>Feature sequence01 261 25 gene locus_tag LOCUS_00010 261 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 513 1055 gene locus_tag LOCUS_00020 513 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1091 2017 gene locus_tag LOCUS_00030 gene xerD 1091 2017 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360354.1 protein_id gnl|my_center|LOCUS_00030 2108 2195 gene locus_tag LOCUS_t00010 2108 2195 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2286 2361 gene locus_tag LOCUS_t00020 2286 2361 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2379 2454 gene locus_tag LOCUS_t00030 2379 2454 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2509 3696 gene locus_tag LOCUS_00040 gene tuf 2509 3696 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165809.1 protein_id gnl|my_center|LOCUS_00040 4055 4130 gene locus_tag LOCUS_t00040 4055 4130 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 4155 4409 gene locus_tag LOCUS_00050 4155 4409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4420 4890 gene locus_tag LOCUS_00060 gene nusG 4420 4890 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943498.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00060 5087 5515 gene locus_tag LOCUS_00070 gene rplK 5087 5515 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943497.1 protein_id gnl|my_center|LOCUS_00070 5717 6412 gene locus_tag LOCUS_00080 gene rplA 5717 6412 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_00080 6437 6961 gene locus_tag LOCUS_00090 gene rplJ 6437 6961 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081510.1 protein_id gnl|my_center|LOCUS_00090 7276 7665 gene locus_tag LOCUS_00100 gene rplL 7276 7665 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854210.1 protein_id gnl|my_center|LOCUS_00100 8039 12490 gene locus_tag LOCUS_00110 gene rpoB 8039 12490 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666423.1 protein_id gnl|my_center|LOCUS_00110 12591 13253 gene locus_tag LOCUS_00120 12591 13253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00120 13181 16894 gene locus_tag LOCUS_00130 gene rpoC 13181 16894 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00130 17227 16994 gene locus_tag LOCUS_00140 17227 16994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 18176 17745 gene locus_tag LOCUS_00150 18176 17745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 18762 18352 gene locus_tag LOCUS_00160 18762 18352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 19233 18892 gene locus_tag LOCUS_00170 19233 18892 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817423.1 protein_id gnl|my_center|LOCUS_00170 19484 19218 gene locus_tag LOCUS_00180 19484 19218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 19700 20893 gene locus_tag LOCUS_00190 19700 20893 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249414.1 protein_id gnl|my_center|LOCUS_00190 22614 20974 gene locus_tag LOCUS_00200 22614 20974 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269292.1 protein_id gnl|my_center|LOCUS_00200 24761 22761 gene locus_tag LOCUS_00210 24761 22761 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948307.1 protein_id gnl|my_center|LOCUS_00210 25745 24879 gene locus_tag LOCUS_00220 25745 24879 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_00220 26417 25863 gene locus_tag LOCUS_00230 26417 25863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 28740 26851 gene locus_tag LOCUS_00240 28740 26851 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963842.1 protein_id gnl|my_center|LOCUS_00240 29006 29890 gene locus_tag LOCUS_00250 29006 29890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 30480 29926 gene locus_tag LOCUS_00260 30480 29926 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039144.1 protein_id gnl|my_center|LOCUS_00260 33744 30619 gene locus_tag LOCUS_00270 33744 30619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 34136 37771 gene locus_tag LOCUS_00280 34136 37771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 37859 39619 gene locus_tag LOCUS_00290 37859 39619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 39773 40645 gene locus_tag LOCUS_00300 gene czcD 39773 40645 CDS product CDF family zinc transporter CzcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229873.1 protein_id gnl|my_center|LOCUS_00300 40650 41933 gene locus_tag LOCUS_00310 gene larA 40650 41933 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943907.1 protein_id gnl|my_center|LOCUS_00310 42473 41952 gene locus_tag LOCUS_00320 42473 41952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 42406 42585 gene locus_tag LOCUS_00330 42406 42585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 43844 42657 gene locus_tag LOCUS_00340 gene dnaN 43844 42657 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_00340 45416 44205 gene locus_tag LOCUS_00350 gene dnaA 45416 44205 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_00350 45608 45429 gene locus_tag LOCUS_00360 45608 45429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 46042 46479 gene locus_tag LOCUS_00370 46042 46479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 47240 46539 gene locus_tag LOCUS_00380 47240 46539 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956832.1 protein_id gnl|my_center|LOCUS_00380 47774 47313 gene locus_tag LOCUS_00390 47774 47313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 49581 47977 gene locus_tag LOCUS_00400 49581 47977 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941565.1 protein_id gnl|my_center|LOCUS_00400 49964 49581 gene locus_tag LOCUS_00410 49964 49581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 50997 50038 gene locus_tag LOCUS_00420 50997 50038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 51228 52250 gene locus_tag LOCUS_00430 gene purM 51228 52250 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461474.1 protein_id gnl|my_center|LOCUS_00430 52356 53498 gene locus_tag LOCUS_00440 52356 53498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 53498 54118 gene locus_tag LOCUS_00450 gene purN 53498 54118 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065739.1 protein_id gnl|my_center|LOCUS_00450 54357 54127 gene locus_tag LOCUS_00460 54357 54127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 54564 54938 gene locus_tag LOCUS_00470 54564 54938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 54945 55154 gene locus_tag LOCUS_00480 gene yidD 54945 55154 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256304.1 protein_id gnl|my_center|LOCUS_00480 55167 57074 gene locus_tag LOCUS_00490 gene yidC 55167 57074 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931700.1 protein_id gnl|my_center|LOCUS_00490 57128 57577 gene locus_tag LOCUS_00500 57128 57577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 57668 59020 gene locus_tag LOCUS_00510 gene mnmE 57668 59020 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880529.1 protein_id gnl|my_center|LOCUS_00510 59527 59027 gene locus_tag LOCUS_00520 59527 59027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 59690 61105 gene locus_tag LOCUS_00530 59690 61105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 61330 62811 gene locus_tag LOCUS_00540 gene pap 61330 62811 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941390.1 protein_id gnl|my_center|LOCUS_00540 62815 63987 gene locus_tag LOCUS_00550 62815 63987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 64048 65532 gene locus_tag LOCUS_00560 64048 65532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 65520 66089 gene locus_tag LOCUS_00570 65520 66089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002080723.1 protein_id gnl|my_center|LOCUS_00570 66168 68051 gene locus_tag LOCUS_00580 gene mnmG 66168 68051 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546402.1 protein_id gnl|my_center|LOCUS_00580 68171 68932 gene locus_tag LOCUS_00590 68171 68932 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940782.1 protein_id gnl|my_center|LOCUS_00590 68925 69791 gene locus_tag LOCUS_00600 68925 69791 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_00600 69901 70878 gene locus_tag LOCUS_00610 gene selD 69901 70878 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012159590.1 protein_id gnl|my_center|LOCUS_00610 70917 71279 gene locus_tag LOCUS_00620 70917 71279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 71279 72313 gene locus_tag LOCUS_00630 71279 72313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 72444 74075 gene locus_tag LOCUS_00640 72444 74075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 74130 74639 gene locus_tag LOCUS_00650 74130 74639 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469134.1 protein_id gnl|my_center|LOCUS_00650 75735 74629 gene locus_tag LOCUS_00660 gene menC 75735 74629 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228259.1 protein_id gnl|my_center|LOCUS_00660 76327 75878 gene locus_tag LOCUS_00670 76327 75878 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_00670 76708 76346 gene locus_tag LOCUS_00680 76708 76346 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462150.1 protein_id gnl|my_center|LOCUS_00680 77987 76764 gene locus_tag LOCUS_00690 77987 76764 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_00690 78868 78638 gene locus_tag LOCUS_00700 78868 78638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 79535 79101 gene locus_tag LOCUS_00710 79535 79101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 80160 79561 gene locus_tag LOCUS_00720 80160 79561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 81658 80522 gene locus_tag LOCUS_00730 gene sufD 81658 80522 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958176.1 protein_id gnl|my_center|LOCUS_00730 82615 81863 gene locus_tag LOCUS_00740 gene sufC 82615 81863 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057741.1 protein_id gnl|my_center|LOCUS_00740 82855 82646 gene locus_tag LOCUS_00750 82855 82646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 83328 82852 gene locus_tag LOCUS_00760 83328 82852 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462120.1 protein_id gnl|my_center|LOCUS_00760 84103 83321 gene locus_tag LOCUS_00770 84103 83321 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776815.1 protein_id gnl|my_center|LOCUS_00770 84534 84100 gene locus_tag LOCUS_00780 84534 84100 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890858.1 protein_id gnl|my_center|LOCUS_00780 85517 84555 gene locus_tag LOCUS_00790 85517 84555 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124396.1 protein_id gnl|my_center|LOCUS_00790 85880 85524 gene locus_tag LOCUS_00800 85880 85524 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262045.1 protein_id gnl|my_center|LOCUS_00800 86574 86002 gene locus_tag LOCUS_00810 86574 86002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043125671.1 protein_id gnl|my_center|LOCUS_00810 89462 86934 gene locus_tag LOCUS_00820 gene sufB 89462 86934 CDS product intein-containing Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407484.1 protein_id gnl|my_center|LOCUS_00820 89962 89477 gene locus_tag LOCUS_00830 89962 89477 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090553.1 protein_id gnl|my_center|LOCUS_00830 90434 90697 gene locus_tag LOCUS_00840 90434 90697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 93593 90798 gene locus_tag LOCUS_00850 93593 90798 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202101.1 protein_id gnl|my_center|LOCUS_00850 93959 94213 gene locus_tag LOCUS_00860 93959 94213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 94194 94673 gene locus_tag LOCUS_00870 94194 94673 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975642.1 protein_id gnl|my_center|LOCUS_00870 95372 95049 gene locus_tag LOCUS_00880 gene mazF9 95372 95049 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414166.1 protein_id gnl|my_center|LOCUS_00880 95589 95359 gene locus_tag LOCUS_00890 95589 95359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 95961 95767 gene locus_tag LOCUS_00900 95961 95767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 96209 95898 gene locus_tag LOCUS_00910 96209 95898 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626089.1 protein_id gnl|my_center|LOCUS_00910 97609 96221 gene locus_tag LOCUS_00920 gene lysC 97609 96221 CDS product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931789.1 protein_id gnl|my_center|LOCUS_00920 98242 97676 gene locus_tag LOCUS_00930 98242 97676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246043.1 protein_id gnl|my_center|LOCUS_00930 98503 98652 gene locus_tag LOCUS_00940 98503 98652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 100156 98762 gene locus_tag LOCUS_00950 100156 98762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 101763 100525 gene locus_tag LOCUS_00960 101763 100525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 102072 101806 gene locus_tag LOCUS_00970 102072 101806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 102842 102060 gene locus_tag LOCUS_00980 102842 102060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 103265 103008 gene locus_tag LOCUS_00990 103265 103008 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263488.1 protein_id gnl|my_center|LOCUS_00990 103837 103481 gene locus_tag LOCUS_01000 103837 103481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 104061 103834 gene locus_tag LOCUS_01010 104061 103834 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_01010 105377 104322 gene locus_tag LOCUS_01020 105377 104322 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901873.1 protein_id gnl|my_center|LOCUS_01020 106253 105465 gene locus_tag LOCUS_01030 gene fabG 106253 105465 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099550.1 protein_id gnl|my_center|LOCUS_01030 106373 108376 gene locus_tag LOCUS_01040 106373 108376 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839249.1 protein_id gnl|my_center|LOCUS_01040 108373 109260 gene locus_tag LOCUS_01050 108373 109260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 109541 109257 gene locus_tag LOCUS_01060 109541 109257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01060 111333 109510 gene locus_tag LOCUS_01070 111333 109510 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01070 111465 112100 gene locus_tag LOCUS_01080 111465 112100 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653302.1 protein_id gnl|my_center|LOCUS_01080 112753 112184 gene locus_tag LOCUS_01090 112753 112184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 113281 112832 gene locus_tag LOCUS_01100 113281 112832 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142675.1 protein_id gnl|my_center|LOCUS_01100 113408 116185 gene locus_tag LOCUS_01110 113408 116185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 116366 117280 gene locus_tag LOCUS_01120 116366 117280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 117455 117658 gene locus_tag LOCUS_01130 117455 117658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 117642 117944 gene locus_tag LOCUS_01140 117642 117944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 118121 119230 gene locus_tag LOCUS_01150 gene hppD 118121 119230 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810922.1 protein_id gnl|my_center|LOCUS_01150 119315 120619 gene locus_tag LOCUS_01160 gene hmgA 119315 120619 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194851.1 protein_id gnl|my_center|LOCUS_01160 120810 121712 gene locus_tag LOCUS_01170 120810 121712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840171.1 protein_id gnl|my_center|LOCUS_01170 121798 122550 gene locus_tag LOCUS_01180 121798 122550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 123977 122598 gene locus_tag LOCUS_01190 123977 122598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 124078 124863 gene locus_tag LOCUS_01200 124078 124863 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232221.1 protein_id gnl|my_center|LOCUS_01200 125561 124860 gene locus_tag LOCUS_01210 125561 124860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 128003 125625 gene locus_tag LOCUS_01220 128003 125625 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206290416.1 protein_id gnl|my_center|LOCUS_01220 129052 128282 gene locus_tag LOCUS_01230 129052 128282 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969935.1 protein_id gnl|my_center|LOCUS_01230 130197 129223 gene locus_tag LOCUS_01240 130197 129223 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883993.1 protein_id gnl|my_center|LOCUS_01240 131102 130194 gene locus_tag LOCUS_01250 131102 130194 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867634.1 protein_id gnl|my_center|LOCUS_01250 131563 132858 gene locus_tag LOCUS_01260 131563 132858 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144244.1 protein_id gnl|my_center|LOCUS_01260 133030 134370 gene locus_tag LOCUS_01270 133030 134370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 134502 135686 gene locus_tag LOCUS_01280 134502 135686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 137088 135907 gene locus_tag LOCUS_01290 137088 135907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 138325 137210 gene locus_tag LOCUS_01300 138325 137210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 139311 138322 gene locus_tag LOCUS_01310 139311 138322 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_01310 139366 140859 gene locus_tag LOCUS_01320 139366 140859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 142597 141668 gene locus_tag LOCUS_01330 142597 141668 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838981.1 protein_id gnl|my_center|LOCUS_01330 142726 144570 gene locus_tag LOCUS_01340 gene uvrC 142726 144570 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_01340 145592 144753 gene locus_tag LOCUS_01350 gene proC 145592 144753 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258104.1 protein_id gnl|my_center|LOCUS_01350 145727 146920 gene locus_tag LOCUS_01360 gene tyrS 145727 146920 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941800.1 protein_id gnl|my_center|LOCUS_01360 146920 147771 gene locus_tag LOCUS_01370 146920 147771 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256259.1 protein_id gnl|my_center|LOCUS_01370 149110 147773 gene locus_tag LOCUS_01380 149110 147773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 149278 150237 gene locus_tag LOCUS_01390 149278 150237 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403405.1 protein_id gnl|my_center|LOCUS_01390 151293 150373 gene locus_tag LOCUS_01400 151293 150373 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944030.1 protein_id gnl|my_center|LOCUS_01400 152261 151293 gene locus_tag LOCUS_01410 152261 151293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 152758 152282 gene locus_tag LOCUS_01420 152758 152282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01420 153572 152643 gene locus_tag LOCUS_01430 153572 152643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01430 154163 153762 gene locus_tag LOCUS_01440 154163 153762 CDS product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072996.1 protein_id gnl|my_center|LOCUS_01440 154710 154303 gene locus_tag LOCUS_01450 154710 154303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 155262 154711 gene locus_tag LOCUS_01460 155262 154711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 156079 155276 gene locus_tag LOCUS_01470 156079 155276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 156670 156083 gene locus_tag LOCUS_01480 156670 156083 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383604.1 protein_id gnl|my_center|LOCUS_01480 157055 156675 gene locus_tag LOCUS_01490 157055 156675 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793035.1 protein_id gnl|my_center|LOCUS_01490 157798 157055 gene locus_tag LOCUS_01500 157798 157055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 158202 157798 gene locus_tag LOCUS_01510 158202 157798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01510 158609 158202 gene locus_tag LOCUS_01520 158609 158202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01520 158955 158602 gene locus_tag LOCUS_01530 158955 158602 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902561.1 protein_id gnl|my_center|LOCUS_01530 159546 159007 gene locus_tag LOCUS_01540 159546 159007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 159889 159551 gene locus_tag LOCUS_01550 159889 159551 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614659.1 protein_id gnl|my_center|LOCUS_01550 160325 159891 gene locus_tag LOCUS_01560 160325 159891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 161095 160613 gene locus_tag LOCUS_01570 161095 160613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 162389 161139 gene locus_tag LOCUS_01580 162389 161139 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226524.1 protein_id gnl|my_center|LOCUS_01580 162711 162358 gene locus_tag LOCUS_01590 162711 162358 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229205.1 protein_id gnl|my_center|LOCUS_01590 163992 162871 gene locus_tag LOCUS_01600 163992 162871 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_01600 164096 164698 gene locus_tag LOCUS_01610 gene lexA 164096 164698 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087594.1 protein_id gnl|my_center|LOCUS_01610 164906 165544 gene locus_tag LOCUS_01620 164906 165544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 165537 166787 gene locus_tag LOCUS_01630 165537 166787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 167003 170029 gene locus_tag LOCUS_01640 167003 170029 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267744.1 protein_id gnl|my_center|LOCUS_01640 170096 170218 gene locus_tag LOCUS_01650 170096 170218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 170473 170928 gene locus_tag LOCUS_01660 170473 170928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 171532 171654 gene locus_tag LOCUS_01670 171532 171654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 171819 173654 gene locus_tag LOCUS_01680 171819 173654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 174057 175235 gene locus_tag LOCUS_01690 174057 175235 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257780.1 protein_id gnl|my_center|LOCUS_01690 175931 175353 gene locus_tag LOCUS_01700 175931 175353 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947704.1 protein_id gnl|my_center|LOCUS_01700 176452 175928 gene locus_tag LOCUS_01710 176452 175928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 176555 177919 gene locus_tag LOCUS_01720 176555 177919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 178381 177869 gene locus_tag LOCUS_01730 178381 177869 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326890.1 protein_id gnl|my_center|LOCUS_01730 178564 180555 gene locus_tag LOCUS_01740 178564 180555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 180717 181622 gene locus_tag LOCUS_01750 180717 181622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 183871 181760 gene locus_tag LOCUS_01760 183871 181760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 184107 184499 gene locus_tag LOCUS_01770 184107 184499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 187329 184525 gene locus_tag LOCUS_01780 187329 184525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 187897 187418 gene locus_tag LOCUS_01790 187897 187418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 190334 187980 gene locus_tag LOCUS_01800 190334 187980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 190471 191034 gene locus_tag LOCUS_01810 190471 191034 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_01810 191038 191859 gene locus_tag LOCUS_01820 191038 191859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 194244 192223 gene locus_tag LOCUS_01830 194244 192223 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546696.1 protein_id gnl|my_center|LOCUS_01830 195875 195057 gene locus_tag LOCUS_01840 195875 195057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 196016 197266 gene locus_tag LOCUS_01850 196016 197266 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929473.1 protein_id gnl|my_center|LOCUS_01850 197635 197276 gene locus_tag LOCUS_01860 197635 197276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 198217 197942 gene locus_tag LOCUS_01870 198217 197942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 198458 198165 gene locus_tag LOCUS_01880 198458 198165 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010699606.1 protein_id gnl|my_center|LOCUS_01880 199156 198500 gene locus_tag LOCUS_01890 199156 198500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 199749 199387 gene locus_tag LOCUS_01900 gene rplS 199749 199387 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941309.1 protein_id gnl|my_center|LOCUS_01900 200518 199823 gene locus_tag LOCUS_01910 gene trmD 200518 199823 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_01910 201103 200588 gene locus_tag LOCUS_01920 gene rimM 201103 200588 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392484.1 protein_id gnl|my_center|LOCUS_01920 201372 201142 gene locus_tag LOCUS_01930 201372 201142 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941305.1 protein_id gnl|my_center|LOCUS_01930 201679 201458 gene locus_tag LOCUS_01940 201679 201458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 202118 201741 gene locus_tag LOCUS_01950 202118 201741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 203690 202194 gene locus_tag LOCUS_01960 gene ffh 203690 202194 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392481.1 protein_id gnl|my_center|LOCUS_01960 204567 203941 gene locus_tag LOCUS_01970 204567 203941 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399422.1 protein_id gnl|my_center|LOCUS_01970 204596 205636 gene locus_tag LOCUS_01980 204596 205636 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484633.1 protein_id gnl|my_center|LOCUS_01980 205636 205899 gene locus_tag LOCUS_01990 205636 205899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 206140 206544 gene locus_tag LOCUS_02000 206140 206544 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528904.1 protein_id gnl|my_center|LOCUS_02000 207608 206541 gene locus_tag LOCUS_02010 207608 206541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 209158 207692 gene locus_tag LOCUS_02020 209158 207692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 209871 209155 gene locus_tag LOCUS_02030 209871 209155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 210092 210718 gene locus_tag LOCUS_02040 210092 210718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 210813 211418 gene locus_tag LOCUS_02050 210813 211418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 211949 211584 gene locus_tag LOCUS_02060 211949 211584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 212403 211975 gene locus_tag LOCUS_02070 212403 211975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 213027 212413 gene locus_tag LOCUS_02080 213027 212413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 213512 213027 gene locus_tag LOCUS_02090 213512 213027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 213784 213515 gene locus_tag LOCUS_02100 213784 213515 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529430.1 protein_id gnl|my_center|LOCUS_02100 214894 213989 gene locus_tag LOCUS_02110 214894 213989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 215418 215056 gene locus_tag LOCUS_02120 215418 215056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 216731 215484 gene locus_tag LOCUS_02130 216731 215484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 217287 217081 gene locus_tag LOCUS_02140 217287 217081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 217529 217314 gene locus_tag LOCUS_02150 217529 217314 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_02150 218859 217705 gene locus_tag LOCUS_02160 gene mqnE 218859 217705 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941110.1 protein_id gnl|my_center|LOCUS_02160 219017 220330 gene locus_tag LOCUS_02170 219017 220330 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 protein_id gnl|my_center|LOCUS_02170 220393 221676 gene locus_tag LOCUS_02180 220393 221676 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 protein_id gnl|my_center|LOCUS_02180 223099 222233 gene locus_tag LOCUS_02190 gene ubiA 223099 222233 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941108.1 protein_id gnl|my_center|LOCUS_02190 223151 223606 gene locus_tag LOCUS_02200 223151 223606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 223615 224148 gene locus_tag LOCUS_02210 223615 224148 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143393.1 protein_id gnl|my_center|LOCUS_02210 225718 224501 gene locus_tag LOCUS_02220 225718 224501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 225932 228661 gene locus_tag LOCUS_02230 225932 228661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 228751 229836 gene locus_tag LOCUS_02240 gene wecB 228751 229836 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060909.1 protein_id gnl|my_center|LOCUS_02240 230435 230097 gene locus_tag LOCUS_02250 230435 230097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 231882 230488 gene locus_tag LOCUS_02260 gene purF 231882 230488 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_02260 232211 232519 gene locus_tag LOCUS_02270 232211 232519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 234689 232485 gene locus_tag LOCUS_02280 234689 232485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 237479 234804 gene locus_tag LOCUS_02290 237479 234804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 237850 237506 gene locus_tag LOCUS_02300 237850 237506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02300 238773 237835 gene locus_tag LOCUS_02310 238773 237835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02310 239125 240603 gene locus_tag LOCUS_02320 gene crtI 239125 240603 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066789316.1 protein_id gnl|my_center|LOCUS_02320 241673 240600 gene locus_tag LOCUS_02330 241673 240600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 242061 245306 gene locus_tag LOCUS_02340 242061 245306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 247979 245370 gene locus_tag LOCUS_02350 247979 245370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 248376 249323 gene locus_tag LOCUS_02360 248376 