag LOCUS_17730 136199 137938 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083824.1 protein_id gnl|my_center|LOCUS_17730 137978 140038 gene locus_tag LOCUS_17740 137978 140038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 140317 140051 gene locus_tag LOCUS_17750 140317 140051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 140295 140894 gene locus_tag LOCUS_17760 140295 140894 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400924.1 protein_id gnl|my_center|LOCUS_17760 140948 141394 gene locus_tag LOCUS_17770 140948 141394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 142836 141589 gene locus_tag LOCUS_17780 142836 141589 CDS product bifunctional alpha/beta hydrolase/OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970426.1 protein_id gnl|my_center|LOCUS_17780 143459 144448 gene locus_tag LOCUS_17790 143459 144448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17790 144427 144762 gene locus_tag LOCUS_17800 144427 144762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 144895 145335 gene locus_tag LOCUS_17810 144895 145335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 145408 146100 gene locus_tag LOCUS_17820 145408 146100 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812168.1 protein_id gnl|my_center|LOCUS_17820 146157 146666 gene locus_tag LOCUS_17830 146157 146666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 147217 146708 gene locus_tag LOCUS_17840 147217 146708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17840 148527 147115 gene locus_tag LOCUS_17850 148527 147115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17850 149584 148559 gene locus_tag LOCUS_17860 149584 148559 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224840.1 protein_id gnl|my_center|LOCUS_17860 149649 150095 gene locus_tag LOCUS_17870 149649 150095 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110027.1 protein_id gnl|my_center|LOCUS_17870 150566 150138 gene locus_tag LOCUS_17880 150566 150138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 150852 151097 gene locus_tag LOCUS_17890 150852 151097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 151292 151573 gene locus_tag LOCUS_17900 151292 151573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 152157 151600 gene locus_tag LOCUS_17910 152157 151600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 152615 153712 gene locus_tag LOCUS_17920 152615 153712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17920 153736 153987 gene locus_tag LOCUS_17930 153736 153987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17930 154511 155344 gene locus_tag LOCUS_17940 154511 155344 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777038.1 protein_id gnl|my_center|LOCUS_17940 155764 155390 gene locus_tag LOCUS_17950 155764 155390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 156242 155997 gene locus_tag LOCUS_17960 156242 155997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 156682 156317 gene locus_tag LOCUS_17970 156682 156317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 157172 156927 gene locus_tag LOCUS_17980 157172 156927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 157355 157173 gene locus_tag LOCUS_17990 157355 157173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 158735 157467 gene locus_tag LOCUS_18000 158735 157467 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639983.1 protein_id gnl|my_center|LOCUS_18000 160096 161085 gene locus_tag LOCUS_18010 160096 161085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18010 162010 161474 gene locus_tag LOCUS_18020 162010 161474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18020 162251 162030 gene locus_tag LOCUS_18030 162251 162030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 162377 162727 gene locus_tag LOCUS_18040 162377 162727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 162775 165288 gene locus_tag LOCUS_18050 162775 165288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 165364 166623 gene locus_tag LOCUS_18060 165364 166623 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027250.1 protein_id gnl|my_center|LOCUS_18060 166960 166640 gene locus_tag LOCUS_18070 166960 166640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 167345 166962 gene locus_tag LOCUS_18080 167345 166962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 167468 168727 gene locus_tag LOCUS_18090 167468 168727 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977530.1 protein_id gnl|my_center|LOCUS_18090 168724 172575 gene locus_tag LOCUS_18100 168724 172575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 172577 176197 gene locus_tag LOCUS_18110 gene recC 172577 176197 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877040.1 protein_id gnl|my_center|LOCUS_18110 176194 179613 gene locus_tag LOCUS_18120 gene recB 176194 179613 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727605.1 protein_id gnl|my_center|LOCUS_18120 179694 181547 gene locus_tag LOCUS_18130 gene recD 179694 181547 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727604.1 protein_id gnl|my_center|LOCUS_18130 181569 181847 gene locus_tag LOCUS_18140 181569 181847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 181857 182279 gene locus_tag LOCUS_18150 181857 182279 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899952.1 protein_id gnl|my_center|LOCUS_18150 182991 182317 gene locus_tag LOCUS_18160 182991 182317 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082705.1 protein_id gnl|my_center|LOCUS_18160 184283 182988 gene locus_tag LOCUS_18170 184283 182988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 184261 184515 gene locus_tag LOCUS_18180 184261 184515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 184757 185659 gene locus_tag LOCUS_18190 184757 185659 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895075.1 protein_id gnl|my_center|LOCUS_18190 186028 185687 gene locus_tag LOCUS_18200 186028 185687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 186251 186015 gene locus_tag LOCUS_18210 186251 186015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 186404 186910 gene locus_tag LOCUS_18220 186404 186910 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109460.1 protein_id gnl|my_center|LOCUS_18220 187360 186920 gene locus_tag LOCUS_18230 187360 186920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 188373 187909 gene locus_tag LOCUS_18240 188373 187909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 188850 189728 gene locus_tag LOCUS_18250 188850 189728 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074041.1 protein_id gnl|my_center|LOCUS_18250 189788 190165 gene locus_tag LOCUS_18260 189788 190165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 190220 190819 gene locus_tag LOCUS_18270 190220 190819 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109460.1 protein_id gnl|my_center|LOCUS_18270 190977 191345 gene locus_tag LOCUS_18280 190977 191345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 191356 191763 gene locus_tag LOCUS_18290 191356 191763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 191773 192285 gene locus_tag LOCUS_18300 191773 192285 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467027.1 protein_id gnl|my_center|LOCUS_18300 192308 192976 gene locus_tag LOCUS_18310 192308 192976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 193155 193487 gene locus_tag LOCUS_18320 193155 193487 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112420.1 protein_id gnl|my_center|LOCUS_18320 193883 195790 gene locus_tag LOCUS_18330 193883 195790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 196111 196548 gene locus_tag LOCUS_18340 196111 196548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 196699 198939 gene locus_tag LOCUS_18350 196699 198939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 198936 199850 gene locus_tag LOCUS_18360 198936 199850 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256857.1 protein_id gnl|my_center|LOCUS_18360 199909 200805 gene locus_tag LOCUS_18370 199909 200805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 200802 202352 gene locus_tag LOCUS_18380 200802 202352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 202499 203473 gene locus_tag LOCUS_18390 202499 203473 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259250.1 protein_id gnl|my_center|LOCUS_18390 203479 204354 gene locus_tag LOCUS_18400 203479 204354 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259037.1 protein_id gnl|my_center|LOCUS_18400 204422 209062 gene locus_tag LOCUS_18410 204422 209062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 209437 209162 gene locus_tag LOCUS_18420 gene relE 209437 209162 CDS product type II toxin-antitoxin system mRNA interferase RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898789.1 protein_id gnl|my_center|LOCUS_18420 209859 209434 gene locus_tag LOCUS_18430 209859 209434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 211783 209939 gene locus_tag LOCUS_18440 211783 209939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 214592 212046 gene locus_tag LOCUS_18450 214592 212046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 214744 215103 gene locus_tag LOCUS_18460 214744 215103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 215096 216316 gene locus_tag LOCUS_18470 215096 216316 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138052126.1 protein_id gnl|my_center|LOCUS_18470 217206 216400 gene locus_tag LOCUS_18480 217206 216400 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111854.1 protein_id gnl|my_center|LOCUS_18480 217308 218510 gene locus_tag LOCUS_18490 gene cyp142 217308 218510 CDS product steroid C26-monooxygenase Cyp142 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900082.1 protein_id gnl|my_center|LOCUS_18490 219264 218530 gene locus_tag LOCUS_18500 219264 218530 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879510.1 protein_id gnl|my_center|LOCUS_18500 220802 219303 gene locus_tag LOCUS_18510 220802 219303 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030033.1 protein_id gnl|my_center|LOCUS_18510 221503 220934 gene locus_tag LOCUS_18520 221503 220934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 221929 221564 gene locus_tag LOCUS_18530 221929 221564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 222067 222522 gene locus_tag LOCUS_18540 gene rppH 222067 222522 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564489.1 protein_id gnl|my_center|LOCUS_18540 222666 223070 gene locus_tag LOCUS_18550 222666 223070 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083682.1 protein_id gnl|my_center|LOCUS_18550 223201 224106 gene locus_tag LOCUS_18560 223201 224106 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229561.1 protein_id gnl|my_center|LOCUS_18560 224149 225012 gene locus_tag LOCUS_18570 224149 225012 CDS product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730987.1 protein_id gnl|my_center|LOCUS_18570 225911 225045 gene locus_tag LOCUS_18580 225911 225045 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228377.1 protein_id gnl|my_center|LOCUS_18580 226900 225908 gene locus_tag LOCUS_18590 226900 225908 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143461.1 protein_id gnl|my_center|LOCUS_18590 227291 227503 gene locus_tag LOCUS_18600 227291 227503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 228109 227792 gene locus_tag LOCUS_18610 228109 227792 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403376.1 protein_id gnl|my_center|LOCUS_18610 228357 228106 gene locus_tag LOCUS_18620 228357 228106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 228823 229149 gene locus_tag LOCUS_18630 228823 229149 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561276.1 protein_id gnl|my_center|LOCUS_18630 230586 229273 gene locus_tag LOCUS_18640 230586 229273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 230946 231074 gene locus_tag LOCUS_18650 230946 231074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18650 231274 231059 gene locus_tag LOCUS_18660 231274 231059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 231359 231760 gene locus_tag LOCUS_18670 231359 231760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18670 231938 232837 gene locus_tag LOCUS_18680 231938 232837 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532545.1 protein_id gnl|my_center|LOCUS_18680 233768 232878 gene locus_tag LOCUS_18690 233768 232878 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256749.1 protein_id gnl|my_center|LOCUS_18690 234908 233904 gene locus_tag LOCUS_18700 gene selD 234908 233904 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804588.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18700 236246 235062 gene locus_tag LOCUS_18710 236246 235062 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098538.1 protein_id gnl|my_center|LOCUS_18710 236411 236782 gene locus_tag LOCUS_18720 236411 236782 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028983.1 protein_id gnl|my_center|LOCUS_18720 236966 237607 gene locus_tag LOCUS_18730 236966 237607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 238502 237621 gene locus_tag LOCUS_18740 238502 237621 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092227.1 protein_id gnl|my_center|LOCUS_18740 238649 238987 gene locus_tag LOCUS_18750 238649 238987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 239265 239492 gene locus_tag LOCUS_18760 239265 239492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 240309 239497 gene locus_tag LOCUS_18770 240309 239497 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224716.1 protein_id gnl|my_center|LOCUS_18770 241633 240419 gene locus_tag LOCUS_18780 241633 240419 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090523.1 protein_id gnl|my_center|LOCUS_18780 242872 241685 gene locus_tag LOCUS_18790 242872 241685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 243934 243095 gene locus_tag LOCUS_18800 243934 243095 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973042.1 protein_id gnl|my_center|LOCUS_18800 243964 245493 gene locus_tag LOCUS_18810 243964 245493 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972529.1 protein_id gnl|my_center|LOCUS_18810 247950 245509 gene locus_tag LOCUS_18820 247950 245509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 248018 248755 gene locus_tag LOCUS_18830 gene frnE 248018 248755 CDS product protein disulfide isomerase FrnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887304.1 protein_id gnl|my_center|LOCUS_18830 249935 249204 gene locus_tag LOCUS_18840 249935 249204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 250521 249928 gene locus_tag LOCUS_18850 250521 249928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 251899 250640 gene locus_tag LOCUS_18860 251899 250640 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225240.1 protein_id gnl|my_center|LOCUS_18860 252370 251921 gene locus_tag LOCUS_18870 252370 251921 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730423.1 protein_id gnl|my_center|LOCUS_18870 252862 252515 gene locus_tag LOCUS_18880 gene mazF9 252862 252515 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414166.1 protein_id gnl|my_center|LOCUS_18880 253080 252862 gene locus_tag LOCUS_18890 253080 252862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 253325 253077 gene locus_tag LOCUS_18900 253325 253077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 253409 254404 gene locus_tag LOCUS_18910 gene cysD 253409 254404 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640249.1 protein_id gnl|my_center|LOCUS_18910 254404 256323 gene locus_tag LOCUS_18920 gene cysN 254404 256323 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919356.1 protein_id gnl|my_center|LOCUS_18920 257991 257575 gene locus_tag LOCUS_18930 257991 257575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 259169 258120 gene locus_tag LOCUS_18940 259169 258120 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113158.1 protein_id gnl|my_center|LOCUS_18940 260391 259228 gene locus_tag LOCUS_18950 260391 259228 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113160.1 protein_id gnl|my_center|LOCUS_18950 260592 261740 gene locus_tag LOCUS_18960 260592 261740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 261837 262229 gene locus_tag LOCUS_18970 261837 262229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 263552 262290 gene locus_tag LOCUS_18980 263552 262290 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228423.1 protein_id gnl|my_center|LOCUS_18980 264756 263611 gene locus_tag LOCUS_18990 264756 263611 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419324.1 protein_id gnl|my_center|LOCUS_18990 265540 264749 gene locus_tag LOCUS_19000 265540 264749 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225237.1 protein_id gnl|my_center|LOCUS_19000 266400 265537 gene locus_tag LOCUS_19010 266400 265537 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225236.1 protein_id gnl|my_center|LOCUS_19010 267243 266485 gene locus_tag LOCUS_19020 267243 266485 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897402.1 protein_id gnl|my_center|LOCUS_19020 267343 268161 gene locus_tag LOCUS_19030 267343 268161 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225233.1 protein_id gnl|my_center|LOCUS_19030 268257 269006 gene locus_tag LOCUS_19040 268257 269006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 269153 269644 gene locus_tag LOCUS_19050 269153 269644 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408058.1 protein_id gnl|my_center|LOCUS_19050 269641 270837 gene locus_tag LOCUS_19060 269641 270837 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729364.1 protein_id gnl|my_center|LOCUS_19060 270875 272035 gene locus_tag LOCUS_19070 gene bioF 270875 272035 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_19070 272068 272754 gene locus_tag LOCUS_19080 272068 272754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 272779 274017 gene locus_tag LOCUS_19090 272779 274017 CDS product trans-acting enoyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896009.1 protein_id gnl|my_center|LOCUS_19090 278711 274728 gene locus_tag LOCUS_19100 278711 274728 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974308.1 protein_id gnl|my_center|LOCUS_19100 280395 278833 gene locus_tag LOCUS_19110 280395 278833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19110 282419 280392 gene locus_tag LOCUS_19120 282419 280392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19120 283365 282625 gene locus_tag LOCUS_19130 283365 282625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 283679 283443 gene locus_tag LOCUS_19140 283679 283443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 283576 285222 gene locus_tag LOCUS_19150 283576 285222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 285662 285288 gene locus_tag LOCUS_19160 gene rplL 285662 285288 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974310.1 protein_id gnl|my_center|LOCUS_19160 286414 285665 gene locus_tag LOCUS_19170 286414 285665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 287381 286686 gene locus_tag LOCUS_19180 gene rplA 287381 286686 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061480.1 protein_id gnl|my_center|LOCUS_19180 288073 287486 gene locus_tag LOCUS_19190 288073 287486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 289060 288215 gene locus_tag LOCUS_19200 gene nusG 289060 288215 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727616.1 protein_id gnl|my_center|LOCUS_19200 289518 289141 gene locus_tag LOCUS_19210 289518 289141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 289774 290166 gene locus_tag LOCUS_19220 289774 290166 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228341.1 protein_id gnl|my_center|LOCUS_19220 291848 290241 gene locus_tag LOCUS_19230 291848 290241 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531218.1 protein_id gnl|my_center|LOCUS_19230 292063 292227 gene locus_tag LOCUS_19240 292063 292227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 292572 293093 gene locus_tag LOCUS_19250 292572 293093 CDS product YdeI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234230.1 protein_id gnl|my_center|LOCUS_19250 293208 293675 gene locus_tag LOCUS_19260 293208 293675 CDS product heme-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888078.1 protein_id gnl|my_center|LOCUS_19260 294223 294603 gene locus_tag LOCUS_19270 294223 294603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 294743 294549 gene locus_tag LOCUS_19280 294743 294549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 294755 296944 gene locus_tag LOCUS_19290 294755 296944 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029390.1 protein_id gnl|my_center|LOCUS_19290 298488 297028 gene locus_tag LOCUS_19300 298488 297028 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986845.1 protein_id gnl|my_center|LOCUS_19300 299365 298718 gene locus_tag LOCUS_19310 299365 298718 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107019778.1 protein_id gnl|my_center|LOCUS_19310 299581 300282 gene locus_tag LOCUS_19320 299581 300282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 300286 300957 gene locus_tag LOCUS_19330 300286 300957 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230358.1 protein_id gnl|my_center|LOCUS_19330 300957 302327 gene locus_tag LOCUS_19340 300957 302327 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973593.1 protein_id gnl|my_center|LOCUS_19340 302416 302787 gene locus_tag LOCUS_19350 302416 302787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 303733 303446 gene locus_tag LOCUS_19360 303733 303446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 304499 304377 gene locus_tag LOCUS_19370 304499 304377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 304825 304562 gene locus_tag LOCUS_19380 304825 304562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 305082 305255 gene locus_tag LOCUS_19390 305082 305255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 305295 305477 gene locus_tag LOCUS_19400 305295 305477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 305776 306543 gene locus_tag LOCUS_19410 305776 306543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 306967 307230 gene locus_tag LOCUS_19420 306967 307230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 308313 307306 gene locus_tag LOCUS_19430 gene xerD 308313 307306 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390088.1 protein_id gnl|my_center|LOCUS_19430 309252 308446 gene locus_tag LOCUS_19440 gene fabG 309252 308446 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_19440 309562 309864 gene locus_tag LOCUS_19450 309562 309864 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921003.1 protein_id gnl|my_center|LOCUS_19450 309988 310653 gene locus_tag LOCUS_19460 309988 310653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 310941 311168 gene locus_tag LOCUS_19470 310941 311168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 311165 311542 gene locus_tag LOCUS_19480 311165 311542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 311693 312838 gene locus_tag LOCUS_19490 311693 312838 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229317.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19490 313232 313477 gene locus_tag LOCUS_19500 313232 313477 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403381.1 protein_id gnl|my_center|LOCUS_19500 313464 313769 gene locus_tag LOCUS_19510 313464 313769 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403376.1 protein_id gnl|my_center|LOCUS_19510 314933 314409 gene locus_tag LOCUS_19520 314933 314409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 315934 315020 gene locus_tag LOCUS_19530 315934 315020 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392170.1 protein_id gnl|my_center|LOCUS_19530 316185 317534 gene locus_tag LOCUS_19540 316185 317534 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_19540 317531 318142 gene locus_tag LOCUS_19550 317531 318142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 318927 319127 gene locus_tag LOCUS_19560 318927 319127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 319313 319056 gene locus_tag LOCUS_19570 319313 319056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 320293 319856 gene locus_tag LOCUS_19580 320293 319856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 320468 320256 gene locus_tag LOCUS_19590 320468 320256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 320581 323364 gene locus_tag LOCUS_19600 320581 323364 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950658.1 protein_id gnl|my_center|LOCUS_19600 323364 324200 gene locus_tag LOCUS_19610 323364 324200 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899172.1 protein_id gnl|my_center|LOCUS_19610 325079 324219 gene locus_tag LOCUS_19620 325079 324219 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974012.1 protein_id gnl|my_center|LOCUS_19620 326050 325076 gene locus_tag LOCUS_19630 326050 325076 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230441.1 protein_id gnl|my_center|LOCUS_19630 326820 326047 gene locus_tag LOCUS_19640 326820 326047 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466502.1 protein_id gnl|my_center|LOCUS_19640 327433 326918 gene locus_tag LOCUS_19650 327433 326918 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392986.1 protein_id gnl|my_center|LOCUS_19650 329406 327703 gene locus_tag LOCUS_19660 329406 327703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 329526 329843 gene locus_tag LOCUS_19670 329526 329843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 331570 329735 gene locus_tag LOCUS_19680 331570 329735 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256059.1 protein_id gnl|my_center|LOCUS_19680 333117 331789 gene locus_tag LOCUS_19690 333117 331789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 333178 333828 gene locus_tag LOCUS_19700 333178 333828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975485.1 protein_id gnl|my_center|LOCUS_19700 333976 335859 gene locus_tag LOCUS_19710 333976 335859 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198536.1 protein_id gnl|my_center|LOCUS_19710 336985 336170 gene locus_tag LOCUS_19720 gene fetB 336985 336170 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090794.1 protein_id gnl|my_center|LOCUS_19720 337716 336982 gene locus_tag LOCUS_19730 337716 336982 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392686.1 protein_id gnl|my_center|LOCUS_19730 337848 338099 gene locus_tag LOCUS_19740 337848 338099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 338387 338713 gene locus_tag LOCUS_19750 338387 338713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 339060 338650 gene locus_tag LOCUS_19760 339060 338650 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403246.1 protein_id gnl|my_center|LOCUS_19760 339307 339053 gene locus_tag LOCUS_19770 339307 339053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 340245 339640 gene locus_tag LOCUS_19780 340245 339640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 340733 340912 gene locus_tag LOCUS_19790 340733 340912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 340946 341251 gene locus_tag LOCUS_19800 340946 341251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 341296 342975 gene locus_tag LOCUS_19810 341296 342975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 343440 343871 gene locus_tag LOCUS_19820 343440 343871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 344897 345385 gene locus_tag LOCUS_19830 344897 345385 CDS product plastocyanin/azurin family copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967544.1 protein_id gnl|my_center|LOCUS_19830 346315 345431 gene locus_tag LOCUS_19840 346315 345431 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030856.1 protein_id gnl|my_center|LOCUS_19840 346674 346315 gene locus_tag LOCUS_19850 346674 346315 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027265.1 protein_id gnl|my_center|LOCUS_19850 347709 347167 gene locus_tag LOCUS_19860 347709 347167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 349320 347857 gene locus_tag LOCUS_19870 349320 347857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 349692 349925 gene locus_tag LOCUS_19880 349692 349925 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775998.1 protein_id gnl|my_center|LOCUS_19880 349922 350896 gene locus_tag LOCUS_19890 349922 350896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225367.1 protein_id gnl|my_center|LOCUS_19890 350889 353216 gene locus_tag LOCUS_19900 350889 353216 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776000.1 protein_id gnl|my_center|LOCUS_19900 353213 355342 gene locus_tag LOCUS_19910 353213 355342 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777103.1 protein_id gnl|my_center|LOCUS_19910 355391 355720 gene locus_tag LOCUS_19920 355391 355720 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776001.1 protein_id gnl|my_center|LOCUS_19920 356613 355747 gene locus_tag LOCUS_19930 356613 355747 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112261.1 protein_id gnl|my_center|LOCUS_19930 357326 356610 gene locus_tag LOCUS_19940 357326 356610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 357817 357323 gene locus_tag LOCUS_19950 357817 357323 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228871.1 protein_id gnl|my_center|LOCUS_19950 358056 358394 gene locus_tag LOCUS_19960 358056 358394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 358513 359862 gene locus_tag LOCUS_19970 358513 359862 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065084.1 protein_id gnl|my_center|LOCUS_19970 360403 359819 gene locus_tag LOCUS_19980 360403 359819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 360961 361350 gene locus_tag LOCUS_19990 360961 361350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 361487 362827 gene locus_tag LOCUS_20000 361487 362827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 362934 363404 gene locus_tag LOCUS_20010 362934 363404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 363682 364065 gene locus_tag LOCUS_20020 363682 364065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 364005 364481 gene locus_tag LOCUS_20030 364005 364481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 364553 365503 gene locus_tag LOCUS_20040 364553 365503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 365686 365988 gene locus_tag LOCUS_20050 365686 365988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 366280 367347 gene locus_tag LOCUS_20060 366280 367347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 368320 367913 gene locus_tag LOCUS_20070 gene vapC26 368320 367913 CDS product type II toxin-antitoxin system toxin ribonuclease C26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403047.1 protein_id gnl|my_center|LOCUS_20070 368583 368323 gene locus_tag LOCUS_20080 368583 368323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 368769 369101 gene locus_tag LOCUS_20090 368769 369101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 370417 370617 gene locus_tag LOCUS_20100 370417 370617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 370982 370662 gene locus_tag LOCUS_20110 370982 370662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 371179 371418 gene locus_tag LOCUS_20120 371179 371418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 372034 371573 gene locus_tag LOCUS_20130 372034 371573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20130 373124 372780 gene locus_tag LOCUS_20140 373124 372780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 373899 373537 gene locus_tag LOCUS_20150 373899 373537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 374008 374193 gene locus_tag LOCUS_20160 374008 374193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 375148 374768 gene locus_tag LOCUS_20170 375148 374768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 375236 376942 gene locus_tag LOCUS_20180 375236 376942 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_20180 377171 377098 gene locus_tag LOCUS_t00310 377171 377098 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 377655 377287 gene locus_tag LOCUS_20190 377655 377287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 378376 377645 gene locus_tag LOCUS_20200 378376 377645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 378572 378411 gene locus_tag LOCUS_20210 gene rpmG 378572 378411 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630505.1 protein_id gnl|my_center|LOCUS_20210 379769 378582 gene locus_tag LOCUS_20220 gene tuf 379769 378582 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215366.1 protein_id gnl|my_center|LOCUS_20220 379910 379834 gene locus_tag LOCUS_t00320 379910 379834 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 380044 379969 gene locus_tag LOCUS_t00330 380044 379969 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 380293 380727 gene locus_tag LOCUS_20230 380293 380727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 380833 381111 gene locus_tag LOCUS_20240 380833 381111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 381231 381737 gene locus_tag LOCUS_20250 381231 381737 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887825.1 protein_id gnl|my_center|LOCUS_20250 381870 381788 gene locus_tag LOCUS_t00340 381870 381788 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 382004 382492 gene locus_tag LOCUS_20260 382004 382492 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077736.1 protein_id gnl|my_center|LOCUS_20260 383047 382535 gene locus_tag LOCUS_20270 383047 382535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 383691 383083 gene locus_tag LOCUS_20280 383691 383083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 384604 383759 gene locus_tag LOCUS_20290 384604 383759 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460068.1 protein_id gnl|my_center|LOCUS_20290 385317 384907 gene locus_tag LOCUS_20300 385317 384907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 386221 385688 gene locus_tag LOCUS_20310 386221 385688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 386184 386474 gene locus_tag LOCUS_20320 386184 386474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 387046 387693 gene locus_tag LOCUS_20330 gene nth 387046 387693 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778932.1 protein_id gnl|my_center|LOCUS_20330 389832 387781 gene locus_tag LOCUS_20340 gene acs 389832 387781 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975373.1 protein_id gnl|my_center|LOCUS_20340 389956 390753 gene locus_tag LOCUS_20350 389956 390753 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887971.1 protein_id gnl|my_center|LOCUS_20350 391560 390799 gene locus_tag LOCUS_20360 391560 390799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 393397 391694 gene locus_tag LOCUS_20370 393397 391694 CDS product copper resistance CopC/CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529536.1 protein_id gnl|my_center|LOCUS_20370 394619 393468 gene locus_tag LOCUS_20380 394619 393468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 396144 394630 gene locus_tag LOCUS_20390 396144 394630 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392502.1 protein_id gnl|my_center|LOCUS_20390 397678 396149 gene locus_tag LOCUS_20400 397678 396149 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029759.1 protein_id gnl|my_center|LOCUS_20400 400043 397806 gene locus_tag LOCUS_20410 gene nuoL 400043 397806 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_20410 400344 400048 gene locus_tag LOCUS_20420 gene nuoK 400344 400048 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140654.1 protein_id gnl|my_center|LOCUS_20420 400873 400349 gene locus_tag LOCUS_20430 400873 400349 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257850.1 protein_id gnl|my_center|LOCUS_20430 401427 400870 gene locus_tag LOCUS_20440 401427 400870 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974344.1 protein_id gnl|my_center|LOCUS_20440 401909 401688 gene locus_tag LOCUS_20450 401909 401688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 403089 402055 gene locus_tag LOCUS_20460 403089 402055 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029756.1 protein_id gnl|my_center|LOCUS_20460 404258 403086 gene locus_tag LOCUS_20470 404258 403086 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975441.1 protein_id gnl|my_center|LOCUS_20470 404959 404255 gene locus_tag LOCUS_20480 404959 404255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 405474 404956 gene locus_tag LOCUS_20490 405474 404956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 405842 405465 gene locus_tag LOCUS_20500 405842 405465 CDS product NAD(P)H-quinone oxidoreductase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124480.1 protein_id gnl|my_center|LOCUS_20500 405933 406331 gene locus_tag LOCUS_20510 405933 406331 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976576.1 protein_id gnl|my_center|LOCUS_20510 406515 410813 gene locus_tag LOCUS_20520 406515 410813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 411088 411780 gene locus_tag LOCUS_20530 411088 411780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776164.1 protein_id gnl|my_center|LOCUS_20530 411777 412379 gene locus_tag LOCUS_20540 411777 412379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 412508 414685 gene locus_tag LOCUS_20550 412508 414685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 416678 414792 gene locus_tag LOCUS_20560 416678 414792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 418451 416889 gene locus_tag LOCUS_20570 gene nuoN 418451 416889 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974371.1 protein_id gnl|my_center|LOCUS_20570 420061 418448 gene locus_tag LOCUS_20580 420061 418448 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_20580 422142 420061 gene locus_tag LOCUS_20590 422142 420061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 422473 422147 gene locus_tag LOCUS_20600 gene nuoK 422473 422147 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081840.1 protein_id gnl|my_center|LOCUS_20600 423141 422470 gene locus_tag LOCUS_20610 423141 422470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 423830 423141 gene locus_tag LOCUS_20620 gene nuoI 423830 423141 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327003.1 protein_id gnl|my_center|LOCUS_20620 425119 423830 gene locus_tag LOCUS_20630 gene nuoH 425119 423830 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416445.1 protein_id gnl|my_center|LOCUS_20630 427746 425119 gene locus_tag LOCUS_20640 427746 425119 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110659.1 protein_id gnl|my_center|LOCUS_20640 429145 427739 gene locus_tag LOCUS_20650 gene nuoF 429145 427739 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909320.1 protein_id gnl|my_center|LOCUS_20650 429885 429145 gene locus_tag LOCUS_20660 429885 429145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 431428 429929 gene locus_tag LOCUS_20670 431428 429929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 431582 432526 gene locus_tag LOCUS_20680 431582 432526 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936979.1 protein_id gnl|my_center|LOCUS_20680 432740 433147 gene locus_tag LOCUS_20690 432740 433147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 433829 433398 gene locus_tag LOCUS_20700 433829 433398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 433810 434037 gene locus_tag LOCUS_20710 433810 434037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 435465 434143 gene locus_tag LOCUS_20720 435465 434143 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222455.1 protein_id gnl|my_center|LOCUS_20720 435872 435465 gene locus_tag LOCUS_20730 435872 435465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 436522 435941 gene locus_tag LOCUS_20740 436522 435941 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081859.1 protein_id gnl|my_center|LOCUS_20740 436971 436519 gene locus_tag LOCUS_20750 gene ndhC 436971 436519 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932448.1 protein_id gnl|my_center|LOCUS_20750 437963 436974 gene locus_tag LOCUS_20760 437963 436974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 439349 437967 gene locus_tag LOCUS_20770 439349 437967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 440277 439420 gene locus_tag LOCUS_20780 440277 439420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 441101 440334 gene locus_tag LOCUS_20790 441101 440334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 441902 441117 gene locus_tag LOCUS_20800 441902 441117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 442352 441936 gene locus_tag LOCUS_20810 442352 441936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 442782 442357 gene locus_tag LOCUS_20820 442782 442357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 442927 443802 gene locus_tag LOCUS_20830 442927 443802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 443862 445214 gene locus_tag LOCUS_20840 443862 445214 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_20840 447024 445195 gene locus_tag LOCUS_20850 447024 445195 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108652.1 protein_id gnl|my_center|LOCUS_20850 447329 447027 gene locus_tag LOCUS_20860 447329 447027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 448826 447351 gene locus_tag LOCUS_20870 448826 447351 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803920.1 protein_id gnl|my_center|LOCUS_20870 449244 449020 gene locus_tag LOCUS_20880 449244 449020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 450406 449621 gene locus_tag LOCUS_20890 450406 449621 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030437.1 protein_id gnl|my_center|LOCUS_20890 450532 450984 gene locus_tag LOCUS_20900 450532 450984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 450981 451580 gene locus_tag LOCUS_20910 450981 451580 CDS product NUDIX hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870383.1 protein_id gnl|my_center|LOCUS_20910 452036 451605 gene locus_tag LOCUS_20920 452036 451605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 452548 452033 gene locus_tag LOCUS_20930 452548 452033 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975651.1 protein_id gnl|my_center|LOCUS_20930 452563 452859 gene locus_tag LOCUS_20940 452563 452859 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728084.1 protein_id gnl|my_center|LOCUS_20940 452946 453419 gene locus_tag LOCUS_20950 452946 453419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 458289 453598 gene locus_tag LOCUS_20960 458289 453598 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030438.1 protein_id gnl|my_center|LOCUS_20960 459076 458276 gene locus_tag LOCUS_20970 459076 458276 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976789.1 protein_id gnl|my_center|LOCUS_20970 460815 459136 gene locus_tag LOCUS_20980 gene leuA 460815 459136 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285511.1 protein_id gnl|my_center|LOCUS_20980 462215 461046 gene locus_tag LOCUS_20990 462215 461046 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031788.1 protein_id gnl|my_center|LOCUS_20990 462377 462856 gene locus_tag LOCUS_21000 462377 462856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 463786 462932 gene locus_tag LOCUS_21010 463786 462932 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730402.1 protein_id gnl|my_center|LOCUS_21010 464102 465412 gene locus_tag LOCUS_21020 464102 465412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 465985 465464 gene locus_tag LOCUS_21030 gene dut 465985 465464 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224478.1 protein_id gnl|my_center|LOCUS_21030 466055 466594 gene locus_tag LOCUS_21040 gene orn 466055 466594 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005096508.1 protein_id gnl|my_center|LOCUS_21040 467321 466620 gene locus_tag LOCUS_21050 467321 466620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 467486 467698 gene locus_tag LOCUS_21060 467486 467698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 467865 468242 gene locus_tag LOCUS_21070 467865 468242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 468282 469001 gene locus_tag LOCUS_21080 468282 469001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 469030 469983 gene locus_tag LOCUS_21090 469030 469983 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112261.1 protein_id gnl|my_center|LOCUS_21090 470549 469935 gene locus_tag LOCUS_21100 gene pdxH 470549 469935 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029623.1 protein_id gnl|my_center|LOCUS_21100 470795 471925 gene locus_tag LOCUS_21110 gene dusB 470795 471925 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230697.1 protein_id gnl|my_center|LOCUS_21110 471918 472562 gene locus_tag LOCUS_21120 471918 472562 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703625.1 protein_id gnl|my_center|LOCUS_21120 473832 472546 gene locus_tag LOCUS_21130 gene serS 473832 472546 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940715.1 protein_id gnl|my_center|LOCUS_21130 474764 473928 gene locus_tag LOCUS_21140 474764 473928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 474809 475780 gene locus_tag LOCUS_21150 474809 475780 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407477.1 protein_id gnl|my_center|LOCUS_21150 475777 476502 gene locus_tag LOCUS_21160 475777 476502 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976890.1 protein_id gnl|my_center|LOCUS_21160 477000 476512 gene locus_tag LOCUS_21170 477000 476512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 477662 477012 gene locus_tag LOCUS_21180 gene cyoC 477662 477012 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086858.1 protein_id gnl|my_center|LOCUS_21180 479766 477655 gene locus_tag LOCUS_21190 gene ctaD 479766 477655 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011371630.1 protein_id gnl|my_center|LOCUS_21190 480214 479789 gene locus_tag LOCUS_21200 480214 479789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 480963 480112 gene locus_tag LOCUS_21210 480963 480112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21210 481878 480985 gene locus_tag LOCUS_21220 481878 480985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 482470 481892 gene locus_tag LOCUS_21230 482470 481892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 484101 482467 gene locus_tag LOCUS_21240 484101 482467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 485054 484248 gene locus_tag LOCUS_21250 485054 484248 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976885.1 protein_id gnl|my_center|LOCUS_21250 484942 485166 gene locus_tag LOCUS_21260 484942 485166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 485278 486330 gene locus_tag LOCUS_21270 485278 486330 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897656.1 protein_id gnl|my_center|LOCUS_21270 486327 486638 gene locus_tag LOCUS_21280 gene clpS 486327 486638 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229464.1 protein_id gnl|my_center|LOCUS_21280 486709 487680 gene locus_tag LOCUS_21290 486709 487680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 487844 487771 gene locus_tag LOCUS_t00350 487844 487771 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 487982 487905 gene locus_tag LOCUS_t00360 487982 487905 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 488313 488238 gene locus_tag LOCUS_t00370 488313 488238 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 489136 488426 gene locus_tag LOCUS_21300 489136 488426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 490562 489159 gene locus_tag LOCUS_21310 490562 489159 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839201.1 protein_id gnl|my_center|LOCUS_21310 491938 490724 gene locus_tag LOCUS_21320 491938 490724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 493566 491935 gene locus_tag LOCUS_21330 493566 491935 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027201.1 protein_id gnl|my_center|LOCUS_21330 494777 493776 gene locus_tag LOCUS_21340 494777 493776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 495355 494774 gene locus_tag LOCUS_21350 495355 494774 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257731.1 protein_id gnl|my_center|LOCUS_21350 496288 495536 gene locus_tag LOCUS_21360 gene truA 496288 495536 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918167.1 protein_id gnl|my_center|LOCUS_21360 496823 496467 gene locus_tag LOCUS_21370 496823 496467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 497764 496820 gene locus_tag LOCUS_21380 497764 496820 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055961.1 protein_id gnl|my_center|LOCUS_21380 498480 497863 gene locus_tag LOCUS_21390 gene rpsD 498480 497863 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222624.1 protein_id gnl|my_center|LOCUS_21390 498896 498498 gene locus_tag LOCUS_21400 gene rpsK 498896 498498 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892910.1 protein_id gnl|my_center|LOCUS_21400 499347 498970 gene locus_tag LOCUS_21410 gene rpsM 499347 498970 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908646.1 protein_id gnl|my_center|LOCUS_21410 499755 499561 gene locus_tag LOCUS_21420 gene infA 499755 499561 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156508.1 protein_id gnl|my_center|LOCUS_21420 500636 499992 gene locus_tag LOCUS_21430 500636 499992 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_21430 501973 500636 gene locus_tag LOCUS_21440 gene secY 501973 500636 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222619.1 protein_id gnl|my_center|LOCUS_21440 502476 501991 gene locus_tag LOCUS_21450 gene rplO 502476 501991 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776358.1 protein_id gnl|my_center|LOCUS_21450 502658 502473 gene locus_tag LOCUS_21460 gene rpmD 502658 502473 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201159.1 protein_id gnl|my_center|LOCUS_21460 503245 502658 gene locus_tag LOCUS_21470 gene rpsE 503245 502658 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892859.1 protein_id gnl|my_center|LOCUS_21470 503613 503248 gene locus_tag LOCUS_21480 gene rplR 503613 503248 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053041.1 protein_id gnl|my_center|LOCUS_21480 504169 503633 gene locus_tag LOCUS_21490 gene rplF 504169 503633 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776362.1 protein_id gnl|my_center|LOCUS_21490 504583 504179 gene locus_tag LOCUS_21500 gene rpsH 504583 504179 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892856.1 protein_id gnl|my_center|LOCUS_21500 504783 504598 gene locus_tag LOCUS_21510 504783 504598 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908573.1 protein_id gnl|my_center|LOCUS_21510 505403 504783 gene locus_tag LOCUS_21520 gene rplE 505403 504783 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116961.1 protein_id gnl|my_center|LOCUS_21520 505735 505400 gene locus_tag LOCUS_21530 gene rplX 505735 505400 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547687.1 protein_id gnl|my_center|LOCUS_21530 506103 505735 gene locus_tag LOCUS_21540 gene rplN 506103 505735 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558867.1 protein_id gnl|my_center|LOCUS_21540 506402 506100 gene locus_tag LOCUS_21550 gene rpsQ 506402 506100 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974258.1 protein_id gnl|my_center|LOCUS_21550 506620 506402 gene locus_tag LOCUS_21560 506620 506402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 507036 506620 gene locus_tag LOCUS_21570 gene rplP 507036 506620 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892830.1 protein_id gnl|my_center|LOCUS_21570 507946 507041 gene locus_tag LOCUS_21580 gene rpsC 507946 507041 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080488.1 protein_id gnl|my_center|LOCUS_21580 508650 507946 gene locus_tag LOCUS_21590 508650 507946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 508937 508653 gene locus_tag LOCUS_21600 gene rpsS 508937 508653 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102083.1 protein_id gnl|my_center|LOCUS_21600 509813 508977 gene locus_tag LOCUS_21610 gene rplB 509813 508977 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727672.1 protein_id gnl|my_center|LOCUS_21610 510118 509825 gene locus_tag LOCUS_21620 510118 509825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 510762 510115 gene locus_tag LOCUS_21630 gene rplD 510762 510115 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222605.1 protein_id gnl|my_center|LOCUS_21630 511421 510762 gene locus_tag LOCUS_21640 gene rplC 511421 510762 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222604.1 protein_id gnl|my_center|LOCUS_21640 511820 512386 gene locus_tag LOCUS_21650 gene wcaB 511820 512386 CDS product colanic acid biosynthesis acetyltransferase WcaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888724.1 protein_id gnl|my_center|LOCUS_21650 512778 512467 gene locus_tag LOCUS_21660 gene rpsJ 512778 512467 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 protein_id gnl|my_center|LOCUS_21660 513695 512940 gene locus_tag LOCUS_21670 513695 512940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 514480 513932 gene locus_tag LOCUS_21680 514480 513932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21680 515118 514480 gene locus_tag LOCUS_21690 515118 514480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21690 517229 515175 gene locus_tag LOCUS_21700 gene fusA 517229 515175 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_21700 517861 517391 gene locus_tag LOCUS_21710 gene rpsG 517861 517391 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403456.1 protein_id gnl|my_center|LOCUS_21710 518234 517863 gene locus_tag LOCUS_21720 gene rpsL 518234 517863 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948652.1 protein_id gnl|my_center|LOCUS_21720 518224 518412 gene locus_tag LOCUS_21730 518224 518412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 519289 518549 gene locus_tag LOCUS_21740 519289 518549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 519722 520759 gene locus_tag LOCUS_21750 519722 520759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 520783 521811 gene locus_tag LOCUS_21760 520783 521811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 521802 522266 gene locus_tag LOCUS_21770 521802 522266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21770 522275 523567 gene locus_tag LOCUS_21780 522275 523567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 523687 524688 gene locus_tag LOCUS_21790 523687 524688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 524685 526262 gene locus_tag LOCUS_21800 524685 526262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 526355 527422 gene locus_tag LOCUS_21810 526355 527422 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977073.1 protein_id gnl|my_center|LOCUS_21810 529137 527440 gene locus_tag LOCUS_21820 529137 527440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 530082 529225 gene locus_tag LOCUS_21830 530082 529225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 531848 530079 gene locus_tag LOCUS_21840 531848 530079 CDS product NADPH-dependent assimilatory sulfite reductase hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287342.1 protein_id gnl|my_center|LOCUS_21840 532620 531940 gene locus_tag LOCUS_21850 532620 531940 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084994.1 protein_id gnl|my_center|LOCUS_21850 532609 533256 gene locus_tag LOCUS_21860 532609 533256 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256584.1 protein_id gnl|my_center|LOCUS_21860 533354 534226 gene locus_tag LOCUS_21870 533354 534226 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228576.1 protein_id gnl|my_center|LOCUS_21870 534306 534989 gene locus_tag LOCUS_21880 534306 534989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 534986 536629 gene locus_tag LOCUS_21890 534986 536629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 536623 537591 gene locus_tag LOCUS_21900 536623 537591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 537588 538475 gene locus_tag LOCUS_21910 537588 538475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 540199 538550 gene locus_tag LOCUS_21920 540199 538550 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727251.1 protein_id gnl|my_center|LOCUS_21920 541290 540253 gene locus_tag LOCUS_21930 541290 540253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 542609 541566 gene locus_tag LOCUS_21940 542609 541566 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_21940 543292 542606 gene locus_tag LOCUS_21950 543292 542606 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977507.1 protein_id gnl|my_center|LOCUS_21950 543400 544239 gene locus_tag LOCUS_21960 543400 544239 CDS product monoacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726751.1 protein_id gnl|my_center|LOCUS_21960 545091 544315 gene locus_tag LOCUS_21970 545091 544315 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878395.1 protein_id gnl|my_center|LOCUS_21970 545799 545164 gene locus_tag LOCUS_21980 545799 545164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 546629 545826 gene locus_tag LOCUS_21990 546629 545826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 546797 548110 gene locus_tag LOCUS_22000 546797 548110 CDS product glycoside hydrolase family 27 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093950791.1 protein_id gnl|my_center|LOCUS_22000 549527 548163 gene locus_tag LOCUS_22010 549527 548163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 550055 550231 gene locus_tag LOCUS_22020 550055 550231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 551258 550275 gene locus_tag LOCUS_22030 551258 550275 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 protein_id gnl|my_center|LOCUS_22030 551661 551999 gene locus_tag LOCUS_22040 551661 551999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22040 552151 551939 gene locus_tag LOCUS_22050 552151 551939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 552179 552361 gene locus_tag LOCUS_22060 552179 552361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 552562 553071 gene locus_tag LOCUS_22070 552562 553071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 553633 553887 gene locus_tag LOCUS_22080 553633 553887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 554931 554131 gene locus_tag LOCUS_22090 554931 554131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 555487 555107 gene locus_tag LOCUS_22100 555487 555107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 555756 555475 gene locus_tag LOCUS_22110 555756 555475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 555902 556318 gene locus_tag LOCUS_22120 555902 556318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 557392 556400 gene locus_tag LOCUS_22130 557392 556400 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408279.1 protein_id gnl|my_center|LOCUS_22130 558378 557947 gene locus_tag LOCUS_22140 558378 557947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 559236 558874 gene locus_tag LOCUS_22150 559236 558874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 560390 559233 gene locus_tag LOCUS_22160 560390 559233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 560642 561109 gene locus_tag LOCUS_22170 560642 561109 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112855.1 protein_id gnl|my_center|LOCUS_22170 561345 561133 gene locus_tag LOCUS_22180 561345 561133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 562225 561671 gene locus_tag LOCUS_22190 562225 561671 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036809.1 protein_id gnl|my_center|LOCUS_22190 562904 562623 gene locus_tag LOCUS_22200 562904 562623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 563176 562901 gene locus_tag LOCUS_22210 563176 562901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 563432 563890 gene locus_tag LOCUS_22220 563432 563890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 565975 564203 gene locus_tag LOCUS_22230 565975 564203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 566796 566188 gene locus_tag LOCUS_22240 566796 566188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 >Feature sequence03 1609 1902 gene locus_tag LOCUS_22250 1609 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 3015 1939 gene locus_tag LOCUS_22260 3015 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 3130 3483 gene locus_tag LOCUS_22270 3130 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 4158 4676 gene locus_tag LOCUS_22280 4158 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 4714 5040 gene locus_tag LOCUS_22290 4714 5040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 5228 6286 gene locus_tag LOCUS_22300 5228 6286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22300 6234 6800 gene locus_tag LOCUS_22310 6234 6800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22310 6752 6958 gene locus_tag LOCUS_22320 6752 6958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 7218 6955 gene locus_tag LOCUS_22330 7218 6955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 7241 10078 gene locus_tag LOCUS_22340 7241 10078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22340 10075 10575 gene locus_tag LOCUS_22350 10075 10575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 10997 11500 gene locus_tag LOCUS_22360 10997 11500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 12261 13742 gene locus_tag LOCUS_22370 12261 13742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 15112 14858 gene locus_tag LOCUS_22380 15112 14858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 16011 15202 gene locus_tag LOCUS_22390 gene istB 16011 15202 CDS product IS21-like element ISMt2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418125.1 protein_id gnl|my_center|LOCUS_22390 17363 16008 gene locus_tag LOCUS_22400 gene istA 17363 16008 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917171.1 protein_id gnl|my_center|LOCUS_22400 18324 17446 gene locus_tag LOCUS_22410 18324 17446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22410 18611 18321 gene locus_tag LOCUS_22420 18611 18321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22420 18693 19109 gene locus_tag LOCUS_22430 18693 19109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 19278 19937 gene locus_tag LOCUS_22440 19278 19937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 20399 20761 gene locus_tag LOCUS_22450 20399 20761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 21455 22249 gene locus_tag LOCUS_22460 21455 22249 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104632.1 protein_id gnl|my_center|LOCUS_22460 22279 22722 gene locus_tag LOCUS_22470 22279 22722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229066.1 protein_id gnl|my_center|LOCUS_22470 23565 23191 gene locus_tag LOCUS_22480 23565 23191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 25663 23675 gene locus_tag LOCUS_22490 25663 23675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 25680 25892 gene locus_tag LOCUS_22500 25680 25892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 26578 32583 gene locus_tag LOCUS_22510 26578 32583 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937974.1 protein_id gnl|my_center|LOCUS_22510 32583 34748 gene locus_tag LOCUS_22520 32583 34748 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218177.1 protein_id gnl|my_center|LOCUS_22520 35107 34832 gene locus_tag LOCUS_22530 35107 34832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 35832 36161 gene locus_tag LOCUS_22540 35832 36161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 36230 36505 gene locus_tag LOCUS_22550 36230 36505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 36493 36738 gene locus_tag LOCUS_22560 36493 36738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 36729 37142 gene locus_tag LOCUS_22570 36729 37142 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391796.1 protein_id gnl|my_center|LOCUS_22570 37286 37552 gene locus_tag LOCUS_22580 37286 37552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 37549 37815 gene locus_tag LOCUS_22590 37549 37815 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007281268.1 protein_id gnl|my_center|LOCUS_22590 38346 38182 gene locus_tag LOCUS_22600 38346 38182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 38739 38506 gene locus_tag LOCUS_22610 38739 38506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 38993 38736 gene locus_tag LOCUS_22620 38993 38736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 39208 39420 gene locus_tag LOCUS_22630 39208 39420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 39417 39827 gene locus_tag LOCUS_22640 gene vapc11 39417 39827 CDS product type II toxin-antitoxin system toxin ribonuclease VapC11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407786.1 protein_id gnl|my_center|LOCUS_22640 39891 43322 gene locus_tag LOCUS_22650 39891 43322 CDS product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153439724.1 protein_id gnl|my_center|LOCUS_22650 43449 43261 gene locus_tag LOCUS_22660 43449 43261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 43610 43876 gene locus_tag LOCUS_22670 43610 43876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 44009 44284 gene locus_tag LOCUS_22680 44009 44284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 46103 44325 gene locus_tag LOCUS_22690 gene accC 46103 44325 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257262.1 protein_id gnl|my_center|LOCUS_22690 46214 47020 gene locus_tag LOCUS_22700 46214 47020 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660454.1 protein_id gnl|my_center|LOCUS_22700 47944 47072 gene locus_tag LOCUS_22710 47944 47072 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902239.1 protein_id gnl|my_center|LOCUS_22710 49156 47981 gene locus_tag LOCUS_22720 49156 47981 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027841.1 protein_id gnl|my_center|LOCUS_22720 49313 50902 gene locus_tag LOCUS_22730 49313 50902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 50969 52216 gene locus_tag LOCUS_22740 50969 52216 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831529.1 protein_id gnl|my_center|LOCUS_22740 52249 53187 gene locus_tag LOCUS_22750 52249 53187 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_22750 54152 53217 gene locus_tag LOCUS_22760 54152 53217 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143781.1 protein_id gnl|my_center|LOCUS_22760 54219 55346 gene locus_tag LOCUS_22770 54219 55346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 55373 56548 gene locus_tag LOCUS_22780 55373 56548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 56580 57860 gene locus_tag LOCUS_22790 56580 57860 CDS product WcaI family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051330685.1 protein_id gnl|my_center|LOCUS_22790 57949 58851 gene locus_tag LOCUS_22800 57949 58851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 58866 59882 gene locus_tag LOCUS_22810 58866 59882 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222926.1 protein_id gnl|my_center|LOCUS_22810 60927 59896 gene locus_tag LOCUS_22820 60927 59896 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_22820 60926 62371 gene locus_tag LOCUS_22830 60926 62371 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731135.1 protein_id gnl|my_center|LOCUS_22830 63105 62380 gene locus_tag LOCUS_22840 63105 62380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 63989 63102 gene locus_tag LOCUS_22850 gene cofD 63989 63102 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_22850 65043 64063 gene locus_tag LOCUS_22860 gene gmd 65043 64063 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_22860 65140 65619 gene locus_tag LOCUS_22870 65140 65619 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257006.1 protein_id gnl|my_center|LOCUS_22870 66603 65695 gene locus_tag LOCUS_22880 66603 65695 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_22880 68386 66713 gene locus_tag LOCUS_22890 68386 66713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 68494 72582 gene locus_tag LOCUS_22900 68494 72582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 72579 74198 gene locus_tag LOCUS_22910 72579 74198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 74201 74620 gene locus_tag LOCUS_22920 74201 74620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 76531 74642 gene locus_tag LOCUS_22930 gene ftsH 76531 74642 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707080.1 protein_id gnl|my_center|LOCUS_22930 76934 77131 gene locus_tag LOCUS_22940 76934 77131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 77139 77948 gene locus_tag LOCUS_22950 77139 77948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 78001 80931 gene locus_tag LOCUS_22960 78001 80931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 81006 82385 gene locus_tag LOCUS_22970 81006 82385 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229751.1 protein_id gnl|my_center|LOCUS_22970 82492 82752 gene locus_tag LOCUS_22980 82492 82752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 82749 83804 gene locus_tag LOCUS_22990 82749 83804 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_22990 83882 85330 gene locus_tag LOCUS_23000 gene ahcY 83882 85330 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975788.1 protein_id gnl|my_center|LOCUS_23000 85477 86406 gene locus_tag LOCUS_23010 85477 86406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 87629 86403 gene locus_tag LOCUS_23020 87629 86403 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_23020 89244 87730 gene locus_tag LOCUS_23030 89244 87730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 89348 90667 gene locus_tag LOCUS_23040 gene obgE 89348 90667 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460894.1 protein_id gnl|my_center|LOCUS_23040 90708 91811 gene locus_tag LOCUS_23050 gene proB 90708 91811 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368077.1 protein_id gnl|my_center|LOCUS_23050 92686 91832 gene locus_tag LOCUS_23060 gene pspA 92686 91832 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057162.1 protein_id gnl|my_center|LOCUS_23060 94826 92697 gene locus_tag LOCUS_23070 gene murJ 94826 92697 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224759.1 protein_id gnl|my_center|LOCUS_23070 95680 94823 gene locus_tag LOCUS_23080 95680 94823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 97566 95728 gene locus_tag LOCUS_23090 97566 95728 CDS product substrate-binding and VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222107.1 protein_id gnl|my_center|LOCUS_23090 98587 97607 gene locus_tag LOCUS_23100 98587 97607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 99023 98655 gene locus_tag LOCUS_23110 99023 98655 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_23110 100822 99305 gene locus_tag LOCUS_23120 100822 99305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 101164 100826 gene locus_tag LOCUS_23130 101164 100826 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409778.1 protein_id gnl|my_center|LOCUS_23130 101397 101161 gene locus_tag LOCUS_23140 101397 101161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 102085 101507 gene locus_tag LOCUS_23150 102085 101507 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031617.1 protein_id gnl|my_center|LOCUS_23150 102154 103107 gene locus_tag LOCUS_23160 102154 103107 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224865.1 protein_id gnl|my_center|LOCUS_23160 103111 104607 gene locus_tag LOCUS_23170 103111 104607 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412513.1 protein_id gnl|my_center|LOCUS_23170 104604 105446 gene locus_tag LOCUS_23180 104604 105446 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964960.1 protein_id gnl|my_center|LOCUS_23180 105443 106600 gene locus_tag LOCUS_23190 105443 106600 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256755.1 protein_id gnl|my_center|LOCUS_23190 106597 107757 gene locus_tag LOCUS_23200 106597 107757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 107754 109034 gene locus_tag LOCUS_23210 107754 109034 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401260.1 protein_id gnl|my_center|LOCUS_23210 109097 109909 gene locus_tag LOCUS_23220 109097 109909 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229293.1 protein_id gnl|my_center|LOCUS_23220 109909 110892 gene locus_tag LOCUS_23230 109909 110892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 110889 111875 gene locus_tag LOCUS_23240 110889 111875 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122762.1 protein_id gnl|my_center|LOCUS_23240 113614 111845 gene locus_tag LOCUS_23250 113614 111845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 117576 113638 gene locus_tag LOCUS_23260 117576 113638 CDS product alpha-(1->3)-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908966.1 protein_id gnl|my_center|LOCUS_23260 118268 117576 gene locus_tag LOCUS_23270 118268 117576 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229286.1 protein_id gnl|my_center|LOCUS_23270 118372 120291 gene locus_tag LOCUS_23280 118372 120291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 120312 121187 gene locus_tag LOCUS_23290 120312 121187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 121228 122973 gene locus_tag LOCUS_23300 121228 122973 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140648.1 protein_id gnl|my_center|LOCUS_23300 123091 124050 gene locus_tag LOCUS_23310 123091 124050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 125385 124072 gene locus_tag LOCUS_23320 125385 124072 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976701.1 protein_id gnl|my_center|LOCUS_23320 126410 125535 gene locus_tag LOCUS_23330 126410 125535 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975615.1 protein_id gnl|my_center|LOCUS_23330 126479 127057 gene locus_tag LOCUS_23340 gene nadD 126479 127057 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 protein_id gnl|my_center|LOCUS_23340 127047 128549 gene locus_tag LOCUS_23350 127047 128549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 128546 128926 gene locus_tag LOCUS_23360 128546 128926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 129004 128931 gene locus_tag LOCUS_t00380 129004 128931 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 129109 130785 gene locus_tag LOCUS_23370 129109 130785 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085019.1 protein_id gnl|my_center|LOCUS_23370 130787 132901 gene locus_tag LOCUS_23380 130787 132901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 132898 135900 gene locus_tag LOCUS_23390 132898 135900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 135969 137672 gene locus_tag LOCUS_23400 135969 137672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 138296 141937 gene locus_tag LOCUS_23410 138296 141937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 142006 142755 gene locus_tag LOCUS_23420 142006 142755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 142752 144611 gene locus_tag LOCUS_23430 142752 144611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 144608 147304 gene locus_tag LOCUS_23440 144608 147304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 147344 148708 gene locus_tag LOCUS_23450 147344 148708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 148879 148598 gene locus_tag LOCUS_23460 148879 148598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 149881 149006 gene locus_tag LOCUS_23470 149881 149006 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728558.1 protein_id gnl|my_center|LOCUS_23470 150936 149890 gene locus_tag LOCUS_23480 150936 149890 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027920.1 protein_id gnl|my_center|LOCUS_23480 151010 151759 gene locus_tag LOCUS_23490 151010 151759 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256114.1 protein_id gnl|my_center|LOCUS_23490 151961 152596 gene locus_tag LOCUS_23500 151961 152596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 152704 153585 gene locus_tag LOCUS_23510 152704 153585 CDS product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775772.1 protein_id gnl|my_center|LOCUS_23510 153582 155294 gene locus_tag LOCUS_23520 153582 155294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 155305 155589 gene locus_tag LOCUS_23530 155305 155589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 155586 156581 gene locus_tag LOCUS_23540 gene holA 155586 156581 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887887.1 protein_id gnl|my_center|LOCUS_23540 157521 156532 gene locus_tag LOCUS_23550 157521 156532 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921208.1 protein_id gnl|my_center|LOCUS_23550 158735 157518 gene locus_tag LOCUS_23560 158735 157518 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093999.1 protein_id gnl|my_center|LOCUS_23560 160161 158743 gene locus_tag LOCUS_23570 160161 158743 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899345.1 protein_id gnl|my_center|LOCUS_23570 161769 160171 gene locus_tag LOCUS_23580 161769 160171 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228760.1 protein_id gnl|my_center|LOCUS_23580 161999 162847 gene locus_tag LOCUS_23590 gene htdY 161999 162847 CDS product 3-hydroxyacyl-thioester dehydratase HtdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417929.1 protein_id gnl|my_center|LOCUS_23590 164181 162844 gene locus_tag LOCUS_23600 164181 162844 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085735.1 protein_id gnl|my_center|LOCUS_23600 164480 164202 gene locus_tag LOCUS_23610 164480 164202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 165388 164738 gene locus_tag LOCUS_23620 gene nucS 165388 164738 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007387684.1 protein_id gnl|my_center|LOCUS_23620 167335 165449 gene locus_tag LOCUS_23630 gene typA 167335 165449 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_23630 167983 168768 gene locus_tag LOCUS_23640 167983 168768 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776687.1 protein_id gnl|my_center|LOCUS_23640 170684 169038 gene locus_tag LOCUS_23650 170684 169038 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729039.1 protein_id gnl|my_center|LOCUS_23650 171119 170802 gene locus_tag LOCUS_23660 171119 170802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 171113 172001 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gccgcaatggagccccggcctgatggccgggg 173839 172655 gene locus_tag LOCUS_23670 173839 172655 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225726.1 protein_id gnl|my_center|LOCUS_23670 174132 175385 gene locus_tag LOCUS_23680 174132 175385 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222356.1 protein_id gnl|my_center|LOCUS_23680 176637 175447 gene locus_tag LOCUS_23690 176637 175447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23690 177201 177542 gene locus_tag LOCUS_23700 177201 177542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23700 177425 177907 gene locus_tag LOCUS_23710 177425 177907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23710 177986 178264 gene locus_tag LOCUS_23720 177986 178264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23720 178261 179502 gene locus_tag LOCUS_23730 178261 179502 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026894.