249323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 249529 249317 gene locus_tag LOCUS_02370 249529 249317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 249737 250669 gene locus_tag LOCUS_02380 249737 250669 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941353.1 protein_id gnl|my_center|LOCUS_02380 250754 251971 gene locus_tag LOCUS_02390 250754 251971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 252600 251968 gene locus_tag LOCUS_02400 252600 251968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 253016 252597 gene locus_tag LOCUS_02410 253016 252597 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945922.1 protein_id gnl|my_center|LOCUS_02410 254761 253022 gene locus_tag LOCUS_02420 254761 253022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 255864 254911 gene locus_tag LOCUS_02430 255864 254911 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937757.1 protein_id gnl|my_center|LOCUS_02430 256672 255911 gene locus_tag LOCUS_02440 256672 255911 CDS product GPMC system MBL fold metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943103.1 protein_id gnl|my_center|LOCUS_02440 257275 256751 gene locus_tag LOCUS_02450 257275 256751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 257409 258212 gene locus_tag LOCUS_02460 gene mazG 257409 258212 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545835.1 protein_id gnl|my_center|LOCUS_02460 258988 258290 gene locus_tag LOCUS_02470 258988 258290 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568463.1 protein_id gnl|my_center|LOCUS_02470 260195 259203 gene locus_tag LOCUS_02480 260195 259203 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967072.1 protein_id gnl|my_center|LOCUS_02480 260987 260364 gene locus_tag LOCUS_02490 260987 260364 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141682.1 protein_id gnl|my_center|LOCUS_02490 263040 261034 gene locus_tag LOCUS_02500 gene tkt 263040 261034 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142294.1 protein_id gnl|my_center|LOCUS_02500 264646 263186 gene locus_tag LOCUS_02510 264646 263186 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015563.1 protein_id gnl|my_center|LOCUS_02510 264786 265634 gene locus_tag LOCUS_02520 264786 265634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 266033 265737 gene locus_tag LOCUS_02530 266033 265737 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477866.1 protein_id gnl|my_center|LOCUS_02530 266545 266066 gene locus_tag LOCUS_02540 266545 266066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 266760 266542 gene locus_tag LOCUS_02550 266760 266542 CDS product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107822.1 protein_id gnl|my_center|LOCUS_02550 267541 266765 gene locus_tag LOCUS_02560 267541 266765 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173231.1 protein_id gnl|my_center|LOCUS_02560 268040 269311 gene locus_tag LOCUS_02570 gene murA 268040 269311 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946583.1 protein_id gnl|my_center|LOCUS_02570 270098 269319 gene locus_tag LOCUS_02580 270098 269319 CDS product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228729.1 protein_id gnl|my_center|LOCUS_02580 270544 270756 gene locus_tag LOCUS_02590 gene cspB 270544 270756 CDS product cold shock-like protein CspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161731.1 protein_id gnl|my_center|LOCUS_02590 271149 270832 gene locus_tag LOCUS_02600 271149 270832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 271355 272743 gene locus_tag LOCUS_02610 gene selA 271355 272743 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880641.1 protein_id gnl|my_center|LOCUS_02610 272833 273528 gene locus_tag LOCUS_02620 272833 273528 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121737.1 protein_id gnl|my_center|LOCUS_02620 273712 274206 gene locus_tag LOCUS_02630 273712 274206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 275289 274207 gene locus_tag LOCUS_02640 gene serC 275289 274207 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931650.1 protein_id gnl|my_center|LOCUS_02640 275579 276181 gene locus_tag LOCUS_02650 gene fadR 275579 276181 CDS product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229547.1 protein_id gnl|my_center|LOCUS_02650 276178 278013 gene locus_tag LOCUS_02660 276178 278013 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_02660 278169 278477 gene locus_tag LOCUS_02670 278169 278477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 281065 278945 gene locus_tag LOCUS_02680 281065 278945 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080037.1 protein_id gnl|my_center|LOCUS_02680 281915 282223 gene locus_tag LOCUS_02690 281915 282223 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_02690 282245 282919 gene locus_tag LOCUS_02700 gene recR 282245 282919 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963454.1 protein_id gnl|my_center|LOCUS_02700 283223 282975 gene locus_tag LOCUS_02710 283223 282975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 285941 283437 gene locus_tag LOCUS_02720 285941 283437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 289487 286440 gene locus_tag LOCUS_02730 289487 286440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 289656 289513 gene locus_tag LOCUS_02740 289656 289513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 290749 289694 gene locus_tag LOCUS_02750 290749 289694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 291525 290848 gene locus_tag LOCUS_02760 291525 290848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 292598 291504 gene locus_tag LOCUS_02770 292598 291504 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02770 292865 294022 gene locus_tag LOCUS_02780 292865 294022 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507840.1 protein_id gnl|my_center|LOCUS_02780 294398 294090 gene locus_tag LOCUS_02790 294398 294090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 294424 296553 gene locus_tag LOCUS_02800 294424 296553 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583832.1 protein_id gnl|my_center|LOCUS_02800 297412 296891 gene locus_tag LOCUS_02810 297412 296891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 297991 297566 gene locus_tag LOCUS_02820 297991 297566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 298914 298297 gene locus_tag LOCUS_02830 298914 298297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 299184 298951 gene locus_tag LOCUS_02840 299184 298951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 300733 299249 gene locus_tag LOCUS_02850 300733 299249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 301285 304368 gene locus_tag LOCUS_02860 301285 304368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 304514 305119 gene locus_tag LOCUS_02870 304514 305119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 305218 305664 gene locus_tag LOCUS_02880 gene fabZ 305218 305664 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919778.1 protein_id gnl|my_center|LOCUS_02880 305673 305984 gene locus_tag LOCUS_02890 305673 305984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 305985 306764 gene locus_tag LOCUS_02900 gene lpxA 305985 306764 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_02900 308095 307394 gene locus_tag LOCUS_02910 308095 307394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 308728 308144 gene locus_tag LOCUS_02920 308728 308144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 309319 308819 gene locus_tag LOCUS_02930 309319 308819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 309627 309337 gene locus_tag LOCUS_02940 309627 309337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 310606 309794 gene locus_tag LOCUS_02950 310606 309794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 311490 311242 gene locus_tag LOCUS_02960 311490 311242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 311945 311514 gene locus_tag LOCUS_02970 311945 311514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 313517 312345 gene locus_tag LOCUS_02980 313517 312345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02980 317574 313510 gene locus_tag LOCUS_02990 317574 313510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 318745 317642 gene locus_tag LOCUS_03000 318745 317642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 319295 319519 gene locus_tag LOCUS_03010 319295 319519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 321906 319996 gene locus_tag LOCUS_03020 gene asnB 321906 319996 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027075.1 protein_id gnl|my_center|LOCUS_03020 323430 322006 gene locus_tag LOCUS_03030 323430 322006 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_03030 324777 323584 gene locus_tag LOCUS_03040 gene cruC 324777 323584 CDS product hydroxychlorobactene glucosyltransferase CruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933643.1 protein_id gnl|my_center|LOCUS_03040 325385 324870 gene locus_tag LOCUS_03050 325385 324870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 325721 326086 gene locus_tag LOCUS_03060 325721 326086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 326155 327300 gene locus_tag LOCUS_03070 326155 327300 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405266.1 protein_id gnl|my_center|LOCUS_03070 327961 327392 gene locus_tag LOCUS_03080 327961 327392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 328204 328725 gene locus_tag LOCUS_03090 328204 328725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 329595 328798 gene locus_tag LOCUS_03100 329595 328798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 329751 330482 gene locus_tag LOCUS_03110 329751 330482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 330626 331042 gene locus_tag LOCUS_03120 330626 331042 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316056.1 protein_id gnl|my_center|LOCUS_03120 332374 331160 gene locus_tag LOCUS_03130 332374 331160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 333134 332424 gene locus_tag LOCUS_03140 333134 332424 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391312.1 protein_id gnl|my_center|LOCUS_03140 336327 333220 gene locus_tag LOCUS_03150 336327 333220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_03150 337786 336476 gene locus_tag LOCUS_03160 337786 336476 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140384.1 protein_id gnl|my_center|LOCUS_03160 339195 337792 gene locus_tag LOCUS_03170 339195 337792 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143713.1 protein_id gnl|my_center|LOCUS_03170 339457 340353 gene locus_tag LOCUS_03180 339457 340353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 343585 340553 gene locus_tag LOCUS_03190 343585 340553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 343856 346522 gene locus_tag LOCUS_03200 343856 346522 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_03200 346664 347779 gene locus_tag LOCUS_03210 346664 347779 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141167.1 protein_id gnl|my_center|LOCUS_03210 347843 348406 gene locus_tag LOCUS_03220 347843 348406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 348530 349753 gene locus_tag LOCUS_03230 348530 349753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03230 349750 349932 gene locus_tag LOCUS_03240 349750 349932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 349967 350509 gene locus_tag LOCUS_03250 349967 350509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 350669 351955 gene locus_tag LOCUS_03260 gene eno 350669 351955 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942923.1 protein_id gnl|my_center|LOCUS_03260 351976 352422 gene locus_tag LOCUS_03270 351976 352422 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481688.1 protein_id gnl|my_center|LOCUS_03270 352460 354010 gene locus_tag LOCUS_03280 gene gpmI 352460 354010 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462173.1 protein_id gnl|my_center|LOCUS_03280 354120 354737 gene locus_tag LOCUS_03290 354120 354737 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966171.1 protein_id gnl|my_center|LOCUS_03290 355024 355527 gene locus_tag LOCUS_03300 355024 355527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 356846 355644 gene locus_tag LOCUS_03310 356846 355644 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 protein_id gnl|my_center|LOCUS_03310 359378 357003 gene locus_tag LOCUS_03320 359378 357003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 359872 359447 gene locus_tag LOCUS_03330 gene nikR 359872 359447 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940151.1 protein_id gnl|my_center|LOCUS_03330 360081 361001 gene locus_tag LOCUS_03340 360081 361001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03340 360961 361668 gene locus_tag LOCUS_03350 360961 361668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03350 361862 362086 gene locus_tag LOCUS_03360 361862 362086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03360 362181 362492 gene locus_tag LOCUS_03370 362181 362492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 363145 363855 gene locus_tag LOCUS_03380 363145 363855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03380 364092 364598 gene locus_tag LOCUS_03390 364092 364598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03390 364602 365081 gene locus_tag LOCUS_03400 364602 365081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 366862 365396 gene locus_tag LOCUS_03410 366862 365396 CDS product IS1182-like element ISPa22 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112390.1 protein_id gnl|my_center|LOCUS_03410 367147 367839 gene locus_tag LOCUS_03420 367147 367839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 367940 368509 gene locus_tag LOCUS_03430 367940 368509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 368592 368840 gene locus_tag LOCUS_03440 368592 368840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 369615 368863 gene locus_tag LOCUS_03450 369615 368863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 370222 369617 gene locus_tag LOCUS_03460 370222 369617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 371402 370323 gene locus_tag LOCUS_03470 371402 370323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03470 372290 371433 gene locus_tag LOCUS_03480 372290 371433 CDS product metallo-mystery pair system four-Cys motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383153.1 protein_id gnl|my_center|LOCUS_03480 373157 372573 gene locus_tag LOCUS_03490 373157 372573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 375133 373199 gene locus_tag LOCUS_03500 375133 373199 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897930.1 protein_id gnl|my_center|LOCUS_03500 375310 376257 gene locus_tag LOCUS_03510 375310 376257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 376958 376254 gene locus_tag LOCUS_03520 376958 376254 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120331.1 protein_id gnl|my_center|LOCUS_03520 378925 376988 gene locus_tag LOCUS_03530 gene selB 378925 376988 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_03530 381130 379001 gene locus_tag LOCUS_03540 381130 379001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 383357 381222 gene locus_tag LOCUS_03550 383357 381222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 384852 383956 gene locus_tag LOCUS_03560 384852 383956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 385266 384919 gene locus_tag LOCUS_03570 385266 384919 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047999.1 protein_id gnl|my_center|LOCUS_03570 385546 386121 gene locus_tag LOCUS_03580 385546 386121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 386758 386093 gene locus_tag LOCUS_03590 386758 386093 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085274.1 protein_id gnl|my_center|LOCUS_03590 387787 386831 gene locus_tag LOCUS_03600 387787 386831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 387874 388284 gene locus_tag LOCUS_03610 387874 388284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 388281 390230 gene locus_tag LOCUS_03620 388281 390230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 390429 390689 gene locus_tag LOCUS_03630 390429 390689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 390753 392297 gene locus_tag LOCUS_03640 390753 392297 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118670.1 protein_id gnl|my_center|LOCUS_03640 392894 392337 gene locus_tag LOCUS_03650 392894 392337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 393975 392923 gene locus_tag LOCUS_03660 393975 392923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122840.1 protein_id gnl|my_center|LOCUS_03660 395584 393992 gene locus_tag LOCUS_03670 395584 393992 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921438.1 protein_id gnl|my_center|LOCUS_03670 397234 395705 gene locus_tag LOCUS_03680 397234 395705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 397310 397987 gene locus_tag LOCUS_03690 397310 397987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 398956 398024 gene locus_tag LOCUS_03700 398956 398024 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141662.1 protein_id gnl|my_center|LOCUS_03700 399125 399787 gene locus_tag LOCUS_03710 399125 399787 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647882.1 protein_id gnl|my_center|LOCUS_03710 400218 399772 gene locus_tag LOCUS_03720 400218 399772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 401951 400485 gene locus_tag LOCUS_03730 401951 400485 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889218.1 protein_id gnl|my_center|LOCUS_03730 402157 404247 gene locus_tag LOCUS_03740 402157 404247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 404596 404408 gene locus_tag LOCUS_03750 404596 404408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 404985 404593 gene locus_tag LOCUS_03760 404985 404593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 405666 405049 gene locus_tag LOCUS_03770 405666 405049 CDS product flavin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188642117.1 protein_id gnl|my_center|LOCUS_03770 406804 405797 gene locus_tag LOCUS_03780 406804 405797 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774414.1 protein_id gnl|my_center|LOCUS_03780 406911 408029 gene locus_tag LOCUS_03790 gene thiO 406911 408029 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_03790 408064 409470 gene locus_tag LOCUS_03800 408064 409470 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123790.1 protein_id gnl|my_center|LOCUS_03800 409496 410125 gene locus_tag LOCUS_03810 409496 410125 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870143.1 protein_id gnl|my_center|LOCUS_03810 410165 410950 gene locus_tag LOCUS_03820 410165 410950 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725652.1 protein_id gnl|my_center|LOCUS_03820 411201 412568 gene locus_tag LOCUS_03830 411201 412568 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963328.1 protein_id gnl|my_center|LOCUS_03830 412614 413993 gene locus_tag LOCUS_03840 412614 413993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 414056 414895 gene locus_tag LOCUS_03850 414056 414895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 414926 416425 gene locus_tag LOCUS_03860 414926 416425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 417112 417867 gene locus_tag LOCUS_03870 417112 417867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 417871 419094 gene locus_tag LOCUS_03880 417871 419094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 419104 419874 gene locus_tag LOCUS_03890 419104 419874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 419950 421302 gene locus_tag LOCUS_03900 gene tssK 419950 421302 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343637.1 protein_id gnl|my_center|LOCUS_03900 421424 422101 gene locus_tag LOCUS_03910 421424 422101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 422186 425779 gene locus_tag LOCUS_03920 422186 425779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 425788 426582 gene locus_tag LOCUS_03930 gene tagJ 425788 426582 CDS product type VI secretion system accessory protein TagJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119488.1 protein_id gnl|my_center|LOCUS_03930 426584 427129 gene locus_tag LOCUS_03940 426584 427129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 427186 428319 gene locus_tag LOCUS_03950 gene tssA 427186 428319 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343647.1 protein_id gnl|my_center|LOCUS_03950 428381 428893 gene locus_tag LOCUS_03960 gene tssB 428381 428893 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318241.1 protein_id gnl|my_center|LOCUS_03960 428896 430380 gene locus_tag LOCUS_03970 gene tssC 428896 430380 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343625.1 protein_id gnl|my_center|LOCUS_03970 430562 431062 gene locus_tag LOCUS_03980 430562 431062 CDS product type VI secretion system tube protein Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086373.1 protein_id gnl|my_center|LOCUS_03980 431173 431658 gene locus_tag LOCUS_03990 gene tssE 431173 431658 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204912.1 protein_id gnl|my_center|LOCUS_03990 431669 432094 gene locus_tag LOCUS_04000 431669 432094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 432100 432588 gene locus_tag LOCUS_04010 432100 432588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 432636 434528 gene locus_tag LOCUS_04020 gene tssF 432636 434528 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343627.1 protein_id gnl|my_center|LOCUS_04020 434685 435695 gene locus_tag LOCUS_04030 gene tssG 434685 435695 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269329.1 protein_id gnl|my_center|LOCUS_04030 435736 436323 gene locus_tag LOCUS_04040 435736 436323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04040 436387 436905 gene locus_tag LOCUS_04050 436387 436905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04050 436865 437419 gene locus_tag LOCUS_04060 436865 437419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04060 437493 437801 gene locus_tag LOCUS_04070 437493 437801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04070 437813 437971 gene locus_tag LOCUS_04080 437813 437971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04080 438054 438509 gene locus_tag LOCUS_04090 438054 438509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04090 438802 438936 gene locus_tag LOCUS_04100 438802 438936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 438959 439126 gene locus_tag LOCUS_04110 438959 439126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 439162 439350 gene locus_tag LOCUS_04120 439162 439350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 439370 439714 gene locus_tag LOCUS_04130 439370 439714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04130 439836 440093 gene locus_tag LOCUS_04140 439836 440093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 440194 440799 gene locus_tag LOCUS_04150 440194 440799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04150 440802 441014 gene locus_tag LOCUS_04160 440802 441014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 441078 441533 gene locus_tag LOCUS_04170 441078 441533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 441777 442190 gene locus_tag LOCUS_04180 441777 442190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 442366 442749 gene locus_tag LOCUS_04190 442366 442749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 442775 442954 gene locus_tag LOCUS_04200 442775 442954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 443096 443356 gene locus_tag LOCUS_04210 443096 443356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 443535 443879 gene locus_tag LOCUS_04220 443535 443879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 444078 444455 gene locus_tag LOCUS_04230 444078 444455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 444608 444964 gene locus_tag LOCUS_04240 444608 444964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 445230 445060 gene locus_tag LOCUS_04250 445230 445060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04250 445487 445242 gene locus_tag LOCUS_04260 445487 445242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04260 446124 445678 gene locus_tag LOCUS_04270 446124 445678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04270 446487 446717 gene locus_tag LOCUS_04280 446487 446717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 446790 447233 gene locus_tag LOCUS_04290 446790 447233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04290 447422 448567 gene locus_tag LOCUS_04300 447422 448567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04300 449335 448838 gene locus_tag LOCUS_04310 449335 448838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 451826 449499 gene locus_tag LOCUS_04320 451826 449499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 452126 452419 gene locus_tag LOCUS_04330 gene rplU 452126 452419 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392094.1 protein_id gnl|my_center|LOCUS_04330 452513 452797 gene locus_tag LOCUS_04340 gene rpmA 452513 452797 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140826.1 protein_id gnl|my_center|LOCUS_04340 453398 452868 gene locus_tag LOCUS_04350 453398 452868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 453877 453464 gene locus_tag LOCUS_04360 453877 453464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 454471 453914 gene locus_tag LOCUS_04370 454471 453914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 455136 454456 gene locus_tag LOCUS_04380 455136 454456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 455529 455248 gene locus_tag LOCUS_04390 455529 455248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 457499 456399 gene locus_tag LOCUS_04400 457499 456399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 457768 457499 gene locus_tag LOCUS_04410 457768 457499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 458393 457956 gene locus_tag LOCUS_04420 458393 457956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 460710 461219 gene locus_tag LOCUS_04430 460710 461219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 461373 461879 gene locus_tag LOCUS_04440 461373 461879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 462193 463515 gene locus_tag LOCUS_04450 462193 463515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 463823 464293 gene locus_tag LOCUS_04460 463823 464293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 464385 464702 gene locus_tag LOCUS_04470 464385 464702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 465270 466079 gene locus_tag LOCUS_04480 465270 466079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 466133 466648 gene locus_tag LOCUS_04490 466133 466648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 467119 467490 gene locus_tag LOCUS_04500 467119 467490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 467930 468499 gene locus_tag LOCUS_04510 467930 468499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 469263 469457 gene locus_tag LOCUS_04520 469263 469457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 469519 469995 gene locus_tag LOCUS_04530 469519 469995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 470144 470656 gene locus_tag LOCUS_04540 470144 470656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 471275 470766 gene locus_tag LOCUS_04550 471275 470766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04550 472035 471211 gene locus_tag LOCUS_04560 472035 471211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04560 473275 472049 gene locus_tag LOCUS_04570 473275 472049 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933019.1 protein_id gnl|my_center|LOCUS_04570 474602 475555 gene locus_tag LOCUS_04580 474602 475555 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040114520.1 protein_id gnl|my_center|LOCUS_04580 476525 476989 gene locus_tag LOCUS_04590 476525 476989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04590 476986 477573 gene locus_tag LOCUS_04600 476986 477573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04600 477554 477868 gene locus_tag LOCUS_04610 477554 477868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 477858 478526 gene locus_tag LOCUS_04620 gene nadD 477858 478526 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015061.1 protein_id gnl|my_center|LOCUS_04620 478526 478954 gene locus_tag LOCUS_04630 gene rsfS 478526 478954 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976226.1 protein_id gnl|my_center|LOCUS_04630 479098 478949 gene locus_tag LOCUS_04640 479098 478949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 481768 479108 gene locus_tag LOCUS_04650 481768 479108 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061075.1 protein_id gnl|my_center|LOCUS_04650 481926 482402 gene locus_tag LOCUS_04660 gene rlmH 481926 482402 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002458513.1 protein_id gnl|my_center|LOCUS_04660 482399 482752 gene locus_tag LOCUS_04670 482399 482752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 483019 482789 gene locus_tag LOCUS_04680 483019 482789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 483035 483517 gene locus_tag LOCUS_04690 483035 483517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 485569 483572 gene locus_tag LOCUS_04700 485569 483572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 485996 485589 gene locus_tag LOCUS_04710 485996 485589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 487182 486397 gene locus_tag LOCUS_04720 gene galU 487182 486397 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941523.1 protein_id gnl|my_center|LOCUS_04720 487372 488721 gene locus_tag LOCUS_04730 gene serS 487372 488721 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937547.1 protein_id gnl|my_center|LOCUS_04730 488869 489477 gene locus_tag LOCUS_04740 488869 489477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 489567 489815 gene locus_tag LOCUS_04750 489567 489815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 489809 490123 gene locus_tag LOCUS_04760 489809 490123 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 protein_id gnl|my_center|LOCUS_04760 490152 490679 gene locus_tag LOCUS_04770 490152 490679 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195801.1 protein_id gnl|my_center|LOCUS_04770 490672 491862 gene locus_tag LOCUS_04780 490672 491862 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392227.1 protein_id gnl|my_center|LOCUS_04780 491888 493327 gene locus_tag LOCUS_04790 491888 493327 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029647.1 protein_id gnl|my_center|LOCUS_04790 493334 494881 gene locus_tag LOCUS_04800 493334 494881 CDS product methyltransferase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967728.1 protein_id gnl|my_center|LOCUS_04800 495124 496635 gene locus_tag LOCUS_04810 495124 496635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 497408 496692 gene locus_tag LOCUS_04820 497408 496692 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889586.1 protein_id gnl|my_center|LOCUS_04820 497529 499289 gene locus_tag LOCUS_04830 497529 499289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 499638 502652 gene locus_tag LOCUS_04840 499638 502652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 502649 503293 gene locus_tag LOCUS_04850 502649 503293 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939847.1 protein_id gnl|my_center|LOCUS_04850 503474 503818 gene locus_tag LOCUS_04860 503474 503818 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544974.1 protein_id gnl|my_center|LOCUS_04860 503893 505017 gene locus_tag LOCUS_04870 503893 505017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 505044 505400 gene locus_tag LOCUS_04880 505044 505400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 505436 505603 gene locus_tag LOCUS_04890 505436 505603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 505610 507673 gene locus_tag LOCUS_04900 505610 507673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 508913 507702 gene locus_tag LOCUS_04910 gene fabF 508913 507702 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_04910 509973 509770 gene locus_tag LOCUS_04920 509973 509770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 511197 511424 gene locus_tag LOCUS_04930 511197 511424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 511532 512080 gene locus_tag LOCUS_04940 511532 512080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 512764 514233 gene locus_tag LOCUS_04950 gene gatB 512764 514233 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_04950 514459 515250 gene locus_tag LOCUS_04960 514459 515250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 515614 515216 gene locus_tag LOCUS_04970 515614 515216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 515628 515888 gene locus_tag LOCUS_04980 515628 515888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04980 518850 516016 gene locus_tag LOCUS_04990 518850 516016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 520401 518878 gene locus_tag LOCUS_05000 520401 518878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 521990 520410 gene locus_tag LOCUS_05010 521990 520410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 522542 522039 gene locus_tag LOCUS_05020 522542 522039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 525013 522545 gene locus_tag LOCUS_05030 525013 522545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 525014 525205 gene locus_tag LOCUS_05040 525014 525205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 525401 527197 gene locus_tag LOCUS_05050 525401 527197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 527208 528089 gene locus_tag LOCUS_05060 527208 528089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 528146 529075 gene locus_tag LOCUS_05070 gene trxB 528146 529075 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229015.1 protein_id gnl|my_center|LOCUS_05070 529260 529069 gene locus_tag LOCUS_05080 529260 529069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 529290 533033 gene locus_tag LOCUS_05090 529290 533033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 533911 533255 gene locus_tag LOCUS_05100 gene cobC 533911 533255 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_05100 535104 534028 gene locus_tag LOCUS_05110 gene prfA 535104 534028 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545879.1 protein_id gnl|my_center|LOCUS_05110 536315 535197 gene locus_tag LOCUS_05120 536315 535197 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943726.1 protein_id gnl|my_center|LOCUS_05120 536720 536514 gene locus_tag LOCUS_05130 gene rpmE 536720 536514 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768737.1 protein_id gnl|my_center|LOCUS_05130 538100 536799 gene locus_tag LOCUS_05140 538100 536799 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104944.1 protein_id gnl|my_center|LOCUS_05140 538087 538578 gene locus_tag LOCUS_05150 538087 538578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 538834 539268 gene locus_tag LOCUS_05160 538834 539268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888930.1 protein_id gnl|my_center|LOCUS_05160 539292 539702 gene locus_tag LOCUS_05170 539292 539702 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815126.1 protein_id gnl|my_center|LOCUS_05170 539766 540695 gene locus_tag LOCUS_05180 539766 540695 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957564.1 protein_id gnl|my_center|LOCUS_05180 542345 540768 gene locus_tag LOCUS_05190 542345 540768 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178932430.1 protein_id gnl|my_center|LOCUS_05190 543279 542380 gene locus_tag LOCUS_05200 543279 542380 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037553.1 protein_id gnl|my_center|LOCUS_05200 544554 543295 gene locus_tag LOCUS_05210 544554 543295 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114957.1 protein_id gnl|my_center|LOCUS_05210 544827 544591 gene locus_tag LOCUS_05220 544827 544591 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037555.1 protein_id gnl|my_center|LOCUS_05220 545998 544814 gene locus_tag LOCUS_05230 gene lhpB 545998 544814 CDS product D-hydroxyproline dehydrogenase subunit beta LhpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114955.1 protein_id gnl|my_center|LOCUS_05230 546939 545995 gene locus_tag LOCUS_05240 546939 545995 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114954.1 protein_id gnl|my_center|LOCUS_05240 547870 547004 gene locus_tag LOCUS_05250 547870 547004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 547963 548838 gene locus_tag LOCUS_05260 547963 548838 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392660.1 protein_id gnl|my_center|LOCUS_05260 549163 548795 gene locus_tag LOCUS_05270 549163 548795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 549313 549594 gene locus_tag LOCUS_05280 549313 549594 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815560.1 protein_id gnl|my_center|LOCUS_05280 549627 550421 gene locus_tag LOCUS_05290 gene paaG 549627 550421 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186957.1 protein_id gnl|my_center|LOCUS_05290 550495 551769 gene locus_tag LOCUS_05300 550495 551769 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249995.1 protein_id gnl|my_center|LOCUS_05300 552694 551759 gene locus_tag LOCUS_05310 552694 551759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 553331 552696 gene locus_tag LOCUS_05320 553331 552696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 554957 553404 gene locus_tag LOCUS_05330 554957 553404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 555361 555131 gene locus_tag LOCUS_05340 555361 555131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 555299 555874 gene locus_tag LOCUS_05350 555299 555874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 555886 556932 gene locus_tag LOCUS_05360 555886 556932 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444177.1 protein_id gnl|my_center|LOCUS_05360 556929 557456 gene locus_tag LOCUS_05370 556929 557456 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929177.1 protein_id gnl|my_center|LOCUS_05370 559524 557566 gene locus_tag LOCUS_05380 559524 557566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 559702 561753 gene locus_tag LOCUS_05390 gene ligA 559702 561753 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031450.1 protein_id gnl|my_center|LOCUS_05390 564013 562307 gene locus_tag LOCUS_05400 gene murJ 564013 562307 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946821.1 protein_id gnl|my_center|LOCUS_05400 565525 564128 gene locus_tag LOCUS_05410 565525 564128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 565968 566678 gene locus_tag LOCUS_05420 565968 566678 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016533.1 protein_id gnl|my_center|LOCUS_05420 566717 568282 gene locus_tag LOCUS_05430 566717 568282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 568303 568803 gene locus_tag LOCUS_05440 568303 568803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 568878 569060 gene locus_tag LOCUS_05450 568878 569060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 569064 569849 gene locus_tag LOCUS_05460 569064 569849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 569879 570454 gene locus_tag LOCUS_05470 569879 570454 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048036.1 protein_id gnl|my_center|LOCUS_05470 570451 571806 gene locus_tag LOCUS_05480 570451 571806 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392478.1 protein_id gnl|my_center|LOCUS_05480 572768 572103 gene locus_tag LOCUS_05490 572768 572103 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_05490 573638 572868 gene locus_tag LOCUS_05500 gene xth 573638 572868 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140144.1 protein_id gnl|my_center|LOCUS_05500 574640 573711 gene locus_tag LOCUS_05510 gene yhdJ 574640 573711 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258883.1 protein_id gnl|my_center|LOCUS_05510 575778 574645 gene locus_tag LOCUS_05520 575778 574645 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926069.1 protein_id gnl|my_center|LOCUS_05520 577045 575834 gene locus_tag LOCUS_05530 577045 575834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 577255 577539 gene locus_tag LOCUS_05540 577255 577539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 578425 577559 gene locus_tag LOCUS_05550 gene dapF 578425 577559 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583145.1 protein_id gnl|my_center|LOCUS_05550 578885 578508 gene locus_tag LOCUS_05560 578885 578508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 581027 579129 gene locus_tag LOCUS_05570 581027 579129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 582143 581640 gene locus_tag LOCUS_05580 582143 581640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 582634 582119 gene locus_tag LOCUS_05590 582634 582119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 583858 582899 gene locus_tag LOCUS_05600 583858 582899 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398688.1 protein_id gnl|my_center|LOCUS_05600 583932 585131 gene locus_tag LOCUS_05610 583932 585131 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404343.1 protein_id gnl|my_center|LOCUS_05610 585383 589189 gene locus_tag LOCUS_05620 585383 589189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 589289 590233 gene locus_tag LOCUS_05630 gene queG 589289 590233 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920720.1 protein_id gnl|my_center|LOCUS_05630 590272 591642 gene locus_tag LOCUS_05640 590272 591642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 592057 593124 gene locus_tag LOCUS_05650 gene moaA 592057 593124 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230243.1 protein_id gnl|my_center|LOCUS_05650 593124 594287 gene locus_tag LOCUS_05660 593124 594287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 594280 594903 gene locus_tag LOCUS_05670 594280 594903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 594923 595378 gene locus_tag LOCUS_05680 594923 595378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 595375 596319 gene locus_tag LOCUS_05690 595375 596319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 597164 596457 gene locus_tag LOCUS_05700 597164 596457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 597465 599402 gene locus_tag LOCUS_05710 597465 599402 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994208.1 protein_id gnl|my_center|LOCUS_05710 599587 602520 gene locus_tag LOCUS_05720 599587 602520 CDS product ligand-binding sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036705.1 protein_id gnl|my_center|LOCUS_05720 602573 603190 gene locus_tag LOCUS_05730 602573 603190 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881293.1 protein_id gnl|my_center|LOCUS_05730 603187 603477 gene locus_tag LOCUS_05740 603187 603477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 603481 604050 gene locus_tag LOCUS_05750 603481 604050 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057305.1 protein_id gnl|my_center|LOCUS_05750 604047 604754 gene locus_tag LOCUS_05760 gene mtnC 604047 604754 CDS product acireductone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147428.1 protein_id gnl|my_center|LOCUS_05760 606518 605469 gene locus_tag LOCUS_05770 606518 605469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 606765 607235 gene locus_tag LOCUS_05780 gene msrA 606765 607235 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_05780 607566 608141 gene locus_tag LOCUS_05790 607566 608141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05790 608257 609585 gene locus_tag LOCUS_05800 608257 609585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05800 611517 609892 gene locus_tag LOCUS_05810 611517 609892 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920680.1 protein_id gnl|my_center|LOCUS_05810 612806 611640 gene locus_tag LOCUS_05820 612806 611640 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228032.1 protein_id gnl|my_center|LOCUS_05820 613296 612937 gene locus_tag LOCUS_05830 613296 612937 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525093.1 protein_id gnl|my_center|LOCUS_05830 614300 613611 gene locus_tag LOCUS_05840 614300 613611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 614746 614297 gene locus_tag LOCUS_05850 614746 614297 CDS product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228417.1 protein_id gnl|my_center|LOCUS_05850 615224 616360 gene locus_tag LOCUS_05860 gene asnA 615224 616360 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790904.1 protein_id gnl|my_center|LOCUS_05860 616667 617278 gene locus_tag LOCUS_05870 616667 617278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 617794 619779 gene locus_tag LOCUS_05880 gene thiC 617794 619779 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193963.1 protein_id gnl|my_center|LOCUS_05880 619937 620230 gene locus_tag LOCUS_05890 619937 620230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 620230 620484 gene locus_tag LOCUS_05900 620230 620484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 620450 620635 gene locus_tag LOCUS_05910 620450 620635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 620759 622087 gene locus_tag LOCUS_05920 620759 622087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 622344 622799 gene locus_tag LOCUS_05930 622344 622799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 623266 623039 gene locus_tag LOCUS_05940 623266 623039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 623956 623687 gene locus_tag LOCUS_05950 623956 623687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 624225 625676 gene locus_tag LOCUS_05960 624225 625676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05960 625924 627369 gene locus_tag LOCUS_05970 625924 627369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 628126 628386 gene locus_tag LOCUS_05980 628126 628386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 629573 628407 gene locus_tag LOCUS_05990 629573 628407 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108005.1 protein_id gnl|my_center|LOCUS_05990 629799 629605 gene locus_tag LOCUS_06000 629799 629605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 630944 630537 gene locus_tag LOCUS_06010 630944 630537 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228480.1 protein_id gnl|my_center|LOCUS_06010 633383 632442 gene locus_tag LOCUS_06020 633383 632442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 633916 633638 gene locus_tag LOCUS_06030 633916 633638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 634968 635642 gene locus_tag LOCUS_06040 634968 635642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 635663 637510 gene locus_tag LOCUS_06050 635663 637510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 637713 638507 gene locus_tag LOCUS_06060 637713 638507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 638684 638511 gene locus_tag LOCUS_06070 638684 638511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 638776 639378 gene locus_tag LOCUS_06080 638776 639378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 639555 639968 gene locus_tag LOCUS_06090 639555 639968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 639975 640382 gene locus_tag LOCUS_06100 639975 640382 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142424.1 protein_id gnl|my_center|LOCUS_06100 640423 641337 gene locus_tag LOCUS_06110 gene bla 640423 641337 CDS product class A beta-lactamase, subclass A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109295.1 protein_id gnl|my_center|LOCUS_06110 641340 642197 gene locus_tag LOCUS_06120 641340 642197 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224290.1 protein_id gnl|my_center|LOCUS_06120 642537 645530 gene locus_tag LOCUS_06130 642537 645530 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196955152.1 protein_id gnl|my_center|LOCUS_06130 645530 646183 gene locus_tag LOCUS_06140 645530 646183 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_06140 646806 646501 gene locus_tag LOCUS_06150 646806 646501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 646687 647016 gene locus_tag LOCUS_06160 646687 647016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 647043 649763 gene locus_tag LOCUS_06170 647043 649763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 649808 650413 gene locus_tag LOCUS_06180 649808 650413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 650410 651027 gene locus_tag LOCUS_06190 650410 651027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 651024 651701 gene locus_tag LOCUS_06200 651024 651701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 651798 652301 gene locus_tag LOCUS_06210 gene dinB 651798 652301 CDS product damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234141.1 protein_id gnl|my_center|LOCUS_06210 652483 652316 gene locus_tag LOCUS_06220 652483 652316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 653294 652632 gene locus_tag LOCUS_06230 653294 652632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 653779 653291 gene locus_tag LOCUS_06240 653779 653291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 655031 653787 gene locus_tag LOCUS_06250 655031 653787 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256300.1 protein_id gnl|my_center|LOCUS_06250 655242 655003 gene locus_tag LOCUS_06260 655242 655003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 656500 655676 gene locus_tag LOCUS_06270 656500 655676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 656700 657173 gene locus_tag LOCUS_06280 656700 657173 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396860.1 protein_id gnl|my_center|LOCUS_06280 657466 657627 gene locus_tag LOCUS_06290 657466 657627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 658138 657968 gene locus_tag LOCUS_06300 658138 657968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 658357 658533 gene locus_tag LOCUS_06310 658357 658533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 660788 658656 gene locus_tag LOCUS_06320 660788 658656 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923343.1 protein_id gnl|my_center|LOCUS_06320 661502 660981 gene locus_tag LOCUS_06330 661502 660981 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247110.1 protein_id gnl|my_center|LOCUS_06330 662345 663643 gene locus_tag LOCUS_06340 662345 663643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 664126 664725 gene locus_tag LOCUS_06350 664126 664725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 664808 665650 gene locus_tag LOCUS_06360 664808 665650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 665820 666422 gene locus_tag LOCUS_06370 665820 666422 CDS product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218919404.1 protein_id gnl|my_center|LOCUS_06370 666436 666975 gene locus_tag LOCUS_06380 666436 666975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 666978 667658 gene locus_tag LOCUS_06390 666978 667658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 667807 668703 gene locus_tag LOCUS_06400 667807 668703 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121410.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06400 669011 669946 gene locus_tag LOCUS_06410 669011 669946 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545486.1 protein_id gnl|my_center|LOCUS_06410 670085 670516 gene locus_tag LOCUS_06420 670085 670516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 670630 671508 gene locus_tag LOCUS_06430 670630 671508 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058149.1 protein_id gnl|my_center|LOCUS_06430 671800 672009 gene locus_tag LOCUS_06440 671800 672009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 >Feature sequence02 248 379 gene locus_tag LOCUS_06450 248 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06450 464 652 gene locus_tag LOCUS_06460 464 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 649 876 gene locus_tag LOCUS_06470 649 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06470 3074 3289 gene locus_tag LOCUS_06480 3074 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 3798 3634 gene locus_tag LOCUS_06490 3798 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 4378 3926 gene locus_tag LOCUS_06500 gene tnpA 4378 3926 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_06500 5648 4827 gene locus_tag LOCUS_06510 5648 4827 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536473.1 protein_id gnl|my_center|LOCUS_06510 6696 5791 gene locus_tag LOCUS_06520 6696 5791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 8038 6689 gene locus_tag LOCUS_06530 8038 6689 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475699.1 protein_id gnl|my_center|LOCUS_06530 8131 9150 gene locus_tag LOCUS_06540 8131 9150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 13184 9948 gene locus_tag LOCUS_06550 13184 9948 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275277.1 protein_id gnl|my_center|LOCUS_06550 14080 13409 gene locus_tag LOCUS_06560 14080 13409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 15243 14842 gene locus_tag LOCUS_06570 15243 14842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 16336 15344 gene locus_tag LOCUS_06580 16336 15344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 17081 16482 gene locus_tag LOCUS_06590 17081 16482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06590 18328 17045 gene locus_tag LOCUS_06600 18328 17045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06600 18582 19586 gene locus_tag LOCUS_06610 18582 19586 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256411.1 protein_id gnl|my_center|LOCUS_06610 20142 19732 gene locus_tag LOCUS_06620 20142 19732 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929291.1 protein_id gnl|my_center|LOCUS_06620 20690 20382 gene locus_tag LOCUS_06630 20690 20382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06630 21702 20587 gene locus_tag LOCUS_06640 21702 20587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 21780 22349 gene locus_tag LOCUS_06650 21780 22349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 22423 23553 gene locus_tag LOCUS_06660 22423 23553 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545010.1 protein_id gnl|my_center|LOCUS_06660 23945 25174 gene locus_tag LOCUS_06670 gene ackA 23945 25174 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082978.1 protein_id gnl|my_center|LOCUS_06670 27178 25946 gene locus_tag LOCUS_06680 27178 25946 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947944.1 protein_id gnl|my_center|LOCUS_06680 28058 27450 gene locus_tag LOCUS_06690 28058 27450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 30540 28384 gene locus_tag LOCUS_06700 30540 28384 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940876.1 protein_id gnl|my_center|LOCUS_06700 31051 30542 gene locus_tag LOCUS_06710 31051 30542 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639856.1 protein_id gnl|my_center|LOCUS_06710 31161 31730 gene locus_tag LOCUS_06720 31161 31730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 32637 32858 gene locus_tag LOCUS_06730 32637 32858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 33384 32872 gene locus_tag LOCUS_06740 33384 32872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 33582 35954 gene locus_tag LOCUS_06750 33582 35954 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486377.1 protein_id gnl|my_center|LOCUS_06750 36089 36640 gene locus_tag LOCUS_06760 36089 36640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 36643 37083 gene locus_tag LOCUS_06770 36643 37083 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079397.1 protein_id gnl|my_center|LOCUS_06770 37080 37337 gene locus_tag LOCUS_06780 37080 37337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 37334 38038 gene locus_tag LOCUS_06790 37334 38038 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927183.1 protein_id gnl|my_center|LOCUS_06790 38050 38496 gene locus_tag LOCUS_06800 38050 38496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 38512 38955 gene locus_tag LOCUS_06810 38512 38955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 39282 39839 gene locus_tag LOCUS_06820 39282 39839 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943758.1 protein_id gnl|my_center|LOCUS_06820 39866 40285 gene locus_tag LOCUS_06830 39866 40285 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943286.1 protein_id gnl|my_center|LOCUS_06830 40294 40776 gene locus_tag LOCUS_06840 gene ybaK 40294 40776 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943709.1 protein_id gnl|my_center|LOCUS_06840 40983 42185 gene locus_tag LOCUS_06850 40983 42185 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259064.1 protein_id gnl|my_center|LOCUS_06850 42413 42733 gene locus_tag LOCUS_06860 42413 42733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 42968 43681 gene locus_tag LOCUS_06870 gene aqpZ 42968 43681 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140371.1 protein_id gnl|my_center|LOCUS_06870 44873 46645 gene locus_tag LOCUS_06880 44873 46645 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002025016.1 protein_id gnl|my_center|LOCUS_06880 48463 48050 gene locus_tag LOCUS_06890 48463 48050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06890 49808 48537 gene locus_tag LOCUS_06900 49808 48537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06900 49992 53138 gene locus_tag LOCUS_06910 49992 53138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_06910 54764 53532 gene locus_tag LOCUS_06920 54764 53532 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_06920 56002 54800 gene locus_tag LOCUS_06930 56002 54800 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_06930 56902 56093 gene locus_tag LOCUS_06940 56902 56093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 58749 56917 gene locus_tag LOCUS_06950 gene pilB 58749 56917 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_06950 60343 59006 gene locus_tag LOCUS_06960 60343 59006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 61632 60505 gene locus_tag LOCUS_06970 61632 60505 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257619.1 protein_id gnl|my_center|LOCUS_06970 61730 62431 gene locus_tag LOCUS_06980 gene lepB 61730 62431 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583882.1 protein_id gnl|my_center|LOCUS_06980 62477 63577 gene locus_tag LOCUS_06990 gene carA 62477 63577 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_06990 63675 64565 gene locus_tag LOCUS_07000 63675 64565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 64761 66953 gene locus_tag LOCUS_07010 64761 66953 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104337.1 protein_id gnl|my_center|LOCUS_07010 67298 67687 gene locus_tag LOCUS_07020 67298 67687 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082423.1 protein_id gnl|my_center|LOCUS_07020 67785 67859 gene locus_tag LOCUS_t00050 67785 67859 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 68580 67864 gene locus_tag LOCUS_07030 68580 67864 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037770.1 protein_id gnl|my_center|LOCUS_07030 69765 68596 gene locus_tag LOCUS_07040 69765 68596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 69861 71234 gene locus_tag LOCUS_07050 69861 71234 CDS product deoxyribodipyrimidine photolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121881.1 protein_id gnl|my_center|LOCUS_07050 71423 71977 gene locus_tag LOCUS_07060 71423 71977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 72870 72154 gene locus_tag LOCUS_07070 72870 72154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 73497 72895 gene locus_tag LOCUS_07080 73497 72895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 74978 74082 gene locus_tag LOCUS_07090 gene ttcA 74978 74082 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126823.1 protein_id gnl|my_center|LOCUS_07090 77602 75188 gene locus_tag LOCUS_07100 77602 75188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 77731 78300 gene locus_tag LOCUS_07110 77731 78300 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_07110 79454 78297 gene locus_tag LOCUS_07120 gene nifS 79454 78297 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_07120 79543 81249 gene locus_tag LOCUS_07130 79543 81249 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257013.1 protein_id gnl|my_center|LOCUS_07130 81269 82378 gene locus_tag LOCUS_07140 81269 82378 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_07140 82465 83571 gene locus_tag LOCUS_07150 82465 83571 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545010.1 protein_id gnl|my_center|LOCUS_07150 83690 84514 gene locus_tag LOCUS_07160 gene cdaA 83690 84514 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938576.1 protein_id gnl|my_center|LOCUS_07160 