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23730 179600 181651 gene locus_tag LOCUS_23740 179600 181651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 182031 181537 gene locus_tag LOCUS_23750 182031 181537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23750 182150 184342 gene locus_tag LOCUS_23760 182150 184342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 186774 184339 gene locus_tag LOCUS_23770 gene ppsA 186774 184339 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838605.1 protein_id gnl|my_center|LOCUS_23770 188162 186918 gene locus_tag LOCUS_23780 188162 186918 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817124.1 protein_id gnl|my_center|LOCUS_23780 188488 188330 gene locus_tag LOCUS_23790 188488 188330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 188954 188571 gene locus_tag LOCUS_23800 188954 188571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 189193 188951 gene locus_tag LOCUS_23810 189193 188951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23810 190038 189814 gene locus_tag LOCUS_23820 190038 189814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 191021 190227 gene locus_tag LOCUS_23830 191021 190227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 191932 191018 gene locus_tag LOCUS_23840 191932 191018 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228542.1 protein_id gnl|my_center|LOCUS_23840 192126 192998 gene locus_tag LOCUS_23850 192126 192998 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053195.1 protein_id gnl|my_center|LOCUS_23850 193473 193048 gene locus_tag LOCUS_23860 gene trxA 193473 193048 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228708.1 protein_id gnl|my_center|LOCUS_23860 195203 193497 gene locus_tag LOCUS_23870 gene ettA 195203 193497 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258061.1 protein_id gnl|my_center|LOCUS_23870 196837 195392 gene locus_tag LOCUS_23880 196837 195392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 196940 197590 gene locus_tag LOCUS_23890 196940 197590 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172637.1 protein_id gnl|my_center|LOCUS_23890 199091 197529 gene locus_tag LOCUS_23900 199091 197529 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030563.1 protein_id gnl|my_center|LOCUS_23900 202758 199138 gene locus_tag LOCUS_23910 202758 199138 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775966.1 protein_id gnl|my_center|LOCUS_23910 202982 203791 gene locus_tag LOCUS_23920 202982 203791 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224644.1 protein_id gnl|my_center|LOCUS_23920 203784 204572 gene locus_tag LOCUS_23930 203784 204572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 206768 204573 gene locus_tag LOCUS_23940 206768 204573 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462428.1 protein_id gnl|my_center|LOCUS_23940 206843 207490 gene locus_tag LOCUS_23950 206843 207490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 207892 207521 gene locus_tag LOCUS_23960 207892 207521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 208762 207914 gene locus_tag LOCUS_23970 208762 207914 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228409.1 protein_id gnl|my_center|LOCUS_23970 209856 208828 gene locus_tag LOCUS_23980 gene galK 209856 208828 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816804.1 protein_id gnl|my_center|LOCUS_23980 210033 211421 gene locus_tag LOCUS_23990 210033 211421 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539284.1 protein_id gnl|my_center|LOCUS_23990 211418 212962 gene locus_tag LOCUS_24000 211418 212962 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205720.1 protein_id gnl|my_center|LOCUS_24000 215940 213004 gene locus_tag LOCUS_24010 215940 213004 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079291.1 protein_id gnl|my_center|LOCUS_24010 217402 215993 gene locus_tag LOCUS_24020 217402 215993 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229720.1 protein_id gnl|my_center|LOCUS_24020 217992 217399 gene locus_tag LOCUS_24030 217992 217399 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140085.1 protein_id gnl|my_center|LOCUS_24030 217961 218143 gene locus_tag LOCUS_24040 217961 218143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 218149 218631 gene locus_tag LOCUS_24050 218149 218631 CDS product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479612.1 protein_id gnl|my_center|LOCUS_24050 218639 219883 gene locus_tag LOCUS_24060 218639 219883 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973241.1 protein_id gnl|my_center|LOCUS_24060 220007 221155 gene locus_tag LOCUS_24070 220007 221155 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_24070 221264 222085 gene locus_tag LOCUS_24080 221264 222085 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228778.1 protein_id gnl|my_center|LOCUS_24080 222082 222441 gene locus_tag LOCUS_24090 222082 222441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 223906 222506 gene locus_tag LOCUS_24100 223906 222506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 224068 225120 gene locus_tag LOCUS_24110 224068 225120 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057667.1 protein_id gnl|my_center|LOCUS_24110 225602 225147 gene locus_tag LOCUS_24120 225602 225147 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227629.1 protein_id gnl|my_center|LOCUS_24120 226469 225750 gene locus_tag LOCUS_24130 226469 225750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 228445 226640 gene locus_tag LOCUS_24140 228445 226640 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_24140 228807 228445 gene locus_tag LOCUS_24150 228807 228445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 229112 228894 gene locus_tag LOCUS_24160 gene rpmB 229112 228894 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775872.1 protein_id gnl|my_center|LOCUS_24160 229257 231434 gene locus_tag LOCUS_24170 gene recG 229257 231434 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223647.1 protein_id gnl|my_center|LOCUS_24170 232062 236381 gene locus_tag LOCUS_24180 232062 236381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 237769 236495 gene locus_tag LOCUS_24190 237769 236495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 241104 238450 gene locus_tag LOCUS_24200 241104 238450 CDS product chromosome condensation regulator RCC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258200.1 protein_id gnl|my_center|LOCUS_24200 241864 241481 gene locus_tag LOCUS_24210 241864 241481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 242300 242016 gene locus_tag LOCUS_24220 242300 242016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 242488 242297 gene locus_tag LOCUS_24230 242488 242297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 243701 242607 gene locus_tag LOCUS_24240 243701 242607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 244111 243698 gene locus_tag LOCUS_24250 244111 243698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 244248 245225 gene locus_tag LOCUS_24260 244248 245225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 245222 245746 gene locus_tag LOCUS_24270 gene rsmD 245222 245746 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466716.1 protein_id gnl|my_center|LOCUS_24270 245839 246339 gene locus_tag LOCUS_24280 gene coaD 245839 246339 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173005.1 protein_id gnl|my_center|LOCUS_24280 246336 247061 gene locus_tag LOCUS_24290 246336 247061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 247168 247632 gene locus_tag LOCUS_24300 247168 247632 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056944.1 protein_id gnl|my_center|LOCUS_24300 247750 247929 gene locus_tag LOCUS_24310 247750 247929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 250399 248168 gene locus_tag LOCUS_24320 250399 248168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 250461 251312 gene locus_tag LOCUS_24330 250461 251312 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403433.1 protein_id gnl|my_center|LOCUS_24330 251372 251665 gene locus_tag LOCUS_24340 251372 251665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 251737 252495 gene locus_tag LOCUS_24350 gene rnc 251737 252495 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973423.1 protein_id gnl|my_center|LOCUS_24350 252598 253464 gene locus_tag LOCUS_24360 252598 253464 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173830.1 protein_id gnl|my_center|LOCUS_24360 253471 256944 gene locus_tag LOCUS_24370 gene smc 253471 256944 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014857.1 protein_id gnl|my_center|LOCUS_24370 258036 257110 gene locus_tag LOCUS_24380 258036 257110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 258231 258836 gene locus_tag LOCUS_24390 258231 258836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 259756 258833 gene locus_tag LOCUS_24400 259756 258833 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222165.1 protein_id gnl|my_center|LOCUS_24400 259805 260929 gene locus_tag LOCUS_24410 259805 260929 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405124.1 protein_id gnl|my_center|LOCUS_24410 261052 262950 gene locus_tag LOCUS_24420 261052 262950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 264061 263087 gene locus_tag LOCUS_24430 264061 263087 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226779.1 protein_id gnl|my_center|LOCUS_24430 265148 264150 gene locus_tag LOCUS_24440 265148 264150 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226780.1 protein_id gnl|my_center|LOCUS_24440 266289 265153 gene locus_tag LOCUS_24450 266289 265153 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407527.1 protein_id gnl|my_center|LOCUS_24450 266508 267638 gene locus_tag LOCUS_24460 gene ftsY 266508 267638 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164278219.1 protein_id gnl|my_center|LOCUS_24460 267645 268442 gene locus_tag LOCUS_24470 267645 268442 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222561.1 protein_id gnl|my_center|LOCUS_24470 268492 269994 gene locus_tag LOCUS_24480 gene ffh 268492 269994 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069602.1 protein_id gnl|my_center|LOCUS_24480 270130 270486 gene locus_tag LOCUS_24490 270130 270486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 270483 270731 gene locus_tag LOCUS_24500 270483 270731 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804620.1 protein_id gnl|my_center|LOCUS_24500 270770 271231 gene locus_tag LOCUS_24510 270770 271231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 271206 272009 gene locus_tag LOCUS_24520 gene trmD 271206 272009 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686892.1 protein_id gnl|my_center|LOCUS_24520 272452 273609 gene locus_tag LOCUS_24530 272452 273609 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228962.1 protein_id gnl|my_center|LOCUS_24530 273724 274107 gene locus_tag LOCUS_24540 gene rplS 273724 274107 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893806.1 protein_id gnl|my_center|LOCUS_24540 274195 274611 gene locus_tag LOCUS_24550 274195 274611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 274657 274848 gene locus_tag LOCUS_24560 274657 274848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 274995 276206 gene locus_tag LOCUS_24570 274995 276206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 276455 276228 gene locus_tag LOCUS_24580 276455 276228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 276727 276452 gene locus_tag LOCUS_24590 276727 276452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 276818 278326 gene locus_tag LOCUS_24600 276818 278326 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174141.1 protein_id gnl|my_center|LOCUS_24600 278326 279642 gene locus_tag LOCUS_24610 278326 279642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 279650 280627 gene locus_tag LOCUS_24620 279650 280627 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728395.1 protein_id gnl|my_center|LOCUS_24620 280659 281411 gene locus_tag LOCUS_24630 gene whiG 280659 281411 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973389.1 protein_id gnl|my_center|LOCUS_24630 281416 281931 gene locus_tag LOCUS_24640 281416 281931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 282109 283068 gene locus_tag LOCUS_24650 gene rpsB 282109 283068 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076880.1 protein_id gnl|my_center|LOCUS_24650 283065 283862 gene locus_tag LOCUS_24660 gene tsf 283065 283862 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888151.1 protein_id gnl|my_center|LOCUS_24660 283874 284596 gene locus_tag LOCUS_24670 gene pyrH 283874 284596 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_24670 284650 285219 gene locus_tag LOCUS_24680 gene frr 284650 285219 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973383.1 protein_id gnl|my_center|LOCUS_24680 285219 286784 gene locus_tag LOCUS_24690 285219 286784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 286801 287952 gene locus_tag LOCUS_24700 286801 287952 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036559.1 protein_id gnl|my_center|LOCUS_24700 287969 289660 gene locus_tag LOCUS_24710 287969 289660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 289790 290938 gene locus_tag LOCUS_24720 gene ispG 289790 290938 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096456766.1 protein_id gnl|my_center|LOCUS_24720 290946 291755 gene locus_tag LOCUS_24730 290946 291755 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031575.1 protein_id gnl|my_center|LOCUS_24730 292137 291718 gene locus_tag LOCUS_24740 292137 291718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 293665 292442 gene locus_tag LOCUS_24750 293665 292442 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113524.1 protein_id gnl|my_center|LOCUS_24750 293758 295176 gene locus_tag LOCUS_24760 gene proS 293758 295176 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227720.1 protein_id gnl|my_center|LOCUS_24760 295295 297751 gene locus_tag LOCUS_24770 gene fxsT 295295 297751 CDS product FxSxx-COOH system tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190714.1 protein_id gnl|my_center|LOCUS_24770 298354 297830 gene locus_tag LOCUS_24780 298354 297830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 298720 299889 gene locus_tag LOCUS_24790 298720 299889 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030291.1 protein_id gnl|my_center|LOCUS_24790 300000 300617 gene locus_tag LOCUS_24800 300000 300617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 300614 301909 gene locus_tag LOCUS_24810 300614 301909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 302208 305336 gene locus_tag LOCUS_24820 302208 305336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 305341 305655 gene locus_tag LOCUS_24830 305341 305655 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257138.1 protein_id gnl|my_center|LOCUS_24830 305689 306093 gene locus_tag LOCUS_24840 gene rbfA 305689 306093 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776442.1 protein_id gnl|my_center|LOCUS_24840 306090 307067 gene locus_tag LOCUS_24850 306090 307067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 309973 307316 gene locus_tag LOCUS_24860 309973 307316 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 protein_id gnl|my_center|LOCUS_24860 310172 311200 gene locus_tag LOCUS_24870 310172 311200 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973315.1 protein_id gnl|my_center|LOCUS_24870 311190 312323 gene locus_tag LOCUS_24880 311190 312323 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728953.1 protein_id gnl|my_center|LOCUS_24880 312455 312736 gene locus_tag LOCUS_24890 gene rpsO 312455 312736 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808855.1 protein_id gnl|my_center|LOCUS_24890 313018 312743 gene locus_tag LOCUS_24900 313018 312743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 313338 315926 gene locus_tag LOCUS_24910 313338 315926 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414124.1 protein_id gnl|my_center|LOCUS_24910 315886 316659 gene locus_tag LOCUS_24920 315886 316659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 316649 318130 gene locus_tag LOCUS_24930 316649 318130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 318127 319317 gene locus_tag LOCUS_24940 gene serB 318127 319317 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977014.1 protein_id gnl|my_center|LOCUS_24940 319368 319970 gene locus_tag LOCUS_24950 319368 319970 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957729.1 protein_id gnl|my_center|LOCUS_24950 319960 320946 gene locus_tag LOCUS_24960 319960 320946 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065995.1 protein_id gnl|my_center|LOCUS_24960 322579 320996 gene locus_tag LOCUS_24970 322579 320996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 322692 323540 gene locus_tag LOCUS_24980 322692 323540 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957730.1 protein_id gnl|my_center|LOCUS_24980 323596 324435 gene locus_tag LOCUS_24990 323596 324435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 324447 325286 gene locus_tag LOCUS_25000 324447 325286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 326584 325337 gene locus_tag LOCUS_25010 326584 325337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 327404 326607 gene locus_tag LOCUS_25020 327404 326607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 328407 327427 gene locus_tag LOCUS_25030 328407 327427 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_25030 328493 329245 gene locus_tag LOCUS_25040 gene dapB 328493 329245 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081787.1 protein_id gnl|my_center|LOCUS_25040 329896 329273 gene locus_tag LOCUS_25050 329896 329273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 330603 330070 gene locus_tag LOCUS_25060 330603 330070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 330493 330750 gene locus_tag LOCUS_25070 330493 330750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 330832 331917 gene locus_tag LOCUS_25080 330832 331917 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228400.1 protein_id gnl|my_center|LOCUS_25080 331901 332506 gene locus_tag LOCUS_25090 gene ybeY 331901 332506 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015012.1 protein_id gnl|my_center|LOCUS_25090 332512 333849 gene locus_tag LOCUS_25100 332512 333849 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228398.1 protein_id gnl|my_center|LOCUS_25100 333824 334732 gene locus_tag LOCUS_25110 gene era 333824 334732 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895864.1 protein_id gnl|my_center|LOCUS_25110 334870 335328 gene locus_tag LOCUS_25120 334870 335328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 337634 335592 gene locus_tag LOCUS_25130 337634 335592 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229470.1 protein_id gnl|my_center|LOCUS_25130 338077 337700 gene locus_tag LOCUS_25140 338077 337700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 338355 338074 gene locus_tag LOCUS_25150 338355 338074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 338723 338445 gene locus_tag LOCUS_25160 338723 338445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 339042 339755 gene locus_tag LOCUS_25170 gene recO 339042 339755 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228390.1 protein_id gnl|my_center|LOCUS_25170 340694 339813 gene locus_tag LOCUS_25180 340694 339813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 341138 340782 gene locus_tag LOCUS_25190 341138 340782 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937339.1 protein_id gnl|my_center|LOCUS_25190 341248 342612 gene locus_tag LOCUS_25200 341248 342612 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067967.1 protein_id gnl|my_center|LOCUS_25200 342673 344634 gene locus_tag LOCUS_25210 342673 344634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 344609 345913 gene locus_tag LOCUS_25220 344609 345913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 345977 346050 gene locus_tag LOCUS_t00390 345977 346050 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 347004 346168 gene locus_tag LOCUS_25230 347004 346168 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028282.1 protein_id gnl|my_center|LOCUS_25230 348617 347001 gene locus_tag LOCUS_25240 348617 347001 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230735.1 protein_id gnl|my_center|LOCUS_25240 349774 348614 gene locus_tag LOCUS_25250 349774 348614 CDS product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028280.1 protein_id gnl|my_center|LOCUS_25250 351026 349791 gene locus_tag LOCUS_25260 351026 349791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 351489 351563 gene locus_tag LOCUS_t00400 351489 351563 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 351683 351946 gene locus_tag LOCUS_25270 351683 351946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 352739 351972 gene locus_tag LOCUS_25280 gene aqpZ 352739 351972 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207869.1 protein_id gnl|my_center|LOCUS_25280 353575 352835 gene locus_tag LOCUS_25290 353575 352835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 354216 353581 gene locus_tag LOCUS_25300 354216 353581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 354338 355120 gene locus_tag LOCUS_25310 354338 355120 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230072.1 protein_id gnl|my_center|LOCUS_25310 355130 355669 gene locus_tag LOCUS_25320 355130 355669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 355694 355768 gene locus_tag LOCUS_t00410 355694 355768 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 356499 355882 gene locus_tag LOCUS_25330 356499 355882 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118644.1 protein_id gnl|my_center|LOCUS_25330 356598 357692 gene locus_tag LOCUS_25340 356598 357692 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899401.1 protein_id gnl|my_center|LOCUS_25340 358459 357731 gene locus_tag LOCUS_25350 358459 357731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 362003 358701 gene locus_tag LOCUS_25360 gene ileS 362003 358701 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111258.1 protein_id gnl|my_center|LOCUS_25360 362204 364627 gene locus_tag LOCUS_25370 362204 364627 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030123.1 protein_id gnl|my_center|LOCUS_25370 364700 365836 gene locus_tag LOCUS_25380 364700 365836 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030122.1 protein_id gnl|my_center|LOCUS_25380 365927 367858 gene locus_tag LOCUS_25390 365927 367858 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797673.1 protein_id gnl|my_center|LOCUS_25390 367859 368617 gene locus_tag LOCUS_25400 367859 368617 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411501.1 protein_id gnl|my_center|LOCUS_25400 368640 369140 gene locus_tag LOCUS_25410 368640 369140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 370599 369160 gene locus_tag LOCUS_25420 gene glpK 370599 369160 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943390.1 protein_id gnl|my_center|LOCUS_25420 371060 370596 gene locus_tag LOCUS_25430 371060 370596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 372619 371057 gene locus_tag LOCUS_25440 372619 371057 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878369.1 protein_id gnl|my_center|LOCUS_25440 374402 372693 gene locus_tag LOCUS_25450 gene glpD 374402 372693 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226258.1 protein_id gnl|my_center|LOCUS_25450 374524 376458 gene locus_tag LOCUS_25460 374524 376458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 376483 377244 gene locus_tag LOCUS_25470 gene udp 376483 377244 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004181652.1 protein_id gnl|my_center|LOCUS_25470 377407 378393 gene locus_tag LOCUS_25480 377407 378393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 378688 378506 gene locus_tag LOCUS_25490 378688 378506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 380650 378953 gene locus_tag LOCUS_25500 380650 378953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 380807 382399 gene locus_tag LOCUS_25510 380807 382399 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203961.1 protein_id gnl|my_center|LOCUS_25510 382500 383294 gene locus_tag LOCUS_25520 382500 383294 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933138.1 protein_id gnl|my_center|LOCUS_25520 384875 384072 gene locus_tag LOCUS_25530 gene fabG 384875 384072 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807992.1 protein_id gnl|my_center|LOCUS_25530 386377 384905 gene locus_tag LOCUS_25540 386377 384905 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403919.1 protein_id gnl|my_center|LOCUS_25540 387203 386430 gene locus_tag LOCUS_25550 387203 386430 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897259.1 protein_id gnl|my_center|LOCUS_25550 387288 387893 gene locus_tag LOCUS_25560 387288 387893 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897891.1 protein_id gnl|my_center|LOCUS_25560 387910 389127 gene locus_tag LOCUS_25570 387910 389127 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730851.1 protein_id gnl|my_center|LOCUS_25570 389182 389973 gene locus_tag LOCUS_25580 389182 389973 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898578.1 protein_id gnl|my_center|LOCUS_25580 389984 391681 gene locus_tag LOCUS_25590 389984 391681 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897264.1 protein_id gnl|my_center|LOCUS_25590 391678 392241 gene locus_tag LOCUS_25600 391678 392241 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403887.1 protein_id gnl|my_center|LOCUS_25600 392223 393134 gene locus_tag LOCUS_25610 392223 393134 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403924.1 protein_id gnl|my_center|LOCUS_25610 393131 393505 gene locus_tag LOCUS_25620 393131 393505 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084283.1 protein_id gnl|my_center|LOCUS_25620 393556 394746 gene locus_tag LOCUS_25630 393556 394746 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_25630 394758 396098 gene locus_tag LOCUS_25640 394758 396098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730849.1 protein_id gnl|my_center|LOCUS_25640 397180 396116 gene locus_tag LOCUS_25650 397180 396116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 397348 398034 gene locus_tag LOCUS_25660 397348 398034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 398390 398073 gene locus_tag LOCUS_25670 398390 398073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 398604 399038 gene locus_tag LOCUS_25680 398604 399038 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973766.1 protein_id gnl|my_center|LOCUS_25680 399049 399468 gene locus_tag LOCUS_25690 399049 399468 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_25690 399588 400184 gene locus_tag LOCUS_25700 399588 400184 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980453.1 protein_id gnl|my_center|LOCUS_25700 400317 400568 gene locus_tag LOCUS_25710 400317 400568 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974205.1 protein_id gnl|my_center|LOCUS_25710 400887 400582 gene locus_tag LOCUS_25720 400887 400582 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090473.1 protein_id gnl|my_center|LOCUS_25720 401226 401477 gene locus_tag LOCUS_25730 401226 401477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 402815 401466 gene locus_tag LOCUS_25740 402815 401466 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028848093.1 protein_id gnl|my_center|LOCUS_25740 403768 402812 gene locus_tag LOCUS_25750 403768 402812 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805019.1 protein_id gnl|my_center|LOCUS_25750 404022 403765 gene locus_tag LOCUS_25760 404022 403765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 403952 404449 gene locus_tag LOCUS_25770 403952 404449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 404676 404894 gene locus_tag LOCUS_25780 404676 404894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 405344 406462 gene locus_tag LOCUS_25790 405344 406462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 406601 407620 gene locus_tag LOCUS_25800 406601 407620 CDS product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976508.1 protein_id gnl|my_center|LOCUS_25800 407638 408414 gene locus_tag LOCUS_25810 407638 408414 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897054.1 protein_id gnl|my_center|LOCUS_25810 408565 409218 gene locus_tag LOCUS_25820 408565 409218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25820 409215 409754 gene locus_tag LOCUS_25830 409215 409754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25830 409811 411196 gene locus_tag LOCUS_25840 409811 411196 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418277.1 protein_id gnl|my_center|LOCUS_25840 411629 411309 gene locus_tag LOCUS_25850 411629 411309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 411798 412565 gene locus_tag LOCUS_25860 411798 412565 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103129516.1 protein_id gnl|my_center|LOCUS_25860 413795 412587 gene locus_tag LOCUS_25870 413795 412587 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395366.1 protein_id gnl|my_center|LOCUS_25870 415162 413807 gene locus_tag LOCUS_25880 415162 413807 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785076.1 protein_id gnl|my_center|LOCUS_25880 416038 415214 gene locus_tag LOCUS_25890 416038 415214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 417518 416115 gene locus_tag LOCUS_25900 417518 416115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 418489 417518 gene locus_tag LOCUS_25910 418489 417518 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942148.1 protein_id gnl|my_center|LOCUS_25910 418722 419399 gene locus_tag LOCUS_25920 418722 419399 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230358.1 protein_id gnl|my_center|LOCUS_25920 419447 420751 gene locus_tag LOCUS_25930 419447 420751 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086851586.1 protein_id gnl|my_center|LOCUS_25930 421131 420748 gene locus_tag LOCUS_25940 421131 420748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 422039 421260 gene locus_tag LOCUS_25950 422039 421260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 422266 422937 gene locus_tag LOCUS_25960 422266 422937 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230358.1 protein_id gnl|my_center|LOCUS_25960 422994 424313 gene locus_tag LOCUS_25970 422994 424313 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086851586.1 protein_id gnl|my_center|LOCUS_25970 424556 424362 gene locus_tag LOCUS_25980 424556 424362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 425188 424550 gene locus_tag LOCUS_25990 425188 424550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 425350 425592 gene locus_tag LOCUS_26000 425350 425592 CDS product DUF2630 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897080.1 protein_id gnl|my_center|LOCUS_26000 426328 426714 gene locus_tag LOCUS_26010 426328 426714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 426790 427053 gene locus_tag LOCUS_26020 426790 427053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 427050 427307 gene locus_tag LOCUS_26030 427050 427307 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249916.1 protein_id gnl|my_center|LOCUS_26030 427336 428391 gene locus_tag LOCUS_26040 gene trpD 427336 428391 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028166.1 protein_id gnl|my_center|LOCUS_26040 428722 428417 gene locus_tag LOCUS_26050 428722 428417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 428710 429930 gene locus_tag LOCUS_26060 428710 429930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 430317 429970 gene locus_tag LOCUS_26070 430317 429970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 430542 432416 gene locus_tag LOCUS_26080 430542 432416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 432523 433686 gene locus_tag LOCUS_26090 gene eno 432523 433686 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727923.1 protein_id gnl|my_center|LOCUS_26090 433786 434034 gene locus_tag LOCUS_26100 433786 434034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 434031 434348 gene locus_tag LOCUS_26110 434031 434348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 435633 434419 gene locus_tag LOCUS_26120 435633 434419 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730272.1 protein_id gnl|my_center|LOCUS_26120 435678 436286 gene locus_tag LOCUS_26130 435678 436286 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229194.1 protein_id gnl|my_center|LOCUS_26130 436757 436329 gene locus_tag LOCUS_26140 436757 436329 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230839.1 protein_id gnl|my_center|LOCUS_26140 436785 437036 gene locus_tag LOCUS_26150 436785 437036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 437091 437435 gene locus_tag LOCUS_26160 437091 437435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 438069 438629 gene locus_tag LOCUS_26170 438069 438629 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975987.1 protein_id gnl|my_center|LOCUS_26170 438693 439100 gene locus_tag LOCUS_26180 438693 439100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 439173 439448 gene locus_tag LOCUS_26190 439173 439448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 440340 439951 gene locus_tag LOCUS_26200 440340 439951 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776472.1 protein_id gnl|my_center|LOCUS_26200 440585 440385 gene locus_tag LOCUS_26210 440585 440385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 442284 441043 gene locus_tag LOCUS_26220 442284 441043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 442876 443109 gene locus_tag LOCUS_26230 442876 443109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 443411 443728 gene locus_tag LOCUS_26240 443411 443728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 >Feature sequence04 890 423 gene locus_tag LOCUS_26250 890 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 3451 3116 gene locus_tag LOCUS_26260 3451 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 3923 3657 gene locus_tag LOCUS_26270 3923 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 4400 4642 gene locus_tag LOCUS_26280 4400 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 6840 7028 gene locus_tag LOCUS_26290 6840 7028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 9745 9413 gene locus_tag LOCUS_26300 9745 9413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 11858 12139 gene locus_tag LOCUS_26310 11858 12139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 12247 12639 gene locus_tag LOCUS_26320 12247 12639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 12590 12781 gene locus_tag LOCUS_26330 12590 12781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 13410 14084 gene locus_tag LOCUS_26340 13410 14084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26340 14963 15289 gene locus_tag LOCUS_26350 14963 15289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 15537 16175 gene locus_tag LOCUS_26360 15537 16175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26360 17707 18165 gene locus_tag LOCUS_26370 17707 18165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 19274 18090 gene locus_tag LOCUS_26380 19274 18090 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459778.1 protein_id gnl|my_center|LOCUS_26380 19664 20224 gene locus_tag LOCUS_26390 19664 20224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26390 20369 20725 gene locus_tag LOCUS_26400 20369 20725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26400 20902 20714 gene locus_tag LOCUS_26410 20902 20714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 21404 20967 gene locus_tag LOCUS_26420 21404 20967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 21738 21493 gene locus_tag LOCUS_26430 21738 21493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 22433 22975 gene locus_tag LOCUS_26440 22433 22975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 23045 23121 gene locus_tag LOCUS_t00420 23045 23121 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 24979 23078 gene locus_tag LOCUS_26450 24979 23078 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158841022.1 protein_id gnl|my_center|LOCUS_26450 25740 24964 gene locus_tag LOCUS_26460 25740 24964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 27186 26476 gene locus_tag LOCUS_26470 27186 26476 CDS product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021204.1 protein_id gnl|my_center|LOCUS_26470 28370 27183 gene locus_tag LOCUS_26480 28370 27183 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224004.1 protein_id gnl|my_center|LOCUS_26480 29314 28367 gene locus_tag LOCUS_26490 29314 28367 CDS product replication-relaxation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224005.1 protein_id gnl|my_center|LOCUS_26490 31707 29425 gene locus_tag LOCUS_26500 31707 29425 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224006.1 protein_id gnl|my_center|LOCUS_26500 32488 32282 gene locus_tag LOCUS_26510 32488 32282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 32739 32485 gene locus_tag LOCUS_26520 32739 32485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 33005 32739 gene locus_tag LOCUS_26530 33005 32739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 32913 33113 gene locus_tag LOCUS_26540 32913 33113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 33208 33993 gene locus_tag LOCUS_26550 33208 33993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 34397 34083 gene locus_tag LOCUS_26560 34397 34083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 34849 34691 gene locus_tag LOCUS_26570 34849 34691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 35196 34945 gene locus_tag LOCUS_26580 35196 34945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 35502 35236 gene locus_tag LOCUS_26590 35502 35236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 35443 35655 gene locus_tag LOCUS_26600 35443 35655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 36676 35642 gene locus_tag LOCUS_26610 36676 35642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 38323 37907 gene locus_tag LOCUS_26620 38323 37907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 38721 38323 gene locus_tag LOCUS_26630 38721 38323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 39044 39292 gene locus_tag LOCUS_26640 39044 39292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 39414 40130 gene locus_tag LOCUS_26650 39414 40130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 40589 40164 gene locus_tag LOCUS_26660 40589 40164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 41449 41015 gene locus_tag LOCUS_26670 41449 41015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 41868 41644 gene locus_tag LOCUS_26680 41868 41644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 42487 41975 gene locus_tag LOCUS_26690 42487 41975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 42878 42642 gene locus_tag LOCUS_26700 42878 42642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 43202 43005 gene locus_tag LOCUS_26710 43202 43005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 43249 44418 gene locus_tag LOCUS_26720 43249 44418 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804192.1 protein_id gnl|my_center|LOCUS_26720 44641 44952 gene locus_tag LOCUS_26730 44641 44952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 45417 45013 gene locus_tag LOCUS_26740 45417 45013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 45650 45414 gene locus_tag LOCUS_26750 45650 45414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 46353 45904 gene locus_tag LOCUS_26760 46353 45904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 46516 46355 gene locus_tag LOCUS_26770 46516 46355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 46731 46513 gene locus_tag LOCUS_26780 46731 46513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 47255 46788 gene locus_tag LOCUS_26790 47255 46788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 47702 47304 gene locus_tag LOCUS_26800 47702 47304 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891553.1 protein_id gnl|my_center|LOCUS_26800 48167 48024 gene locus_tag LOCUS_26810 48167 48024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 48320 49834 gene locus_tag LOCUS_26820 48320 49834 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226334.1 protein_id gnl|my_center|LOCUS_26820 49834 50688 gene locus_tag LOCUS_26830 49834 50688 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103932.1 protein_id gnl|my_center|LOCUS_26830 52369 50735 gene locus_tag LOCUS_26840 52369 50735 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030655.1 protein_id gnl|my_center|LOCUS_26840 52521 53570 gene locus_tag LOCUS_26850 52521 53570 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106518184.1 protein_id gnl|my_center|LOCUS_26850 53577 53978 gene locus_tag LOCUS_26860 53577 53978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 53975 55126 gene locus_tag LOCUS_26870 53975 55126 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227132.1 protein_id gnl|my_center|LOCUS_26870 55222 56028 gene locus_tag LOCUS_26880 55222 56028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 56232 57182 gene locus_tag LOCUS_26890 56232 57182 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487181.1 protein_id gnl|my_center|LOCUS_26890 57384 58817 gene locus_tag LOCUS_26900 57384 58817 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487169.1 protein_id gnl|my_center|LOCUS_26900 58820 59296 gene locus_tag LOCUS_26910 58820 59296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 59329 60312 gene locus_tag LOCUS_26920 59329 60312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 60309 61925 gene locus_tag LOCUS_26930 60309 61925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 61941 63011 gene locus_tag LOCUS_26940 gene hisC 61941 63011 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029330.1 protein_id gnl|my_center|LOCUS_26940 63292 63023 gene locus_tag LOCUS_26950 63292 63023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 63864 63307 gene locus_tag LOCUS_26960 63864 63307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 64383 65039 gene locus_tag LOCUS_26970 64383 65039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 65145 65342 gene locus_tag LOCUS_26980 gene rpmI 65145 65342 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977225.1 protein_id gnl|my_center|LOCUS_26980 65413 65790 gene locus_tag LOCUS_26990 gene rplT 65413 65790 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553161.1 protein_id gnl|my_center|LOCUS_26990 65910 66635 gene locus_tag LOCUS_27000 65910 66635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 66801 67829 gene locus_tag LOCUS_27010 gene pheS 66801 67829 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037597.1 protein_id gnl|my_center|LOCUS_27010 67848 70262 gene locus_tag LOCUS_27020 gene pheT 67848 70262 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398979.1 protein_id gnl|my_center|LOCUS_27020 70676 70329 gene locus_tag LOCUS_27030 70676 70329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 71110 70679 gene locus_tag LOCUS_27040 71110 70679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 72746 71124 gene locus_tag LOCUS_27050 72746 71124 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897308.1 protein_id gnl|my_center|LOCUS_27050 73910 72804 gene locus_tag LOCUS_27060 gene argC 73910 72804 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459299.1 protein_id gnl|my_center|LOCUS_27060 73986 74936 gene locus_tag LOCUS_27070 gene argB 73986 74936 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_27070 74950 76185 gene locus_tag LOCUS_27080 74950 76185 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110845.1 protein_id gnl|my_center|LOCUS_27080 76256 77248 gene locus_tag LOCUS_27090 gene argF 76256 77248 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228507.1 protein_id gnl|my_center|LOCUS_27090 77241 77789 gene locus_tag LOCUS_27100 77241 77789 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408178.1 protein_id gnl|my_center|LOCUS_27100 77786 78427 gene locus_tag LOCUS_27110 77786 78427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 79828 78434 gene locus_tag LOCUS_27120 gene argG 79828 78434 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226260.1 protein_id gnl|my_center|LOCUS_27120 79827 80918 gene locus_tag LOCUS_27130 gene rimK 79827 80918 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096254.1 protein_id gnl|my_center|LOCUS_27130 80938 81948 gene locus_tag LOCUS_27140 80938 81948 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455969.1 protein_id gnl|my_center|LOCUS_27140 82193 82795 gene locus_tag LOCUS_27150 gene bfr 82193 82795 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035731.1 protein_id gnl|my_center|LOCUS_27150 84190 82829 gene locus_tag LOCUS_27160 gene mgtE 84190 82829 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803803.1 protein_id gnl|my_center|LOCUS_27160 85576 84299 gene locus_tag LOCUS_27170 85576 84299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 86547 85576 gene locus_tag LOCUS_27180 gene rnz 86547 85576 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404890.1 protein_id gnl|my_center|LOCUS_27180 86675 88246 gene locus_tag LOCUS_27190 gene argH 86675 88246 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110848.1 protein_id gnl|my_center|LOCUS_27190 88197 88922 gene locus_tag LOCUS_27200 88197 88922 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091814.1 protein_id gnl|my_center|LOCUS_27200 89576 88971 gene locus_tag LOCUS_27210 89576 88971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 92140 89684 gene locus_tag LOCUS_27220 92140 89684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 92251 93615 gene locus_tag LOCUS_27230 gene tyrS 92251 93615 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332625.1 protein_id gnl|my_center|LOCUS_27230 94151 95669 gene locus_tag LOCUS_r00010 94151 95669 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 95910 98967 gene locus_tag LOCUS_r00020 95910 98967 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 99036 99146 gene locus_tag LOCUS_r00030 99036 99146 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 99414 99755 gene locus_tag LOCUS_27240 99414 99755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 99758 100372 gene locus_tag LOCUS_27250 99758 100372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 100431 101486 gene locus_tag LOCUS_27260 100431 101486 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921780.1 protein_id gnl|my_center|LOCUS_27260 101488 101964 gene locus_tag LOCUS_27270 101488 101964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 102042 102824 gene locus_tag LOCUS_27280 gene tlyA 102042 102824 CDS product 16S/23S rRNA (cytidine-2'-O)-methyltransferase TlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408382.1 protein_id gnl|my_center|LOCUS_27280 102817 103689 gene locus_tag LOCUS_27290 102817 103689 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_27290 103772 105388 gene locus_tag LOCUS_27300 gene recN 103772 105388 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_27300 105442 106605 gene locus_tag LOCUS_27310 gene steA 105442 106605 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804976.1 protein_id gnl|my_center|LOCUS_27310 106602 107705 gene locus_tag LOCUS_27320 106602 107705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 107702 109360 gene locus_tag LOCUS_27330 107702 109360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 109386 112241 gene locus_tag LOCUS_27340 109386 112241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 112248 114050 gene locus_tag LOCUS_27350 112248 114050 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_27350 114043 114627 gene locus_tag LOCUS_27360 114043 114627 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943966.1 protein_id gnl|my_center|LOCUS_27360 114638 115666 gene locus_tag LOCUS_27370 gene xerD 114638 115666 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068014.1 protein_id gnl|my_center|LOCUS_27370 115663 116316 gene locus_tag LOCUS_27380 115663 116316 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173961.1 protein_id gnl|my_center|LOCUS_27380 116303 116809 gene locus_tag LOCUS_27390 116303 116809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 116806 117672 gene locus_tag LOCUS_27400 116806 117672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 117669 118040 gene locus_tag LOCUS_27410 117669 118040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 119193 118171 gene locus_tag LOCUS_27420 gene trpS 119193 118171 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417440.1 protein_id gnl|my_center|LOCUS_27420 119435 120337 gene locus_tag LOCUS_27430 119435 120337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 120334 121140 gene locus_tag LOCUS_27440 120334 121140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 121137 121469 gene locus_tag LOCUS_27450 121137 121469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 121485 122267 gene locus_tag LOCUS_27460 121485 122267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 122257 122925 gene locus_tag LOCUS_27470 gene scpB 122257 122925 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027964.1 protein_id gnl|my_center|LOCUS_27470 122976 123755 gene locus_tag LOCUS_27480 122976 123755 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079325.1 protein_id gnl|my_center|LOCUS_27480 123767 124171 gene locus_tag LOCUS_27490 gene aroH 123767 124171 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977062.1 protein_id gnl|my_center|LOCUS_27490 124270 125646 gene locus_tag LOCUS_27500 124270 125646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 127586 125676 gene locus_tag LOCUS_27510 127586 125676 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727411.1 protein_id gnl|my_center|LOCUS_27510 127643 129079 gene locus_tag LOCUS_27520 gene gdhA 127643 129079 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896839.1 protein_id gnl|my_center|LOCUS_27520 129195 129007 gene locus_tag LOCUS_27530 129195 129007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 131377 129713 gene locus_tag LOCUS_27540 131377 129713 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 protein_id gnl|my_center|LOCUS_27540 132447 131374 gene locus_tag LOCUS_27550 132447 131374 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973464.1 protein_id gnl|my_center|LOCUS_27550 132630 134891 gene locus_tag LOCUS_27560 132630 134891 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086677.1 protein_id gnl|my_center|LOCUS_27560 134920 135765 gene locus_tag LOCUS_27570 134920 135765 CDS product Rv2407 family type 3 sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412350.1 protein_id gnl|my_center|LOCUS_27570 135821 136693 gene locus_tag LOCUS_27580 135821 136693 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112994.1 protein_id gnl|my_center|LOCUS_27580 136778 137143 gene locus_tag LOCUS_27590 136778 137143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 137202 138359 gene locus_tag LOCUS_27600 137202 138359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 140137 138512 gene locus_tag LOCUS_27610 140137 138512 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226873.1 protein_id gnl|my_center|LOCUS_27610 141911 140163 gene locus_tag LOCUS_27620 141911 140163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 142012 142680 gene locus_tag LOCUS_27630 142012 142680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 143074 142703 gene locus_tag LOCUS_27640 143074 142703 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027943.1 protein_id gnl|my_center|LOCUS_27640 143853 143071 gene locus_tag LOCUS_27650 143853 143071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 146241 144328 gene locus_tag LOCUS_27660 146241 144328 CDS product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110061.1 protein_id gnl|my_center|LOCUS_27660 146597 146295 gene locus_tag LOCUS_27670 146597 146295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 147205 146852 gene locus_tag LOCUS_27680 147205 146852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 147618 147202 gene locus_tag LOCUS_27690 147618 147202 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223738.1 protein_id gnl|my_center|LOCUS_27690 149935 147731 gene locus_tag LOCUS_27700 149935 147731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 150087 150731 gene locus_tag LOCUS_27710 150087 150731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 151604 150741 gene locus_tag LOCUS_27720 151604 150741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 152849 151635 gene locus_tag LOCUS_27730 152849 151635 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900033.1 protein_id gnl|my_center|LOCUS_27730 153690 152854 gene locus_tag LOCUS_27740 153690 152854 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529020.1 protein_id gnl|my_center|LOCUS_27740 155196 153700 gene locus_tag LOCUS_27750 155196 153700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 155446 156705 gene locus_tag LOCUS_27760 155446 156705 CDS product bifunctional phosphatase PAP2/diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226721.1 protein_id gnl|my_center|LOCUS_27760 156794 157414 gene locus_tag LOCUS_27770 gene pgpB 156794 157414 CDS product phosphatidylglycerophosphatase PgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399336.1 protein_id gnl|my_center|LOCUS_27770 158008 157433 gene locus_tag LOCUS_27780 158008 157433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 158181 158828 gene locus_tag LOCUS_27790 158181 158828 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528294.1 protein_id gnl|my_center|LOCUS_27790 158825 159778 gene locus_tag LOCUS_27800 158825 159778 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727248.1 protein_id gnl|my_center|LOCUS_27800 162055 159863 gene locus_tag LOCUS_27810 162055 159863 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228470.1 protein_id gnl|my_center|LOCUS_27810 163008 162100 gene locus_tag LOCUS_27820 163008 162100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 163212 165530 gene locus_tag LOCUS_27830 163212 165530 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086677.1 protein_id gnl|my_center|LOCUS_27830 165594 166193 gene locus_tag LOCUS_27840 165594 166193 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059191192.1 protein_id gnl|my_center|LOCUS_27840 166260 167321 gene locus_tag LOCUS_27850 166260 167321 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044885.1 protein_id gnl|my_center|LOCUS_27850 167683 167483 gene locus_tag LOCUS_27860 167683 167483 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566521.1 protein_id gnl|my_center|LOCUS_27860 168223 168942 gene locus_tag LOCUS_27870 168223 168942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 170833 168974 gene locus_tag LOCUS_27880 170833 168974 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110557.1 protein_id gnl|my_center|LOCUS_27880 171126 170839 gene locus_tag LOCUS_27890 171126 170839 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771921.1 protein_id gnl|my_center|LOCUS_27890 171565 172908 gene locus_tag LOCUS_27900 171565 172908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 173512 172808 gene locus_tag LOCUS_27910 173512 172808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 174636 173584 gene locus_tag LOCUS_27920 174636 173584 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_27920 175739 174633 gene locus_tag LOCUS_27930 gene rffA 175739 174633 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950550.1 protein_id gnl|my_center|LOCUS_27930 176678 175908 gene locus_tag LOCUS_27940 176678 175908 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222221.1 protein_id gnl|my_center|LOCUS_27940 177397 176705 gene locus_tag LOCUS_27950 177397 176705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 178404 177517 gene locus_tag LOCUS_27960 178404 177517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 179364 178546 gene locus_tag LOCUS_27970 179364 178546 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092652.1 protein_id gnl|my_center|LOCUS_27970 179606 180505 gene locus_tag LOCUS_27980 179606 180505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 180675 181340 gene locus_tag LOCUS_27990 180675 181340 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256835.1 protein_id gnl|my_center|LOCUS_27990 181396 182844 gene locus_tag LOCUS_28000 181396 182844 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728383.1 protein_id gnl|my_center|LOCUS_28000 182890 183693 gene locus_tag LOCUS_28010 182890 183693 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225714.1 protein_id gnl|my_center|LOCUS_28010 183737 184522 gene locus_tag LOCUS_28020 183737 184522 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038691.1 protein_id gnl|my_center|LOCUS_28020 184633 184890 gene locus_tag LOCUS_28030 184633 184890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 184869 185117 gene locus_tag LOCUS_28040 184869 185117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 185135 185437 gene locus_tag LOCUS_28050 185135 185437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 185434 186537 gene locus_tag LOCUS_28060 185434 186537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 186851 186576 gene locus_tag LOCUS_28070 186851 186576 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414602.1 protein_id gnl|my_center|LOCUS_28070 187117 186848 gene locus_tag LOCUS_28080 187117 186848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 187472 187209 gene locus_tag LOCUS_28090 187472 187209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 188013 187813 gene locus_tag LOCUS_28100 188013 187813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 189176 187914 gene locus_tag LOCUS_28110 189176 187914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 190589 189417 gene locus_tag LOCUS_28120 190589 189417 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202265.1 protein_id gnl|my_center|LOCUS_28120 190588 190767 gene locus_tag LOCUS_28130 190588 190767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 190770 191480 gene locus_tag LOCUS_28140 190770 191480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 191491 192669 gene locus_tag LOCUS_28150 191491 192669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 193121 192711 gene locus_tag LOCUS_28160 193121 192711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 193919 194368 gene locus_tag LOCUS_28170 193919 194368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28170 194386 195003 gene locus_tag LOCUS_28180 194386 195003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 194994 195212 gene locus_tag LOCUS_28190 194994 195212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 195486 195746 gene locus_tag LOCUS_28200 195486 195746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 195759 196034 gene locus_tag LOCUS_28210 195759 196034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 196802 196596 gene locus_tag LOCUS_28220 196802 196596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 197569 197129 gene locus_tag LOCUS_28230 197569 197129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 197881 197666 gene locus_tag LOCUS_28240 197881 197666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 198957 197878 gene locus_tag LOCUS_28250 198957 197878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28250 199280 198954 gene locus_tag LOCUS_28260 199280 198954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28260 199388 199552 gene locus_tag LOCUS_28270 199388 199552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 199814 200116 gene locus_tag LOCUS_28280 199814 200116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 201222 200209 gene locus_tag LOCUS_28290 201222 200209 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900518.1 protein_id gnl|my_center|LOCUS_28290 202538 201348 gene locus_tag LOCUS_28300 gene ltrA 202538 201348 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967989.1 protein_id gnl|my_center|LOCUS_28300 203610 203314 gene locus_tag LOCUS_28310 203610 203314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 204014 204367 gene locus_tag LOCUS_28320 204014 204367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 206685 205027 gene locus_tag LOCUS_28330 206685 205027 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460998.1 protein_id gnl|my_center|LOCUS_28330 206852 207052 gene locus_tag LOCUS_28340 206852 207052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 207169 208410 gene locus_tag LOCUS_28350 207169 208410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 208699 208391 gene locus_tag LOCUS_28360 208699 208391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 209157 208741 gene locus_tag LOCUS_28370 209157 208741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 209341 209724 gene locus_tag LOCUS_28380 209341 209724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 210023 209721 gene locus_tag LOCUS_28390 210023 209721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 209916 210740 gene locus_tag LOCUS_28400 209916 210740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 211179 210796 gene locus_tag LOCUS_28410 211179 210796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28410 211320 211607 gene locus_tag LOCUS_28420 211320 211607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 212385 212131 gene locus_tag LOCUS_28430 212385 212131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 213252 212473 gene locus_tag LOCUS_28440 gene istB 213252 212473 CDS product IS21-like element ISMt2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418125.1 protein_id gnl|my_center|LOCUS_28440 214160 213249 gene locus_tag LOCUS_28450 214160 213249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 214345 215553 gene locus_tag LOCUS_28460 214345 215553 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967847.1 protein_id gnl|my_center|LOCUS_28460 215550 216482 gene locus_tag LOCUS_28470 215550 216482 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764770.1 protein_id gnl|my_center|LOCUS_28470 217117 216764 gene locus_tag LOCUS_28480 217117 216764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 218185 217355 gene locus_tag LOCUS_28490 218185 217355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 223819 224295 gene locus_tag LOCUS_28500 223819 224295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28500 225069 225812 gene locus_tag LOCUS_28510 225069 225812 CDS product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414201.1 protein_id gnl|my_center|LOCUS_28510 225882 226871 gene locus_tag LOCUS_28520 225882 226871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 227086 227775 gene locus_tag LOCUS_28530 227086 227775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 227788 228795 gene locus_tag LOCUS_28540 227788 228795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 229073 229678 gene locus_tag LOCUS_28550 229073 229678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 229675 230265 gene locus_tag LOCUS_28560 229675 230265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 230336 230755 gene locus_tag LOCUS_28570 230336 230755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 230774 231979 gene locus_tag LOCUS_28580 230774 231979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 231990 232256 gene locus_tag LOCUS_28590 231990 232256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 232258 232593 gene locus_tag LOCUS_28600 232258 232593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 232811 233710 gene locus_tag LOCUS_28610 232811 233710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 233718 234131 gene locus_tag LOCUS_28620 233718 234131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 235393 234620 gene locus_tag LOCUS_28630 235393 234620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 236343 236867 gene locus_tag LOCUS_28640 236343 236867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28640 237361 237825 gene locus_tag LOCUS_28650 gene bcp 237361 237825 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_28650 237865 238611 gene locus_tag LOCUS_28660 237865 238611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 239473 238667 gene locus_tag LOCUS_28670 239473 238667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 240295 239528 gene locus_tag LOCUS_28680 240295 239528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 240944 241273 gene locus_tag LOCUS_28690 240944 241273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28690 241706 241987 gene locus_tag LOCUS_28700 241706 241987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28700 242126 242452 gene locus_tag LOCUS_28710 242126 242452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 242443 243402 gene locus_tag LOCUS_28720 242443 243402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 243536 244699 gene locus_tag LOCUS_28730 243536 244699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 245301 245086 gene locus_tag LOCUS_28740 245301 245086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 245218 246123 gene locus_tag LOCUS_28750 245218 246123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 246140 247183 gene locus_tag LOCUS_28760 246140 247183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 247180 247728 gene locus_tag LOCUS_28770 247180 247728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 247855 248145 gene locus_tag LOCUS_28780 247855 248145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 248938 248546 gene locus_tag LOCUS_28790 248938 248546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28790 249446 250183 gene locus_tag LOCUS_28800 249446 250183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 250180 250686 gene locus_tag LOCUS_28810 250180 250686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 250667 250924 gene locus_tag LOCUS_28820 250667 250924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 251431 252321 gene locus_tag LOCUS_28830 251431 252321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28830 252393 252611 gene locus_tag LOCUS_28840 252393 252611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28840 252658 252960 gene locus_tag LOCUS_28850 252658 252960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28850 253785 253513 gene locus_tag LOCUS_28860 253785 253513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 254449 254075 gene locus_tag LOCUS_28870 254449 254075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 255333 254446 gene locus_tag LOCUS_28880 255333 254446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 256358 255918 gene locus_tag LOCUS_28890 256358 255918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 257098 256454 gene locus_tag LOCUS_28900 257098 256454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 >Feature sequence05 298 543 gene locus_tag LOCUS_28910 298 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 585 812 gene locus_tag LOCUS_28920 585 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 809 1495 gene locus_tag LOCUS_28930 809 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 1841 1500 gene locus_tag LOCUS_28940 1841 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 2372 2157 gene locus_tag LOCUS_28950 2372 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 2532 2801 gene locus_tag LOCUS_28960 2532 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 2698 3033 gene locus_tag LOCUS_28970 2698 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 3266 3712 gene locus_tag LOCUS_28980 3266 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 3825 4688 gene locus_tag LOCUS_28990 3825 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28990 4625 5182 gene locus_tag LOCUS_29000 4625 5182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29000 5562 5882 gene locus_tag LOCUS_29010 5562 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 7127 5913 gene locus_tag LOCUS_29020 7127 5913 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730272.1 protein_id gnl|my_center|LOCUS_29020 7172 7780 gene locus_tag LOCUS_29030 7172 7780 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229194.1 protein_id gnl|my_center|LOCUS_29030 7997 7824 gene locus_tag LOCUS_29040 7997 7824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 8233 7934 gene locus_tag LOCUS_29050 8233 7934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 9159 8758 gene locus_tag LOCUS_29060 gene cadR 9159 8758 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004364961.1 protein_id gnl|my_center|LOCUS_29060 9214 9513 gene locus_tag LOCUS_29070 9214 9513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 9506 9829 gene locus_tag LOCUS_29080 9506 9829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 9822 11276 gene locus_tag LOCUS_29090 9822 11276 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296237.1 protein_id gnl|my_center|LOCUS_29090 12310 11705 gene locus_tag LOCUS_29100 12310 11705 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072078.1 protein_id gnl|my_center|LOCUS_29100 12989 12198 gene locus_tag LOCUS_29110 12989 12198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 13462 12986 gene locus_tag LOCUS_29120 gene lspA 13462 12986 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039646.1 protein_id gnl|my_center|LOCUS_29120 15378 13462 gene locus_tag LOCUS_29130 15378 13462 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946745.1 protein_id gnl|my_center|LOCUS_29130 15849 16184 gene locus_tag LOCUS_29140 15849 16184 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112726.1 protein_id gnl|my_center|LOCUS_29140 17136 16624 gene locus_tag LOCUS_29150 17136 16624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 18673 17897 gene locus_tag LOCUS_29160 gene istB 18673 17897 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289053.1 protein_id gnl|my_center|LOCUS_29160 18957 18670 gene locus_tag LOCUS_29170 18957 18670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 20201 18954 gene locus_tag LOCUS_29180 20201 18954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 20275 21069 gene locus_tag LOCUS_29190 20275 21069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 21059 21487 gene locus_tag LOCUS_29200 21059 21487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29200 21753 21418 gene locus_tag LOCUS_29210 21753 21418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 21762 22172 gene locus_tag LOCUS_29220 21762 22172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29220 22411 23301 gene locus_tag LOCUS_29230 22411 23301 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764768.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29230 23196 23504 gene locus_tag LOCUS_29240 23196 23504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29240 24110 25285 gene locus_tag LOCUS_29250 24110 25285 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_29250 26526 27284 gene locus_tag LOCUS_29260 26526 27284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 27607 27529 gene locus_tag LOCUS_t00430 27607 27529 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 28539 27724 gene locus_tag LOCUS_29270 28539 27724 CDS product phospholipid scramblase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223563.1 protein_id gnl|my_center|LOCUS_29270 28934 28701 gene locus_tag LOCUS_29280 28934 28701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 29981 28989 gene locus_tag LOCUS_29290 29981 28989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 30885 30070 gene locus_tag LOCUS_29300 gene thpD 30885 30070 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040098.