84637 85527 gene locus_tag LOCUS_07170 84637 85527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 86541 85555 gene locus_tag LOCUS_07180 86541 85555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 86943 87224 gene locus_tag LOCUS_07190 86943 87224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07190 91549 88742 gene locus_tag LOCUS_07200 gene secA 91549 88742 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942693.1 protein_id gnl|my_center|LOCUS_07200 92465 91779 gene locus_tag LOCUS_07210 92465 91779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 93442 92588 gene locus_tag LOCUS_07220 93442 92588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 94780 93452 gene locus_tag LOCUS_07230 94780 93452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 95189 96061 gene locus_tag LOCUS_07240 95189 96061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 96730 96071 gene locus_tag LOCUS_07250 96730 96071 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839307.1 protein_id gnl|my_center|LOCUS_07250 96893 97222 gene locus_tag LOCUS_07260 96893 97222 CDS product arsenosugar biosynthesis-associated peroxidase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809059.1 protein_id gnl|my_center|LOCUS_07260 97251 98264 gene locus_tag LOCUS_07270 gene arsS 97251 98264 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272452.1 protein_id gnl|my_center|LOCUS_07270 98356 98189 gene locus_tag LOCUS_07280 98356 98189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 98412 98966 gene locus_tag LOCUS_07290 98412 98966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 100245 99130 gene locus_tag LOCUS_07300 100245 99130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 100873 100421 gene locus_tag LOCUS_07310 100873 100421 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932613.1 protein_id gnl|my_center|LOCUS_07310 101983 101210 gene locus_tag LOCUS_07320 101983 101210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222822.1 protein_id gnl|my_center|LOCUS_07320 102404 101964 gene locus_tag LOCUS_07330 102404 101964 CDS product ABA4-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222821.1 protein_id gnl|my_center|LOCUS_07330 103235 102702 gene locus_tag LOCUS_07340 103235 102702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 103687 105168 gene locus_tag LOCUS_07350 103687 105168 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207749.1 protein_id gnl|my_center|LOCUS_07350 105507 105743 gene locus_tag LOCUS_07360 105507 105743 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119262.1 protein_id gnl|my_center|LOCUS_07360 106047 105832 gene locus_tag LOCUS_07370 106047 105832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 106171 107271 gene locus_tag LOCUS_07380 gene rlmN 106171 107271 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_07380 107274 107711 gene locus_tag LOCUS_07390 107274 107711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 107708 108157 gene locus_tag LOCUS_07400 107708 108157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 109617 108895 gene locus_tag LOCUS_07410 109617 108895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 111281 109614 gene locus_tag LOCUS_07420 111281 109614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640134.1 protein_id gnl|my_center|LOCUS_07420 112180 111359 gene locus_tag LOCUS_07430 gene pgeF 112180 111359 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931720.1 protein_id gnl|my_center|LOCUS_07430 112299 112688 gene locus_tag LOCUS_07440 112299 112688 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942448.1 protein_id gnl|my_center|LOCUS_07440 113049 116393 gene locus_tag LOCUS_07450 113049 116393 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_07450 117170 120427 gene locus_tag LOCUS_07460 117170 120427 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_07460 121184 120603 gene locus_tag LOCUS_07470 121184 120603 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943393.1 protein_id gnl|my_center|LOCUS_07470 121965 121192 gene locus_tag LOCUS_07480 121965 121192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 122102 123424 gene locus_tag LOCUS_07490 122102 123424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 124751 123444 gene locus_tag LOCUS_07500 124751 123444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 126782 124791 gene locus_tag LOCUS_07510 126782 124791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 127868 128212 gene locus_tag LOCUS_07520 127868 128212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 128858 128274 gene locus_tag LOCUS_07530 128858 128274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 130883 129021 gene locus_tag LOCUS_07540 130883 129021 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994158.1 protein_id gnl|my_center|LOCUS_07540 132058 130931 gene locus_tag LOCUS_07550 132058 130931 CDS product YARHG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627158.1 protein_id gnl|my_center|LOCUS_07550 132597 132094 gene locus_tag LOCUS_07560 132597 132094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 133213 132785 gene locus_tag LOCUS_07570 133213 132785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 133555 133292 gene locus_tag LOCUS_07580 133555 133292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 134521 133940 gene locus_tag LOCUS_07590 134521 133940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 135497 135126 gene locus_tag LOCUS_07600 135497 135126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 136243 135947 gene locus_tag LOCUS_07610 136243 135947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 137427 136423 gene locus_tag LOCUS_07620 137427 136423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 138292 137606 gene locus_tag LOCUS_07630 138292 137606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 139492 138356 gene locus_tag LOCUS_07640 139492 138356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 140584 140060 gene locus_tag LOCUS_07650 140584 140060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 141625 140600 gene locus_tag LOCUS_07660 141625 140600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 142703 142209 gene locus_tag LOCUS_07670 142703 142209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 143183 142926 gene locus_tag LOCUS_07680 143183 142926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 144403 143828 gene locus_tag LOCUS_07690 144403 143828 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_07690 144912 144457 gene locus_tag LOCUS_07700 144912 144457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 148186 145040 gene locus_tag LOCUS_07710 148186 145040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 149807 148317 gene locus_tag LOCUS_07720 149807 148317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 150031 149807 gene locus_tag LOCUS_07730 150031 149807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 151693 150278 gene locus_tag LOCUS_07740 151693 150278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 151743 151880 gene locus_tag LOCUS_07750 151743 151880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 153150 152092 gene locus_tag LOCUS_07760 153150 152092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 153930 153586 gene locus_tag LOCUS_07770 153930 153586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 154098 154751 gene locus_tag LOCUS_07780 154098 154751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 155011 157305 gene locus_tag LOCUS_07790 155011 157305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 157950 159524 gene locus_tag LOCUS_07800 157950 159524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 159686 161242 gene locus_tag LOCUS_07810 159686 161242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 161780 161265 gene locus_tag LOCUS_07820 161780 161265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 161927 163024 gene locus_tag LOCUS_07830 161927 163024 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931917.1 protein_id gnl|my_center|LOCUS_07830 163880 163503 gene locus_tag LOCUS_07840 163880 163503 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206942.1 protein_id gnl|my_center|LOCUS_07840 165019 163892 gene locus_tag LOCUS_07850 165019 163892 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250026.1 protein_id gnl|my_center|LOCUS_07850 165481 165035 gene locus_tag LOCUS_07860 165481 165035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 165792 166850 gene locus_tag LOCUS_07870 165792 166850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 166860 169070 gene locus_tag LOCUS_07880 gene nasC 166860 169070 CDS product assimilatory nitrate reductase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246484.1 protein_id gnl|my_center|LOCUS_07880 169067 169705 gene locus_tag LOCUS_07890 169067 169705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 170122 170694 gene locus_tag LOCUS_07900 170122 170694 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808186.1 protein_id gnl|my_center|LOCUS_07900 170681 170917 gene locus_tag LOCUS_07910 170681 170917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 171470 172957 gene locus_tag LOCUS_07920 171470 172957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 173037 174380 gene locus_tag LOCUS_07930 173037 174380 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014188.1 protein_id gnl|my_center|LOCUS_07930 174475 175854 gene locus_tag LOCUS_07940 174475 175854 CDS product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810724.1 protein_id gnl|my_center|LOCUS_07940 175965 177368 gene locus_tag LOCUS_07950 175965 177368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 177664 177425 gene locus_tag LOCUS_07960 177664 177425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 179849 178026 gene locus_tag LOCUS_07970 gene glmS 179849 178026 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940943.1 protein_id gnl|my_center|LOCUS_07970 180693 180322 gene locus_tag LOCUS_07980 180693 180322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 180955 180674 gene locus_tag LOCUS_07990 180955 180674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 182244 181066 gene locus_tag LOCUS_08000 gene glmU 182244 181066 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706816.1 protein_id gnl|my_center|LOCUS_08000 183337 182315 gene locus_tag LOCUS_08010 183337 182315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 183565 184167 gene locus_tag LOCUS_08020 183565 184167 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940775.1 protein_id gnl|my_center|LOCUS_08020 184246 184830 gene locus_tag LOCUS_08030 184246 184830 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_08030 185232 186446 gene locus_tag LOCUS_08040 185232 186446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 186450 187148 gene locus_tag LOCUS_08050 186450 187148 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970242.1 protein_id gnl|my_center|LOCUS_08050 187501 188538 gene locus_tag LOCUS_08060 187501 188538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 188778 190466 gene locus_tag LOCUS_08070 gene kdpA 188778 190466 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529643.1 protein_id gnl|my_center|LOCUS_08070 190491 192536 gene locus_tag LOCUS_08080 gene kdpB 190491 192536 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391516.1 protein_id gnl|my_center|LOCUS_08080 192553 193116 gene locus_tag LOCUS_08090 gene kdpC 192553 193116 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391518.1 protein_id gnl|my_center|LOCUS_08090 193120 194298 gene locus_tag LOCUS_08100 gene kdpDN 193120 194298 CDS product KdpD-like non-kinase potassium sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270702.1 protein_id gnl|my_center|LOCUS_08100 194535 197579 gene locus_tag LOCUS_08110 194535 197579 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038744192.1 protein_id gnl|my_center|LOCUS_08110 197869 198300 gene locus_tag LOCUS_08120 197869 198300 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095512524.1 protein_id gnl|my_center|LOCUS_08120 198305 198769 gene locus_tag LOCUS_08130 198305 198769 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266690.1 protein_id gnl|my_center|LOCUS_08130 199254 198829 gene locus_tag LOCUS_08140 199254 198829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 199938 199432 gene locus_tag LOCUS_08150 199938 199432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 200808 200101 gene locus_tag LOCUS_08160 200808 200101 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653722.1 protein_id gnl|my_center|LOCUS_08160 201144 200812 gene locus_tag LOCUS_08170 201144 200812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 202587 201595 gene locus_tag LOCUS_08180 202587 201595 CDS product photosynthesis system II assembly factor Ycf48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057532.1 protein_id gnl|my_center|LOCUS_08180 204042 203230 gene locus_tag LOCUS_08190 204042 203230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 205564 204173 gene locus_tag LOCUS_08200 205564 204173 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_08200 206617 205622 gene locus_tag LOCUS_08210 206617 205622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 207756 206701 gene locus_tag LOCUS_08220 207756 206701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 209685 208027 gene locus_tag LOCUS_08230 209685 208027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 209889 209704 gene locus_tag LOCUS_08240 209889 209704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 210936 209905 gene locus_tag LOCUS_08250 210936 209905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 212125 210992 gene locus_tag LOCUS_08260 212125 210992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 214239 212650 gene locus_tag LOCUS_08270 214239 212650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 216228 214363 gene locus_tag LOCUS_08280 216228 214363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 216655 216410 gene locus_tag LOCUS_08290 216655 216410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 218373 216823 gene locus_tag LOCUS_08300 218373 216823 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 protein_id gnl|my_center|LOCUS_08300 219894 219818 gene locus_tag LOCUS_t00060 219894 219818 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 220094 220018 gene locus_tag LOCUS_t00070 220094 220018 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 220723 220331 gene locus_tag LOCUS_08310 220723 220331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 221118 220639 gene locus_tag LOCUS_08320 221118 220639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08320 222182 221910 gene locus_tag LOCUS_08330 222182 221910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 222959 223228 gene locus_tag LOCUS_08340 222959 223228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 223444 224286 gene locus_tag LOCUS_08350 223444 224286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 224201 224572 gene locus_tag LOCUS_08360 224201 224572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 225096 224602 gene locus_tag LOCUS_08370 225096 224602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 229380 225583 gene locus_tag LOCUS_08380 gene smc 229380 225583 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941791.1 protein_id gnl|my_center|LOCUS_08380 230261 229485 gene locus_tag LOCUS_08390 230261 229485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 230431 231966 gene locus_tag LOCUS_08400 230431 231966 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390236.1 protein_id gnl|my_center|LOCUS_08400 233405 232098 gene locus_tag LOCUS_08410 233405 232098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 233860 233588 gene locus_tag LOCUS_08420 233860 233588 CDS product DUF2277 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089416.1 protein_id gnl|my_center|LOCUS_08420 235800 233998 gene locus_tag LOCUS_08430 gene lepA 235800 233998 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941921.1 protein_id gnl|my_center|LOCUS_08430 235937 236677 gene locus_tag LOCUS_08440 235937 236677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 237123 240239 gene locus_tag LOCUS_08450 237123 240239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 240247 240801 gene locus_tag LOCUS_08460 240247 240801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08460 241046 241531 gene locus_tag LOCUS_08470 241046 241531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 243441 241771 gene locus_tag LOCUS_08480 243441 241771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 244063 243701 gene locus_tag LOCUS_08490 244063 243701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 244397 244999 gene locus_tag LOCUS_08500 244397 244999 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924792.1 protein_id gnl|my_center|LOCUS_08500 245060 246385 gene locus_tag LOCUS_08510 245060 246385 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583203.1 protein_id gnl|my_center|LOCUS_08510 246511 248442 gene locus_tag LOCUS_08520 246511 248442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 248671 248465 gene locus_tag LOCUS_08530 248671 248465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 248615 249574 gene locus_tag LOCUS_08540 248615 249574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 249651 250121 gene locus_tag LOCUS_08550 249651 250121 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142456.1 protein_id gnl|my_center|LOCUS_08550 250141 250602 gene locus_tag LOCUS_08560 250141 250602 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065754.1 protein_id gnl|my_center|LOCUS_08560 250599 251036 gene locus_tag LOCUS_08570 250599 251036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070947244.1 protein_id gnl|my_center|LOCUS_08570 251219 252946 gene locus_tag LOCUS_08580 251219 252946 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948610.1 protein_id gnl|my_center|LOCUS_08580 253070 253420 gene locus_tag LOCUS_08590 253070 253420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 254225 253476 gene locus_tag LOCUS_08600 254225 253476 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224130.1 protein_id gnl|my_center|LOCUS_08600 255484 254411 gene locus_tag LOCUS_08610 255484 254411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 256507 255578 gene locus_tag LOCUS_08620 256507 255578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 256666 257655 gene locus_tag LOCUS_08630 256666 257655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 258854 257697 gene locus_tag LOCUS_08640 258854 257697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 260760 259738 gene locus_tag LOCUS_08650 260760 259738 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810382.1 protein_id gnl|my_center|LOCUS_08650 262885 260837 gene locus_tag LOCUS_08660 262885 260837 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258127.1 protein_id gnl|my_center|LOCUS_08660 263072 263737 gene locus_tag LOCUS_08670 263072 263737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 263849 265453 gene locus_tag LOCUS_08680 263849 265453 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918850.1 protein_id gnl|my_center|LOCUS_08680 265578 266426 gene locus_tag LOCUS_08690 265578 266426 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421145.1 protein_id gnl|my_center|LOCUS_08690 266505 266774 gene locus_tag LOCUS_08700 266505 266774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 266853 267809 gene locus_tag LOCUS_08710 266853 267809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 268058 268831 gene locus_tag LOCUS_08720 268058 268831 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064989.1 protein_id gnl|my_center|LOCUS_08720 268939 270393 gene locus_tag LOCUS_08730 268939 270393 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064334.1 protein_id gnl|my_center|LOCUS_08730 270417 270875 gene locus_tag LOCUS_08740 270417 270875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 270998 272485 gene locus_tag LOCUS_08750 270998 272485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 272482 272772 gene locus_tag LOCUS_08760 272482 272772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 272803 273195 gene locus_tag LOCUS_08770 272803 273195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 273686 273270 gene locus_tag LOCUS_08780 273686 273270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 273802 274953 gene locus_tag LOCUS_08790 gene gntC 273802 274953 CDS product guanitoxin biosynthesis PLP-dependent (S)-gamma-hydroxy-L-arginine cyclodehydratase GntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061335.1 protein_id gnl|my_center|LOCUS_08790 276615 278450 gene locus_tag LOCUS_08800 276615 278450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08800 278458 279810 gene locus_tag LOCUS_08810 278458 279810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08810 280681 279917 gene locus_tag LOCUS_08820 280681 279917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 281375 280668 gene locus_tag LOCUS_08830 281375 280668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 282697 284136 gene locus_tag LOCUS_08840 282697 284136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 284371 284565 gene locus_tag LOCUS_08850 284371 284565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 284823 285113 gene locus_tag LOCUS_08860 284823 285113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 285103 285243 gene locus_tag LOCUS_08870 285103 285243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 285262 285438 gene locus_tag LOCUS_08880 285262 285438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 285585 285854 gene locus_tag LOCUS_08890 285585 285854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 285958 286494 gene locus_tag LOCUS_08900 285958 286494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 286713 287504 gene locus_tag LOCUS_08910 286713 287504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08910 287420 287719 gene locus_tag LOCUS_08920 287420 287719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08920 287873 289015 gene locus_tag LOCUS_08930 287873 289015 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338163.1 protein_id gnl|my_center|LOCUS_08930 289196 289576 gene locus_tag LOCUS_08940 289196 289576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 289594 289833 gene locus_tag LOCUS_08950 289594 289833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 290177 289923 gene locus_tag LOCUS_08960 290177 289923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 290407 290643 gene locus_tag LOCUS_08970 290407 290643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 291163 292455 gene locus_tag LOCUS_08980 gene purB 291163 292455 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942277.1 protein_id gnl|my_center|LOCUS_08980 292862 292452 gene locus_tag LOCUS_08990 292862 292452 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870963.1 protein_id gnl|my_center|LOCUS_08990 293099 293266 gene locus_tag LOCUS_09000 293099 293266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 293417 294055 gene locus_tag LOCUS_09010 gene purQ 293417 294055 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393545.1 protein_id gnl|my_center|LOCUS_09010 295131 294058 gene locus_tag LOCUS_09020 295131 294058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 297044 295242 gene locus_tag LOCUS_09030 297044 295242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 298023 297298 gene locus_tag LOCUS_09040 298023 297298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 299126 298104 gene locus_tag LOCUS_09050 299126 298104 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966336.1 protein_id gnl|my_center|LOCUS_09050 299946 299206 gene locus_tag LOCUS_09060 299946 299206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 300128 301051 gene locus_tag LOCUS_09070 300128 301051 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038547.1 protein_id gnl|my_center|LOCUS_09070 301316 301978 gene locus_tag LOCUS_09080 301316 301978 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258004.1 protein_id gnl|my_center|LOCUS_09080 302051 305332 gene locus_tag LOCUS_09090 302051 305332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 305396 306847 gene locus_tag LOCUS_09100 gene nrfD 305396 306847 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256519.1 protein_id gnl|my_center|LOCUS_09100 306971 307534 gene locus_tag LOCUS_09110 306971 307534 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256520.1 protein_id gnl|my_center|LOCUS_09110 307521 308270 gene locus_tag LOCUS_09120 307521 308270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 308273 309487 gene locus_tag LOCUS_09130 308273 309487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256522.1 protein_id gnl|my_center|LOCUS_09130 309556 310185 gene locus_tag LOCUS_09140 309556 310185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 310190 311134 gene locus_tag LOCUS_09150 310190 311134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 311171 312208 gene locus_tag LOCUS_09160 gene coxB 311171 312208 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258007.1 protein_id gnl|my_center|LOCUS_09160 312222 313886 gene locus_tag LOCUS_09170 gene ctaD 312222 313886 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258008.1 protein_id gnl|my_center|LOCUS_09170 313971 314891 gene locus_tag LOCUS_09180 313971 314891 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258009.1 protein_id gnl|my_center|LOCUS_09180 314896 315222 gene locus_tag LOCUS_09190 314896 315222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 315534 316469 gene locus_tag LOCUS_09200 315534 316469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 316521 317195 gene locus_tag LOCUS_09210 316521 317195 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187151961.1 protein_id gnl|my_center|LOCUS_09210 317273 317581 gene locus_tag LOCUS_09220 317273 317581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 317610 318284 gene locus_tag LOCUS_09230 317610 318284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 318582 319517 gene locus_tag LOCUS_09240 318582 319517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 319614 320195 gene locus_tag LOCUS_09250 319614 320195 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_09250 320524 321138 gene locus_tag LOCUS_09260 320524 321138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 321162 321875 gene locus_tag LOCUS_09270 321162 321875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 321918 322301 gene locus_tag LOCUS_09280 321918 322301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 322500 323315 gene locus_tag LOCUS_09290 322500 323315 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169648.1 protein_id gnl|my_center|LOCUS_09290 323948 324187 gene locus_tag LOCUS_09300 323948 324187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 324315 324680 gene locus_tag LOCUS_09310 324315 324680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 324917 327604 gene locus_tag LOCUS_09320 324917 327604 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257097.1 protein_id gnl|my_center|LOCUS_09320 328032 327790 gene locus_tag LOCUS_09330 328032 327790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 327976 329661 gene locus_tag LOCUS_09340 327976 329661 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015482.1 protein_id gnl|my_center|LOCUS_09340 329799 329984 gene locus_tag LOCUS_09350 329799 329984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 333168 330154 gene locus_tag LOCUS_09360 333168 330154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 334708 333227 gene locus_tag LOCUS_09370 334708 333227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 335477 334731 gene locus_tag LOCUS_09380 335477 334731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 335715 336218 gene locus_tag LOCUS_09390 335715 336218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 336211 336642 gene locus_tag LOCUS_09400 336211 336642 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523514.1 protein_id gnl|my_center|LOCUS_09400 337226 336687 gene locus_tag LOCUS_09410 337226 336687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 339522 337768 gene locus_tag LOCUS_09420 339522 337768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 340205 339888 gene locus_tag LOCUS_09430 340205 339888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 340661 341047 gene locus_tag LOCUS_09440 340661 341047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 341445 342683 gene locus_tag LOCUS_09450 341445 342683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09450 342685 343254 gene locus_tag LOCUS_09460 342685 343254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 343399 345399 gene locus_tag LOCUS_09470 343399 345399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 345777 346532 gene locus_tag LOCUS_09480 345777 346532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 346529 347932 gene locus_tag LOCUS_09490 346529 347932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 347969 348748 gene locus_tag LOCUS_09500 347969 348748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 349056 349277 gene locus_tag LOCUS_09510 349056 349277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 349339 350256 gene locus_tag LOCUS_09520 349339 350256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 350613 350969 gene locus_tag LOCUS_09530 350613 350969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 351014 351667 gene locus_tag LOCUS_09540 351014 351667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 351676 352983 gene locus_tag LOCUS_09550 351676 352983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 353502 353636 gene locus_tag LOCUS_09560 353502 353636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 354046 355020 gene locus_tag LOCUS_09570 354046 355020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 355079 355306 gene locus_tag LOCUS_09580 355079 355306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 355320 355925 gene locus_tag LOCUS_09590 355320 355925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 356124 356579 gene locus_tag LOCUS_09600 356124 356579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 357186 358967 gene locus_tag LOCUS_09610 357186 358967 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552510.1 