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29300 31418 31029 gene locus_tag LOCUS_29310 31418 31029 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776472.1 protein_id gnl|my_center|LOCUS_29310 32013 31462 gene locus_tag LOCUS_29320 32013 31462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 32545 32063 gene locus_tag LOCUS_29330 32545 32063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 33821 32514 gene locus_tag LOCUS_29340 33821 32514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29340 33966 34187 gene locus_tag LOCUS_29350 33966 34187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976677.1 protein_id gnl|my_center|LOCUS_29350 34223 35638 gene locus_tag LOCUS_29360 34223 35638 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224086.1 protein_id gnl|my_center|LOCUS_29360 35635 36849 gene locus_tag LOCUS_29370 gene queG 35635 36849 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345218.1 protein_id gnl|my_center|LOCUS_29370 36846 38000 gene locus_tag LOCUS_29380 gene pimB 36846 38000 CDS product GDP-mannose-dependent alpha-(1-6)-phosphatidylinositol monomannoside mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411369.1 protein_id gnl|my_center|LOCUS_29380 38026 38580 gene locus_tag LOCUS_29390 38026 38580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 38577 39833 gene locus_tag LOCUS_29400 38577 39833 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256376.1 protein_id gnl|my_center|LOCUS_29400 39848 40108 gene locus_tag LOCUS_29410 39848 40108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 40166 41140 gene locus_tag LOCUS_29420 40166 41140 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805026.1 protein_id gnl|my_center|LOCUS_29420 41237 42355 gene locus_tag LOCUS_29430 41237 42355 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120956.1 protein_id gnl|my_center|LOCUS_29430 42348 43034 gene locus_tag LOCUS_29440 42348 43034 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_29440 43665 43042 gene locus_tag LOCUS_29450 43665 43042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 45276 43783 gene locus_tag LOCUS_29460 gene glpK 45276 43783 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815059.1 protein_id gnl|my_center|LOCUS_29460 45349 46380 gene locus_tag LOCUS_29470 45349 46380 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976696.1 protein_id gnl|my_center|LOCUS_29470 47106 46405 gene locus_tag LOCUS_29480 47106 46405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 48697 47111 gene locus_tag LOCUS_29490 48697 47111 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227536.1 protein_id gnl|my_center|LOCUS_29490 49374 48694 gene locus_tag LOCUS_29500 49374 48694 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227535.1 protein_id gnl|my_center|LOCUS_29500 50353 49481 gene locus_tag LOCUS_29510 50353 49481 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224474.1 protein_id gnl|my_center|LOCUS_29510 50631 50350 gene locus_tag LOCUS_29520 50631 50350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 50763 51230 gene locus_tag LOCUS_29530 50763 51230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 51278 52525 gene locus_tag LOCUS_29540 51278 52525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 52512 52877 gene locus_tag LOCUS_29550 52512 52877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 55130 52890 gene locus_tag LOCUS_29560 55130 52890 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486200.1 protein_id gnl|my_center|LOCUS_29560 56332 55130 gene locus_tag LOCUS_29570 56332 55130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 57431 56472 gene locus_tag LOCUS_29580 57431 56472 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976721.1 protein_id gnl|my_center|LOCUS_29580 57582 58457 gene locus_tag LOCUS_29590 57582 58457 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403330.1 protein_id gnl|my_center|LOCUS_29590 58457 58693 gene locus_tag LOCUS_29600 58457 58693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 59201 58713 gene locus_tag LOCUS_29610 59201 58713 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327363.1 protein_id gnl|my_center|LOCUS_29610 59277 60020 gene locus_tag LOCUS_29620 59277 60020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 60232 60639 gene locus_tag LOCUS_29630 gene mraZ 60232 60639 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689463.1 protein_id gnl|my_center|LOCUS_29630 60881 61840 gene locus_tag LOCUS_29640 gene rsmH 60881 61840 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_29640 61954 62628 gene locus_tag LOCUS_29650 61954 62628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 62820 64787 gene locus_tag LOCUS_29660 gene ftsI 62820 64787 CDS product cell division protein FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028132.1 protein_id gnl|my_center|LOCUS_29660 64720 66303 gene locus_tag LOCUS_29670 64720 66303 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_29670 66300 67346 gene locus_tag LOCUS_29680 gene mraY 66300 67346 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228040.1 protein_id gnl|my_center|LOCUS_29680 67614 67366 gene locus_tag LOCUS_29690 67614 67366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 67514 68635 gene locus_tag LOCUS_29700 gene ftsW 67514 68635 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_29700 68635 69801 gene locus_tag LOCUS_29710 gene murG 68635 69801 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804702.1 protein_id gnl|my_center|LOCUS_29710 69798 71273 gene locus_tag LOCUS_29720 gene murC 69798 71273 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920403.1 protein_id gnl|my_center|LOCUS_29720 71270 72232 gene locus_tag LOCUS_29730 gene murB 71270 72232 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089340.1 protein_id gnl|my_center|LOCUS_29730 72229 73032 gene locus_tag LOCUS_29740 72229 73032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 73224 74369 gene locus_tag LOCUS_29750 gene ftsZ 73224 74369 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_29750 74332 75078 gene locus_tag LOCUS_29760 74332 75078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 75075 75791 gene locus_tag LOCUS_29770 75075 75791 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194162.1 protein_id gnl|my_center|LOCUS_29770 75815 76444 gene locus_tag LOCUS_29780 75815 76444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 76473 76739 gene locus_tag LOCUS_29790 76473 76739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 76841 78226 gene locus_tag LOCUS_29800 76841 78226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 78293 78838 gene locus_tag LOCUS_29810 78293 78838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 78825 79358 gene locus_tag LOCUS_29820 78825 79358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 79381 80319 gene locus_tag LOCUS_29830 79381 80319 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256790.1 protein_id gnl|my_center|LOCUS_29830 80380 81531 gene locus_tag LOCUS_29840 80380 81531 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013610.1 protein_id gnl|my_center|LOCUS_29840 81964 81515 gene locus_tag LOCUS_29850 81964 81515 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_29850 82159 83268 gene locus_tag LOCUS_29860 82159 83268 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229483.1 protein_id gnl|my_center|LOCUS_29860 83288 83884 gene locus_tag LOCUS_29870 83288 83884 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975113.1 protein_id gnl|my_center|LOCUS_29870 83936 87475 gene locus_tag LOCUS_29880 gene dnaE 83936 87475 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407751.1 protein_id gnl|my_center|LOCUS_29880 87575 88261 gene locus_tag LOCUS_29890 87575 88261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 88270 88953 gene locus_tag LOCUS_29900 88270 88953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 89001 89516 gene locus_tag LOCUS_29910 89001 89516 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921241.1 protein_id gnl|my_center|LOCUS_29910 89513 90298 gene locus_tag LOCUS_29920 89513 90298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 91199 90282 gene locus_tag LOCUS_29930 91199 90282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 93414 91375 gene locus_tag LOCUS_29940 93414 91375 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119948893.1 protein_id gnl|my_center|LOCUS_29940 93458 95074 gene locus_tag LOCUS_29950 93458 95074 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112031.1 protein_id gnl|my_center|LOCUS_29950 95670 95107 gene locus_tag LOCUS_29960 95670 95107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 95924 96577 gene locus_tag LOCUS_29970 95924 96577 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927004.1 protein_id gnl|my_center|LOCUS_29970 97684 96581 gene locus_tag LOCUS_29980 gene menE 97684 96581 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081439373.1 protein_id gnl|my_center|LOCUS_29980 97589 98680 gene locus_tag LOCUS_29990 97589 98680 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776415.1 protein_id gnl|my_center|LOCUS_29990 99257 98691 gene locus_tag LOCUS_30000 99257 98691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 100429 99311 gene locus_tag LOCUS_30010 100429 99311 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225715.1 protein_id gnl|my_center|LOCUS_30010 101032 100496 gene locus_tag LOCUS_30020 101032 100496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 101607 101029 gene locus_tag LOCUS_30030 101607 101029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 102776 101604 gene locus_tag LOCUS_30040 102776 101604 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_30040 104052 102829 gene locus_tag LOCUS_30050 104052 102829 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897303.1 protein_id gnl|my_center|LOCUS_30050 105333 104140 gene locus_tag LOCUS_30060 105333 104140 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_30060 105971 105474 gene locus_tag LOCUS_30070 105971 105474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 106270 106701 gene locus_tag LOCUS_30080 106270 106701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 106869 108671 gene locus_tag LOCUS_30090 gene menD 106869 108671 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989780.1 protein_id gnl|my_center|LOCUS_30090 108830 109849 gene locus_tag LOCUS_30100 108830 109849 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894961.1 protein_id gnl|my_center|LOCUS_30100 109846 110028 gene locus_tag LOCUS_30110 109846 110028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 111355 110039 gene locus_tag LOCUS_30120 111355 110039 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416879.1 protein_id gnl|my_center|LOCUS_30120 112097 111348 gene locus_tag LOCUS_30130 gene ubiE 112097 111348 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889031.1 protein_id gnl|my_center|LOCUS_30130 113797 112178 gene locus_tag LOCUS_30140 113797 112178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 114219 113992 gene locus_tag LOCUS_30150 114219 113992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30150 115664 114156 gene locus_tag LOCUS_30160 115664 114156 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729261.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30160 117303 115762 gene locus_tag LOCUS_30170 117303 115762 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776491.1 protein_id gnl|my_center|LOCUS_30170 117784 117323 gene locus_tag LOCUS_30180 117784 117323 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_30180 118230 117832 gene locus_tag LOCUS_30190 118230 117832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 118241 119257 gene locus_tag LOCUS_30200 118241 119257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 120409 119243 gene locus_tag LOCUS_30210 gene rlmN 120409 119243 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092553592.1 protein_id gnl|my_center|LOCUS_30210 121194 120406 gene locus_tag LOCUS_30220 121194 120406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 121635 122684 gene locus_tag LOCUS_30230 121635 122684 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404056.1 protein_id gnl|my_center|LOCUS_30230 122681 123418 gene locus_tag LOCUS_30240 gene deoD 122681 123418 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707410.1 protein_id gnl|my_center|LOCUS_30240 124749 123448 gene locus_tag LOCUS_30250 124749 123448 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933494.1 protein_id gnl|my_center|LOCUS_30250 125672 124746 gene locus_tag LOCUS_30260 125672 124746 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049748902.1 protein_id gnl|my_center|LOCUS_30260 127090 125909 gene locus_tag LOCUS_30270 127090 125909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 127989 127168 gene locus_tag LOCUS_30280 127989 127168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 128669 128914 gene locus_tag LOCUS_30290 128669 128914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 128915 129274 gene locus_tag LOCUS_30300 128915 129274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 129560 131743 gene locus_tag LOCUS_30310 129560 131743 CDS product TerB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104238.1 protein_id gnl|my_center|LOCUS_30310 131740 133122 gene locus_tag LOCUS_30320 131740 133122 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003683.1 protein_id gnl|my_center|LOCUS_30320 134011 133853 gene locus_tag LOCUS_30330 134011 133853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 135076 134822 gene locus_tag LOCUS_30340 135076 134822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 136338 135571 gene locus_tag LOCUS_30350 136338 135571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 136228 136881 gene locus_tag LOCUS_30360 136228 136881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 137437 138912 gene locus_tag LOCUS_30370 137437 138912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 138942 140177 gene locus_tag LOCUS_30380 138942 140177 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229595.1 protein_id gnl|my_center|LOCUS_30380 140174 141625 gene locus_tag LOCUS_30390 140174 141625 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030377.1 protein_id gnl|my_center|LOCUS_30390 142177 141692 gene locus_tag LOCUS_30400 142177 141692 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111753.1 protein_id gnl|my_center|LOCUS_30400 143360 142191 gene locus_tag LOCUS_30410 gene ald 143360 142191 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229678.1 protein_id gnl|my_center|LOCUS_30410 144730 143357 gene locus_tag LOCUS_30420 144730 143357 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226084.1 protein_id gnl|my_center|LOCUS_30420 145713 144838 gene locus_tag LOCUS_30430 145713 144838 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894682.1 protein_id gnl|my_center|LOCUS_30430 146588 145713 gene locus_tag LOCUS_30440 146588 145713 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894683.1 protein_id gnl|my_center|LOCUS_30440 147806 146631 gene locus_tag LOCUS_30450 147806 146631 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894684.1 protein_id gnl|my_center|LOCUS_30450 149115 147850 gene locus_tag LOCUS_30460 149115 147850 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728946.1 protein_id gnl|my_center|LOCUS_30460 149246 150667 gene locus_tag LOCUS_30470 gene patD 149246 150667 CDS product aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158107.1 protein_id gnl|my_center|LOCUS_30470 150741 151784 gene locus_tag LOCUS_30480 150741 151784 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356689.1 protein_id gnl|my_center|LOCUS_30480 151775 152785 gene locus_tag LOCUS_30490 151775 152785 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079494.1 protein_id gnl|my_center|LOCUS_30490 153103 153486 gene locus_tag LOCUS_30500 153103 153486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 154129 155922 gene locus_tag LOCUS_30510 154129 155922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 156092 156445 gene locus_tag LOCUS_30520 156092 156445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 156469 156987 gene locus_tag LOCUS_30530 156469 156987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 156984 157313 gene locus_tag LOCUS_30540 156984 157313 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058065.1 protein_id gnl|my_center|LOCUS_30540 157478 157870 gene locus_tag LOCUS_30550 157478 157870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 158177 159136 gene locus_tag LOCUS_30560 158177 159136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 160478 159189 gene locus_tag LOCUS_30570 160478 159189 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040264.1 protein_id gnl|my_center|LOCUS_30570 160586 162142 gene locus_tag LOCUS_30580 160586 162142 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095242.1 protein_id gnl|my_center|LOCUS_30580 162291 163718 gene locus_tag LOCUS_30590 162291 163718 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893539.1 protein_id gnl|my_center|LOCUS_30590 166034 163758 gene locus_tag LOCUS_30600 166034 163758 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963302.1 protein_id gnl|my_center|LOCUS_30600 166893 166243 gene locus_tag LOCUS_30610 gene degU 166893 166243 CDS product two-component system response regulator DegU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219701.1 protein_id gnl|my_center|LOCUS_30610 167771 166890 gene locus_tag LOCUS_30620 167771 166890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 167880 168545 gene locus_tag LOCUS_30630 gene coaE 167880 168545 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976822.1 protein_id gnl|my_center|LOCUS_30630 170774 168570 gene locus_tag LOCUS_30640 170774 168570 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028805.1 protein_id gnl|my_center|LOCUS_30640 170874 171491 gene locus_tag LOCUS_30650 170874 171491 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487124.1 protein_id gnl|my_center|LOCUS_30650 171520 171738 gene locus_tag LOCUS_30660 171520 171738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 172304 171735 gene locus_tag LOCUS_30670 172304 171735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 173236 172301 gene locus_tag LOCUS_30680 173236 172301 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259359.1 protein_id gnl|my_center|LOCUS_30680 173738 173253 gene locus_tag LOCUS_30690 173738 173253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 174336 173731 gene locus_tag LOCUS_30700 174336 173731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 174251 174451 gene locus_tag LOCUS_30710 174251 174451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 174495 175166 gene locus_tag LOCUS_30720 174495 175166 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973245.1 protein_id gnl|my_center|LOCUS_30720 175163 176566 gene locus_tag LOCUS_30730 175163 176566 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224238.1 protein_id gnl|my_center|LOCUS_30730 176612 177838 gene locus_tag LOCUS_30740 176612 177838 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933793.1 protein_id gnl|my_center|LOCUS_30740 178122 178439 gene locus_tag LOCUS_30750 178122 178439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 178521 178751 gene locus_tag LOCUS_30760 178521 178751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 178904 178680 gene locus_tag LOCUS_30770 178904 178680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 179267 178929 gene locus_tag LOCUS_30780 179267 178929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 180179 179343 gene locus_tag LOCUS_30790 180179 179343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 181240 180176 gene locus_tag LOCUS_30800 181240 180176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 182811 181495 gene locus_tag LOCUS_30810 182811 181495 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172947.1 protein_id gnl|my_center|LOCUS_30810 182991 183248 gene locus_tag LOCUS_30820 182991 183248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 183245 183526 gene locus_tag LOCUS_30830 183245 183526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 183582 184400 gene locus_tag LOCUS_30840 183582 184400 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977273.1 protein_id gnl|my_center|LOCUS_30840 185121 184405 gene locus_tag LOCUS_30850 185121 184405 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226228.1 protein_id gnl|my_center|LOCUS_30850 185216 186145 gene locus_tag LOCUS_30860 185216 186145 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095780.1 protein_id gnl|my_center|LOCUS_30860 186153 186500 gene locus_tag LOCUS_30870 186153 186500 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408743.1 protein_id gnl|my_center|LOCUS_30870 186513 187091 gene locus_tag LOCUS_30880 gene cobO 186513 187091 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229235.1 protein_id gnl|my_center|LOCUS_30880 188148 187096 gene locus_tag LOCUS_30890 188148 187096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 188762 188145 gene locus_tag LOCUS_30900 188762 188145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 189493 188771 gene locus_tag LOCUS_30910 189493 188771 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191554.1 protein_id gnl|my_center|LOCUS_30910 189653 191752 gene locus_tag LOCUS_30920 gene uvrB 189653 191752 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028069.1 protein_id gnl|my_center|LOCUS_30920 191852 193822 gene locus_tag LOCUS_30930 191852 193822 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730604.1 protein_id gnl|my_center|LOCUS_30930 194962 193847 gene locus_tag LOCUS_30940 gene aroC 194962 193847 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_30940 196204 194987 gene locus_tag LOCUS_30950 196204 194987 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190545.1 protein_id gnl|my_center|LOCUS_30950 196300 199167 gene locus_tag LOCUS_30960 gene uvrA 196300 199167 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028066.1 protein_id gnl|my_center|LOCUS_30960 200048 199164 gene locus_tag LOCUS_30970 200048 199164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 200114 200344 gene locus_tag LOCUS_30980 200114 200344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 201290 200508 gene locus_tag LOCUS_30990 201290 200508 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084305.1 protein_id gnl|my_center|LOCUS_30990 201443 202546 gene locus_tag LOCUS_31000 gene nadA 201443 202546 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858544.1 protein_id gnl|my_center|LOCUS_31000 202642 203409 gene locus_tag LOCUS_31010 gene menH 202642 203409 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255997.1 protein_id gnl|my_center|LOCUS_31010 203501 205447 gene locus_tag LOCUS_31020 203501 205447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 205493 205948 gene locus_tag LOCUS_31030 205493 205948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 205945 207216 gene locus_tag LOCUS_31040 205945 207216 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226839.1 protein_id gnl|my_center|LOCUS_31040 207243 207572 gene locus_tag LOCUS_31050 207243 207572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 207601 208764 gene locus_tag LOCUS_31060 gene rnd 207601 208764 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971431.1 protein_id gnl|my_center|LOCUS_31060 208910 209092 gene locus_tag LOCUS_31070 208910 209092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 209114 209953 gene locus_tag LOCUS_31080 209114 209953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898484.1 protein_id gnl|my_center|LOCUS_31080 209953 210165 gene locus_tag LOCUS_31090 209953 210165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 212084 210162 gene locus_tag LOCUS_31100 212084 210162 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927144.1 protein_id gnl|my_center|LOCUS_31100 213019 212114 gene locus_tag LOCUS_31110 213019 212114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 214260 213016 gene locus_tag LOCUS_31120 214260 213016 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060798.1 protein_id gnl|my_center|LOCUS_31120 214472 215284 gene locus_tag LOCUS_31130 214472 215284 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_31130 215296 216519 gene locus_tag LOCUS_31140 gene lldD 215296 216519 CDS product FMN-dependent L-lactate dehydrogenase LldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919035.1 protein_id gnl|my_center|LOCUS_31140 218983 216542 gene locus_tag LOCUS_31150 218983 216542 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406167.1 protein_id gnl|my_center|LOCUS_31150 220029 218980 gene locus_tag LOCUS_31160 220029 218980 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256245.1 protein_id gnl|my_center|LOCUS_31160 222142 220022 gene locus_tag LOCUS_31170 222142 220022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 223244 222153 gene locus_tag LOCUS_31180 gene tal 223244 222153 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031085.1 protein_id gnl|my_center|LOCUS_31180 225269 223293 gene locus_tag LOCUS_31190 gene tkt 225269 223293 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301211.1 protein_id gnl|my_center|LOCUS_31190 225268 226518 gene locus_tag LOCUS_31200 225268 226518 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403248.1 protein_id gnl|my_center|LOCUS_31200 226572 227024 gene locus_tag LOCUS_31210 226572 227024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 227061 228032 gene locus_tag LOCUS_31220 227061 228032 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876331.1 protein_id gnl|my_center|LOCUS_31220 229089 228037 gene locus_tag LOCUS_31230 229089 228037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 229183 230001 gene locus_tag LOCUS_31240 229183 230001 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224343.1 protein_id gnl|my_center|LOCUS_31240 230048 230758 gene locus_tag LOCUS_31250 230048 230758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31250 >Feature sequence06 1101 1682 gene locus_tag LOCUS_31260 1101 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31260 1842 2021 gene locus_tag LOCUS_31270 1842 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31270 2238 2104 gene locus_tag LOCUS_31280 2238 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 2472 2780 gene locus_tag LOCUS_31290 2472 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31290 3438 2992 gene locus_tag LOCUS_31300 3438 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 4378 3428 gene locus_tag LOCUS_31310 4378 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 4613 4819 gene locus_tag LOCUS_31320 4613 4819 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027899.1 protein_id gnl|my_center|LOCUS_31320 4839 6086 gene locus_tag LOCUS_31330 4839 6086 CDS product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028042.1 protein_id gnl|my_center|LOCUS_31330 6159 6986 gene locus_tag LOCUS_31340 gene prcB 6159 6986 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_31340 7038 7919 gene locus_tag LOCUS_31350 gene prcA 7038 7919 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027897.1 protein_id gnl|my_center|LOCUS_31350 7994 9352 gene locus_tag LOCUS_31360 gene pafA 7994 9352 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 protein_id gnl|my_center|LOCUS_31360 9375 10400 gene locus_tag LOCUS_31370 9375 10400 CDS product DUF3866 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896132.1 protein_id gnl|my_center|LOCUS_31370 10486 11439 gene locus_tag LOCUS_31380 10486 11439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 11448 12398 gene locus_tag LOCUS_31390 11448 12398 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226714.1 protein_id gnl|my_center|LOCUS_31390 12395 13225 gene locus_tag LOCUS_31400 12395 13225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 13215 14069 gene locus_tag LOCUS_31410 13215 14069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 15219 14185 gene locus_tag LOCUS_31420 15219 14185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 16019 15288 gene locus_tag LOCUS_31430 16019 15288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 16142 16462 gene locus_tag LOCUS_31440 16142 16462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 16554 17186 gene locus_tag LOCUS_31450 16554 17186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 17183 17965 gene locus_tag LOCUS_31460 gene tatC 17183 17965 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080091.1 protein_id gnl|my_center|LOCUS_31460 17962 20727 gene locus_tag LOCUS_31470 17962 20727 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027893.1 protein_id gnl|my_center|LOCUS_31470 20724 21410 gene locus_tag LOCUS_31480 20724 21410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 21453 22667 gene locus_tag LOCUS_31490 21453 22667 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228841.1 protein_id gnl|my_center|LOCUS_31490 22763 24376 gene locus_tag LOCUS_31500 22763 24376 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256261.1 protein_id gnl|my_center|LOCUS_31500 24544 25086 gene locus_tag LOCUS_31510 24544 25086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 25083 25631 gene locus_tag LOCUS_31520 25083 25631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 25628 26134 gene locus_tag LOCUS_31530 25628 26134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 26121 26549 gene locus_tag LOCUS_31540 26121 26549 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763493.1 protein_id gnl|my_center|LOCUS_31540 27417 26596 gene locus_tag LOCUS_31550 27417 26596 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808209.1 protein_id gnl|my_center|LOCUS_31550 28936 27455 gene locus_tag LOCUS_31560 28936 27455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 30566 29112 gene locus_tag LOCUS_31570 30566 29112 CDS product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223941.1 protein_id gnl|my_center|LOCUS_31570 30682 31761 gene locus_tag LOCUS_31580 30682 31761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 31673 32851 gene locus_tag LOCUS_31590 31673 32851 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418997.1 protein_id gnl|my_center|LOCUS_31590 32923 34053 gene locus_tag LOCUS_31600 32923 34053 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730884.1 protein_id gnl|my_center|LOCUS_31600 34120 34722 gene locus_tag LOCUS_31610 34120 34722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 35015 34734 gene locus_tag LOCUS_31620 35015 34734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 36166 35012 gene locus_tag LOCUS_31630 36166 35012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 36936 36226 gene locus_tag LOCUS_31640 36936 36226 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401202.1 protein_id gnl|my_center|LOCUS_31640 37898 37122 gene locus_tag LOCUS_31650 37898 37122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 38796 37933 gene locus_tag LOCUS_31660 38796 37933 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067118245.1 protein_id gnl|my_center|LOCUS_31660 38999 39757 gene locus_tag LOCUS_31670 38999 39757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 39978 40397 gene locus_tag LOCUS_31680 39978 40397 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230834.1 protein_id gnl|my_center|LOCUS_31680 40405 41376 gene locus_tag LOCUS_31690 40405 41376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 41488 42435 gene locus_tag LOCUS_31700 41488 42435 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223699.1 protein_id gnl|my_center|LOCUS_31700 42998 42441 gene locus_tag LOCUS_31710 42998 42441 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865482.1 protein_id gnl|my_center|LOCUS_31710 43554 43054 gene locus_tag LOCUS_31720 43554 43054 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401601.1 protein_id gnl|my_center|LOCUS_31720 43647 44315 gene locus_tag LOCUS_31730 43647 44315 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919054.1 protein_id gnl|my_center|LOCUS_31730 44534 45526 gene locus_tag LOCUS_31740 44534 45526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 45624 46697 gene locus_tag LOCUS_31750 45624 46697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 46970 49915 gene locus_tag LOCUS_31760 gene gcvP 46970 49915 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027754.1 protein_id gnl|my_center|LOCUS_31760 49925 50188 gene locus_tag LOCUS_31770 49925 50188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 50185 51426 gene locus_tag LOCUS_31780 50185 51426 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257181.1 protein_id gnl|my_center|LOCUS_31780 51437 51769 gene locus_tag LOCUS_31790 51437 51769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 51809 52840 gene locus_tag LOCUS_31800 51809 52840 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728259.1 protein_id gnl|my_center|LOCUS_31800 53290 52874 gene locus_tag LOCUS_31810 gene msrB 53290 52874 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813871.1 protein_id gnl|my_center|LOCUS_31810 53963 53334 gene locus_tag LOCUS_31820 gene msrA 53963 53334 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056729.1 protein_id gnl|my_center|LOCUS_31820 55140 54046 gene locus_tag LOCUS_31830 gene gcvT 55140 54046 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899219.1 protein_id gnl|my_center|LOCUS_31830 55652 55137 gene locus_tag LOCUS_31840 55652 55137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 56321 55824 gene locus_tag LOCUS_31850 56321 55824 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977444.1 protein_id gnl|my_center|LOCUS_31850 57672 56374 gene locus_tag LOCUS_31860 57672 56374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 58117 57677 gene locus_tag LOCUS_31870 58117 57677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 58491 58117 gene locus_tag LOCUS_31880 gene gcvH 58491 58117 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409234.1 protein_id gnl|my_center|LOCUS_31880 59200 58535 gene locus_tag LOCUS_31890 59200 58535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 59266 59715 gene locus_tag LOCUS_31900 59266 59715 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087112.1 protein_id gnl|my_center|LOCUS_31900 60528 59743 gene locus_tag LOCUS_31910 60528 59743 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_31910 60614 61825 gene locus_tag LOCUS_31920 60614 61825 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088385.1 protein_id gnl|my_center|LOCUS_31920 63290 61839 gene locus_tag LOCUS_31930 63290 61839 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528760.1 protein_id gnl|my_center|LOCUS_31930 63464 63389 gene locus_tag LOCUS_t00440 63464 63389 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 63478 64368 gene locus_tag LOCUS_31940 63478 64368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 64678 64403 gene locus_tag LOCUS_31950 64678 64403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 66251 64743 gene locus_tag LOCUS_31960 66251 64743 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231527.1 protein_id gnl|my_center|LOCUS_31960 67432 66338 gene locus_tag LOCUS_31970 67432 66338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 68922 67486 gene locus_tag LOCUS_31980 68922 67486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 70466 68919 gene locus_tag LOCUS_31990 70466 68919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 70500 71594 gene locus_tag LOCUS_32000 gene ispH 70500 71594 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922221.1 protein_id gnl|my_center|LOCUS_32000 71776 72183 gene locus_tag LOCUS_32010 71776 72183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 72225 72551 gene locus_tag LOCUS_32020 72225 72551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 72676 72840 gene locus_tag LOCUS_32030 72676 72840 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752909.1 protein_id gnl|my_center|LOCUS_32030 73112 73324 gene locus_tag LOCUS_32040 73112 73324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 74758 73367 gene locus_tag LOCUS_32050 74758 73367 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839029.1 protein_id gnl|my_center|LOCUS_32050 76809 74854 gene locus_tag LOCUS_32060 76809 74854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 76920 77378 gene locus_tag LOCUS_32070 76920 77378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 77375 78403 gene locus_tag LOCUS_32080 77375 78403 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111946.1 protein_id gnl|my_center|LOCUS_32080 78403 79644 gene locus_tag LOCUS_32090 78403 79644 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893439.1 protein_id gnl|my_center|LOCUS_32090 80738 79665 gene locus_tag LOCUS_32100 80738 79665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 83593 80780 gene locus_tag LOCUS_32110 83593 80780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 85071 83587 gene locus_tag LOCUS_32120 85071 83587 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963040.1 protein_id gnl|my_center|LOCUS_32120 85729 85076 gene locus_tag LOCUS_32130 85729 85076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 87032 85752 gene locus_tag LOCUS_32140 87032 85752 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730116.1 protein_id gnl|my_center|LOCUS_32140 87525 87112 gene locus_tag LOCUS_32150 87525 87112 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082839.1 protein_id gnl|my_center|LOCUS_32150 88311 87601 gene locus_tag LOCUS_32160 88311 87601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 89243 88308 gene locus_tag LOCUS_32170 89243 88308 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976536.1 protein_id gnl|my_center|LOCUS_32170 90338 89322 gene locus_tag LOCUS_32180 90338 89322 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_32180 90489 91163 gene locus_tag LOCUS_32190 90489 91163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 92473 91208 gene locus_tag LOCUS_32200 92473 91208 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_32200 93097 92576 gene locus_tag LOCUS_32210 93097 92576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 93157 93723 gene locus_tag LOCUS_32220 93157 93723 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257245.1 protein_id gnl|my_center|LOCUS_32220 93772 94890 gene locus_tag LOCUS_32230 93772 94890 CDS product DUF2855 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920925.1 protein_id gnl|my_center|LOCUS_32230 95970 95527 gene locus_tag LOCUS_32240 95970 95527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 96371 96156 gene locus_tag LOCUS_32250 96371 96156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 96680 96501 gene locus_tag LOCUS_32260 96680 96501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 101325 96862 gene locus_tag LOCUS_32270 101325 96862 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909023.1 protein_id gnl|my_center|LOCUS_32270 101537 101878 gene locus_tag LOCUS_32280 101537 101878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 102345 101875 gene locus_tag LOCUS_32290 102345 101875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 104823 102454 gene locus_tag LOCUS_32300 104823 102454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 105008 106339 gene locus_tag LOCUS_32310 105008 106339 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879270.1 protein_id gnl|my_center|LOCUS_32310 106519 107025 gene locus_tag LOCUS_32320 106519 107025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32320 107101 107382 gene locus_tag LOCUS_32330 107101 107382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32330 107562 108143 gene locus_tag LOCUS_32340 107562 108143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 108502 108158 gene locus_tag LOCUS_32350 108502 108158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 109514 108480 gene locus_tag LOCUS_32360 109514 108480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 109524 109913 gene locus_tag LOCUS_32370 109524 109913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32370 109900 110184 gene locus_tag LOCUS_32380 109900 110184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32380 110212 110421 gene locus_tag LOCUS_32390 110212 110421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 110828 111280 gene locus_tag LOCUS_32400 110828 111280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 111632 113131 gene locus_tag LOCUS_32410 111632 113131 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256346.1 protein_id gnl|my_center|LOCUS_32410 113238 113621 gene locus_tag LOCUS_32420 113238 113621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 113993 113658 gene locus_tag LOCUS_32430 113993 113658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 114100 114294 gene locus_tag LOCUS_32440 114100 114294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 115958 114375 gene locus_tag LOCUS_32450 115958 114375 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549141.1 protein_id gnl|my_center|LOCUS_32450 116022 117179 gene locus_tag LOCUS_32460 116022 117179 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222756.1 protein_id gnl|my_center|LOCUS_32460 117176 118315 gene locus_tag LOCUS_32470 117176 118315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 118330 118992 gene locus_tag LOCUS_32480 118330 118992 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896555.1 protein_id gnl|my_center|LOCUS_32480 120160 119000 gene locus_tag LOCUS_32490 120160 119000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 120273 121088 gene locus_tag LOCUS_32500 120273 121088 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933138.1 protein_id gnl|my_center|LOCUS_32500 122469 121105 gene locus_tag LOCUS_32510 122469 121105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086672.1 protein_id gnl|my_center|LOCUS_32510 123324 122476 gene locus_tag LOCUS_32520 123324 122476 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466752.1 protein_id gnl|my_center|LOCUS_32520 124304 123321 gene locus_tag LOCUS_32530 124304 123321 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_32530 124801 124301 gene locus_tag LOCUS_32540 124801 124301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 126265 124811 gene locus_tag LOCUS_32550 126265 124811 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029681.1 protein_id gnl|my_center|LOCUS_32550 127821 126259 gene locus_tag LOCUS_32560 127821 126259 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029681.1 protein_id gnl|my_center|LOCUS_32560 127947 128741 gene locus_tag LOCUS_32570 127947 128741 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003143427.1 protein_id gnl|my_center|LOCUS_32570 129532 128774 gene locus_tag LOCUS_32580 129532 128774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 131047 129719 gene locus_tag LOCUS_32590 131047 129719 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030570.1 protein_id