protein_id gnl|my_center|LOCUS_09610 359373 359777 gene locus_tag LOCUS_09620 359373 359777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 359943 362675 gene locus_tag LOCUS_09630 359943 362675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 364930 362777 gene locus_tag LOCUS_09640 364930 362777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 365028 365381 gene locus_tag LOCUS_09650 365028 365381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 365405 365590 gene locus_tag LOCUS_09660 365405 365590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 365642 366223 gene locus_tag LOCUS_09670 365642 366223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 366334 366903 gene locus_tag LOCUS_09680 366334 366903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 366921 367373 gene locus_tag LOCUS_09690 366921 367373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 367497 368417 gene locus_tag LOCUS_09700 367497 368417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 369196 368573 gene locus_tag LOCUS_09710 369196 368573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 371591 369351 gene locus_tag LOCUS_09720 gene clpA 371591 369351 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317954.1 protein_id gnl|my_center|LOCUS_09720 371990 371673 gene locus_tag LOCUS_09730 gene clpS 371990 371673 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640501.1 protein_id gnl|my_center|LOCUS_09730 372099 372677 gene locus_tag LOCUS_09740 372099 372677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 372722 374671 gene locus_tag LOCUS_09750 372722 374671 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980092.1 protein_id gnl|my_center|LOCUS_09750 374765 375133 gene locus_tag LOCUS_09760 374765 375133 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986800.1 protein_id gnl|my_center|LOCUS_09760 375151 376062 gene locus_tag LOCUS_09770 375151 376062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 376076 377569 gene locus_tag LOCUS_09780 gene pyk 376076 377569 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258979.1 protein_id gnl|my_center|LOCUS_09780 379149 377827 gene locus_tag LOCUS_09790 379149 377827 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003128157.1 protein_id gnl|my_center|LOCUS_09790 379506 379198 gene locus_tag LOCUS_09800 379506 379198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 380803 379481 gene locus_tag LOCUS_09810 380803 379481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09810 381710 381009 gene locus_tag LOCUS_09820 381710 381009 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_09820 382657 381773 gene locus_tag LOCUS_09830 382657 381773 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360255.1 protein_id gnl|my_center|LOCUS_09830 383786 382914 gene locus_tag LOCUS_09840 383786 382914 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921038.1 protein_id gnl|my_center|LOCUS_09840 384747 383893 gene locus_tag LOCUS_09850 384747 383893 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057556.1 protein_id gnl|my_center|LOCUS_09850 384849 385640 gene locus_tag LOCUS_09860 384849 385640 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942561.1 protein_id gnl|my_center|LOCUS_09860 387429 386206 gene locus_tag LOCUS_09870 gene mqnC 387429 386206 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921709.1 protein_id gnl|my_center|LOCUS_09870 387753 387568 gene locus_tag LOCUS_09880 387753 387568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 388038 387829 gene locus_tag LOCUS_09890 388038 387829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 388107 388514 gene locus_tag LOCUS_09900 388107 388514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 389336 388518 gene locus_tag LOCUS_09910 389336 388518 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545998.1 protein_id gnl|my_center|LOCUS_09910 389740 390375 gene locus_tag LOCUS_09920 389740 390375 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943961.1 protein_id gnl|my_center|LOCUS_09920 390447 392147 gene locus_tag LOCUS_09930 390447 392147 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258493.1 protein_id gnl|my_center|LOCUS_09930 392307 392657 gene locus_tag LOCUS_09940 392307 392657 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349502.1 protein_id gnl|my_center|LOCUS_09940 393741 392815 gene locus_tag LOCUS_09950 393741 392815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 393865 395298 gene locus_tag LOCUS_09960 393865 395298 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_09960 395363 395890 gene locus_tag LOCUS_09970 395363 395890 CDS product phosphoglycerate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071056.1 protein_id gnl|my_center|LOCUS_09970 396281 398512 gene locus_tag LOCUS_09980 396281 398512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 398664 399233 gene locus_tag LOCUS_09990 398664 399233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925589.1 protein_id gnl|my_center|LOCUS_09990 400475 399240 gene locus_tag LOCUS_10000 400475 399240 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257455.1 protein_id gnl|my_center|LOCUS_10000 400557 402413 gene locus_tag LOCUS_10010 400557 402413 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259046.1 protein_id gnl|my_center|LOCUS_10010 402418 403695 gene locus_tag LOCUS_10020 402418 403695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 404516 405001 gene locus_tag LOCUS_10030 404516 405001 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174045.1 protein_id gnl|my_center|LOCUS_10030 407264 405114 gene locus_tag LOCUS_10040 407264 405114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 409276 407930 gene locus_tag LOCUS_10050 409276 407930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 412143 409354 gene locus_tag LOCUS_10060 412143 409354 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058185.1 protein_id gnl|my_center|LOCUS_10060 412761 412258 gene locus_tag LOCUS_10070 412761 412258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 413519 412929 gene locus_tag LOCUS_10080 413519 412929 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223264.1 protein_id gnl|my_center|LOCUS_10080 415412 413616 gene locus_tag LOCUS_10090 415412 413616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 415323 415535 gene locus_tag LOCUS_10100 415323 415535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 417293 416394 gene locus_tag LOCUS_10110 417293 416394 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837921.1 protein_id gnl|my_center|LOCUS_10110 419214 417331 gene locus_tag LOCUS_10120 419214 417331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 419098 419352 gene locus_tag LOCUS_10130 419098 419352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 421025 420018 gene locus_tag LOCUS_10140 421025 420018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 422431 421277 gene locus_tag LOCUS_10150 422431 421277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 423636 422428 gene locus_tag LOCUS_10160 423636 422428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 425285 424329 gene locus_tag LOCUS_10170 425285 424329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 425840 425376 gene locus_tag LOCUS_10180 425840 425376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 425992 426399 gene locus_tag LOCUS_10190 425992 426399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10190 426514 426816 gene locus_tag LOCUS_10200 426514 426816 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172987.1 protein_id gnl|my_center|LOCUS_10200 426881 427486 gene locus_tag LOCUS_10210 gene coaE 426881 427486 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976822.1 protein_id gnl|my_center|LOCUS_10210 427499 429322 gene locus_tag LOCUS_10220 427499 429322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 429482 431941 gene locus_tag LOCUS_10230 429482 431941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 431947 432861 gene locus_tag LOCUS_10240 431947 432861 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144111.1 protein_id gnl|my_center|LOCUS_10240 432868 433830 gene locus_tag LOCUS_10250 432868 433830 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144110.1 protein_id gnl|my_center|LOCUS_10250 433861 434382 gene locus_tag LOCUS_10260 433861 434382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 434391 435053 gene locus_tag LOCUS_10270 434391 435053 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140605.1 protein_id gnl|my_center|LOCUS_10270 435061 436086 gene locus_tag LOCUS_10280 435061 436086 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144109.1 protein_id gnl|my_center|LOCUS_10280 436083 436751 gene locus_tag LOCUS_10290 436083 436751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 436778 437956 gene locus_tag LOCUS_10300 436778 437956 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_10300 439418 440119 gene locus_tag LOCUS_10310 439418 440119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 440037 440783 gene locus_tag LOCUS_10320 440037 440783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 440780 441556 gene locus_tag LOCUS_10330 440780 441556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 442497 441580 gene locus_tag LOCUS_10340 442497 441580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 443261 442560 gene locus_tag LOCUS_10350 443261 442560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10350 446033 443562 gene locus_tag LOCUS_10360 446033 443562 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929325.1 protein_id gnl|my_center|LOCUS_10360 446275 446505 gene locus_tag LOCUS_10370 446275 446505 CDS product DUF2281 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258326.1 protein_id gnl|my_center|LOCUS_10370 446502 446888 gene locus_tag LOCUS_10380 446502 446888 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142022.1 protein_id gnl|my_center|LOCUS_10380 447705 449117 gene locus_tag LOCUS_10390 447705 449117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 449589 450053 gene locus_tag LOCUS_10400 449589 450053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10400 450296 450874 gene locus_tag LOCUS_10410 450296 450874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 450859 451488 gene locus_tag LOCUS_10420 450859 451488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 451485 454397 gene locus_tag LOCUS_10430 451485 454397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 454387 455922 gene locus_tag LOCUS_10440 454387 455922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 456186 456662 gene locus_tag LOCUS_10450 456186 456662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 456683 458746 gene locus_tag LOCUS_10460 gene vgrG1b 456683 458746 CDS product type VI secretion system spike protein VgrG1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147059.1 protein_id gnl|my_center|LOCUS_10460 458751 459377 gene locus_tag LOCUS_10470 458751 459377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 459299 459775 gene locus_tag LOCUS_10480 459299 459775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 459971 460570 gene locus_tag LOCUS_10490 459971 460570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 460455 461675 gene locus_tag LOCUS_10500 460455 461675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 461679 462854 gene locus_tag LOCUS_10510 461679 462854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 462930 463367 gene locus_tag LOCUS_10520 462930 463367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 463383 463580 gene locus_tag LOCUS_10530 463383 463580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 463616 464167 gene locus_tag LOCUS_10540 463616 464167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 464127 464306 gene locus_tag LOCUS_10550 464127 464306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 464586 465437 gene locus_tag LOCUS_10560 464586 465437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 465533 466579 gene locus_tag LOCUS_10570 465533 466579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 466576 467772 gene locus_tag LOCUS_10580 466576 467772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 468227 468484 gene locus_tag LOCUS_10590 468227 468484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 468695 470962 gene locus_tag LOCUS_10600 468695 470962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 470959 473142 gene locus_tag LOCUS_10610 470959 473142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 473748 474068 gene locus_tag LOCUS_10620 473748 474068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 474155 475417 gene locus_tag LOCUS_10630 474155 475417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 476535 476158 gene locus_tag LOCUS_10640 476535 476158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 480776 476844 gene locus_tag LOCUS_10650 480776 476844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 481080 481472 gene locus_tag LOCUS_10660 481080 481472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 482364 481462 gene locus_tag LOCUS_10670 482364 481462 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329773.1 protein_id gnl|my_center|LOCUS_10670 482744 482466 gene locus_tag LOCUS_10680 482744 482466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 482783 483316 gene locus_tag LOCUS_10690 482783 483316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10690 483356 485149 gene locus_tag LOCUS_10700 gene sdhA 483356 485149 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229567.1 protein_id gnl|my_center|LOCUS_10700 485154 485741 gene locus_tag LOCUS_10710 485154 485741 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057636.1 protein_id gnl|my_center|LOCUS_10710 485738 486541 gene locus_tag LOCUS_10720 gene sdhB 485738 486541 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139712.1 protein_id gnl|my_center|LOCUS_10720 489206 486705 gene locus_tag LOCUS_10730 489206 486705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 490305 489394 gene locus_tag LOCUS_10740 490305 489394 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873433.1 protein_id gnl|my_center|LOCUS_10740 492851 490338 gene locus_tag LOCUS_10750 492851 490338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 495670 493145 gene locus_tag LOCUS_10760 495670 493145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 496009 497577 gene locus_tag LOCUS_10770 496009 497577 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_10770 497574 497819 gene locus_tag LOCUS_10780 497574 497819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 500913 498403 gene locus_tag LOCUS_10790 500913 498403 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256479.1 protein_id gnl|my_center|LOCUS_10790 501233 501051 gene locus_tag LOCUS_10800 501233 501051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 502708 501371 gene locus_tag LOCUS_10810 gene ccoG 502708 501371 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073459.1 protein_id gnl|my_center|LOCUS_10810 503507 502788 gene locus_tag LOCUS_10820 503507 502788 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_10820 505585 503645 gene locus_tag LOCUS_10830 505585 503645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 506036 505716 gene locus_tag LOCUS_10840 506036 505716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 506184 505993 gene locus_tag LOCUS_10850 506184 505993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 506832 506263 gene locus_tag LOCUS_10860 506832 506263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 508287 506854 gene locus_tag LOCUS_10870 gene ccoN 508287 506854 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157695.1 protein_id gnl|my_center|LOCUS_10870 510242 508398 gene locus_tag LOCUS_10880 510242 508398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 511509 510262 gene locus_tag LOCUS_10890 511509 510262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 512127 511645 gene locus_tag LOCUS_10900 512127 511645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 512344 512111 gene locus_tag LOCUS_10910 512344 512111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 512833 512411 gene locus_tag LOCUS_10920 512833 512411 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930578.1 protein_id gnl|my_center|LOCUS_10920 512940 513602 gene locus_tag LOCUS_10930 512940 513602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 513795 515624 gene locus_tag LOCUS_10940 513795 515624 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_10940 515980 515765 gene locus_tag LOCUS_10950 515980 515765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 516645 516364 gene locus_tag LOCUS_10960 516645 516364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 517139 518290 gene locus_tag LOCUS_10970 517139 518290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 518406 519965 gene locus_tag LOCUS_10980 518406 519965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 520041 521231 gene locus_tag LOCUS_10990 520041 521231 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_10990 521228 522283 gene locus_tag LOCUS_11000 521228 522283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 522294 523169 gene locus_tag LOCUS_11010 522294 523169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 523209 523694 gene locus_tag LOCUS_11020 523209 523694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 523696 525579 gene locus_tag LOCUS_11030 523696 525579 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_11030 525588 526310 gene locus_tag LOCUS_11040 525588 526310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 526313 527461 gene locus_tag LOCUS_11050 526313 527461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 527545 530001 gene locus_tag LOCUS_11060 527545 530001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 531014 530760 gene locus_tag LOCUS_11070 531014 530760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 531648 533186 gene locus_tag LOCUS_11080 531648 533186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11080 533086 534687 gene locus_tag LOCUS_11090 533086 534687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 534594 534881 gene locus_tag LOCUS_11100 534594 534881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 535349 535047 gene locus_tag LOCUS_11110 535349 535047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 >Feature sequence03 1839 787 gene locus_tag LOCUS_11120 1839 787 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315813.1 protein_id gnl|my_center|LOCUS_11120 2677 1892 gene locus_tag LOCUS_11130 2677 1892 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 protein_id gnl|my_center|LOCUS_11130 3712 2729 gene locus_tag LOCUS_11140 3712 2729 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257832.1 protein_id gnl|my_center|LOCUS_11140 4610 3714 gene locus_tag LOCUS_11150 4610 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 5260 4712 gene locus_tag LOCUS_11160 5260 4712 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208128.1 protein_id gnl|my_center|LOCUS_11160 5922 5275 gene locus_tag LOCUS_11170 5922 5275 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_11170 6184 5915 gene locus_tag LOCUS_11180 6184 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 7224 6196 gene locus_tag LOCUS_11190 7224 6196 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_11190 7708 7190 gene locus_tag LOCUS_11200 7708 7190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 8345 7734 gene locus_tag LOCUS_11210 8345 7734 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 protein_id gnl|my_center|LOCUS_11210 8950 8342 gene locus_tag LOCUS_11220 8950 8342 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703862.1 protein_id gnl|my_center|LOCUS_11220 9739 9065 gene locus_tag LOCUS_11230 9739 9065 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058035.1 protein_id gnl|my_center|LOCUS_11230 10216 9785 gene locus_tag LOCUS_11240 10216 9785 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383201.1 protein_id gnl|my_center|LOCUS_11240 11153 10281 gene locus_tag LOCUS_11250 11153 10281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 12652 11153 gene locus_tag LOCUS_11260 12652 11153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 13045 13827 gene locus_tag LOCUS_11270 13045 13827 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480304.1 protein_id gnl|my_center|LOCUS_11270 15198 14164 gene locus_tag LOCUS_11280 15198 14164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123815508.1 protein_id gnl|my_center|LOCUS_11280 16188 15298 gene locus_tag LOCUS_11290 16188 15298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 16694 16269 gene locus_tag LOCUS_11300 16694 16269 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148917.1 protein_id gnl|my_center|LOCUS_11300 16877 18445 gene locus_tag LOCUS_11310 16877 18445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 18587 19390 gene locus_tag LOCUS_11320 18587 19390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 19809 19585 gene locus_tag LOCUS_11330 19809 19585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 20010 21464 gene locus_tag LOCUS_11340 20010 21464 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249925.1 protein_id gnl|my_center|LOCUS_11340 21892 22443 gene locus_tag LOCUS_11350 21892 22443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 23397 23101 gene locus_tag LOCUS_11360 23397 23101 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942189.1 protein_id gnl|my_center|LOCUS_11360 24176 23637 gene locus_tag LOCUS_11370 24176 23637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11370 24952 24338 gene locus_tag LOCUS_11380 24952 24338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 25298 25086 gene locus_tag LOCUS_11390 25298 25086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 27673 25523 gene locus_tag LOCUS_11400 27673 25523 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840085.1 protein_id gnl|my_center|LOCUS_11400 28490 28002 gene locus_tag LOCUS_11410 28490 28002 CDS product glycine/sarcosine/betaine reductase selenoprotein B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255959.1 protein_id gnl|my_center|LOCUS_11410 30337 28652 gene locus_tag LOCUS_11420 30337 28652 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404351.1 protein_id gnl|my_center|LOCUS_11420 30798 30334 gene locus_tag LOCUS_11430 30798 30334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259055.1 protein_id gnl|my_center|LOCUS_11430 31099 30782 gene locus_tag LOCUS_11440 31099 30782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 31310 32284 gene locus_tag LOCUS_11450 31310 32284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 32304 33419 gene locus_tag LOCUS_11460 32304 33419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263257.1 protein_id gnl|my_center|LOCUS_11460 33482 33802 gene locus_tag LOCUS_11470 33482 33802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 33818 34243 gene locus_tag LOCUS_11480 33818 34243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 34249 34992 gene locus_tag LOCUS_11490 34249 34992 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445444.1 protein_id gnl|my_center|LOCUS_11490 34989 37481 gene locus_tag LOCUS_11500 gene mgtA 34989 37481 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948085.1 protein_id gnl|my_center|LOCUS_11500 37478 39847 gene locus_tag LOCUS_11510 37478 39847 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932893.1 protein_id gnl|my_center|LOCUS_11510 39852 41465 gene locus_tag LOCUS_11520 39852 41465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 41480 41890 gene locus_tag LOCUS_11530 41480 41890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 42060 42452 gene locus_tag LOCUS_11540 42060 42452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 43853 42849 gene locus_tag LOCUS_11550 43853 42849 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035273.1 protein_id gnl|my_center|LOCUS_11550 44233 45084 gene locus_tag LOCUS_11560 44233 45084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 45346 45906 gene locus_tag LOCUS_11570 45346 45906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 46018 48684 gene locus_tag LOCUS_11580 46018 48684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 49316 48867 gene locus_tag LOCUS_11590 49316 48867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 49583 50296 gene locus_tag LOCUS_11600 49583 50296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 50296 51438 gene locus_tag LOCUS_11610 50296 51438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 51946 51458 gene locus_tag LOCUS_11620 51946 51458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 52252 52013 gene locus_tag LOCUS_11630 52252 52013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 54016 52424 gene locus_tag LOCUS_11640 54016 52424 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228252.1 protein_id gnl|my_center|LOCUS_11640 54872 54099 gene locus_tag LOCUS_11650 54872 54099 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919165.1 protein_id gnl|my_center|LOCUS_11650 54960 55751 gene locus_tag LOCUS_11660 54960 55751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 56076 55816 gene locus_tag LOCUS_11670 56076 55816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 56890 56171 gene locus_tag LOCUS_11680 56890 56171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11680 57128 56883 gene locus_tag LOCUS_11690 57128 56883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11690 57241 57606 gene locus_tag LOCUS_11700 57241 57606 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544974.1 protein_id gnl|my_center|LOCUS_11700 58221 57634 gene locus_tag LOCUS_11710 58221 57634 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966252.1 protein_id gnl|my_center|LOCUS_11710 58773 58432 gene locus_tag LOCUS_11720 58773 58432 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929212.1 protein_id gnl|my_center|LOCUS_11720 58918 60249 gene locus_tag LOCUS_11730 58918 60249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 60411 61244 gene locus_tag LOCUS_11740 60411 61244 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037361.1 protein_id gnl|my_center|LOCUS_11740 61265 61744 gene locus_tag LOCUS_11750 gene guaD 61265 61744 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245084.1 protein_id gnl|my_center|LOCUS_11750 61868 62326 gene locus_tag LOCUS_11760 61868 62326 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229066.1 protein_id gnl|my_center|LOCUS_11760 62438 63937 gene locus_tag LOCUS_11770 gene xdhA 62438 63937 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061551.1 protein_id gnl|my_center|LOCUS_11770 64254 66470 gene locus_tag LOCUS_11780 gene xdhB 64254 66470 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114679.1 protein_id gnl|my_center|LOCUS_11780 66813 67841 gene locus_tag LOCUS_11790 66813 67841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 68758 69816 gene locus_tag LOCUS_11800 68758 69816 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793101.1 protein_id gnl|my_center|LOCUS_11800 69945 70229 gene locus_tag LOCUS_11810 69945 70229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 71645 70221 gene locus_tag LOCUS_11820 71645 70221 CDS product TIGR03279 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124272.1 protein_id gnl|my_center|LOCUS_11820 71753 72157 gene locus_tag LOCUS_11830 71753 72157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 73564 72449 gene locus_tag LOCUS_11840 gene ald 73564 72449 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219405.1 protein_id gnl|my_center|LOCUS_11840 75301 73772 gene locus_tag LOCUS_11850 75301 73772 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257638.1 protein_id gnl|my_center|LOCUS_11850 76869 75367 gene locus_tag LOCUS_11860 76869 75367 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565602.1 protein_id gnl|my_center|LOCUS_11860 77874 76918 gene locus_tag LOCUS_11870 77874 76918 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_11870 78710 77874 gene locus_tag LOCUS_11880 78710 77874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 78861 79532 gene locus_tag LOCUS_11890 78861 79532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 79529 79867 gene locus_tag LOCUS_11900 79529 79867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 79924 80529 gene locus_tag LOCUS_11910 79924 80529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 81328 80657 gene locus_tag LOCUS_11920 81328 80657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 82731 81475 gene locus_tag LOCUS_11930 82731 81475 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_11930 83591 82905 gene locus_tag LOCUS_11940 83591 82905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 84811 83573 gene locus_tag LOCUS_11950 84811 83573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 85259 84822 gene locus_tag LOCUS_11960 gene rpiB 85259 84822 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161952859.1 protein_id gnl|my_center|LOCUS_11960 85946 85617 gene locus_tag LOCUS_11970 85946 85617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 86563 86051 gene locus_tag LOCUS_11980 86563 86051 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038968086.1 protein_id gnl|my_center|LOCUS_11980 86843 87703 gene locus_tag LOCUS_11990 86843 87703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 87793 88446 gene locus_tag LOCUS_12000 87793 88446 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403974.1 protein_id gnl|my_center|LOCUS_12000 88535 89818 gene locus_tag LOCUS_12010 88535 89818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 89778 90209 gene locus_tag LOCUS_12020 89778 90209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 90493 91836 gene locus_tag LOCUS_12030 90493 91836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12030 91719 92222 gene locus_tag LOCUS_12040 91719 92222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12040 92304 93704 gene locus_tag LOCUS_12050 92304 93704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 94619 93834 gene locus_tag LOCUS_12060 gene larB 94619 93834 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947959.1 protein_id gnl|my_center|LOCUS_12060 94727 95344 gene locus_tag LOCUS_12070 94727 95344 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073576.1 protein_id gnl|my_center|LOCUS_12070 95427 96077 gene locus_tag LOCUS_12080 95427 96077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 96082 96837 gene locus_tag LOCUS_12090 96082 96837 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994060.1 protein_id gnl|my_center|LOCUS_12090 96846 97694 gene locus_tag LOCUS_12100 96846 97694 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 protein_id gnl|my_center|LOCUS_12100 97878 99446 gene locus_tag LOCUS_12110 97878 99446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 99571 100389 gene locus_tag LOCUS_12120 99571 100389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 102197 100452 gene locus_tag LOCUS_12130 102197 100452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 103594 102311 gene locus_tag LOCUS_12140 103594 102311 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038890.1 protein_id gnl|my_center|LOCUS_12140 103843 104838 gene locus_tag LOCUS_12150 103843 104838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 104850 105239 gene locus_tag LOCUS_12160 104850 105239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 105254 106465 gene locus_tag LOCUS_12170 105254 106465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12170 106368 107672 gene locus_tag LOCUS_12180 106368 107672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12180 107633 107866 gene locus_tag LOCUS_12190 107633 107866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 107870 109153 gene locus_tag LOCUS_12200 107870 109153 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028742.1 protein_id gnl|my_center|LOCUS_12200 109468 109788 gene locus_tag LOCUS_12210 109468 109788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 109822 110841 gene locus_tag LOCUS_12220 109822 110841 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943148.1 protein_id gnl|my_center|LOCUS_12220 111043 111834 gene locus_tag LOCUS_12230 111043 111834 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_12230 111844 113805 gene locus_tag LOCUS_12240 111844 113805 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_12240 113802 115370 gene locus_tag LOCUS_12250 113802 115370 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076056374.1 protein_id gnl|my_center|LOCUS_12250 115513 115968 gene locus_tag LOCUS_12260 115513 115968 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941854.1 protein_id gnl|my_center|LOCUS_12260 116556 117110 gene locus_tag LOCUS_12270 116556 117110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 117717 120566 gene locus_tag LOCUS_12280 117717 120566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 123270 120763 gene locus_tag LOCUS_12290 123270 120763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 123241 123447 gene locus_tag LOCUS_12300 123241 123447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 124022 123474 gene locus_tag LOCUS_12310 124022 123474 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_12310 124127 125368 gene locus_tag LOCUS_12320 124127 125368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 125419 127566 gene locus_tag LOCUS_12330 125419 127566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 127603 128796 gene locus_tag LOCUS_12340 127603 128796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 128916 129629 gene locus_tag LOCUS_12350 128916 129629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12350 130321 130109 gene locus_tag LOCUS_12360 130321 130109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 131760 130330 gene locus_tag LOCUS_12370 131760 130330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 132782 131757 gene locus_tag LOCUS_12380 132782 131757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 133354 132779 gene locus_tag LOCUS_12390 133354 132779 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_12390 133555 133959 gene locus_tag LOCUS_12400 133555 133959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 134117 134386 gene locus_tag LOCUS_12410 134117 134386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 134383 134667 gene locus_tag LOCUS_12420 134383 134667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 134812 135936 gene locus_tag LOCUS_12430 134812 135936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 135991 138438 gene locus_tag LOCUS_12440 135991 138438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 138446 139774 gene locus_tag LOCUS_12450 138446 139774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 139777 139926 gene locus_tag LOCUS_12460 139777 139926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 139937 140812 gene locus_tag LOCUS_12470 139937 140812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 141263 143071 gene locus_tag LOCUS_12480 gene typA 141263 143071 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 protein_id gnl|my_center|LOCUS_12480 143185 143520 gene locus_tag LOCUS_12490 143185 143520 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406877.1 protein_id gnl|my_center|LOCUS_12490 143716 143522 gene locus_tag LOCUS_12500 143716 143522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 143762 144598 gene locus_tag LOCUS_12510 143762 144598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 144608 144844 gene locus_tag LOCUS_12520 144608 144844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 144807 145292 gene locus_tag LOCUS_12530 144807 145292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 145382 146320 gene locus_tag LOCUS_12540 145382 146320 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942460.1 protein_id gnl|my_center|LOCUS_12540 146388 147350 gene locus_tag LOCUS_12550 146388 147350 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037025.1 protein_id gnl|my_center|LOCUS_12550 147498 148124 gene locus_tag LOCUS_12560 147498 148124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 148589 148158 gene locus_tag LOCUS_12570 148589 148158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 149633 148746 gene locus_tag LOCUS_12580 149633 148746 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143390.1 protein_id gnl|my_center|LOCUS_12580 149782 150048 gene locus_tag LOCUS_12590 149782 150048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 150114 150845 gene locus_tag LOCUS_12600 150114 150845 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392343.1 protein_id gnl|my_center|LOCUS_12600 151080 151442 gene locus_tag LOCUS_12610 151080 151442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 151599 152636 gene locus_tag LOCUS_12620 151599 152636 CDS product GSU2203 family decaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942843.1 protein_id gnl|my_center|LOCUS_12620 152657 154738 gene locus_tag LOCUS_12630 152657 154738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 155314 158010 gene locus_tag LOCUS_12640 gene ppdK 155314 158010 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258815.1 protein_id gnl|my_center|LOCUS_12640 158483 158821 gene locus_tag LOCUS_12650 158483 158821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 159127 158795 gene locus_tag LOCUS_12660 159127 158795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 159606 161204 gene locus_tag LOCUS_12670 159606 161204 CDS product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943871.1 protein_id gnl|my_center|LOCUS_12670 161728 161399 gene locus_tag LOCUS_12680 161728 161399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 162408 161914 gene locus_tag LOCUS_12690 162408 161914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 163611 162799 gene locus_tag LOCUS_12700 163611 162799 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811924.1 protein_id gnl|my_center|LOCUS_12700 164694 163813 gene locus_tag LOCUS_12710 164694 163813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12710 166307 164994 gene locus_tag LOCUS_12720 166307 164994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 167557 166316 gene locus_tag LOCUS_12730 167557 166316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 167676 169145 gene locus_tag LOCUS_12740 167676 169145 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023171479.1 protein_id gnl|my_center|LOCUS_12740 169733 171181 gene locus_tag LOCUS_12750 169733 171181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 171365 172084 gene locus_tag LOCUS_12760 171365 172084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 172692 173663 gene locus_tag LOCUS_12770 172692 173663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 174080 173745 gene locus_tag LOCUS_12780 174080 173745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 175246 174095 gene locus_tag LOCUS_12790 175246 174095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 176712 175243 gene locus_tag LOCUS_12800 176712 175243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 177027 178670 gene locus_tag LOCUS_12810 gene purH 177027 178670 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941271.1 protein_id gnl|my_center|LOCUS_12810 178856 179065 gene locus_tag LOCUS_12820 178856 179065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 179387 179034 gene locus_tag LOCUS_12830 179387 179034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 180180 179839 gene locus_tag LOCUS_12840 180180 179839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 180635 180177 gene locus_tag LOCUS_12850 180635 180177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 181388 180654 gene locus_tag LOCUS_12860 181388 180654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 181668 181342 gene locus_tag LOCUS_12870 181668 181342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 182990 182493 gene locus_tag LOCUS_12880 182990 182493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 183765 182911 gene locus_tag LOCUS_12890 183765 182911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 184589 183762 gene locus_tag LOCUS_12900 184589 183762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 184993 184829 gene locus_tag LOCUS_12910 184993 184829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 186173 185946 gene locus_tag LOCUS_12920 186173 185946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 186585 186310 gene locus_tag LOCUS_12930 186585 186310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 187261 186965 gene locus_tag LOCUS_12940 187261 186965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 187753 187553 gene locus_tag LOCUS_12950 187753 187553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 188824 187970 gene locus_tag LOCUS_12960 188824 187970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12960 189708 188836 gene locus_tag LOCUS_12970 189708 188836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 190314 189802 gene locus_tag LOCUS_12980 190314 189802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 191743 190622 gene locus_tag LOCUS_12990 191743 190622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 192229 191939 gene locus_tag LOCUS_13000 192229 191939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 194213 192348 gene locus_tag LOCUS_13010 194213 192348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 196686 195502 gene locus_tag LOCUS_13020 196686 195502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 197395 196895 gene locus_tag LOCUS_13030 197395 196895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 199406 198708 gene locus_tag LOCUS_13040 199406 198708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 200842 199421 gene locus_tag LOCUS_13050 200842 199421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 205365 200839 gene locus_tag LOCUS_13060 205365 200839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 206583 205444 gene locus_tag LOCUS_13070 206583 205444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 208494 207538 gene locus_tag LOCUS_13080 208494 207538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 209087 208491 gene locus_tag LOCUS_13090 gene thiE 209087 208491 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941250.1 protein_id gnl|my_center|LOCUS_13090 209550 209248 gene locus_tag LOCUS_13100 209550 209248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 211896 209599 gene locus_tag LOCUS_13110 211896 209599 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942342.1 protein_id gnl|my_center|LOCUS_13110 212156 213196 gene locus_tag LOCUS_13120 212156 213196 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258545.1 protein_id gnl|my_center|LOCUS_13120 213199 213657 gene locus_tag LOCUS_13130 213199 213657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 213662 214492 gene locus_tag LOCUS_13140 gene mutM 213662 214492 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989743.1 protein_id gnl|my_center|LOCUS_13140 214551 215204 gene locus_tag LOCUS_13150 214551 215204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 215562 217529 gene locus_tag LOCUS_13160 215562 217529 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_13160 217965 217696 gene locus_tag LOCUS_13170 217965 217696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 219276 218356 gene locus_tag LOCUS_13180 219276 218356 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977632.1 protein_id gnl|my_center|LOCUS_13180 219729 219400 gene locus_tag LOCUS_13190 gene trxA 219729 219400 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405369.1 protein_id gnl|my_center|LOCUS_13190 220842 219832 gene locus_tag LOCUS_13200 gene ahr 220842 219832 CDS product NADPH-dependent aldehyde reductase Ahr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301967.1 protein_id gnl|my_center|LOCUS_13200 221189 220959 gene locus_tag LOCUS_13210 221189 220959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 221454 223127 gene locus_tag LOCUS_13220 221454 223127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 224813 223581 gene locus_tag LOCUS_13230 224813 223581 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257673.1 protein_id gnl|my_center|LOCUS_13230 228873 225013 gene locus_tag LOCUS_13240 228873 225013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 229106 229867 gene locus_tag LOCUS_13250 229106 229867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 229955 230782 gene locus_tag LOCUS_13260 229955 230782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 230835 231497 gene locus_tag LOCUS_13270 230835 231497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 231503 232162 gene locus_tag LOCUS_13280 231503 232162 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869529.1 protein_id gnl|my_center|LOCUS_13280 233763 232159 gene locus_tag LOCUS_13290 233763 232159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 234281 233841 gene locus_tag LOCUS_13300 234281 233841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 235364 234489 gene locus_tag LOCUS_13310 235364 234489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 235629 237866 gene locus_tag LOCUS_13320 235629 237866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 237872 239515 gene locus_tag LOCUS_13330 237872 239515 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920272.1 protein_id gnl|my_center|LOCUS_13330 239681 240397 gene locus_tag LOCUS_13340 239681 240397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 240469 242913 gene locus_tag LOCUS_13350 240469 242913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 243080 243946 gene locus_tag LOCUS_13360 243080 243946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 244058 245491 gene locus_tag LOCUS_13370 gene trpE 244058 245491 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546555.1 protein_id gnl|my_center|LOCUS_13370 245496 246311 gene locus_tag LOCUS_13380 245496 246311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 246321 246887 gene locus_tag LOCUS_13390 246321 246887 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545428.1 protein_id gnl|my_center|LOCUS_13390 246974 248053 gene locus_tag LOCUS_13400 gene trpD 246974 248053 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_13400 249044 248055 gene locus_tag LOCUS_13410 gene lpxK 249044 248055 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_13410 250668 249196 gene locus_tag LOCUS_13420 250668 249196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 251111 250806 gene locus_tag LOCUS_13430 251111 250806 CDS product ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546507.1 protein_id gnl|my_center|LOCUS_13430 252231 251335 gene locus_tag LOCUS_13440 252231 251335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 252656 252234 gene locus_tag LOCUS_13450 252656 252234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 253419 252949 gene locus_tag LOCUS_13460 253419 252949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 254810 253458 gene locus_tag LOCUS_13470 254810 253458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 256064 254868 gene locus_tag LOCUS_13480 256064 254868 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122402.1 protein_id gnl|my_center|LOCUS_13480 257365 256061 gene locus_tag LOCUS_13490 257365 256061 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_13490 258022 257459 gene locus_tag LOCUS_13500 gene efp 258022 257459 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082309.1 protein_id gnl|my_center|LOCUS_13500 258753 258229 gene locus_tag LOCUS_13510 258753 258229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 260947 258992 gene locus_tag LOCUS_13520 260947 258992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 261280 261077 gene locus_tag LOCUS_13530 261280 261077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 262228 261284 gene locus_tag LOCUS_13540 262228 261284 CDS product DUF4349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680721.1 protein_id gnl|my_center|LOCUS_13540 262931 262305 gene locus_tag LOCUS_13550 262931 262305 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185803.1 protein_id gnl|my_center|LOCUS_13550 263214 263726 gene locus_tag LOCUS_13560 263214 263726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 265123 263768 gene locus_tag LOCUS_13570 265123 263768 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941040.1 protein_id gnl|my_center|LOCUS_13570 265255 265986 gene locus_tag LOCUS_13580 265255 265986 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962538.1 protein_id gnl|my_center|LOCUS_13580 267568 266075 gene locus_tag LOCUS_13590 267568 266075 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941041.1 protein_id gnl|my_center|LOCUS_13590 267799 269217 gene locus_tag LOCUS_13600 267799 269217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 269561 270757 gene locus_tag LOCUS_13610 269561 270757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 270841 271575 gene locus_tag LOCUS_13620 gene rnc 270841 271575 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071557.1 protein_id gnl|my_center|LOCUS_13620 271628 272446 gene locus_tag LOCUS_13630 271628 272446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 272550 273449 gene locus_tag LOCUS_13640 272550 273449 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707170.1 protein_id gnl|my_center|LOCUS_13640 274171 273446 gene locus_tag LOCUS_13650 274171 273446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 274719 274222 gene locus_tag LOCUS_13660 gene ruvC 274719 274222 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256932.1 protein_id gnl|my_center|LOCUS_13660 275660 274920 gene locus_tag LOCUS_13670 275660 274920 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_13670 276017 275712 gene locus_tag LOCUS_13680 gene yggU 276017 275712 CDS product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277224.1 protein_id gnl|my_center|LOCUS_13680 276607 276014 gene locus_tag LOCUS_13690 276607 276014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 277296 276610 gene locus_tag LOCUS_13700 277296 276610 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546351.1 protein_id gnl|my_center|LOCUS_13700 277367 277453 gene locus_tag LOCUS_t00080 277367 277453 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 278439 278113 gene locus_tag LOCUS_13710 278439 278113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 279108 278512 gene locus_tag LOCUS_13720 279108 278512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 279186 279848 gene locus_tag LOCUS_13730 279186 279848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 280225 279824 gene locus_tag LOCUS_13740 280225 279824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 280262 280792 gene locus_tag LOCUS_13750 280262 280792 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167131.1 protein_id gnl|my_center|LOCUS_13750 280789 281946 gene locus_tag LOCUS_13760 280789 281946 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260957.1 protein_id gnl|my_center|LOCUS_13760 282869 282237 gene locus_tag LOCUS_13770 282869 282237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 283738 282890 gene locus_tag LOCUS_13780 283738 282890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 284903 283755 gene locus_tag LOCUS_13790 284903 283755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 285397 284891 gene locus_tag LOCUS_13800 285397 284891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 285701 285405 gene locus_tag LOCUS_13810 285701 285405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 288841 285641 gene locus_tag LOCUS_13820 288841 285641 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877688.1 protein_id gnl|my_center|LOCUS_13820 290532 288871 gene locus_tag LOCUS_13830 290532 288871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 292084 290537 gene locus_tag LOCUS_13840 292084 290537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 292567 292088 gene locus_tag LOCUS_13850 292567 292088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 294502 292580 gene locus_tag LOCUS_13860 294502 292580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 294930 296588 gene locus_tag LOCUS_13870 294930 296588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 296607 297686 gene locus_tag LOCUS_13880 296607 297686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 299303 298449 gene locus_tag LOCUS_13890 299303 298449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 299975 299337 gene locus_tag LOCUS_13900 299975 299337 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392680.1 protein_id gnl|my_center|LOCUS_13900 301127 300027 gene locus_tag LOCUS_13910 gene ychF 301127 300027 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965433.1 protein_id gnl|my_center|LOCUS_13910 301293 303257 gene locus_tag LOCUS_13920 301293 303257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 303291 305612 gene locus_tag LOCUS_13930 303291 305612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 308499 305701 gene locus_tag LOCUS_13940 308499 305701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 309563 308517 gene locus_tag LOCUS_13950 309563 308517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 310145 309585 gene locus_tag LOCUS_13960 310145 309585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 310752 310159 gene locus_tag LOCUS_13970 310752 310159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 312077 310956 gene locus_tag LOCUS_13980 312077 310956 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259418.1 protein_id gnl|my_center|LOCUS_13980 312457 312125 gene locus_tag LOCUS_13990 312457 312125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 313600 312716 gene locus_tag LOCUS_14000 313600 312716 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545844.1 protein_id gnl|my_center|LOCUS_14000 314097 313861 gene locus_tag LOCUS_14010 314097 313861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 314540 314097 gene locus_tag LOCUS_14020 314540 314097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 314716 314537 gene locus_tag LOCUS_14030 314716 314537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 314888 316060 gene locus_tag LOCUS_14040 314888 316060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 316150 317238 gene locus_tag LOCUS_14050 gene leuB 316150 317238 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393735.1 protein_id gnl|my_center|LOCUS_14050 317311 318729 gene locus_tag LOCUS_14060 gene leuC 317311 318729 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855526.1 protein_id gnl|my_center|LOCUS_14060 318803 319408 gene locus_tag LOCUS_14070 gene leuD 318803 319408 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038429.1 protein_id gnl|my_center|LOCUS_14070 319553 320686 gene locus_tag LOCUS_14080 319553 320686 CDS product bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201906.1 protein_id gnl|my_center|LOCUS_14080 320777 321709 gene locus_tag LOCUS_14090 320777 321709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 322434 321934 gene locus_tag LOCUS_14100 322434 321934 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080739.1 protein_id gnl|my_center|LOCUS_14100 322527 322612 gene locus_tag LOCUS_t00090 322527 322612 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 323210 322818 gene locus_tag LOCUS_14110 323210 322818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 323415 323215 gene locus_tag LOCUS_14120 323415 323215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 325448 324366 gene locus_tag LOCUS_14130 325448 324366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14130 326832 325615 gene locus_tag LOCUS_14140 326832 325615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14140 327488 328069 gene locus_tag LOCUS_14150 327488 328069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 328239 328835 gene locus_tag LOCUS_14160 328239 328835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 330497 329001 gene locus_tag LOCUS_14170 330497 329001 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051113354.1 protein_id gnl|my_center|LOCUS_14170 331139 332074 gene locus_tag LOCUS_14180 gene mdh 331139 332074 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_14180 332266 332493 gene locus_tag LOCUS_14190 332266 332493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 332486 332842 gene locus_tag LOCUS_14200 332486 332842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14200 332950 333816 gene locus_tag LOCUS_14210 332950 333816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14210 334630 334028 gene locus_tag LOCUS_14220 334630 334028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14220 335382 334573 gene locus_tag LOCUS_14230 335382 334573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14230 335980 335438 gene locus_tag LOCUS_14240 335980 335438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 338443 336299 gene locus_tag LOCUS_14250 338443 336299 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_14250 338579 339445 gene locus_tag LOCUS_14260 338579 339445 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047751.1 protein_id gnl|my_center|LOCUS_14260 339884 339423 gene locus_tag LOCUS_14270 339884 339423 CDS product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404918.1 protein_id gnl|my_center|LOCUS_14270 341243 340386 gene locus_tag LOCUS_14280 gene nadC 341243 340386 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067615902.1 protein_id gnl|my_center|LOCUS_14280 344080 341360 gene locus_tag LOCUS_14290 344080 341360 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942688.1 protein_id gnl|my_center|LOCUS_14290 345347 344241 gene locus_tag LOCUS_14300 345347 344241 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942689.1 protein_id gnl|my_center|LOCUS_14300 345768 345373 gene locus_tag LOCUS_14310 345768 345373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 346835 345807 gene locus_tag LOCUS_14320 gene pdxA 346835 345807 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545509.1 protein_id gnl|my_center|LOCUS_14320 347198 346908 gene locus_tag LOCUS_14330 347198 346908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 348359 347229 gene locus_tag LOCUS_14340 gene ftsZ 348359 347229 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_14340 349751 348510 gene locus_tag LOCUS_14350 gene ftsA 349751 348510 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_14350 350497 349748 gene locus_tag LOCUS_14360 350497 349748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 351991 350612 gene locus_tag LOCUS_14370 gene murC 351991 350612 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_14370 353288 352224 gene locus_tag LOCUS_14380 gene murG 353288 352224 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_14380 354516 353356 gene locus_tag LOCUS_14390 gene spoVE 354516 353356 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949037.1 protein_id gnl|my_center|LOCUS_14390 355905 354541 gene locus_tag LOCUS_14400 gene murD 355905 354541 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_14400 357158 356007 gene locus_tag LOCUS_14410 gene mraY 357158 356007 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_14410 358678 357221 gene locus_tag LOCUS_14420 358678 357221 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_14420 360597 358675 gene locus_tag LOCUS_14430 360597 358675 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_14430 361173 360649 gene locus_tag LOCUS_14440 361173 360649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 362125 361187 gene locus_tag LOCUS_14450 gene rsmH 362125 361187 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142921.1 protein_id gnl|my_center|LOCUS_14450 362648 363454 gene locus_tag LOCUS_14460 362648 363454 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057504658.1 protein_id gnl|my_center|LOCUS_14460 363518 364402 gene locus_tag LOCUS_14470 363518 364402 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948221.1 protein_id gnl|my_center|LOCUS_14470 364509 365105 gene locus_tag LOCUS_14480 364509 365105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 365130 365849 gene locus_tag LOCUS_14490 365130 365849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 365957 366658 gene locus_tag LOCUS_14500 365957 366658 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272666.1 protein_id gnl|my_center|LOCUS_14500 367121 366768 gene locus_tag LOCUS_14510 367121 366768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 367432 367118 gene locus_tag LOCUS_14520 367432 367118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 368003 367725 gene locus_tag LOCUS_14530 368003 367725 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388667.1 protein_id gnl|my_center|LOCUS_14530 368367 368101 gene locus_tag LOCUS_14540 368367 368101 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016131.1 