gnl|my_center|LOCUS_32590 131491 131847 gene locus_tag LOCUS_32600 131491 131847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 134011 131945 gene locus_tag LOCUS_32610 134011 131945 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112725.1 protein_id gnl|my_center|LOCUS_32610 134366 134004 gene locus_tag LOCUS_32620 134366 134004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 134716 134363 gene locus_tag LOCUS_32630 134716 134363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 134773 134934 gene locus_tag LOCUS_32640 134773 134934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 135670 134981 gene locus_tag LOCUS_32650 135670 134981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 136884 135703 gene locus_tag LOCUS_32660 136884 135703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 137176 136994 gene locus_tag LOCUS_32670 137176 136994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 137235 137948 gene locus_tag LOCUS_32680 137235 137948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 139230 138304 gene locus_tag LOCUS_32690 139230 138304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 139339 139719 gene locus_tag LOCUS_32700 139339 139719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 139720 140814 gene locus_tag LOCUS_32710 139720 140814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 140908 142575 gene locus_tag LOCUS_32720 140908 142575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 143206 142607 gene locus_tag LOCUS_32730 143206 142607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 143729 143496 gene locus_tag LOCUS_32740 143729 143496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 143989 143777 gene locus_tag LOCUS_32750 143989 143777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 144375 144073 gene locus_tag LOCUS_32760 144375 144073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 146251 144293 gene locus_tag LOCUS_32770 146251 144293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 147379 146291 gene locus_tag LOCUS_32780 gene xerC 147379 146291 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456225.1 protein_id gnl|my_center|LOCUS_32780 147595 148500 gene locus_tag LOCUS_32790 147595 148500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 150006 148840 gene locus_tag LOCUS_32800 150006 148840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 150506 150132 gene locus_tag LOCUS_32810 150506 150132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 150821 150648 gene locus_tag LOCUS_32820 150821 150648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 151992 153059 gene locus_tag LOCUS_32830 151992 153059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 153705 153040 gene locus_tag LOCUS_32840 153705 153040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 153915 154241 gene locus_tag LOCUS_32850 153915 154241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 155304 154234 gene locus_tag LOCUS_32860 155304 154234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 155649 156299 gene locus_tag LOCUS_32870 155649 156299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 156289 157035 gene locus_tag LOCUS_32880 156289 157035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 157738 157184 gene locus_tag LOCUS_32890 157738 157184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 158757 157735 gene locus_tag LOCUS_32900 158757 157735 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 protein_id gnl|my_center|LOCUS_32900 158973 160178 gene locus_tag LOCUS_32910 158973 160178 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528130.1 protein_id gnl|my_center|LOCUS_32910 160175 162151 gene locus_tag LOCUS_32920 160175 162151 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815500.1 protein_id gnl|my_center|LOCUS_32920 162157 163149 gene locus_tag LOCUS_32930 162157 163149 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249955.1 protein_id gnl|my_center|LOCUS_32930 163323 164081 gene locus_tag LOCUS_32940 163323 164081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 164381 164013 gene locus_tag LOCUS_32950 164381 164013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 170450 164994 gene locus_tag LOCUS_32960 170450 164994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 173972 170745 gene locus_tag LOCUS_32970 gene mobF 173972 170745 CDS product MobF family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296243.1 protein_id gnl|my_center|LOCUS_32970 174662 174339 gene locus_tag LOCUS_32980 174662 174339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 174895 174659 gene locus_tag LOCUS_32990 174895 174659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 175213 175707 gene locus_tag LOCUS_33000 175213 175707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 175685 177067 gene locus_tag LOCUS_33010 175685 177067 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167773.1 protein_id gnl|my_center|LOCUS_33010 177203 177598 gene locus_tag LOCUS_33020 177203 177598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 177682 178035 gene locus_tag LOCUS_33030 177682 178035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 178067 178483 gene locus_tag LOCUS_33040 178067 178483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 178392 180023 gene locus_tag LOCUS_33050 178392 180023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 180693 180211 gene locus_tag LOCUS_33060 180693 180211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 180934 180850 gene locus_tag LOCUS_t00450 180934 180850 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 181168 181617 gene locus_tag LOCUS_33070 181168 181617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 181855 182616 gene locus_tag LOCUS_33080 181855 182616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 182669 183865 gene locus_tag LOCUS_33090 182669 183865 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764772.1 protein_id gnl|my_center|LOCUS_33090 183862 184788 gene locus_tag LOCUS_33100 183862 184788 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970904.1 protein_id gnl|my_center|LOCUS_33100 184785 185780 gene locus_tag LOCUS_33110 184785 185780 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970282.1 protein_id gnl|my_center|LOCUS_33110 186087 186004 gene locus_tag LOCUS_t00460 186087 186004 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 186706 186416 gene locus_tag LOCUS_33120 186706 186416 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003950507.1 protein_id gnl|my_center|LOCUS_33120 187169 186996 gene locus_tag LOCUS_33130 187169 186996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 187603 187307 gene locus_tag LOCUS_33140 187603 187307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 190002 189454 gene locus_tag LOCUS_33150 190002 189454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33150 190126 189977 gene locus_tag LOCUS_33160 190126 189977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 191086 190151 gene locus_tag LOCUS_33170 191086 190151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 >Feature sequence07 2649 1465 gene locus_tag LOCUS_33180 2649 1465 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919308.1 protein_id gnl|my_center|LOCUS_33180 4064 2646 gene locus_tag LOCUS_33190 4064 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 4563 4054 gene locus_tag LOCUS_33200 4563 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33200 5855 4446 gene locus_tag LOCUS_33210 5855 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33210 7178 6141 gene locus_tag LOCUS_33220 gene corA 7178 6141 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223003.1 protein_id gnl|my_center|LOCUS_33220 8587 7175 gene locus_tag LOCUS_33230 8587 7175 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876257.1 protein_id gnl|my_center|LOCUS_33230 8763 9770 gene locus_tag LOCUS_33240 8763 9770 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258100.1 protein_id gnl|my_center|LOCUS_33240 10289 9852 gene locus_tag LOCUS_33250 10289 9852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 10453 10283 gene locus_tag LOCUS_33260 10453 10283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 10800 11129 gene locus_tag LOCUS_33270 10800 11129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 11780 11595 gene locus_tag LOCUS_33280 11780 11595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 11779 12285 gene locus_tag LOCUS_33290 11779 12285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 12881 12246 gene locus_tag LOCUS_33300 12881 12246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 13266 13054 gene locus_tag LOCUS_33310 13266 13054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 14419 13340 gene locus_tag LOCUS_33320 14419 13340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 14678 15103 gene locus_tag LOCUS_33330 14678 15103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 15103 15426 gene locus_tag LOCUS_33340 15103 15426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 16335 15469 gene locus_tag LOCUS_33350 16335 15469 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223704.1 protein_id gnl|my_center|LOCUS_33350 16811 16401 gene locus_tag LOCUS_33360 gene vapC20 16811 16401 CDS product type II toxin-antitoxin system toxin 23S rRNA-specific endonuclease VapC20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413180.1 protein_id gnl|my_center|LOCUS_33360 17038 16808 gene locus_tag LOCUS_33370 17038 16808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 17065 18585 gene locus_tag LOCUS_33380 17065 18585 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966249.1 protein_id gnl|my_center|LOCUS_33380 18675 18995 gene locus_tag LOCUS_33390 18675 18995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 19079 19624 gene locus_tag LOCUS_33400 19079 19624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 20463 19660 gene locus_tag LOCUS_33410 20463 19660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 21028 21927 gene locus_tag LOCUS_33420 21028 21927 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972903.1 protein_id gnl|my_center|LOCUS_33420 22032 22583 gene locus_tag LOCUS_33430 22032 22583 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177743.1 protein_id gnl|my_center|LOCUS_33430 22710 24164 gene locus_tag LOCUS_33440 22710 24164 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056872.1 protein_id gnl|my_center|LOCUS_33440 24536 24225 gene locus_tag LOCUS_33450 24536 24225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 24983 25246 gene locus_tag LOCUS_33460 24983 25246 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403497.1 protein_id gnl|my_center|LOCUS_33460 25233 26126 gene locus_tag LOCUS_33470 gene hisG 25233 26126 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226744.1 protein_id gnl|my_center|LOCUS_33470 27068 26133 gene locus_tag LOCUS_33480 27068 26133 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854514.1 protein_id gnl|my_center|LOCUS_33480 28692 27304 gene locus_tag LOCUS_33490 28692 27304 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730828.1 protein_id gnl|my_center|LOCUS_33490 29930 28692 gene locus_tag LOCUS_33500 29930 28692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 30095 34705 gene locus_tag LOCUS_33510 gene gltB 30095 34705 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086150.1 protein_id gnl|my_center|LOCUS_33510 34716 36176 gene locus_tag LOCUS_33520 34716 36176 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062753.1 protein_id gnl|my_center|LOCUS_33520 36337 38127 gene locus_tag LOCUS_33530 36337 38127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 38130 38984 gene locus_tag LOCUS_33540 38130 38984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 39836 39030 gene locus_tag LOCUS_33550 39836 39030 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224750.1 protein_id gnl|my_center|LOCUS_33550 39909 40808 gene locus_tag LOCUS_33560 39909 40808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 42050 40815 gene locus_tag LOCUS_33570 42050 40815 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763226.1 protein_id gnl|my_center|LOCUS_33570 46378 42047 gene locus_tag LOCUS_33580 46378 42047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 46885 46499 gene locus_tag LOCUS_33590 46885 46499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 47645 46887 gene locus_tag LOCUS_33600 47645 46887 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878191.1 protein_id gnl|my_center|LOCUS_33600 47958 47695 gene locus_tag LOCUS_33610 47958 47695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 48985 48053 gene locus_tag LOCUS_33620 48985 48053 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028728.1 protein_id gnl|my_center|LOCUS_33620 49521 49024 gene locus_tag LOCUS_33630 49521 49024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 51293 49536 gene locus_tag LOCUS_33640 51293 49536 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729261.1 protein_id gnl|my_center|LOCUS_33640 51249 52052 gene locus_tag LOCUS_33650 51249 52052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 52139 53227 gene locus_tag LOCUS_33660 52139 53227 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230142.1 protein_id gnl|my_center|LOCUS_33660 55648 53261 gene locus_tag LOCUS_33670 55648 53261 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224401.1 protein_id gnl|my_center|LOCUS_33670 56721 55696 gene locus_tag LOCUS_33680 56721 55696 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_33680 57862 56723 gene locus_tag LOCUS_33690 57862 56723 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_33690 58866 57946 gene locus_tag LOCUS_33700 58866 57946 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085650.1 protein_id gnl|my_center|LOCUS_33700 59806 58859 gene locus_tag LOCUS_33710 59806 58859 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388735.1 protein_id gnl|my_center|LOCUS_33710 61493 59868 gene locus_tag LOCUS_33720 61493 59868 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583223.1 protein_id gnl|my_center|LOCUS_33720 62404 61712 gene locus_tag LOCUS_33730 gene rsmI 62404 61712 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804940.1 protein_id gnl|my_center|LOCUS_33730 63525 62431 gene locus_tag LOCUS_33740 63525 62431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 63407 64546 gene locus_tag LOCUS_33750 63407 64546 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462091.1 protein_id gnl|my_center|LOCUS_33750 64569 65363 gene locus_tag LOCUS_33760 64569 65363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 65438 66865 gene locus_tag LOCUS_33770 gene pyk 65438 66865 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393367.1 protein_id gnl|my_center|LOCUS_33770 66862 67980 gene locus_tag LOCUS_33780 66862 67980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 68026 69927 gene locus_tag LOCUS_33790 gene uvrC 68026 69927 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728800.1 protein_id gnl|my_center|LOCUS_33790 69985 70572 gene locus_tag LOCUS_33800 69985 70572 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989628.1 protein_id gnl|my_center|LOCUS_33800 70577 71428 gene locus_tag LOCUS_33810 70577 71428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 71507 72403 gene locus_tag LOCUS_33820 gene pdxS 71507 72403 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051767629.1 protein_id gnl|my_center|LOCUS_33820 72421 73023 gene locus_tag LOCUS_33830 gene pdxT 72421 73023 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888007.1 protein_id gnl|my_center|LOCUS_33830 73051 73803 gene locus_tag LOCUS_33840 73051 73803 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_33840 74423 73749 gene locus_tag LOCUS_33850 74423 73749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 74965 74420 gene locus_tag LOCUS_33860 74965 74420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 75351 74962 gene locus_tag LOCUS_33870 75351 74962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 75670 75356 gene locus_tag LOCUS_33880 75670 75356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 76251 75676 gene locus_tag LOCUS_33890 76251 75676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 76398 78620 gene locus_tag LOCUS_33900 76398 78620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 78748 79239 gene locus_tag LOCUS_33910 gene ruvC 78748 79239 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284467.1 protein_id gnl|my_center|LOCUS_33910 79236 79850 gene locus_tag LOCUS_33920 gene ruvA 79236 79850 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418603.1 protein_id gnl|my_center|LOCUS_33920 79853 80947 gene locus_tag LOCUS_33930 gene ruvB 79853 80947 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393202.1 protein_id gnl|my_center|LOCUS_33930 82709 80967 gene locus_tag LOCUS_33940 82709 80967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 84252 82702 gene locus_tag LOCUS_33950 84252 82702 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141135.1 protein_id gnl|my_center|LOCUS_33950 84251 84430 gene locus_tag LOCUS_33960 84251 84430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 84434 85528 gene locus_tag LOCUS_33970 gene queA 84434 85528 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393197.1 protein_id gnl|my_center|LOCUS_33970 85525 86622 gene locus_tag LOCUS_33980 gene tgt 85525 86622 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_33980 86753 87169 gene locus_tag LOCUS_33990 86753 87169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 87166 89076 gene locus_tag LOCUS_34000 gene secD 87166 89076 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805000.1 protein_id gnl|my_center|LOCUS_34000 89073 90206 gene locus_tag LOCUS_34010 gene secF 89073 90206 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977312.1 protein_id gnl|my_center|LOCUS_34010 90302 92548 gene locus_tag LOCUS_34020 gene relA 90302 92548 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 protein_id gnl|my_center|LOCUS_34020 97887 93730 gene locus_tag LOCUS_34030 97887 93730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 99672 97942 gene locus_tag LOCUS_34040 99672 97942 CDS product DUF3556 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407380.1 protein_id gnl|my_center|LOCUS_34040 99830 101629 gene locus_tag LOCUS_34050 gene aspS 99830 101629 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229758.1 protein_id gnl|my_center|LOCUS_34050 101626 102441 gene locus_tag LOCUS_34060 101626 102441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 102431 103807 gene locus_tag LOCUS_34070 102431 103807 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393158.1 protein_id gnl|my_center|LOCUS_34070 103804 104100 gene locus_tag LOCUS_34080 103804 104100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 104314 104697 gene locus_tag LOCUS_34090 104314 104697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 104741 105490 gene locus_tag LOCUS_34100 104741 105490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 105539 108130 gene locus_tag LOCUS_34110 gene alaS 105539 108130 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940824.1 protein_id gnl|my_center|LOCUS_34110 108127 108672 gene locus_tag LOCUS_34120 gene ruvX 108127 108672 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051736371.1 protein_id gnl|my_center|LOCUS_34120 108669 110165 gene locus_tag LOCUS_34130 108669 110165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 110185 111030 gene locus_tag LOCUS_34140 110185 111030 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892481.1 protein_id gnl|my_center|LOCUS_34140 111159 111659 gene locus_tag LOCUS_34150 111159 111659 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258976.1 protein_id gnl|my_center|LOCUS_34150 111656 112693 gene locus_tag LOCUS_34160 111656 112693 CDS product 3-dehydroquinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222554.1 protein_id gnl|my_center|LOCUS_34160 112680 113180 gene locus_tag LOCUS_34170 gene aroQ 112680 113180 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106162.1 protein_id gnl|my_center|LOCUS_34170 113247 113810 gene locus_tag LOCUS_34180 gene efp 113247 113810 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_34180 113803 114264 gene locus_tag LOCUS_34190 gene nusB 113803 114264 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728771.1 protein_id gnl|my_center|LOCUS_34190 114257 114862 gene locus_tag LOCUS_34200 gene pyrR 114257 114862 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257759.1 protein_id gnl|my_center|LOCUS_34200 114912 115865 gene locus_tag LOCUS_34210 114912 115865 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_34210 115993 117204 gene locus_tag LOCUS_34220 115993 117204 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082347.1 protein_id gnl|my_center|LOCUS_34220 117326 118408 gene locus_tag LOCUS_34230 gene carA 117326 118408 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660544.1 protein_id gnl|my_center|LOCUS_34230 118924 118436 gene locus_tag LOCUS_34240 118924 118436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 118942 119379 gene locus_tag LOCUS_34250 118942 119379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 119536 122937 gene locus_tag LOCUS_34260 gene carB 119536 122937 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141767.1 protein_id gnl|my_center|LOCUS_34260 122975 123874 gene locus_tag LOCUS_34270 122975 123874 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_34270 123887 124825 gene locus_tag LOCUS_34280 123887 124825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 124822 125733 gene locus_tag LOCUS_34290 124822 125733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 125792 126142 gene locus_tag LOCUS_34300 125792 126142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 126164 127429 gene locus_tag LOCUS_34310 gene coaBC 126164 127429 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485775.1 protein_id gnl|my_center|LOCUS_34310 127535 128731 gene locus_tag LOCUS_34320 gene metK 127535 128731 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977350.1 protein_id gnl|my_center|LOCUS_34320 128854 130623 gene locus_tag LOCUS_34330 128854 130623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 131206 130652 gene locus_tag LOCUS_34340 131206 130652 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804681.1 protein_id gnl|my_center|LOCUS_34340 131339 131911 gene locus_tag LOCUS_34350 gene def 131339 131911 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_34350 131908 132861 gene locus_tag LOCUS_34360 gene fmt 131908 132861 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064701.1 protein_id gnl|my_center|LOCUS_34360 132854 134020 gene locus_tag LOCUS_34370 132854 134020 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228244.1 protein_id gnl|my_center|LOCUS_34370 134128 134655 gene locus_tag LOCUS_34380 134128 134655 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227870.1 protein_id gnl|my_center|LOCUS_34380 134666 135751 gene locus_tag LOCUS_34390 gene ribD 134666 135751 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082329.1 protein_id gnl|my_center|LOCUS_34390 135756 136370 gene locus_tag LOCUS_34400 135756 136370 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803670.1 protein_id gnl|my_center|LOCUS_34400 136367 137632 gene locus_tag LOCUS_34410 136367 137632 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224641.1 protein_id gnl|my_center|LOCUS_34410 137629 138114 gene locus_tag LOCUS_34420 gene ribH 137629 138114 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223915.1 protein_id gnl|my_center|LOCUS_34420 140371 138128 gene locus_tag LOCUS_34430 140371 138128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 140544 141980 gene locus_tag LOCUS_34440 140544 141980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 141977 142237 gene locus_tag LOCUS_34450 141977 142237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 142338 143555 gene locus_tag LOCUS_34460 142338 143555 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031025.1 protein_id gnl|my_center|LOCUS_34460 144655 143840 gene locus_tag LOCUS_34470 144655 143840 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977024.1 protein_id gnl|my_center|LOCUS_34470 144842 145510 gene locus_tag LOCUS_34480 gene npdG 144842 145510 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878704.1 protein_id gnl|my_center|LOCUS_34480 145523 146641 gene locus_tag LOCUS_34490 gene cysS 145523 146641 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256641.1 protein_id gnl|my_center|LOCUS_34490 146842 147885 gene locus_tag LOCUS_34500 146842 147885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 148008 150059 gene locus_tag LOCUS_34510 gene thrS 148008 150059 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977296.1 protein_id gnl|my_center|LOCUS_34510 150056 150586 gene locus_tag LOCUS_34520 150056 150586 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403826.1 protein_id gnl|my_center|LOCUS_34520 150591 151118 gene locus_tag LOCUS_34530 150591 151118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 151184 151876 gene locus_tag LOCUS_34540 gene pgsA 151184 151876 CDS product archaetidylinositol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061121.1 protein_id gnl|my_center|LOCUS_34540 151921 152874 gene locus_tag LOCUS_34550 151921 152874 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 protein_id gnl|my_center|LOCUS_34550 152885 153466 gene locus_tag LOCUS_34560 152885 153466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34560 153348 153977 gene locus_tag LOCUS_34570 153348 153977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34570 154049 155215 gene locus_tag LOCUS_34580 gene trpB 154049 155215 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124343.1 protein_id gnl|my_center|LOCUS_34580 155212 156030 gene locus_tag LOCUS_34590 gene trpA 155212 156030 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976780.1 protein_id gnl|my_center|LOCUS_34590 156322 156612 gene locus_tag LOCUS_34600 156322 156612 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003950507.1 protein_id gnl|my_center|LOCUS_34600 156944 157026 gene locus_tag LOCUS_t00470 156944 157026 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 158517 157027 gene locus_tag LOCUS_34610 158517 157027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 159128 159295 gene locus_tag LOCUS_34620 159128 159295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 159827 159582 gene locus_tag LOCUS_34630 159827 159582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 160427 160158 gene locus_tag LOCUS_34640 160427 160158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 160890 160591 gene locus_tag LOCUS_34650 160890 160591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 161363 160887 gene locus_tag LOCUS_34660 161363 160887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 >Feature sequence08 3176 3388 gene locus_tag LOCUS_34670 3176 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 4090 5403 gene locus_tag LOCUS_34680 4090 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34680 5297 5872 gene locus_tag LOCUS_34690 5297 5872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34690 6047 7102 gene locus_tag LOCUS_34700 gene hrcA 6047 7102 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123574708.1 protein_id gnl|my_center|LOCUS_34700 7352 8347 gene locus_tag LOCUS_34710 gene dnaJ 7352 8347 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976250.1 protein_id gnl|my_center|LOCUS_34710 8385 8858 gene locus_tag LOCUS_34720 8385 8858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34720 8846 9145 gene locus_tag LOCUS_34730 8846 9145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 9468 9782 gene locus_tag LOCUS_34740 9468 9782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 10045 10929 gene locus_tag LOCUS_34750 10045 10929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 12187 10982 gene locus_tag LOCUS_34760 gene menC 12187 10982 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225317.1 protein_id gnl|my_center|LOCUS_34760 14227 12239 gene locus_tag LOCUS_34770 14227 12239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 14798 14343 gene locus_tag LOCUS_34780 14798 14343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 15277 14822 gene locus_tag LOCUS_34790 15277 14822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 15621 15289 gene locus_tag LOCUS_34800 15621 15289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 15953 15705 gene locus_tag LOCUS_34810 15953 15705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 16910 16017 gene locus_tag LOCUS_34820 16910 16017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 17791 16907 gene locus_tag LOCUS_34830 17791 16907 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776057.1 protein_id gnl|my_center|LOCUS_34830 19266 17788 gene locus_tag LOCUS_34840 19266 17788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 20603 19263 gene locus_tag LOCUS_34850 20603 19263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 21258 20596 gene locus_tag LOCUS_34860 21258 20596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 21803 23440 gene locus_tag LOCUS_34870 21803 23440 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110588.1 protein_id gnl|my_center|LOCUS_34870 23505 24347 gene locus_tag LOCUS_34880 23505 24347 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256115.1 protein_id gnl|my_center|LOCUS_34880 24340 24975 gene locus_tag LOCUS_34890 24340 24975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 25051 25965 gene locus_tag LOCUS_34900 25051 25965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 25962 27128 gene locus_tag LOCUS_34910 25962 27128 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195328.1 protein_id gnl|my_center|LOCUS_34910 27278 28156 gene locus_tag LOCUS_34920 gene dapA 27278 28156 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392582.1 protein_id gnl|my_center|LOCUS_34920 28217 29878 gene locus_tag LOCUS_34930 28217 29878 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943734.1 protein_id gnl|my_center|LOCUS_34930 29892 30581 gene locus_tag LOCUS_34940 29892 30581 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083661.1 protein_id gnl|my_center|LOCUS_34940 30572 30934 gene locus_tag LOCUS_34950 30572 30934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 31602 31036 gene locus_tag LOCUS_34960 31602 31036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 32106 31636 gene locus_tag LOCUS_34970 32106 31636 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978225.1 protein_id gnl|my_center|LOCUS_34970 32424 34736 gene locus_tag LOCUS_34980 32424 34736 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113701643.1 protein_id gnl|my_center|LOCUS_34980 34821 36236 gene locus_tag LOCUS_34990 gene rimO 34821 36236 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257724.1 protein_id gnl|my_center|LOCUS_34990 36229 36843 gene locus_tag LOCUS_35000 gene pgsA 36229 36843 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389876.1 protein_id gnl|my_center|LOCUS_35000 36896 37765 gene locus_tag LOCUS_35010 36896 37765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 37894 39135 gene locus_tag LOCUS_35020 37894 39135 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142436.1 protein_id gnl|my_center|LOCUS_35020 39132 40694 gene locus_tag LOCUS_35030 gene murL 39132 40694 CDS product UDP-N-acetyl-alpha-D-muramoyl-L-alanyl-L-glutamate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037869.1 protein_id gnl|my_center|LOCUS_35030 40703 42124 gene locus_tag LOCUS_35040 gene murD 40703 42124 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014923.1 protein_id gnl|my_center|LOCUS_35040 42581 42111 gene locus_tag LOCUS_35050 42581 42111 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065587.1 protein_id gnl|my_center|LOCUS_35050 42857 43942 gene locus_tag LOCUS_35060 gene recA 42857 43942 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224217.1 protein_id gnl|my_center|LOCUS_35060 44959 43988 gene locus_tag LOCUS_35070 gene fdhD 44959 43988 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228505.1 protein_id gnl|my_center|LOCUS_35070 45158 46024 gene locus_tag LOCUS_35080 45158 46024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 47292 46021 gene locus_tag LOCUS_35090 47292 46021 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931796.1 protein_id gnl|my_center|LOCUS_35090 47390 47773 gene locus_tag LOCUS_35100 47390 47773 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080328.1 protein_id gnl|my_center|LOCUS_35100 49987 47804 gene locus_tag LOCUS_35110 49987 47804 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938554.1 protein_id gnl|my_center|LOCUS_35110 50149 51648 gene locus_tag LOCUS_35120 gene miaB 50149 51648 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037471.1 protein_id gnl|my_center|LOCUS_35120 51645 52373 gene locus_tag LOCUS_35130 51645 52373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 52521 53231 gene locus_tag LOCUS_35140 52521 53231 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399592.1 protein_id gnl|my_center|LOCUS_35140 53228 55771 gene locus_tag LOCUS_35150 53228 55771 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222778.1 protein_id gnl|my_center|LOCUS_35150 55909 56901 gene locus_tag LOCUS_35160 gene miaA 55909 56901 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030456.1 protein_id gnl|my_center|LOCUS_35160 56914 57717 gene locus_tag LOCUS_35170 gene dapF 56914 57717 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944873.1 protein_id gnl|my_center|LOCUS_35170 57714 59162 gene locus_tag LOCUS_35180 gene hflX 57714 59162 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413984.1 protein_id gnl|my_center|LOCUS_35180 59194 60291 gene locus_tag LOCUS_35190 gene dapC 59194 60291 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730331.1 protein_id gnl|my_center|LOCUS_35190 60355 61008 gene locus_tag LOCUS_35200 60355 61008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 61074 61787 gene locus_tag LOCUS_35210 61074 61787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 61744 62877 gene locus_tag LOCUS_35220 gene dapE 61744 62877 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222942.1 protein_id gnl|my_center|LOCUS_35220 62979 64052 gene locus_tag LOCUS_35230 gene dapD 62979 64052 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976903.1 protein_id gnl|my_center|LOCUS_35230 64781 64083 gene locus_tag LOCUS_35240 gene lexA 64781 64083 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899448.1 protein_id gnl|my_center|LOCUS_35240 65004 65540 gene locus_tag LOCUS_35250 65004 65540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 65715 66041 gene locus_tag LOCUS_35260 65715 66041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 66795 66043 gene locus_tag LOCUS_35270 66795 66043 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030623.1 protein_id gnl|my_center|LOCUS_35270 67342 70107 gene locus_tag LOCUS_35280 67342 70107 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224267.1 protein_id gnl|my_center|LOCUS_35280 70325 70828 gene locus_tag LOCUS_35290 70325 70828 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853867.1 protein_id gnl|my_center|LOCUS_35290 70841 71905 gene locus_tag LOCUS_35300 70841 71905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 72711 71950 gene locus_tag LOCUS_35310 72711 71950 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411619.1 protein_id gnl|my_center|LOCUS_35310 72889 74058 gene locus_tag LOCUS_35320 72889 74058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 74199 76439 gene locus_tag LOCUS_35330 74199 76439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 76381 76932 gene locus_tag LOCUS_35340 76381 76932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 77298 77531 gene locus_tag LOCUS_35350 77298 77531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 78678 78220 gene locus_tag LOCUS_35360 78678 78220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 78994 78605 gene locus_tag LOCUS_35370 78994 78605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 79889 79380 gene locus_tag LOCUS_35380 79889 79380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 80137 81429 gene locus_tag LOCUS_35390 80137 81429 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229667.1 protein_id gnl|my_center|LOCUS_35390 81426 82592 gene locus_tag LOCUS_35400 81426 82592 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921004.1 protein_id gnl|my_center|LOCUS_35400 82580 83383 gene locus_tag LOCUS_35410 82580 83383 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283913.1 protein_id gnl|my_center|LOCUS_35410 83494 84618 gene locus_tag LOCUS_35420 83494 84618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 84661 84736 gene locus_tag LOCUS_t00480 84661 84736 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 84809 86440 gene locus_tag LOCUS_35430 84809 86440 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899914.1 protein_id gnl|my_center|LOCUS_35430 86509 86581 gene locus_tag LOCUS_t00490 86509 86581 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 86722 87852 gene locus_tag LOCUS_35440 86722 87852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 87910 87984 gene locus_tag LOCUS_t00500 87910 87984 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 88653 88003 gene locus_tag LOCUS_35450 88653 88003 CDS product DUF2064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870668.1 protein_id gnl|my_center|LOCUS_35450 89338 88646 gene locus_tag LOCUS_35460 89338 88646 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029202.1 protein_id gnl|my_center|LOCUS_35460 89383 90468 gene locus_tag LOCUS_35470 89383 90468 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284184.1 protein_id gnl|my_center|LOCUS_35470 90546 91859 gene locus_tag LOCUS_35480 90546 91859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230051.1 protein_id gnl|my_center|LOCUS_35480 91871 92893 gene locus_tag LOCUS_35490 91871 92893 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400489.1 protein_id gnl|my_center|LOCUS_35490 93070 92879 gene locus_tag LOCUS_35500 93070 92879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 93095 94384 gene locus_tag LOCUS_35510 gene hisD 93095 94384 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058085.1 protein_id gnl|my_center|LOCUS_35510 94381 95469 gene locus_tag LOCUS_35520 94381 95469 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976762.1 protein_id gnl|my_center|LOCUS_35520 95514 96437 gene locus_tag LOCUS_35530 95514 96437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 97323 96439 gene locus_tag LOCUS_35540 97323 96439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 98747 97320 gene locus_tag LOCUS_35550 98747 97320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 