protein_id gnl|my_center|LOCUS_14540 368719 368441 gene locus_tag LOCUS_14550 gene pduA 368719 368441 CDS product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183618.1 protein_id gnl|my_center|LOCUS_14550 369546 368764 gene locus_tag LOCUS_14560 369546 368764 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392225.1 protein_id gnl|my_center|LOCUS_14560 369957 369685 gene locus_tag LOCUS_14570 369957 369685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 370672 370019 gene locus_tag LOCUS_14580 370672 370019 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936275.1 protein_id gnl|my_center|LOCUS_14580 370843 371454 gene locus_tag LOCUS_14590 gene ruvA 370843 371454 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_14590 371522 372325 gene locus_tag LOCUS_14600 371522 372325 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639024.1 protein_id gnl|my_center|LOCUS_14600 372332 373375 gene locus_tag LOCUS_14610 gene ruvB 372332 373375 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072404.1 protein_id gnl|my_center|LOCUS_14610 373507 373695 gene locus_tag LOCUS_14620 373507 373695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 374196 373924 gene locus_tag LOCUS_14630 374196 373924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 374960 374199 gene locus_tag LOCUS_14640 374960 374199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 374959 375228 gene locus_tag LOCUS_14650 374959 375228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 375493 375212 gene locus_tag LOCUS_14660 375493 375212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 377570 375615 gene locus_tag LOCUS_14670 gene acs 377570 375615 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933316.1 protein_id gnl|my_center|LOCUS_14670 379255 377705 gene locus_tag LOCUS_14680 379255 377705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 380092 379613 gene locus_tag LOCUS_14690 380092 379613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 380371 380754 gene locus_tag LOCUS_14700 380371 380754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 380876 381514 gene locus_tag LOCUS_14710 380876 381514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 381663 382232 gene locus_tag LOCUS_14720 381663 382232 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172421.1 protein_id gnl|my_center|LOCUS_14720 382418 383773 gene locus_tag LOCUS_14730 382418 383773 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229720.1 protein_id gnl|my_center|LOCUS_14730 383892 384662 gene locus_tag LOCUS_14740 383892 384662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 385706 384747 gene locus_tag LOCUS_14750 385706 384747 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226301.1 protein_id gnl|my_center|LOCUS_14750 387103 385868 gene locus_tag LOCUS_14760 gene serA 387103 385868 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116919.1 protein_id gnl|my_center|LOCUS_14760 387199 387453 gene locus_tag LOCUS_14770 387199 387453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 389084 387486 gene locus_tag LOCUS_14780 389084 387486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 390638 389229 gene locus_tag LOCUS_14790 gene lpdA 390638 389229 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258694.1 protein_id gnl|my_center|LOCUS_14790 390906 391277 gene locus_tag LOCUS_14800 390906 391277 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140042.1 protein_id gnl|my_center|LOCUS_14800 391274 391681 gene locus_tag LOCUS_14810 391274 391681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 392616 392239 gene locus_tag LOCUS_14820 392616 392239 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119424.1 protein_id gnl|my_center|LOCUS_14820 393341 392850 gene locus_tag LOCUS_14830 393341 392850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 394350 393778 gene locus_tag LOCUS_14840 394350 393778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 394423 395196 gene locus_tag LOCUS_14850 394423 395196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 395634 396065 gene locus_tag LOCUS_14860 395634 396065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 396273 396941 gene locus_tag LOCUS_14870 396273 396941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 397042 397698 gene locus_tag LOCUS_14880 397042 397698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14880 397830 397755 gene locus_tag LOCUS_t00100 397830 397755 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 400033 398012 gene locus_tag LOCUS_14890 400033 398012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 401598 400249 gene locus_tag LOCUS_14900 401598 400249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 403037 401772 gene locus_tag LOCUS_14910 403037 401772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 403511 403083 gene locus_tag LOCUS_14920 403511 403083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 404171 403665 gene locus_tag LOCUS_14930 404171 403665 CDS product Rab family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_14930 405844 404168 gene locus_tag LOCUS_14940 405844 404168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 406506 405952 gene locus_tag LOCUS_14950 406506 405952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 408452 406503 gene locus_tag LOCUS_14960 408452 406503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 410553 409189 gene locus_tag LOCUS_14970 410553 409189 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462141.1 protein_id gnl|my_center|LOCUS_14970 411850 410576 gene locus_tag LOCUS_14980 411850 410576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 412178 411858 gene locus_tag LOCUS_14990 412178 411858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 412334 413998 gene locus_tag LOCUS_15000 412334 413998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 415674 414109 gene locus_tag LOCUS_15010 gene nadB 415674 414109 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545397.1 protein_id gnl|my_center|LOCUS_15010 415956 416462 gene locus_tag LOCUS_15020 415956 416462 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942724.1 protein_id gnl|my_center|LOCUS_15020 416641 416895 gene locus_tag LOCUS_15030 416641 416895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 416896 418104 gene locus_tag LOCUS_15040 416896 418104 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121802.1 protein_id gnl|my_center|LOCUS_15040 418170 419975 gene locus_tag LOCUS_15050 418170 419975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098076974.1 protein_id gnl|my_center|LOCUS_15050 419984 421258 gene locus_tag LOCUS_15060 419984 421258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 421255 422661 gene locus_tag LOCUS_15070 421255 422661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 423341 422664 gene locus_tag LOCUS_15080 423341 422664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 425149 423341 gene locus_tag LOCUS_15090 425149 423341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 425703 425356 gene locus_tag LOCUS_15100 425703 425356 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406877.1 protein_id gnl|my_center|LOCUS_15100 426201 425785 gene locus_tag LOCUS_15110 426201 425785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 426365 426907 gene locus_tag LOCUS_15120 426365 426907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 428063 426954 gene locus_tag LOCUS_15130 428063 426954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 428502 428053 gene locus_tag LOCUS_15140 428502 428053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 428988 429491 gene locus_tag LOCUS_15150 428988 429491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15150 429521 430045 gene locus_tag LOCUS_15160 429521 430045 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151377.1 protein_id gnl|my_center|LOCUS_15160 430215 430544 gene locus_tag LOCUS_15170 430215 430544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 430566 430934 gene locus_tag LOCUS_15180 gene kbp 430566 430934 CDS product potassium binding protein Kbp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522413.1 protein_id gnl|my_center|LOCUS_15180 431645 433639 gene locus_tag LOCUS_15190 431645 433639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 435276 433864 gene locus_tag LOCUS_15200 435276 433864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 436660 435269 gene locus_tag LOCUS_15210 436660 435269 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223055.1 protein_id gnl|my_center|LOCUS_15210 436856 437182 gene locus_tag LOCUS_15220 436856 437182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 437576 437172 gene locus_tag LOCUS_15230 437576 437172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 437893 437573 gene locus_tag LOCUS_15240 437893 437573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 438002 438223 gene locus_tag LOCUS_15250 438002 438223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 438418 440157 gene locus_tag LOCUS_15260 438418 440157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 440157 440849 gene locus_tag LOCUS_15270 440157 440849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 441870 440737 gene locus_tag LOCUS_15280 441870 440737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 442492 441926 gene locus_tag LOCUS_15290 442492 441926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 443763 442555 gene locus_tag LOCUS_15300 443763 442555 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787334.1 protein_id gnl|my_center|LOCUS_15300 444711 443764 gene locus_tag LOCUS_15310 444711 443764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 446940 445057 gene locus_tag LOCUS_15320 446940 445057 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_15320 447105 448694 gene locus_tag LOCUS_15330 447105 448694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 449931 449113 gene locus_tag LOCUS_15340 449931 449113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 452082 449935 gene locus_tag LOCUS_15350 452082 449935 CDS product bi-domain-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924817.1 protein_id gnl|my_center|LOCUS_15350 452445 452203 gene locus_tag LOCUS_15360 452445 452203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15360 453318 452473 gene locus_tag LOCUS_15370 453318 452473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15370 455023 454805 gene locus_tag LOCUS_15380 455023 454805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 455906 455418 gene locus_tag LOCUS_15390 455906 455418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 457044 455911 gene locus_tag LOCUS_15400 457044 455911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 457444 457046 gene locus_tag LOCUS_15410 457444 457046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 458111 457497 gene locus_tag LOCUS_15420 458111 457497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 459664 458672 gene locus_tag LOCUS_15430 459664 458672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 461170 459683 gene locus_tag LOCUS_15440 461170 459683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 461766 461281 gene locus_tag LOCUS_15450 461766 461281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 463845 461815 gene locus_tag LOCUS_15460 463845 461815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 464432 464103 gene locus_tag LOCUS_15470 464432 464103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 466041 465667 gene locus_tag LOCUS_15480 466041 465667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 466628 466038 gene locus_tag LOCUS_15490 466628 466038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 467011 466649 gene locus_tag LOCUS_15500 467011 466649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 467734 467174 gene locus_tag LOCUS_15510 467734 467174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 469015 467741 gene locus_tag LOCUS_15520 469015 467741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 469275 468997 gene locus_tag LOCUS_15530 469275 468997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 470262 469630 gene locus_tag LOCUS_15540 470262 469630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 470981 471160 gene locus_tag LOCUS_15550 470981 471160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 472679 472335 gene locus_tag LOCUS_15560 472679 472335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 >Feature sequence04 582 427 gene locus_tag LOCUS_15570 582 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 1535 579 gene locus_tag LOCUS_15580 1535 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 1845 1606 gene locus_tag LOCUS_15590 1845 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 2437 2018 gene locus_tag LOCUS_15600 2437 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 3015 2434 gene locus_tag LOCUS_15610 3015 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 3769 3041 gene locus_tag LOCUS_15620 3769 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 5061 4447 gene locus_tag LOCUS_15630 5061 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 5237 5073 gene locus_tag LOCUS_15640 5237 5073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 8125 5411 gene locus_tag LOCUS_15650 8125 5411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 9246 8035 gene locus_tag LOCUS_15660 9246 8035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 10040 9297 gene locus_tag LOCUS_15670 10040 9297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 10837 10547 gene locus_tag LOCUS_15680 10837 10547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 11639 11517 gene locus_tag LOCUS_15690 11639 11517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 13526 11790 gene locus_tag LOCUS_15700 13526 11790 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058098.1 protein_id gnl|my_center|LOCUS_15700 15671 13656 gene locus_tag LOCUS_15710 15671 13656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 15763 16365 gene locus_tag LOCUS_15720 15763 16365 CDS product DUF937 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962799.1 protein_id gnl|my_center|LOCUS_15720 16595 16792 gene locus_tag LOCUS_15730 16595 16792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 16914 17375 gene locus_tag LOCUS_15740 16914 17375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 17453 18550 gene locus_tag LOCUS_15750 17453 18550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 18534 18770 gene locus_tag LOCUS_15760 18534 18770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 18767 19066 gene locus_tag LOCUS_15770 18767 19066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 19921 20142 gene locus_tag LOCUS_15780 19921 20142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 20521 20862 gene locus_tag LOCUS_15790 20521 20862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 21219 20944 gene locus_tag LOCUS_15800 21219 20944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15800 22228 22605 gene locus_tag LOCUS_15810 22228 22605 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776558.1 protein_id gnl|my_center|LOCUS_15810 22705 26331 gene locus_tag LOCUS_15820 gene metH 22705 26331 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140480.1 protein_id gnl|my_center|LOCUS_15820 26449 26970 gene locus_tag LOCUS_15830 26449 26970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 26990 27175 gene locus_tag LOCUS_15840 26990 27175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 27237 27599 gene locus_tag LOCUS_15850 27237 27599 CDS product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878140.1 protein_id gnl|my_center|LOCUS_15850 27611 27988 gene locus_tag LOCUS_15860 27611 27988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 28110 28325 gene locus_tag LOCUS_15870 28110 28325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 28340 29476 gene locus_tag LOCUS_15880 28340 29476 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067131.1 protein_id gnl|my_center|LOCUS_15880 29497 29862 gene locus_tag LOCUS_15890 29497 29862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 29885 30532 gene locus_tag LOCUS_15900 29885 30532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 30537 30986 gene locus_tag LOCUS_15910 30537 30986 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531786.1 protein_id gnl|my_center|LOCUS_15910 31604 30978 gene locus_tag LOCUS_15920 31604 30978 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530981.1 protein_id gnl|my_center|LOCUS_15920 32212 31604 gene locus_tag LOCUS_15930 32212 31604 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039531.1 protein_id gnl|my_center|LOCUS_15930 32728 32360 gene locus_tag LOCUS_15940 32728 32360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 34898 32850 gene locus_tag LOCUS_15950 34898 32850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 38050 35141 gene locus_tag LOCUS_15960 38050 35141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 38183 39049 gene locus_tag LOCUS_15970 38183 39049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 39046 39387 gene locus_tag LOCUS_15980 39046 39387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 39581 39724 gene locus_tag LOCUS_15990 39581 39724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 40179 39715 gene locus_tag LOCUS_16000 40179 39715 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_16000 40376 40837 gene locus_tag LOCUS_16010 40376 40837 CDS product heme-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726283.1 protein_id gnl|my_center|LOCUS_16010 41047 41577 gene locus_tag LOCUS_16020 41047 41577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 41702 42676 gene locus_tag LOCUS_16030 41702 42676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 42677 43525 gene locus_tag LOCUS_16040 42677 43525 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265874.1 protein_id gnl|my_center|LOCUS_16040 43551 44057 gene locus_tag LOCUS_16050 43551 44057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 44286 44546 gene locus_tag LOCUS_16060 44286 44546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 44609 45130 gene locus_tag LOCUS_16070 gene def 44609 45130 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545479.1 protein_id gnl|my_center|LOCUS_16070 46094 47212 gene locus_tag LOCUS_16080 46094 47212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 47435 47250 gene locus_tag LOCUS_16090 47435 47250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 49132 48098 gene locus_tag LOCUS_16100 49132 48098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 50740 49139 gene locus_tag LOCUS_16110 50740 49139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 50984 50772 gene locus_tag LOCUS_16120 50984 50772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 51149 54763 gene locus_tag LOCUS_16130 51149 54763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 54862 56871 gene locus_tag LOCUS_16140 54862 56871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 57021 58310 gene locus_tag LOCUS_16150 gene pelB 57021 58310 CDS product exopolygalacturonase PelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865120.1 protein_id gnl|my_center|LOCUS_16150 58332 59075 gene locus_tag LOCUS_16160 gene rhgT 58332 59075 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233825.1 protein_id gnl|my_center|LOCUS_16160 59146 61065 gene locus_tag LOCUS_16170 59146 61065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 61773 62291 gene locus_tag LOCUS_16180 61773 62291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 62350 63114 gene locus_tag LOCUS_16190 62350 63114 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393787.1 protein_id gnl|my_center|LOCUS_16190 64799 63183 gene locus_tag LOCUS_16200 64799 63183 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055228983.1 protein_id gnl|my_center|LOCUS_16200 66072 64792 gene locus_tag LOCUS_16210 66072 64792 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_16210 67162 66083 gene locus_tag LOCUS_16220 67162 66083 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582708.1 protein_id gnl|my_center|LOCUS_16220 67935 67159 gene locus_tag LOCUS_16230 67935 67159 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029015.1 protein_id gnl|my_center|LOCUS_16230 68156 69082 gene locus_tag LOCUS_16240 68156 69082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 69086 70657 gene locus_tag LOCUS_16250 69086 70657 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085758.1 protein_id gnl|my_center|LOCUS_16250 70676 71893 gene locus_tag LOCUS_16260 70676 71893 CDS product xylose repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244935.1 protein_id gnl|my_center|LOCUS_16260 71903 72739 gene locus_tag LOCUS_16270 gene iolB 71903 72739 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031348.1 protein_id gnl|my_center|LOCUS_16270 72791 73555 gene locus_tag LOCUS_16280 gene kduD 72791 73555 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097013.1 protein_id gnl|my_center|LOCUS_16280 73591 74682 gene locus_tag LOCUS_16290 73591 74682 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_16290 74672 75340 gene locus_tag LOCUS_16300 gene eda 74672 75340 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_16300 75703 76467 gene locus_tag LOCUS_16310 75703 76467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 78221 77094 gene locus_tag LOCUS_16320 78221 77094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 79461 78277 gene locus_tag LOCUS_16330 79461 78277 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261965.1 protein_id gnl|my_center|LOCUS_16330 79573 80874 gene locus_tag LOCUS_16340 79573 80874 CDS product lpg1661 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947388.1 protein_id gnl|my_center|LOCUS_16340 83138 80961 gene locus_tag LOCUS_16350 83138 80961 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404730.1 protein_id gnl|my_center|LOCUS_16350 83955 83629 gene locus_tag LOCUS_16360 83955 83629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 86420 84036 gene locus_tag LOCUS_16370 gene pcrA 86420 84036 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163769.1 protein_id gnl|my_center|LOCUS_16370 88290 86518 gene locus_tag LOCUS_16380 88290 86518 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111122.1 protein_id gnl|my_center|LOCUS_16380 88841 88287 gene locus_tag LOCUS_16390 88841 88287 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933341.1 protein_id gnl|my_center|LOCUS_16390 89000 88845 gene locus_tag LOCUS_16400 89000 88845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 89095 90945 gene locus_tag LOCUS_16410 89095 90945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 91540 91767 gene locus_tag LOCUS_16420 91540 91767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 91764 93185 gene locus_tag LOCUS_16430 91764 93185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 94743 93643 gene locus_tag LOCUS_16440 94743 93643 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876334.1 protein_id gnl|my_center|LOCUS_16440 96513 94876 gene locus_tag LOCUS_16450 96513 94876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 96691 97095 gene locus_tag LOCUS_16460 96691 97095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 98085 97210 gene locus_tag LOCUS_16470 98085 97210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 99280 98141 gene locus_tag LOCUS_16480 99280 98141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 99912 99277 gene locus_tag LOCUS_16490 99912 99277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 100399 99917 gene locus_tag LOCUS_16500 100399 99917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 103365 100573 gene locus_tag LOCUS_16510 103365 100573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 104855 103362 gene locus_tag LOCUS_16520 104855 103362 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389142.1 protein_id gnl|my_center|LOCUS_16520 105135 106595 gene locus_tag LOCUS_16530 105135 106595 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211292884.1 protein_id gnl|my_center|LOCUS_16530 107601 107392 gene locus_tag LOCUS_16540 107601 107392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 107482 108276 gene locus_tag LOCUS_16550 107482 108276 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 protein_id gnl|my_center|LOCUS_16550 108300 108980 gene locus_tag LOCUS_16560 108300 108980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 110345 109065 gene locus_tag LOCUS_16570 110345 109065 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16570 110656 110336 gene locus_tag LOCUS_16580 110656 110336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16580 111696 110968 gene locus_tag LOCUS_16590 111696 110968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 112497 111835 gene locus_tag LOCUS_16600 112497 111835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 113321 112530 gene locus_tag LOCUS_16610 113321 112530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 114064 113393 gene locus_tag LOCUS_16620 114064 113393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16620 114139 114288 gene locus_tag LOCUS_16630 114139 114288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 114466 114777 gene locus_tag LOCUS_16640 114466 114777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 115789 114854 gene locus_tag LOCUS_16650 115789 114854 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941926.1 protein_id gnl|my_center|LOCUS_16650 116430 115918 gene locus_tag LOCUS_16660 gene pyrR 116430 115918 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460661.1 protein_id gnl|my_center|LOCUS_16660 117691 116525 gene locus_tag LOCUS_16670 gene lpxB 117691 116525 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_16670 117946 120507 gene locus_tag LOCUS_16680 117946 120507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 120726 121721 gene locus_tag LOCUS_16690 gene ilvE 120726 121721 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061049.1 protein_id gnl|my_center|LOCUS_16690 121844 122146 gene locus_tag LOCUS_16700 121844 122146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 122143 122460 gene locus_tag LOCUS_16710 122143 122460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 122466 123560 gene locus_tag LOCUS_16720 122466 123560 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143073.1 protein_id gnl|my_center|LOCUS_16720 123684 124190 gene locus_tag LOCUS_16730 123684 124190 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545391.1 protein_id gnl|my_center|LOCUS_16730 124259 124444 gene locus_tag LOCUS_16740 gene rpmF 124259 124444 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007598106.1 protein_id gnl|my_center|LOCUS_16740 124526 125509 gene locus_tag LOCUS_16750 124526 125509 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942246.1 protein_id gnl|my_center|LOCUS_16750 125847 126815 gene locus_tag LOCUS_16760 gene fabD 125847 126815 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_16760 126872 127111 gene locus_tag LOCUS_16770 126872 127111 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779510.1 protein_id gnl|my_center|LOCUS_16770 127202 128443 gene locus_tag LOCUS_16780 gene fabF 127202 128443 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_16780 128580 129350 gene locus_tag LOCUS_16790 128580 129350 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692397.1 protein_id gnl|my_center|LOCUS_16790 129381 130349 gene locus_tag LOCUS_16800 gene etfA 129381 130349 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101963.1 protein_id gnl|my_center|LOCUS_16800 130557 130330 gene locus_tag LOCUS_16810 130557 130330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 131256 130591 gene locus_tag LOCUS_16820 131256 130591 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932882.1 protein_id gnl|my_center|LOCUS_16820 132716 131361 gene locus_tag LOCUS_16830 132716 131361 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228250.1 protein_id gnl|my_center|LOCUS_16830 132986 134992 gene locus_tag LOCUS_16840 132986 134992 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257128.1 protein_id gnl|my_center|LOCUS_16840 135495 135196 gene locus_tag LOCUS_16850 135495 135196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 135999 135757 gene locus_tag LOCUS_16860 135999 135757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 136356 137615 gene locus_tag LOCUS_16870 136356 137615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 137810 139210 gene locus_tag LOCUS_16880 137810 139210 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444159.1 protein_id gnl|my_center|LOCUS_16880 140683 139457 gene locus_tag LOCUS_16890 140683 139457 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809406.1 protein_id gnl|my_center|LOCUS_16890 141221 140733 gene locus_tag LOCUS_16900 141221 140733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 141976 141320 gene locus_tag LOCUS_16910 141976 141320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16910 142202 143086 gene locus_tag LOCUS_16920 gene sucD 142202 143086 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020335.1 protein_id gnl|my_center|LOCUS_16920 143106 143534 gene locus_tag LOCUS_16930 143106 143534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 143531 143917 gene locus_tag LOCUS_16940 143531 143917 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920363.1 protein_id gnl|my_center|LOCUS_16940 144016 144432 gene locus_tag LOCUS_16950 gene ndk 144016 144432 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725218.1 protein_id gnl|my_center|LOCUS_16950 144571 145911 gene locus_tag LOCUS_16960 144571 145911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 145933 146454 gene locus_tag LOCUS_16970 145933 146454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 146530 147150 gene locus_tag LOCUS_16980 146530 147150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 147578 148474 gene locus_tag LOCUS_16990 147578 148474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 148814 148557 gene locus_tag LOCUS_17000 148814 148557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 149013 150233 gene locus_tag LOCUS_17010 149013 150233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 151140 150286 gene locus_tag LOCUS_17020 151140 150286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 151258 152028 gene locus_tag LOCUS_17030 gene kdsB 151258 152028 