99237 98791 gene locus_tag LOCUS_35560 99237 98791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 99376 99948 gene locus_tag LOCUS_35570 gene hisB 99376 99948 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976763.1 protein_id gnl|my_center|LOCUS_35570 99945 100571 gene locus_tag LOCUS_35580 gene hisH 99945 100571 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877134.1 protein_id gnl|my_center|LOCUS_35580 100568 101359 gene locus_tag LOCUS_35590 gene hisF 100568 101359 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817210.1 protein_id gnl|my_center|LOCUS_35590 101483 103345 gene locus_tag LOCUS_35600 101483 103345 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_35600 103342 104376 gene locus_tag LOCUS_35610 103342 104376 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_35610 104408 104770 gene locus_tag LOCUS_35620 104408 104770 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975911.1 protein_id gnl|my_center|LOCUS_35620 104767 105099 gene locus_tag LOCUS_35630 gene hisI 104767 105099 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403778.1 protein_id gnl|my_center|LOCUS_35630 105099 106685 gene locus_tag LOCUS_35640 105099 106685 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976773.1 protein_id gnl|my_center|LOCUS_35640 106806 108326 gene locus_tag LOCUS_35650 gene nirK 106806 108326 CDS product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225006.1 protein_id gnl|my_center|LOCUS_35650 108502 109950 gene locus_tag LOCUS_35660 108502 109950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 109932 111119 gene locus_tag LOCUS_35670 109932 111119 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087559.1 protein_id gnl|my_center|LOCUS_35670 111242 112369 gene locus_tag LOCUS_35680 111242 112369 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225242.1 protein_id gnl|my_center|LOCUS_35680 113945 112392 gene locus_tag LOCUS_35690 113945 112392 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173812.1 protein_id gnl|my_center|LOCUS_35690 114208 115224 gene locus_tag LOCUS_35700 114208 115224 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964801.1 protein_id gnl|my_center|LOCUS_35700 115617 116597 gene locus_tag LOCUS_35710 115617 116597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 116932 116744 gene locus_tag LOCUS_35720 116932 116744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 116867 118048 gene locus_tag LOCUS_35730 116867 118048 CDS product NAD/FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388481.1 protein_id gnl|my_center|LOCUS_35730 118045 118923 gene locus_tag LOCUS_35740 118045 118923 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971978.1 protein_id gnl|my_center|LOCUS_35740 118920 120125 gene locus_tag LOCUS_35750 118920 120125 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640238.1 protein_id gnl|my_center|LOCUS_35750 120681 120235 gene locus_tag LOCUS_35760 gene rpiB 120681 120235 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546357.1 protein_id gnl|my_center|LOCUS_35760 121428 120715 gene locus_tag LOCUS_35770 121428 120715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35770 122088 121534 gene locus_tag LOCUS_35780 122088 121534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 122229 122882 gene locus_tag LOCUS_35790 122229 122882 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_35790 122896 123624 gene locus_tag LOCUS_35800 gene deoC 122896 123624 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049234098.1 protein_id gnl|my_center|LOCUS_35800 123621 124955 gene locus_tag LOCUS_35810 123621 124955 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030612.1 protein_id gnl|my_center|LOCUS_35810 126613 125006 gene locus_tag LOCUS_35820 126613 125006 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729267.1 protein_id gnl|my_center|LOCUS_35820 127494 126616 gene locus_tag LOCUS_35830 127494 126616 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726959.1 protein_id gnl|my_center|LOCUS_35830 128497 127598 gene locus_tag LOCUS_35840 gene fadH 128497 127598 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660904.1 protein_id gnl|my_center|LOCUS_35840 129279 128500 gene locus_tag LOCUS_35850 129279 128500 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_35850 131345 129276 gene locus_tag LOCUS_35860 131345 129276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 131446 132201 gene locus_tag LOCUS_35870 131446 132201 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973175.1 protein_id gnl|my_center|LOCUS_35870 132198 133001 gene locus_tag LOCUS_35880 132198 133001 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969706.1 protein_id gnl|my_center|LOCUS_35880 132998 133858 gene locus_tag LOCUS_35890 gene rapZ 132998 133858 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_35890 133915 134850 gene locus_tag LOCUS_35900 gene yvcK 133915 134850 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907802.1 protein_id gnl|my_center|LOCUS_35900 134953 135960 gene locus_tag LOCUS_35910 gene gap 134953 135960 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_35910 135967 137130 gene locus_tag LOCUS_35920 135967 137130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 137187 137960 gene locus_tag LOCUS_35930 gene tpiA 137187 137960 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 protein_id gnl|my_center|LOCUS_35930 138009 138239 gene locus_tag LOCUS_35940 gene secG 138009 138239 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325957.1 protein_id gnl|my_center|LOCUS_35940 138334 138630 gene locus_tag LOCUS_35950 138334 138630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 138674 139279 gene locus_tag LOCUS_35960 138674 139279 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227937.1 protein_id gnl|my_center|LOCUS_35960 139550 141985 gene locus_tag LOCUS_35970 gene polA 139550 141985 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467407.1 protein_id gnl|my_center|LOCUS_35970 142622 142119 gene locus_tag LOCUS_35980 142622 142119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 142660 143301 gene locus_tag LOCUS_35990 142660 143301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35990 143199 143657 gene locus_tag LOCUS_36000 143199 143657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36000 143919 144920 gene locus_tag LOCUS_36010 143919 144920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36010 144911 145267 gene locus_tag LOCUS_36020 144911 145267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36020 145679 145311 gene locus_tag LOCUS_36030 145679 145311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36030 146472 145726 gene locus_tag LOCUS_36040 146472 145726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36040 146887 146585 gene locus_tag LOCUS_36050 146887 146585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 147174 148166 gene locus_tag LOCUS_36060 147174 148166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36060 148764 148186 gene locus_tag LOCUS_36070 148764 148186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 149318 148713 gene locus_tag LOCUS_36080 149318 148713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36080 149549 150196 gene locus_tag LOCUS_36090 149549 150196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 150266 150342 gene locus_tag LOCUS_t00510 150266 150342 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 152176 150299 gene locus_tag LOCUS_36100 152176 150299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 152796 152173 gene locus_tag LOCUS_36110 152796 152173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 153218 152793 gene locus_tag LOCUS_36120 153218 152793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 153579 153400 gene locus_tag LOCUS_36130 153579 153400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 154059 153820 gene locus_tag LOCUS_36140 154059 153820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 154691 154428 gene locus_tag LOCUS_36150 154691 154428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 155049 154828 gene locus_tag LOCUS_36160 155049 154828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 154933 155814 gene locus_tag LOCUS_36170 154933 155814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 156144 155950 gene locus_tag LOCUS_36180 156144 155950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 156139 156360 gene locus_tag LOCUS_36190 156139 156360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 158962 158777 gene locus_tag LOCUS_36200 158962 158777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 >Feature sequence09 1852 2493 gene locus_tag LOCUS_36210 1852 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 2447 2647 gene locus_tag LOCUS_36220 2447 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 2729 3175 gene locus_tag LOCUS_36230 2729 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 3144 3293 gene locus_tag LOCUS_36240 3144 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 3570 3845 gene locus_tag LOCUS_36250 3570 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 5301 4909 gene locus_tag LOCUS_36260 5301 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 5875 5438 gene locus_tag LOCUS_36270 5875 5438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 7092 5890 gene locus_tag LOCUS_36280 7092 5890 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414142.1 protein_id gnl|my_center|LOCUS_36280 7287 7496 gene locus_tag LOCUS_36290 7287 7496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 7884 8273 gene locus_tag LOCUS_36300 7884 8273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 9759 8263 gene locus_tag LOCUS_36310 9759 8263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 9914 10561 gene locus_tag LOCUS_36320 9914 10561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 10776 11792 gene locus_tag LOCUS_36330 10776 11792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 11824 13086 gene locus_tag LOCUS_36340 11824 13086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 13158 13604 gene locus_tag LOCUS_36350 13158 13604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 13617 14348 gene locus_tag LOCUS_36360 13617 14348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 14558 14992 gene locus_tag LOCUS_36370 14558 14992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 14965 16212 gene locus_tag LOCUS_36380 14965 16212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 16752 16222 gene locus_tag LOCUS_36390 16752 16222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 17806 19092 gene locus_tag LOCUS_36400 17806 19092 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917061.1 protein_id gnl|my_center|LOCUS_36400 19606 19899 gene locus_tag LOCUS_36410 19606 19899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36410 20230 20009 gene locus_tag LOCUS_36420 20230 20009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 20302 21093 gene locus_tag LOCUS_36430 20302 21093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 21426 22808 gene locus_tag LOCUS_36440 21426 22808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 22753 23343 gene locus_tag LOCUS_36450 22753 23343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 23996 24640 gene locus_tag LOCUS_36460 23996 24640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 25738 25247 gene locus_tag LOCUS_36470 25738 25247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 26607 26191 gene locus_tag LOCUS_36480 26607 26191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 27510 27638 gene locus_tag LOCUS_36490 27510 27638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 30132 27898 gene locus_tag LOCUS_36500 30132 27898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 30871 30317 gene locus_tag LOCUS_36510 30871 30317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 31014 31646 gene locus_tag LOCUS_36520 31014 31646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 31774 33291 gene locus_tag LOCUS_36530 31774 33291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 33703 33266 gene locus_tag LOCUS_36540 33703 33266 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467525.1 protein_id gnl|my_center|LOCUS_36540 34605 33700 gene locus_tag LOCUS_36550 34605 33700 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228576.1 protein_id gnl|my_center|LOCUS_36550 35855 34629 gene locus_tag LOCUS_36560 35855 34629 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419982.1 protein_id gnl|my_center|LOCUS_36560 36792 35890 gene locus_tag LOCUS_36570 36792 35890 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230200.1 protein_id gnl|my_center|LOCUS_36570 37238 36840 gene locus_tag LOCUS_36580 37238 36840 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230457.1 protein_id gnl|my_center|LOCUS_36580 37497 38012 gene locus_tag LOCUS_36590 37497 38012 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031511861.1 protein_id gnl|my_center|LOCUS_36590 38140 39699 gene locus_tag LOCUS_36600 38140 39699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 40602 39733 gene locus_tag LOCUS_36610 40602 39733 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_36610 41795 40668 gene locus_tag LOCUS_36620 41795 40668 CDS product 23S rRNA (cytosine(2499)-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886697.1 protein_id gnl|my_center|LOCUS_36620 41965 42678 gene locus_tag LOCUS_36630 41965 42678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 42678 43499 gene locus_tag LOCUS_36640 42678 43499 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020166.1 protein_id gnl|my_center|LOCUS_36640 43765 45018 gene locus_tag LOCUS_36650 43765 45018 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144955419.1 protein_id gnl|my_center|LOCUS_36650 45226 45026 gene locus_tag LOCUS_36660 45226 45026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 45379 45711 gene locus_tag LOCUS_36670 45379 45711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 46242 47438 gene locus_tag LOCUS_36680 46242 47438 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257896.1 protein_id gnl|my_center|LOCUS_36680 47832 47605 gene locus_tag LOCUS_36690 47832 47605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 48242 47844 gene locus_tag LOCUS_36700 48242 47844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 48744 48671 gene locus_tag LOCUS_t00520 48744 48671 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 48878 49630 gene locus_tag LOCUS_36710 48878 49630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 49698 50960 gene locus_tag LOCUS_36720 gene lysA 49698 50960 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030202.1 protein_id gnl|my_center|LOCUS_36720 51140 52399 gene locus_tag LOCUS_36730 51140 52399 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_36730 52457 53845 gene locus_tag LOCUS_36740 gene thrC 52457 53845 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390981.1 protein_id gnl|my_center|LOCUS_36740 53853 55040 gene locus_tag LOCUS_36750 53853 55040 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942463.1 protein_id gnl|my_center|LOCUS_36750 55037 55585 gene locus_tag LOCUS_36760 55037 55585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 56005 57615 gene locus_tag LOCUS_36770 56005 57615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36770 57770 58054 gene locus_tag LOCUS_36780 57770 58054 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193070.1 protein_id gnl|my_center|LOCUS_36780 58094 59260 gene locus_tag LOCUS_36790 58094 59260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 59270 60340 gene locus_tag LOCUS_36800 gene prfA 59270 60340 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869569.1 protein_id gnl|my_center|LOCUS_36800 60337 61302 gene locus_tag LOCUS_36810 gene prmC 60337 61302 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036071.1 protein_id gnl|my_center|LOCUS_36810 61310 61981 gene locus_tag LOCUS_36820 61310 61981 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041322625.1 protein_id gnl|my_center|LOCUS_36820 62037 62471 gene locus_tag LOCUS_36830 62037 62471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 62578 63414 gene locus_tag LOCUS_36840 62578 63414 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056709.1 protein_id gnl|my_center|LOCUS_36840 64970 63498 gene locus_tag LOCUS_36850 64970 63498 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112031.1 protein_id gnl|my_center|LOCUS_36850 65166 65603 gene locus_tag LOCUS_36860 gene rpiB 65166 65603 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161952859.1 protein_id gnl|my_center|LOCUS_36860 65707 66960 gene locus_tag LOCUS_36870 65707 66960 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_36870 67008 68219 gene locus_tag LOCUS_36880 67008 68219 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113078.1 protein_id gnl|my_center|LOCUS_36880 69223 68240 gene locus_tag LOCUS_36890 69223 68240 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056930.1 protein_id gnl|my_center|LOCUS_36890 70013 69273 gene locus_tag LOCUS_36900 70013 69273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 71742 70027 gene locus_tag LOCUS_36910 71742 70027 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926642.1 protein_id gnl|my_center|LOCUS_36910 71953 73413 gene locus_tag LOCUS_36920 71953 73413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 73495 75951 gene locus_tag LOCUS_36930 73495 75951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 75948 76664 gene locus_tag LOCUS_36940 75948 76664 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942376.1 protein_id gnl|my_center|LOCUS_36940 76667 77416 gene locus_tag LOCUS_36950 76667 77416 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887677.1 protein_id gnl|my_center|LOCUS_36950 77439 77894 gene locus_tag LOCUS_36960 77439 77894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 78195 78458 gene locus_tag LOCUS_36970 78195 78458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 78455 79030 gene locus_tag LOCUS_36980 78455 79030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 79047 79880 gene locus_tag LOCUS_36990 gene atpB 79047 79880 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775944.1 protein_id gnl|my_center|LOCUS_36990 80000 80305 gene locus_tag LOCUS_37000 80000 80305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 80371 80910 gene locus_tag LOCUS_37010 80371 80910 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819064.1 protein_id gnl|my_center|LOCUS_37010 80920 81453 gene locus_tag LOCUS_37020 80920 81453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 81463 81990 gene locus_tag LOCUS_37030 81463 81990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 82098 83744 gene locus_tag LOCUS_37040 gene atpA 82098 83744 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084634.1 protein_id gnl|my_center|LOCUS_37040 83748 84734 gene locus_tag LOCUS_37050 83748 84734 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896329.1 protein_id gnl|my_center|LOCUS_37050 84808 86283 gene locus_tag LOCUS_37060 gene atpD 84808 86283 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004120484.1 protein_id gnl|my_center|LOCUS_37060 86286 86699 gene locus_tag LOCUS_37070 86286 86699 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973623.1 protein_id gnl|my_center|LOCUS_37070 86831 87493 gene locus_tag LOCUS_37080 86831 87493 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229801.1 protein_id gnl|my_center|LOCUS_37080 87540 88370 gene locus_tag LOCUS_37090 87540 88370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 89207 88401 gene locus_tag LOCUS_37100 89207 88401 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886780.1 protein_id gnl|my_center|LOCUS_37100 90280 89309 gene locus_tag LOCUS_37110 gene glpX 90280 89309 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742217.1 protein_id gnl|my_center|LOCUS_37110 90384 91349 gene locus_tag LOCUS_37120 90384 91349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 91414 92118 gene locus_tag LOCUS_37130 91414 92118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 92135 92701 gene locus_tag LOCUS_37140 92135 92701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 93569 92751 gene locus_tag LOCUS_37150 93569 92751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 94321 93620 gene locus_tag LOCUS_37160 94321 93620 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110163.1 protein_id gnl|my_center|LOCUS_37160 95930 94371 gene locus_tag LOCUS_37170 95930 94371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 95954 96247 gene locus_tag LOCUS_37180 95954 96247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 96294 97328 gene locus_tag LOCUS_37190 gene meaB 96294 97328 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223478.1 protein_id gnl|my_center|LOCUS_37190 97418 98950 gene locus_tag LOCUS_37200 97418 98950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 99048 99869 gene locus_tag LOCUS_37210 99048 99869 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030262.1 protein_id gnl|my_center|LOCUS_37210 99869 101173 gene locus_tag LOCUS_37220 gene mak 99869 101173 CDS product maltokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003916610.1 protein_id gnl|my_center|LOCUS_37220 102471 101215 gene locus_tag LOCUS_37230 102471 101215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225785.1 protein_id gnl|my_center|LOCUS_37230 103675 104412 gene locus_tag LOCUS_37240 103675 104412 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975079.1 protein_id gnl|my_center|LOCUS_37240 104870 104421 gene locus_tag LOCUS_37250 104870 104421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 104930 105868 gene locus_tag LOCUS_37260 104930 105868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 105859 106569 gene locus_tag LOCUS_37270 105859 106569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 106566 107771 gene locus_tag LOCUS_37280 106566 107771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 107683 108705 gene locus_tag LOCUS_37290 107683 108705 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223047.1 protein_id gnl|my_center|LOCUS_37290 108709 110031 gene locus_tag LOCUS_37300 108709 110031 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731131.1 protein_id gnl|my_center|LOCUS_37300 111088 110009 gene locus_tag LOCUS_37310 111088 110009 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731132.1 protein_id gnl|my_center|LOCUS_37310 111059 112069 gene locus_tag LOCUS_37320 111059 112069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 112057 113319 gene locus_tag LOCUS_37330 gene nifS 112057 113319 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_37330 113316 114404 gene locus_tag LOCUS_37340 gene mnmA 113316 114404 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093979.1 protein_id gnl|my_center|LOCUS_37340 114514 115167 gene locus_tag LOCUS_37350 114514 115167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 115164 115787 gene locus_tag LOCUS_37360 115164 115787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 116834 115845 gene locus_tag LOCUS_37370 116834 115845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 116888 117610 gene locus_tag LOCUS_37380 116888 117610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 117607 119700 gene locus_tag LOCUS_37390 gene ligA 117607 119700 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256150.1 protein_id gnl|my_center|LOCUS_37390 119697 120362 gene locus_tag LOCUS_37400 119697 120362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 120828 120376 gene locus_tag LOCUS_37410 120828 120376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 120988 122949 gene locus_tag LOCUS_37420 120988 122949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 123937 122972 gene locus_tag LOCUS_37430 123937 122972 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173531.1 protein_id gnl|my_center|LOCUS_37430 124422 123985 gene locus_tag LOCUS_37440 124422 123985 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118641.1 protein_id gnl|my_center|LOCUS_37440 124571 125656 gene locus_tag LOCUS_37450 124571 125656 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222030.1 protein_id gnl|my_center|LOCUS_37450 125707 126546 gene locus_tag LOCUS_37460 125707 126546 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222029.1 protein_id gnl|my_center|LOCUS_37460 126910 127227 gene locus_tag LOCUS_37470 gene gatC 126910 127227 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933493.1 protein_id gnl|my_center|LOCUS_37470 127224 128690 gene locus_tag LOCUS_37480 gene gatA 127224 128690 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920797.1 protein_id gnl|my_center|LOCUS_37480 128687 130168 gene locus_tag LOCUS_37490 gene gatB 128687 130168 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854737.1 protein_id gnl|my_center|LOCUS_37490 130104 130847 gene locus_tag LOCUS_37500 130104 130847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 130844 131185 gene locus_tag LOCUS_37510 130844 131185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 131346 131675 gene locus_tag LOCUS_37520 131346 131675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 131775 133196 gene locus_tag LOCUS_37530 131775 133196 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730431.1 protein_id gnl|my_center|LOCUS_37530 133189 134382 gene locus_tag LOCUS_37540 133189 134382 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229838.1 protein_id gnl|my_center|LOCUS_37540 134887 134408 gene locus_tag LOCUS_37550 134887 134408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 135728 134793 gene locus_tag LOCUS_37560 135728 134793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 136069 135656 gene locus_tag LOCUS_37570 136069 135656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 136950 136069 gene locus_tag LOCUS_37580 136950 136069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804978.1 protein_id gnl|my_center|LOCUS_37580 137204 138127 gene locus_tag LOCUS_37590 137204 138127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 138201 138440 gene locus_tag LOCUS_37600 138201 138440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 138673 138972 gene locus_tag LOCUS_37610 138673 138972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 139299 139676 gene locus_tag LOCUS_37620 139299 139676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 140538 139612 gene locus_tag LOCUS_37630 140538 139612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 140692 142227 gene locus_tag LOCUS_37640 140692 142227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37640 142203 142871 gene locus_tag LOCUS_37650 142203 142871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37650 143211 142849 gene locus_tag LOCUS_37660 143211 142849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 144279 143503 gene locus_tag LOCUS_37670 144279 143503 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030941.1 protein_id gnl|my_center|LOCUS_37670 144445 144570 gene locus_tag LOCUS_37680 144445 144570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 144951 145616 gene locus_tag LOCUS_37690 gene thiF 144951 145616 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880850.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37690 146835 145621 gene locus_tag LOCUS_37700 146835 145621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 147395 146796 gene locus_tag LOCUS_37710 147395 146796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 148217 147645 gene locus_tag LOCUS_37720 148217 147645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 148345 148797 gene locus_tag LOCUS_37730 148345 148797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37730 148724 149056 gene locus_tag LOCUS_37740 148724 149056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37740 149035 149193 gene locus_tag LOCUS_37750 149035 149193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 149447 149746 gene locus_tag LOCUS_37760 149447 149746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 149875 150210 gene locus_tag LOCUS_37770 149875 150210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37770 150456 150647 gene locus_tag LOCUS_37780 150456 150647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 151022 150681 gene locus_tag LOCUS_37790 151022 150681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 >Feature sequence10 1737 2138 gene locus_tag LOCUS_37800 1737 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 2578 3027 gene locus_tag LOCUS_37810 2578 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37810 3024 3617 gene locus_tag LOCUS_37820 3024 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 3625 4758 gene locus_tag LOCUS_37830 3625 4758 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224427.1 protein_id gnl|my_center|LOCUS_37830 4755 5687 gene locus_tag LOCUS_37840 4755 5687 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897320.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37840 5639 5923 gene locus_tag LOCUS_37850 5639 5923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37850 5985 6326 gene locus_tag LOCUS_37860 5985 6326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 6446 6847 gene locus_tag LOCUS_37870 6446 6847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 6844 7158 gene locus_tag LOCUS_37880 6844 7158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37880 7107 7394 gene locus_tag LOCUS_37890 7107 7394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37890 7664 8131 gene locus_tag LOCUS_37900 7664 8131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 8470 8546 gene locus_tag LOCUS_t00530 8470 8546 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8709 9068 gene locus_tag LOCUS_37910 8709 9068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 9095 9619 gene locus_tag LOCUS_37920 9095 9619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 9816 10952 gene locus_tag LOCUS_37930 9816 10952 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_37930 11236 10886 gene locus_tag LOCUS_37940 11236 10886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 11521 11793 gene locus_tag LOCUS_37950 11521 11793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413719.1 protein_id gnl|my_center|LOCUS_37950 12017 12646 gene locus_tag LOCUS_37960 12017 12646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 12788 13183 gene locus_tag LOCUS_37970 12788 13183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 13871 13206 gene locus_tag LOCUS_37980 13871 13206 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179719124.1 protein_id gnl|my_center|LOCUS_37980 13969 15009 gene locus_tag LOCUS_37990 13969 15009 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223904.1 protein_id gnl|my_center|LOCUS_37990 15045 16121 gene locus_tag LOCUS_38000 15045 16121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 16899 16174 gene locus_tag LOCUS_38010 16899 16174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 16799 17647 gene locus_tag LOCUS_38020 16799 17647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 17650 18027 gene locus_tag LOCUS_38030 17650 18027 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222929.1 protein_id gnl|my_center|LOCUS_38030 19588 18629 gene locus_tag LOCUS_38040 19588 18629 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531702.1 protein_id gnl|my_center|LOCUS_38040 19671 20372 gene locus_tag LOCUS_38050 19671 20372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 20369 21196 gene locus_tag LOCUS_38060 20369 21196 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862685.1 protein_id gnl|my_center|LOCUS_38060 21927 21184 gene locus_tag LOCUS_38070 21927 21184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 23252 23070 gene locus_tag LOCUS_38080 23252 23070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 23798 23361 gene locus_tag LOCUS_38090 23798 23361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 23902 24282 gene locus_tag LOCUS_38100 23902 24282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 24661 24918 gene locus_tag LOCUS_38110 24661 24918 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003370228.1 protein_id gnl|my_center|LOCUS_38110 24918 25337 gene locus_tag LOCUS_38120 24918 25337 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 protein_id gnl|my_center|LOCUS_38120 25688 26209 gene locus_tag LOCUS_38130 25688 26209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 27108 26359 gene locus_tag LOCUS_38140 27108 26359 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015582873.1 protein_id gnl|my_center|LOCUS_38140 29078 27105 gene locus_tag LOCUS_38150 29078 27105 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013606.1 protein_id gnl|my_center|LOCUS_38150 29818 29078 gene locus_tag LOCUS_38160 29818 29078 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855465.1 protein_id gnl|my_center|LOCUS_38160 30240 29965 gene locus_tag LOCUS_38170 30240 29965 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079596.1 protein_id gnl|my_center|LOCUS_38170 31125 30259 gene locus_tag LOCUS_38180 31125 30259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 31238 31915 gene locus_tag LOCUS_38190 31238 31915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 31927 33171 gene locus_tag LOCUS_38200 31927 33171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 33929 33168 gene locus_tag LOCUS_38210 33929 33168 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389972.1 protein_id gnl|my_center|LOCUS_38210 35535 33922 gene locus_tag LOCUS_38220 35535 33922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 35861 35532 gene locus_tag LOCUS_38230 35861 35532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 36249 37244 gene locus_tag LOCUS_38240 36249 37244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 37304 37924 gene locus_tag LOCUS_38250 37304 37924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 37921 39423 gene locus_tag LOCUS_38260 37921 39423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 43032 40063 gene locus_tag LOCUS_38270 43032 40063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 43352 43179 gene locus_tag LOCUS_38280 43352 43179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 43294 43902 gene locus_tag LOCUS_38290 43294 43902 CDS product VUT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479579.1 protein_id gnl|my_center|LOCUS_38290 44001 45242 gene locus_tag LOCUS_38300 gene ugpC 44001 45242 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222655.1 protein_id gnl|my_center|LOCUS_38300 45283 46188 gene locus_tag LOCUS_38310 45283 46188 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906794.1 protein_id gnl|my_center|LOCUS_38310 46181 47080 gene locus_tag LOCUS_38320 46181 47080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 47077 48522 gene locus_tag LOCUS_38330 47077 48522 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080298.1 protein_id gnl|my_center|LOCUS_38330 49121 48567 gene locus_tag LOCUS_38340 49121 48567 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403741.1 protein_id gnl|my_center|LOCUS_38340 49370 50515 gene locus_tag LOCUS_38350 49370 50515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 50808 51845 gene locus_tag LOCUS_38360 50808 51845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 51928 53004 gene locus_tag LOCUS_38370 gene ychF 51928 53004 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057426.1 protein_id gnl|my_center|LOCUS_38370 53039 53497 gene locus_tag LOCUS_38380 53039 53497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 53533 54057 gene locus_tag LOCUS_38390 53533 54057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 54681 54091 gene locus_tag LOCUS_38400 54681 54091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 55416 54694 gene locus_tag LOCUS_38410 55416 54694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 55595 57427 gene locus_tag LOCUS_38420 55595 57427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 58705 57413 gene locus_tag LOCUS_38430 58705 57413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 58942 59598 gene locus_tag LOCUS_38440 58942 59598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 59598 60779 gene locus_tag LOCUS_38450 59598 60779 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070945485.1 protein_id gnl|my_center|LOCUS_38450 61946 60798 gene locus_tag LOCUS_38460 61946 60798 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061151682.1 protein_id gnl|my_center|LOCUS_38460 62826 61939 gene locus_tag LOCUS_38470 62826 61939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 64558 62819 gene locus_tag LOCUS_38480 64558 62819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 65414 64545 gene locus_tag LOCUS_38490 gene legD1 65414 64545 CDS product Dot/Icm type IV secretion system effector LegD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948394.1 protein_id gnl|my_center|LOCUS_38490 67072 65786 gene locus_tag LOCUS_38500 67072 65786 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029928.1 protein_id gnl|my_center|LOCUS_38500 68208 67069 gene locus_tag LOCUS_38510 68208 67069 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222770.1 protein_id gnl|my_center|LOCUS_38510 69794 68205 gene locus_tag LOCUS_38520 69794 68205 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974086.1 protein_id gnl|my_center|LOCUS_38520 70878 69820 gene locus_tag LOCUS_38530 70878 69820 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222768.1 protein_id gnl|my_center|LOCUS_38530 71153 72139 gene locus_tag LOCUS_38540 71153 72139 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266000.1 protein_id gnl|my_center|LOCUS_38540 72969 72154 gene locus_tag LOCUS_38550 72969 72154 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530243.1 protein_id gnl|my_center|LOCUS_38550 72914 74149 gene locus_tag LOCUS_38560 72914 74149 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_38560 75576 74137 gene locus_tag LOCUS_38570 75576 74137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 77336 75576 gene locus_tag LOCUS_38580 77336 75576 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495362.1 protein_id gnl|my_center|LOCUS_38580 77456 78229 gene locus_tag LOCUS_38590 77456 78229 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091117.1 protein_id gnl|my_center|LOCUS_38590 78289 78726 gene locus_tag LOCUS_38600 78289 78726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 78723 79604 gene locus_tag LOCUS_38610 gene rsmA 78723 79604 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229977.1 protein_id gnl|my_center|LOCUS_38610 79614 80378 gene locus_tag LOCUS_38620 79614 80378 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336977.1 protein_id gnl|my_center|LOCUS_38620 80584 80657 gene locus_tag LOCUS_t00540 80584 80657 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 80617 81726 gene locus_tag LOCUS_38630 80617 81726 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975691.1 protein_id gnl|my_center|LOCUS_38630 82839 81694 gene locus_tag LOCUS_38640 82839 81694 CDS product DUF2332 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066961.1 protein_id gnl|my_center|LOCUS_38640 83027 83674 gene locus_tag LOCUS_38650 83027 83674 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391626.1 protein_id gnl|my_center|LOCUS_38650 83731 84294 gene locus_tag LOCUS_38660 gene pth 83731 84294 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405251.1 protein_id gnl|my_center|LOCUS_38660 84344 84868 gene locus_tag LOCUS_38670 84344 84868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 86567 84912 gene locus_tag LOCUS_38680 86567 84912 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080653.1 protein_id gnl|my_center|LOCUS_38680 86628 90362 gene locus_tag LOCUS_38690 gene mfd 86628 90362 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229948.1 protein_id gnl|my_center|LOCUS_38690 90447 91499 gene locus_tag LOCUS_38700 90447 91499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 91527 92477 gene locus_tag LOCUS_38710 91527 92477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 92517 93428 gene locus_tag LOCUS_38720 92517 93428 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085668.1 protein_id gnl|my_center|LOCUS_38720 93481 95409 gene locus_tag LOCUS_38730 93481 95409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 95866 95411 gene locus_tag LOCUS_38740 95866 95411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 98397 95851 gene locus_tag LOCUS_38750 98397 95851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 98553 99584 gene locus_tag LOCUS_38760 98553 99584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 99677 100138 gene locus_tag LOCUS_38770 99677 100138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 100201 101406 gene locus_tag LOCUS_38780 100201 101406 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963596.1 protein_id gnl|my_center|LOCUS_38780 101403 102800 gene locus_tag LOCUS_38790 101403 102800 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895673.1 protein_id gnl|my_center|LOCUS_38790 102797 103726 gene locus_tag LOCUS_38800 102797 103726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 106536 105094 gene locus_tag LOCUS_38810 106536 105094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 107578 106703 gene locus_tag LOCUS_38820 107578 106703 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217633758.1 protein_id gnl|my_center|LOCUS_38820 109124 107661 gene locus_tag LOCUS_38830 109124 107661 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891663.1 protein_id gnl|my_center|LOCUS_38830 109236 110222 gene locus_tag LOCUS_38840 109236 110222 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775988.1 protein_id gnl|my_center|LOCUS_38840 110222 111031 gene locus_tag LOCUS_38850 110222 111031 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226742.1 protein_id gnl|my_center|LOCUS_38850 112029 111082 gene locus_tag LOCUS_38860 112029 111082 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257188.1 protein_id gnl|my_center|LOCUS_38860 112114 113484 gene locus_tag LOCUS_38870 112114 113484 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_38870 113793 113521 gene locus_tag LOCUS_38880 113793 113521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 114011 117526 gene locus_tag LOCUS_38890 114011 117526 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615086.1 protein_id gnl|my_center|LOCUS_38890 117536 118129 gene locus_tag LOCUS_38900 117536 118129 CDS product HhH-GPD-type base excision DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406064.1 protein_id gnl|my_center|LOCUS_38900 121576 118145 gene locus_tag LOCUS_38910 121576 118145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 121580 123091 gene locus_tag LOCUS_38920 gene eno 121580 123091 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975715.1 protein_id gnl|my_center|LOCUS_38920 123162 123521 gene locus_tag LOCUS_38930 123162 123521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 >Feature sequence11 135 1361 gene locus_tag LOCUS_38940 135 1361 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084023633.1 protein_id gnl|my_center|LOCUS_38940 2167 1547 gene locus_tag LOCUS_38950 2167 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 3045 2248 gene locus_tag LOCUS_38960 3045 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 3493 2960 gene locus_tag LOCUS_38970 3493 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38970 4502 5038 gene locus_tag LOCUS_38980 4502 5038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 5786 5112 gene locus_tag LOCUS_38990 gene udk 5786 5112 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886805.1 protein_id gnl|my_center|LOCUS_38990 6453 5800 gene locus_tag LOCUS_39000 6453 5800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 6751 6584 gene locus_tag LOCUS_39010 6751 6584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 6790 6984 gene locus_tag LOCUS_39020 6790 6984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 7732 8238 gene locus_tag LOCUS_39030 7732 8238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39030 8249 8464 gene locus_tag LOCUS_39040 8249 8464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 8506 8694 gene locus_tag LOCUS_39050 8506 8694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 8980 9426 gene locus_tag LOCUS_39060 8980 9426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39060 9381 9635 gene locus_tag LOCUS_39070 9381 9635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39070 9560 10438 gene locus_tag LOCUS_39080 9560 10438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39080 11243 10467 gene locus_tag LOCUS_39090 11243 10467 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030941.1 protein_id gnl|my_center|LOCUS_39090 11408 12178 gene locus_tag LOCUS_39100 11408 12178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39100 12132 12587 gene locus_tag LOCUS_39110 12132 12587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39110 13383 12592 gene locus_tag LOCUS_39120 13383 12592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 13273 13587 gene locus_tag LOCUS_39130 13273 13587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 15188 13749 gene locus_tag LOCUS_39140 15188 13749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 15297 16415 gene locus_tag LOCUS_39150 15297 16415 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_39150 16470 17036 gene locus_tag LOCUS_39160 gene rfbC 16470 17036 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159758.1 protein_id gnl|my_center|LOCUS_39160 17069 18040 gene locus_tag LOCUS_39170 gene rfbB 17069 18040 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023679.1 protein_id gnl|my_center|LOCUS_39170 18109 19443 gene locus_tag LOCUS_39180 18109 19443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 19443 20345 gene locus_tag LOCUS_39190 19443 20345 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031159.1 protein_id gnl|my_center|LOCUS_39190 20455 21141 gene locus_tag LOCUS_39200 20455 21141 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876008.1 protein_id gnl|my_center|LOCUS_39200 21144 22601 gene locus_tag LOCUS_39210 21144 22601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 25295 22608 gene locus_tag LOCUS_39220 25295 22608 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630643.1 protein_id gnl|my_center|LOCUS_39220 26070 25300 gene locus_tag LOCUS_39230 26070 25300 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972238.1 protein_id gnl|my_center|LOCUS_39230 26912 26073 gene locus_tag LOCUS_39240 26912 26073 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975816.1 protein_id gnl|my_center|LOCUS_39240 28274 26928 gene locus_tag LOCUS_39250 28274 26928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 29544 28279 gene locus_tag LOCUS_39260 29544 28279 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257610.1 protein_id gnl|my_center|LOCUS_39260 30398 29604 gene locus_tag LOCUS_39270 30398 29604 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294698.1 protein_id gnl|my_center|LOCUS_39270 30559 31446 gene locus_tag LOCUS_39280 30559 31446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 31443 32162 gene locus_tag LOCUS_39290 31443 32162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 33010 32183 gene locus_tag LOCUS_39300 33010 32183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 33840 33010 gene locus_tag LOCUS_39310 33840 33010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 34055 34519 gene locus_tag LOCUS_39320 34055 34519 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189303094.1 protein_id gnl|my_center|LOCUS_39320 35518 34523 gene locus_tag LOCUS_39330 35518 34523 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094369.1 protein_id gnl|my_center|LOCUS_39330 36335 35577 gene locus_tag LOCUS_39340 36335 35577 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973919.1 protein_id gnl|my_center|LOCUS_39340 36436 36360 gene locus_tag LOCUS_t00550 36436 36360 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 36519 37574 gene locus_tag LOCUS_39350 36519 37574 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986244.1 protein_id gnl|my_center|LOCUS_39350 39100 37586 gene locus_tag LOCUS_39360 39100 37586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 39166 39450 gene locus_tag LOCUS_39370 39166 39450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 39491 39871 gene locus_tag LOCUS_39380 39491 39871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 40078 40920 gene locus_tag LOCUS_39390 gene rfbD 40078 40920 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_39390 41004 42329 gene locus_tag LOCUS_39400 41004 42329 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727859.1 protein_id gnl|my_center|LOCUS_39400 43392 42562 gene locus_tag LOCUS_39410 43392 42562 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188832.1 protein_id gnl|my_center|LOCUS_39410 44790 43492 gene locus_tag LOCUS_39420 44790 43492 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227654.1 protein_id gnl|my_center|LOCUS_39420 45236 45610 gene locus_tag LOCUS_39430 45236 45610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 46959 45652 gene locus_tag LOCUS_39440 46959 45652 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640087.1 protein_id gnl|my_center|LOCUS_39440 47283 50132 gene locus_tag LOCUS_39450 47283 50132 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013860.1 protein_id gnl|my_center|LOCUS_39450 50369 50187 gene locus_tag LOCUS_39460 50369 50187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 50947 50432 gene locus_tag LOCUS_39470 50947 50432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 51229 51014 gene locus_tag LOCUS_39480 51229 51014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 52236 51286 gene locus_tag LOCUS_39490 52236 51286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 52679 52395 gene locus_tag LOCUS_39500 52679 52395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 52877 52695 gene locus_tag LOCUS_39510 52877 52695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 53388 52915 gene locus_tag LOCUS_39520 53388 52915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 53369 53884 gene locus_tag LOCUS_39530 53369 53884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 54493 54212 gene locus_tag LOCUS_39540 54493 54212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 54702 56264 gene locus_tag LOCUS_39550 54702 56264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39550 56174 57283 gene locus_tag LOCUS_39560 56174 57283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39560 58154 57204 gene locus_tag LOCUS_39570 58154 57204 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765045.1 protein_id gnl|my_center|LOCUS_39570 59637 58333 gene locus_tag LOCUS_39580 59637 58333 CDS product IS1380-like element ISMsm11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727590.1 protein_id gnl|my_center|LOCUS_39580 59735 60373 gene locus_tag LOCUS_39590 59735 60373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 60446 60925 gene locus_tag LOCUS_39600 60446 60925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 61105 60878 gene locus_tag LOCUS_39610 61105 60878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 62657 61113 gene locus_tag LOCUS_39620 62657 61113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 62817 63206 gene locus_tag LOCUS_39630 62817 63206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39630 63203 63469 gene locus_tag LOCUS_39640 63203 63469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 63928 63554 gene locus_tag LOCUS_39650 63928 63554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 64436 64056 gene locus_tag LOCUS_39660 64436 64056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 64573 64983 gene locus_tag LOCUS_39670 64573 64983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 65188 66225 gene locus_tag LOCUS_39680 65188 66225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 66668 66330 gene locus_tag LOCUS_39690 66668 66330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 66897 67187 gene locus_tag LOCUS_39700 66897 67187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39700 67184 67699 gene locus_tag LOCUS_39710 67184 67699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39710 67669 67923 gene locus_tag LOCUS_39720 67669 67923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39720 69467 68139 gene locus_tag LOCUS_39730 69467 68139 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867479.1 protein_id gnl|my_center|LOCUS_39730 70888 69464 gene locus_tag LOCUS_39740 70888 69464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 71771 71181 gene locus_tag LOCUS_39750 71771 71181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 72094 71768 gene locus_tag LOCUS_39760 72094 71768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 72235 72537 gene locus_tag LOCUS_39770 72235 72537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 73417 73118 gene locus_tag LOCUS_39780 73417 73118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 76320 74551 gene locus_tag LOCUS_39790 76320 74551 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_39790 76633 76788 gene locus_tag LOCUS_39800 76633 76788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 77802 78446 gene locus_tag LOCUS_39810 77802 78446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 80115 78448 gene locus_tag LOCUS_39820 80115 78448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 80120 81163 gene locus_tag LOCUS_39830 80120 81163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39830 81267 83435 gene locus_tag LOCUS_39840 81267 83435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 83884 83696 gene locus_tag LOCUS_39850 83884 83696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 84774 84511 gene locus_tag LOCUS_39860 84774 84511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 85465 85208 gene locus_tag LOCUS_39870 85465 85208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 87121 86255 gene locus_tag LOCUS_39880 87121 86255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 88138 87122 gene locus_tag LOCUS_39890 88138 87122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 92440 93780 gene locus_tag LOCUS_39900 92440 93780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39900 93765 95750 gene locus_tag LOCUS_39910 93765 95750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39910 95720 97195 gene locus_tag LOCUS_39920 95720 97195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39920 98297 97551 gene locus_tag LOCUS_39930 gene istB 98297 97551 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727958.1 protein_id gnl|my_center|LOCUS_39930 98964 98341 gene locus_tag LOCUS_39940 98964 98341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 99659 100054 gene locus_tag LOCUS_39950 99659 100054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 100347 101135 gene locus_tag LOCUS_39960 100347 101135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39960 101674 101886 gene locus_tag LOCUS_39970 101674 101886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 101883 102290 gene locus_tag LOCUS_39980 gene vapc11 101883 102290 CDS product type II toxin-antitoxin system toxin ribonuclease VapC11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407786.1 protein_id gnl|my_center|LOCUS_39980 102352 103422 gene locus_tag LOCUS_39990 102352 103422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 103698 103910 gene locus_tag LOCUS_40000 103698 103910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 104502 104975 gene locus_tag LOCUS_40010 104502 104975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40010 105235 105501 gene locus_tag LOCUS_40020 105235 105501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_40020 105444 105764 gene locus_tag LOCUS_40030 105444 105764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40030 105891 105703 gene locus_tag LOCUS_40040 105891 105703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 107110 106721 gene locus_tag LOCUS_40050 107110 106721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 107769 107635 gene locus_tag LOCUS_40060 107769 107635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 >Feature sequence12 230 424 gene locus_tag LOCUS_40070 230 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 933 673 gene locus_tag LOCUS_40080 933 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 1584 1030 gene locus_tag LOCUS_40090 1584 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 2116 1814 gene locus_tag LOCUS_40100 2116 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 2914 2717 gene locus_tag LOCUS_40110 2914 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 3382 3582 gene locus_tag LOCUS_40120 3382 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 6152 4452 gene locus_tag LOCUS_40130 6152 4452 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926642.1 protein_id gnl|my_center|LOCUS_40130 6293 6916 gene locus_tag LOCUS_40140 6293 6916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 6940 8031 gene locus_tag LOCUS_40150 6940 8031 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224840.1 protein_id gnl|my_center|LOCUS_40150 9138 8074 gene locus_tag LOCUS_40160 9138 8074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40160 9488 9733 gene locus_tag LOCUS_40170 9488 9733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 10610 9618 gene locus_tag LOCUS_40180 10610 9618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40180 11362 10607 gene locus_tag LOCUS_40190 11362 10607 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804566.1 protein_id gnl|my_center|LOCUS_40190 11705 11436 gene locus_tag LOCUS_40200 gene rpsT 11705 11436 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859343.1 protein_id gnl|my_center|LOCUS_40200 13175 11865 gene locus_tag LOCUS_40210 13175 11865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 14809 13172 gene locus_tag LOCUS_40220 14809 13172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 16125 14806 gene locus_tag LOCUS_40230 16125 14806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 16330 17856 gene locus_tag LOCUS_40240 16330 17856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 19233 17911 gene locus_tag LOCUS_40250 19233 17911 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_40250 19359 19664 gene locus_tag LOCUS_40260 19359 19664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 19668 20558 gene locus_tag LOCUS_40270 19668 20558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 20546 22756 gene locus_tag LOCUS_40280 20546 22756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 22771 23565 gene locus_tag LOCUS_40290 22771 23565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40290 23528 24400 gene locus_tag LOCUS_40300 23528 24400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40300 24336 24548 gene locus_tag LOCUS_40310 24336 24548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40310 25528 25767 gene locus_tag LOCUS_40320 25528 25767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 25867 27012 gene locus_tag LOCUS_40330 gene dnaJ 25867 27012 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095211.1 protein_id gnl|my_center|LOCUS_40330 27050 27757 gene locus_tag LOCUS_40340 27050 27757 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228402.1 protein_id gnl|my_center|LOCUS_40340 27931 28434 gene locus_tag LOCUS_40350 gene bldD 27931 28434 CDS product transcriptional regulator BldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977337.1 protein_id gnl|my_center|LOCUS_40350 28705 29022 gene locus_tag LOCUS_40360 28705 29022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 29302 29045 gene locus_tag LOCUS_40370 29302 29045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 29951 29601 gene locus_tag LOCUS_40380 29951 29601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 32024 31839 gene locus_tag LOCUS_40390 32024 31839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 33378 32923 gene locus_tag LOCUS_40400 33378 32923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 34201 34001 gene locus_tag LOCUS_40410 34201 34001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 35194 35592 gene locus_tag LOCUS_40420 35194 35592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 >Feature sequence13 704 1474 gene locus_tag LOCUS_40430 704 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 2407 1484 gene locus_tag LOCUS_40440 2407 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 2723 2511 gene locus_tag LOCUS_40450 2723 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 4441 2720 gene locus_tag LOCUS_40460 4441 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 4698 4438 gene locus_tag LOCUS_40470 4698 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 6894 4912 gene locus_tag LOCUS_40480 6894 4912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 7097 6894 gene locus_tag LOCUS_40490 7097 6894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 7909 7094 gene locus_tag LOCUS_40500 7909 7094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 8419 7970 gene locus_tag LOCUS_40510 8419 7970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 10023 8416 gene locus_tag LOCUS_40520 10023 8416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 11687 10020 gene locus_tag LOCUS_40530 11687 10020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 13613 11964 gene locus_tag LOCUS_40540 13613 11964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40540 14180 13788 gene locus_tag LOCUS_40550 14180 13788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 14890 14363 gene locus_tag LOCUS_40560 14890 14363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 14909 16333 gene locus_tag LOCUS_40570 14909 16333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 15919 16012 gene locus_tag LOCUS_t00560 15919 16012 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 16399 17214 gene locus_tag LOCUS_40580 16399 17214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 17221 18093 gene locus_tag LOCUS_40590 17221 18093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 18095 20113 gene locus_tag LOCUS_40600 18095 20113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40600 20083 20655 gene locus_tag LOCUS_40610 20083 20655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40610 21610 20789 gene locus_tag LOCUS_40620 21610 20789 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411707.1 protein_id gnl|my_center|LOCUS_40620 21705 22982 gene locus_tag LOCUS_40630 21705 22982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 22967 23173 gene locus_tag LOCUS_40640 22967 23173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 >Feature sequence14 280 140 gene locus_tag LOCUS_40650 280 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 462 277 gene locus_tag LOCUS_40660 462 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 1463 459 gene locus_tag LOCUS_40670 1463 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 1603 1460 gene locus_tag LOCUS_40680 1603 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 2312 1719 gene locus_tag LOCUS_40690 2312 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 2528 2334 gene locus_tag LOCUS_40700 2528 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 3636 2494 gene locus_tag LOCUS_40710 3636 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 4739 3603 gene locus_tag LOCUS_40720 4739 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 7402 4736 gene locus_tag LOCUS_40730 7402 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 7612 7806 gene locus_tag LOCUS_40740 7612 7806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 8637 8113 gene locus_tag LOCUS_40750 8637 8113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110310.1 protein_id gnl|my_center|LOCUS_40750 9564 8647 gene locus_tag LOCUS_40760 9564 8647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 10346 9834 gene locus_tag LOCUS_40770 10346 9834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 10766 10521 gene locus_tag LOCUS_40780 10766 10521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 11542 10766 gene locus_tag LOCUS_40790 11542 10766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 12363 11545 gene locus_tag LOCUS_40800 12363 11545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 13015 12554 gene locus_tag LOCUS_40810 13015 12554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 13496 13053 gene locus_tag LOCUS_40820 13496 13053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 13657 13394 gene locus_tag LOCUS_40830 13657 13394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 14390 13641 gene locus_tag LOCUS_40840 14390 13641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 14863 14327 gene locus_tag LOCUS_40850 14863 14327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 16708 14990 gene locus_tag LOCUS_40860 16708 14990 CDS product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389873.1 protein_id gnl|my_center|LOCUS_40860 >Feature sequence15 19 1737 gene locus_tag LOCUS_40870 19 1737 CDS product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389873.1 protein_id gnl|my_center|LOCUS_40870 1742 3085 gene locus_tag LOCUS_40880 1742 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 3069 3674 gene locus_tag LOCUS_40890 3069 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 3712 4230 gene locus_tag LOCUS_40900 3712 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 4293 4493 gene locus_tag LOCUS_40910 4293 4493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 4447 5181 gene locus_tag LOCUS_40920 4447 5181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 5184 5960 gene locus_tag LOCUS_40930 5184 5960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 6022 6204 gene locus_tag LOCUS_40940 6022 6204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 6273 6737 gene locus_tag LOCUS_40950 6273 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 7291 8097 gene locus_tag LOCUS_40960 7291 8097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 8107 8631 gene locus_tag LOCUS_40970 8107 8631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110310.1 protein_id gnl|my_center|LOCUS_40970 8631 8942 gene locus_tag LOCUS_40980 8631 8942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 9011 9352 gene locus_tag LOCUS_40990 9011 9352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 9342 10679 gene locus_tag LOCUS_41000 9342 10679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 10745 12007 gene locus_tag LOCUS_41010 10745 12007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 12004 12393 gene locus_tag LOCUS_41020 12004 12393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 12490 13140 gene locus_tag LOCUS_41030 12490 13140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 13107 14411 gene locus_tag LOCUS_41040 13107 14411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 14434 14826 gene locus_tag LOCUS_41050 14434 14826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 14775 15026 gene locus_tag LOCUS_41060 14775 15026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 15142 15288 gene locus_tag LOCUS_41070 15142 15288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 15285 15938 gene locus_tag LOCUS_41080 15285 15938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 15938 16351 gene locus_tag LOCUS_41090 15938 16351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 16338 16697 gene locus_tag LOCUS_41100 16338 16697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 16694 16879 gene locus_tag LOCUS_41110 16694 16879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 >Feature sequence16 89 289 gene locus_tag LOCUS_41120 89 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 769 539 gene locus_tag LOCUS_41130 769 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 1089 1706 gene locus_tag LOCUS_41140 1089 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 3519 2935 gene locus_tag LOCUS_41150 3519 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 3671 4315 gene locus_tag LOCUS_41160 3671 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 4371 4718 gene locus_tag LOCUS_41170 4371 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 4715 4912 gene locus_tag LOCUS_41180 4715 4912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 5218 5142 gene locus_tag LOCUS_t00570 5218 5142 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6090 5209 gene locus_tag LOCUS_41190 6090 5209 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893601.1 protein_id gnl|my_center|LOCUS_41190 6386 6087 gene locus_tag LOCUS_41200 6386 6087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41200 6944 8356 gene locus_tag LOCUS_41210 6944 8356 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467877.1 protein_id gnl|my_center|LOCUS_41210 9956 8340 gene locus_tag LOCUS_41220 9956 8340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 10631 10050 gene locus_tag LOCUS_41230 10631 10050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41230 10774 10628 gene locus_tag LOCUS_41240 10774 10628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 11303 11506 gene locus_tag LOCUS_41250 11303 11506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 12092 11859 gene locus_tag LOCUS_41260 12092 11859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 12603 12067 gene locus_tag LOCUS_41270 12603 12067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41270 12786 13253 gene locus_tag LOCUS_41280 12786 13253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 13139 13549 gene locus_tag LOCUS_41290 13139 13549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 13546 13851 gene locus_tag LOCUS_41300 13546 13851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 14006 14398 gene locus_tag LOCUS_41310 14006 14398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 16474 16109 gene locus_tag LOCUS_41320 16474 16109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41320 >Feature sequence17 306 55 gene locus_tag LOCUS_41330 306 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 959 570 gene locus_tag LOCUS_41340 959 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_41340 1077 2642 gene locus_tag LOCUS_41350 1077 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 2639 3412 gene locus_tag LOCUS_41360 gene istB 2639 3412 CDS product IS21-like element ISMt2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418125.1 protein_id gnl|my_center|LOCUS_41360 3573 4895 gene locus_tag LOCUS_41370 3573 4895 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144955419.1 protein_id gnl|my_center|LOCUS_41370 5121 4903 gene locus_tag LOCUS_41380 5121 4903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 7053 5983 gene locus_tag LOCUS_41390 7053 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41390 8395 7265 gene locus_tag LOCUS_41400 gene wecB 8395 7265 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406828.1 protein_id gnl|my_center|LOCUS_41400 10717 8405 gene locus_tag LOCUS_41410 10717 8405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 11864 10800 gene locus_tag LOCUS_41420 11864 10800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 11945 12988 gene locus_tag LOCUS_41430 gene csaB 11945 12988 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886807.1 protein_id gnl|my_center|LOCUS_41430 13907 12960 gene locus_tag LOCUS_41440 13907 12960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 14127 15074 gene locus_tag LOCUS_41450 14127 15074 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_41450 15816 15463 gene locus_tag LOCUS_41460 15816 15463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 >Feature sequence18 1507 1731 gene locus_tag LOCUS_41470 1507 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 2521 2865 gene locus_tag LOCUS_41480 2521 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 2984 3280 gene locus_tag LOCUS_41490 2984 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 3782 3961 gene locus_tag LOCUS_41500 3782 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 5743 4400 gene locus_tag LOCUS_41510 5743 4400 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110107303.1 protein_id gnl|my_center|LOCUS_41510 5892 6323 gene locus_tag LOCUS_41520 5892 6323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 6316 6801 gene locus_tag LOCUS_41530 6316 6801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 7042 7464 gene locus_tag LOCUS_41540 7042 7464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41540 7475 8482 gene locus_tag LOCUS_41550 7475 8482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_41550 8619 8936 gene locus_tag LOCUS_41560 8619 8936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_41560 9003 9233 gene locus_tag LOCUS_41570 9003 9233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41570 9475 9876 gene locus_tag LOCUS_41580 9475 9876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 9851 10573 gene locus_tag LOCUS_41590 9851 10573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 10817 11440 gene locus_tag LOCUS_41600 10817 11440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41600 11397 11834 gene locus_tag LOCUS_41610 11397 11834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41610 12310 12630 gene locus_tag LOCUS_41620 12310 12630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 12657 13040 gene locus_tag LOCUS_41630 12657 13040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 13057 13233 gene locus_tag LOCUS_41640 13057 13233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41640 >Feature sequence19 1601 456 gene locus_tag LOCUS_41650 1601 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 2299 1598 gene locus_tag LOCUS_41660 2299 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 4028 2196 gene locus_tag LOCUS_41670 4028 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 4317 4018 gene locus_tag LOCUS_41680 4317 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 4739 4428 gene locus_tag LOCUS_41690 4739 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 5035 4739 gene locus_tag LOCUS_41700 5035 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 6295 5045 gene locus_tag LOCUS_41710 6295 5045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 6576 6322 gene locus_tag LOCUS_41720 6576 6322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 6853 6611 gene locus_tag LOCUS_41730 6853 6611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 7183 6893 gene locus_tag LOCUS_41740 7183 6893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 7629 7180 gene locus_tag LOCUS_41750 7629 7180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 8522 7632 gene locus_tag LOCUS_41760 8522 7632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 9103 8585 gene locus_tag LOCUS_41770 9103 8585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 9746 9141 gene locus_tag LOCUS_41780 9746 9141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 11073 9730 gene locus_tag LOCUS_41790 11073 9730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 12796 11078 gene locus_tag LOCUS_41800 12796 11078 CDS product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389873.1 protein_id gnl|my_center|LOCUS_41800 13218 12793 gene locus_tag LOCUS_41810 13218 12793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 >Feature sequence20 507 184 gene locus_tag LOCUS_41820 507 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 774 643 gene locus_tag LOCUS_41830 774 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 1274 771 gene locus_tag LOCUS_41840 1274 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 1504 1271 gene locus_tag LOCUS_41850 1504 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 1866 1501 gene locus_tag LOCUS_41860 1866 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 2207 1863 gene locus_tag LOCUS_41870 2207 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 4054 2204 gene locus_tag LOCUS_41880 4054 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 4444 4701 gene locus_tag LOCUS_41890 4444 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 4698 4928 gene locus_tag LOCUS_41900 4698 4928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 4925 5197 gene locus_tag LOCUS_41910 4925 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 5194 5577 gene locus_tag LOCUS_41920 5194 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 5817 5966 gene locus_tag LOCUS_41930 5817 5966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 5963 6250 gene locus_tag LOCUS_41940 5963 6250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 6638 6870 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccgcagggtacgccgcatgggacgccgca 7193 7618 gene locus_tag LOCUS_41950 7193 7618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 >Feature sequence21 236 2014 gene locus_tag LOCUS_41960 236 2014 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_41960 2054 2269 gene locus_tag LOCUS_41970 2054 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 2624 2286 gene locus_tag LOCUS_41980 2624 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 2873 2667 gene locus_tag LOCUS_41990 2873 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 3275 3000 gene locus_tag LOCUS_42000 3275 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 3718 3362 gene locus_tag LOCUS_42010 3718 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 4167 3625 gene locus_tag LOCUS_42020 4167 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42020 4525 4310 gene locus_tag LOCUS_42030 4525 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_42030 5004 4741 gene locus_tag LOCUS_42040 5004 4741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040