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_17030 152025 152318 gene locus_tag LOCUS_17040 152025 152318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 152328 154028 gene locus_tag LOCUS_17050 152328 154028 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942540.1 protein_id gnl|my_center|LOCUS_17050 154092 154919 gene locus_tag LOCUS_17060 gene kdsA 154092 154919 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_17060 154961 157204 gene locus_tag LOCUS_17070 154961 157204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 157208 157738 gene locus_tag LOCUS_17080 157208 157738 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689546.1 protein_id gnl|my_center|LOCUS_17080 158085 159601 gene locus_tag LOCUS_r00010 158085 159601 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 159751 159827 gene locus_tag LOCUS_t00110 159751 159827 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 159839 159915 gene locus_tag LOCUS_t00120 159839 159915 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 159994 160069 gene locus_tag LOCUS_t00130 159994 160069 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 160226 163099 gene locus_tag LOCUS_r00020 160226 163099 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 163178 163287 gene locus_tag LOCUS_r00030 163178 163287 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 163631 164062 gene locus_tag LOCUS_17090 163631 164062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 164231 164653 gene locus_tag LOCUS_17100 164231 164653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 164786 165151 gene locus_tag LOCUS_17110 164786 165151 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764611.1 protein_id gnl|my_center|LOCUS_17110 167752 165620 gene locus_tag LOCUS_17120 167752 165620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 167926 168246 gene locus_tag LOCUS_17130 167926 168246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 168260 170113 gene locus_tag LOCUS_17140 168260 170113 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040200.1 protein_id gnl|my_center|LOCUS_17140 170247 171143 gene locus_tag LOCUS_17150 170247 171143 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_17150 171447 171145 gene locus_tag LOCUS_17160 171447 171145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 172200 171448 gene locus_tag LOCUS_17170 172200 171448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 172559 172290 gene locus_tag LOCUS_17180 172559 172290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 174157 173138 gene locus_tag LOCUS_17190 174157 173138 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057605.1 protein_id gnl|my_center|LOCUS_17190 176131 174359 gene locus_tag LOCUS_17200 gene ptsP 176131 174359 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254212.1 protein_id gnl|my_center|LOCUS_17200 177071 176142 gene locus_tag LOCUS_17210 177071 176142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 177659 177111 gene locus_tag LOCUS_17220 177659 177111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 179116 177725 gene locus_tag LOCUS_17230 179116 177725 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258886.1 protein_id gnl|my_center|LOCUS_17230 180048 179113 gene locus_tag LOCUS_17240 180048 179113 CDS product metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942637.1 protein_id gnl|my_center|LOCUS_17240 180405 182048 gene locus_tag LOCUS_17250 180405 182048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 182818 182105 gene locus_tag LOCUS_17260 182818 182105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 182925 183923 gene locus_tag LOCUS_17270 182925 183923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 183929 184951 gene locus_tag LOCUS_17280 183929 184951 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933710.1 protein_id gnl|my_center|LOCUS_17280 185364 184975 gene locus_tag LOCUS_17290 185364 184975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070814.1 protein_id gnl|my_center|LOCUS_17290 188502 186052 gene locus_tag LOCUS_17300 188502 186052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 190690 188975 gene locus_tag LOCUS_17310 gene hflX 190690 188975 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941674.1 protein_id gnl|my_center|LOCUS_17310 192898 190808 gene locus_tag LOCUS_17320 192898 190808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 193822 193172 gene locus_tag LOCUS_17330 193822 193172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 194353 194775 gene locus_tag LOCUS_17340 194353 194775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 195346 194924 gene locus_tag LOCUS_17350 gene ybeY 195346 194924 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880869.1 protein_id gnl|my_center|LOCUS_17350 196324 195407 gene locus_tag LOCUS_17360 196324 195407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 196534 198048 gene locus_tag LOCUS_17370 gene atpD 196534 198048 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962293.1 protein_id gnl|my_center|LOCUS_17370 198131 198529 gene locus_tag LOCUS_17380 198131 198529 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462228.1 protein_id gnl|my_center|LOCUS_17380 199773 198733 gene locus_tag LOCUS_17390 gene aroF 199773 198733 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256593.1 protein_id gnl|my_center|LOCUS_17390 200294 199770 gene locus_tag LOCUS_17400 200294 199770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963783.1 protein_id gnl|my_center|LOCUS_17400 202637 200517 gene locus_tag LOCUS_17410 202637 200517 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250186.1 protein_id gnl|my_center|LOCUS_17410 203138 203671 gene locus_tag LOCUS_17420 203138 203671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 203682 204041 gene locus_tag LOCUS_17430 203682 204041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 204249 204614 gene locus_tag LOCUS_17440 204249 204614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 204713 205204 gene locus_tag LOCUS_17450 204713 205204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 205802 206002 gene locus_tag LOCUS_17460 205802 206002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 206249 207370 gene locus_tag LOCUS_17470 206249 207370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 207580 208050 gene locus_tag LOCUS_17480 207580 208050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 208406 209026 gene locus_tag LOCUS_17490 208406 209026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 209163 210245 gene locus_tag LOCUS_17500 209163 210245 CDS product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237280.1 protein_id gnl|my_center|LOCUS_17500 210342 212165 gene locus_tag LOCUS_17510 210342 212165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 212605 213072 gene locus_tag LOCUS_17520 212605 213072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 213892 214152 gene locus_tag LOCUS_17530 213892 214152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 214167 215177 gene locus_tag LOCUS_17540 214167 215177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 215230 215481 gene locus_tag LOCUS_17550 215230 215481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 215544 216905 gene locus_tag LOCUS_17560 215544 216905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 216974 217162 gene locus_tag LOCUS_17570 216974 217162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 217159 218001 gene locus_tag LOCUS_17580 217159 218001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 218492 218686 gene locus_tag LOCUS_17590 218492 218686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 218741 219049 gene locus_tag LOCUS_17600 218741 219049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 219240 219638 gene locus_tag LOCUS_17610 219240 219638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 219569 219835 gene locus_tag LOCUS_17620 219569 219835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 220454 220146 gene locus_tag LOCUS_17630 220454 220146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 222525 222776 gene locus_tag LOCUS_17640 222525 222776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 224627 225346 gene locus_tag LOCUS_17650 224627 225346 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881424.1 protein_id gnl|my_center|LOCUS_17650 225351 226049 gene locus_tag LOCUS_17660 225351 226049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17660 226040 226534 gene locus_tag LOCUS_17670 226040 226534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17670 226575 227216 gene locus_tag LOCUS_17680 226575 227216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 227225 227821 gene locus_tag LOCUS_17690 gene folE 227225 227821 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225516.1 protein_id gnl|my_center|LOCUS_17690 228017 227811 gene locus_tag LOCUS_17700 228017 227811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 228036 229277 gene locus_tag LOCUS_17710 228036 229277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17710 229355 229690 gene locus_tag LOCUS_17720 229355 229690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17720 229880 231913 gene locus_tag LOCUS_17730 gene metG 229880 231913 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391596.1 protein_id gnl|my_center|LOCUS_17730 231919 233181 gene locus_tag LOCUS_17740 231919 233181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 233182 233997 gene locus_tag LOCUS_17750 233182 233997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 234386 234883 gene locus_tag LOCUS_17760 234386 234883 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944407.1 protein_id gnl|my_center|LOCUS_17760 234883 235344 gene locus_tag LOCUS_17770 234883 235344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 235382 236806 gene locus_tag LOCUS_17780 235382 236806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 236832 237851 gene locus_tag LOCUS_17790 236832 237851 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037866.1 protein_id gnl|my_center|LOCUS_17790 237848 238525 gene locus_tag LOCUS_17800 237848 238525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 238528 238899 gene locus_tag LOCUS_17810 238528 238899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 238913 239827 gene locus_tag LOCUS_17820 238913 239827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 241084 240116 gene locus_tag LOCUS_17830 241084 240116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 241978 241088 gene locus_tag LOCUS_17840 gene argB 241978 241088 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869561.1 protein_id gnl|my_center|LOCUS_17840 242978 241980 gene locus_tag LOCUS_17850 242978 241980 CDS product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037393.1 protein_id gnl|my_center|LOCUS_17850 243898 242975 gene locus_tag LOCUS_17860 243898 242975 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933689.1 protein_id gnl|my_center|LOCUS_17860 244122 243895 gene locus_tag LOCUS_17870 244122 243895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 244361 245518 gene locus_tag LOCUS_17880 gene thrC 244361 245518 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_17880 245541 246140 gene locus_tag LOCUS_17890 245541 246140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17890 246820 246473 gene locus_tag LOCUS_17900 246820 246473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 246792 247988 gene locus_tag LOCUS_17910 246792 247988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17910 248680 248486 gene locus_tag LOCUS_17920 248680 248486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 249092 248808 gene locus_tag LOCUS_17930 249092 248808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 249931 249596 gene locus_tag LOCUS_17940 249931 249596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 250792 250193 gene locus_tag LOCUS_17950 250792 250193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 251919 252101 gene locus_tag LOCUS_17960 251919 252101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 254381 253806 gene locus_tag LOCUS_17970 254381 253806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 254736 254518 gene locus_tag LOCUS_17980 254736 254518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 255886 254720 gene locus_tag LOCUS_17990 255886 254720 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404943.1 protein_id gnl|my_center|LOCUS_17990 256312 255890 gene locus_tag LOCUS_18000 256312 255890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 256565 256344 gene locus_tag LOCUS_18010 256565 256344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 257639 256569 gene locus_tag LOCUS_18020 gene argC 257639 256569 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870608.1 protein_id gnl|my_center|LOCUS_18020 258051 257644 gene locus_tag LOCUS_18030 258051 257644 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071181.1 protein_id gnl|my_center|LOCUS_18030 258457 258053 gene locus_tag LOCUS_18040 258457 258053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920749.1 protein_id gnl|my_center|LOCUS_18040 258865 261039 gene locus_tag LOCUS_18050 258865 261039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 261230 263719 gene locus_tag LOCUS_18060 261230 263719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 264477 263788 gene locus_tag LOCUS_18070 264477 263788 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202330.1 protein_id gnl|my_center|LOCUS_18070 265123 264557 gene locus_tag LOCUS_18080 265123 264557 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633352.1 protein_id gnl|my_center|LOCUS_18080 265455 266261 gene locus_tag LOCUS_18090 265455 266261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 266938 266456 gene locus_tag LOCUS_18100 266938 266456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 268095 267169 gene locus_tag LOCUS_18110 gene thiL 268095 267169 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_18110 268180 268716 gene locus_tag LOCUS_18120 268180 268716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 268763 268836 gene locus_tag LOCUS_t00140 268763 268836 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 269944 268874 gene locus_tag LOCUS_18130 269944 268874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 270435 269941 gene locus_tag LOCUS_18140 270435 269941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 271691 270537 gene locus_tag LOCUS_18150 271691 270537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18150 272035 271661 gene locus_tag LOCUS_18160 272035 271661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 273011 272127 gene locus_tag LOCUS_18170 gene speB 273011 272127 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_18170 274207 273146 gene locus_tag LOCUS_18180 274207 273146 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022952.1 protein_id gnl|my_center|LOCUS_18180 276185 274263 gene locus_tag LOCUS_18190 gene speA 276185 274263 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926066.1 protein_id gnl|my_center|LOCUS_18190 276499 276921 gene locus_tag LOCUS_18200 276499 276921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 277027 278931 gene locus_tag LOCUS_18210 277027 278931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 279039 280460 gene locus_tag LOCUS_18220 gene glnA 279039 280460 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_18220 280873 281412 gene locus_tag LOCUS_18230 280873 281412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 281421 281708 gene locus_tag LOCUS_18240 281421 281708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 281720 282940 gene locus_tag LOCUS_18250 281720 282940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 282951 283688 gene locus_tag LOCUS_18260 gene pyrF 282951 283688 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942107.1 protein_id gnl|my_center|LOCUS_18260 283688 285238 gene locus_tag LOCUS_18270 283688 285238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 285286 285738 gene locus_tag LOCUS_18280 285286 285738 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265636.1 protein_id gnl|my_center|LOCUS_18280 285735 285962 gene locus_tag LOCUS_18290 285735 285962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 285959 287899 gene locus_tag LOCUS_18300 gene feoB 285959 287899 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640041.1 protein_id gnl|my_center|LOCUS_18300 288263 288084 gene locus_tag LOCUS_18310 288263 288084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 288476 288778 gene locus_tag LOCUS_18320 288476 288778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 288775 289368 gene locus_tag LOCUS_18330 288775 289368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 289566 290039 gene locus_tag LOCUS_18340 289566 290039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 290099 290449 gene locus_tag LOCUS_18350 290099 290449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 290412 290630 gene locus_tag LOCUS_18360 290412 290630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 290781 291395 gene locus_tag LOCUS_18370 290781 291395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 291338 291559 gene locus_tag LOCUS_18380 291338 291559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 292204 293058 gene locus_tag LOCUS_18390 292204 293058 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929455.1 protein_id gnl|my_center|LOCUS_18390 293277 293678 gene locus_tag LOCUS_18400 293277 293678 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180982954.1 protein_id gnl|my_center|LOCUS_18400 293837 294316 gene locus_tag LOCUS_18410 293837 294316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 294333 296963 gene locus_tag LOCUS_18420 gene cphA 294333 296963 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144309.1 protein_id gnl|my_center|LOCUS_18420 300596 299925 gene locus_tag LOCUS_18430 300596 299925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 301746 300997 gene locus_tag LOCUS_18440 301746 300997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 302711 302139 gene locus_tag LOCUS_18450 302711 302139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 303369 302869 gene locus_tag LOCUS_18460 303369 302869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 304093 303659 gene locus_tag LOCUS_18470 304093 303659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 305000 304461 gene locus_tag LOCUS_18480 305000 304461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 305975 305175 gene locus_tag LOCUS_18490 305975 305175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 306273 306094 gene locus_tag LOCUS_18500 306273 306094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 306577 306311 gene locus_tag LOCUS_18510 306577 306311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 307483 307169 gene locus_tag LOCUS_18520 307483 307169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 308149 307664 gene locus_tag LOCUS_18530 308149 307664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 308225 308914 gene locus_tag LOCUS_18540 308225 308914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 311685 309004 gene locus_tag LOCUS_18550 311685 309004 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162006391.1 protein_id gnl|my_center|LOCUS_18550 314027 311922 gene locus_tag LOCUS_18560 gene fusA 314027 311922 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942578.1 protein_id gnl|my_center|LOCUS_18560 314300 314914 gene locus_tag LOCUS_18570 314300 314914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 314841 317387 gene locus_tag LOCUS_18580 314841 317387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 317472 320507 gene locus_tag LOCUS_18590 317472 320507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 320710 322497 gene locus_tag LOCUS_18600 320710 322497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 322539 324389 gene locus_tag LOCUS_18610 322539 324389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 324390 325463 gene locus_tag LOCUS_18620 324390 325463 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270166.1 protein_id gnl|my_center|LOCUS_18620 325652 329590 gene locus_tag LOCUS_18630 325652 329590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 330052 330498 gene locus_tag LOCUS_18640 330052 330498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 330838 332286 gene locus_tag LOCUS_18650 330838 332286 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_18650 332353 332580 gene locus_tag LOCUS_18660 332353 332580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 332932 332780 gene locus_tag LOCUS_18670 332932 332780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 333984 333460 gene locus_tag LOCUS_18680 333984 333460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 334700 334002 gene locus_tag LOCUS_18690 334700 334002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 335671 334886 gene locus_tag LOCUS_18700 335671 334886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18700 336031 335837 gene locus_tag LOCUS_18710 336031 335837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 336552 336157 gene locus_tag LOCUS_18720 336552 336157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 336841 336563 gene locus_tag LOCUS_18730 336841 336563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 337875 337165 gene locus_tag LOCUS_18740 337875 337165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 337852 338136 gene locus_tag LOCUS_18750 337852 338136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 340795 338129 gene locus_tag LOCUS_18760 340795 338129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 341317 342762 gene locus_tag LOCUS_18770 341317 342762 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924829.1 protein_id gnl|my_center|LOCUS_18770 342923 343603 gene locus_tag LOCUS_18780 342923 343603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 343522 343740 gene locus_tag LOCUS_18790 343522 343740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 344100 344468 gene locus_tag LOCUS_18800 344100 344468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 344957 344469 gene locus_tag LOCUS_18810 344957 344469 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250575.1 protein_id gnl|my_center|LOCUS_18810 346183 345053 gene locus_tag LOCUS_18820 gene speY 346183 345053 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141047.1 protein_id gnl|my_center|LOCUS_18820 346473 346180 gene locus_tag LOCUS_18830 346473 346180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 347367 346732 gene locus_tag LOCUS_18840 347367 346732 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 protein_id gnl|my_center|LOCUS_18840 348821 347505 gene locus_tag LOCUS_18850 348821 347505 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258059.1 protein_id gnl|my_center|LOCUS_18850 348877 351222 gene locus_tag LOCUS_18860 348877 351222 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259579.1 protein_id gnl|my_center|LOCUS_18860 351697 351200 gene locus_tag LOCUS_18870 gene ruvX 351697 351200 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209978.1 protein_id gnl|my_center|LOCUS_18870 351745 353082 gene locus_tag LOCUS_18880 351745 353082 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939609.1 protein_id gnl|my_center|LOCUS_18880 354272 353196 gene locus_tag LOCUS_18890 gene lpxD 354272 353196 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142009.1 protein_id gnl|my_center|LOCUS_18890 354357 354929 gene locus_tag LOCUS_18900 354357 354929 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_18900 358731 356257 gene locus_tag LOCUS_18910 gene priA 358731 356257 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_18910 358824 359282 gene locus_tag LOCUS_18920 358824 359282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 361043 359286 gene locus_tag LOCUS_18930 361043 359286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 362008 361052 gene locus_tag LOCUS_18940 362008 361052 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057738.1 protein_id gnl|my_center|LOCUS_18940 363009 362077 gene locus_tag LOCUS_18950 363009 362077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 363794 363006 gene locus_tag LOCUS_18960 363794 363006 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142866.1 protein_id gnl|my_center|LOCUS_18960 364522 364034 gene locus_tag LOCUS_18970 364522 364034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 365351 364863 gene locus_tag LOCUS_18980 365351 364863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 366989 366498 gene locus_tag LOCUS_18990 366989 366498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 368636 367239 gene locus_tag LOCUS_19000 368636 367239 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_19000 370508 368775 gene locus_tag LOCUS_19010 370508 368775 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_19010 370575 370922 gene locus_tag LOCUS_19020 370575 370922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 370953 372461 gene locus_tag LOCUS_19030 370953 372461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 372995 372447 gene locus_tag LOCUS_19040 gene gmhB 372995 372447 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_19040 374023 372992 gene locus_tag LOCUS_19050 gene waaF 374023 372992 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_19050 374868 374023 gene locus_tag LOCUS_19060 374868 374023 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909115.1 protein_id gnl|my_center|LOCUS_19060 375891 374875 gene locus_tag LOCUS_19070 375891 374875 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_19070 376085 378820 gene locus_tag LOCUS_19080 gene mrcB 376085 378820 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427455.1 protein_id gnl|my_center|LOCUS_19080 379216 379028 gene locus_tag LOCUS_19090 379216 379028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 380393 379224 gene locus_tag LOCUS_19100 gene nifS 380393 379224 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_19100 380575 381741 gene locus_tag LOCUS_19110 380575 381741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 381868 383040 gene locus_tag LOCUS_19120 381868 383040 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426064.1 protein_id gnl|my_center|LOCUS_19120 384958 383282 gene locus_tag LOCUS_19130 384958 383282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 385396 384977 gene locus_tag LOCUS_19140 385396 384977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 385709 386458 gene locus_tag LOCUS_19150 gene fabG 385709 386458 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_19150 386509 386943 gene locus_tag LOCUS_19160 386509 386943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 387894 387013 gene locus_tag LOCUS_19170 387894 387013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 388142 387897 gene locus_tag LOCUS_19180 388142 387897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 388603 389757 gene locus_tag LOCUS_19190 388603 389757 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_19190 390235 392229 gene locus_tag LOCUS_19200 390235 392229 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_19200 392307 392588 gene locus_tag LOCUS_19210 392307 392588 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943239.1 protein_id gnl|my_center|LOCUS_19210 392600 393112 gene locus_tag LOCUS_19220 392600 393112 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256622.1 protein_id gnl|my_center|LOCUS_19220 393119 393739 gene locus_tag LOCUS_19230 gene lexA 393119 393739 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080401.1 protein_id gnl|my_center|LOCUS_19230 393830 395335 gene locus_tag LOCUS_19240 393830 395335 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839201.1 protein_id gnl|my_center|LOCUS_19240 396278 396487 gene locus_tag LOCUS_19250 396278 396487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 396564 396725 gene locus_tag LOCUS_19260 396564 396725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 396888 397460 gene locus_tag LOCUS_19270 396888 397460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 397568 398137 gene locus_tag LOCUS_19280 397568 398137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 398440 399066 gene locus_tag LOCUS_19290 398440 399066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 399068 399577 gene locus_tag LOCUS_19300 399068 399577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 399574 399888 gene locus_tag LOCUS_19310 399574 399888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 400142 400699 gene locus_tag LOCUS_19320 400142 400699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 401417 401875 gene locus_tag LOCUS_19330 401417 401875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 402481 404592 gene locus_tag LOCUS_19340 402481 404592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 404635 405987 gene locus_tag LOCUS_19350 gene rimO 404635 405987 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_19350 405932 406240 gene locus_tag LOCUS_19360 405932 406240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 406299 406709 gene locus_tag LOCUS_19370 406299 406709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 407629 406832 gene locus_tag LOCUS_19380 407629 406832 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528194.1 protein_id gnl|my_center|LOCUS_19380 408194 407694 gene locus_tag LOCUS_19390 gene moaC 408194 407694 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639855.1 protein_id gnl|my_center|LOCUS_19390 408939 408196 gene locus_tag LOCUS_19400 408939 408196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 410142 408946 gene locus_tag LOCUS_19410 410142 408946 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272494.1 protein_id gnl|my_center|LOCUS_19410 410522 410139 gene locus_tag LOCUS_19420 410522 410139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19420 411106 410519 gene locus_tag LOCUS_19430 411106 410519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19430 411369 410989 gene locus_tag LOCUS_19440 411369 410989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 411593 412810 gene locus_tag LOCUS_19450 411593 412810 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258522.1 protein_id gnl|my_center|LOCUS_19450 414136 412880 gene locus_tag LOCUS_19460 414136 412880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 414383 415726 gene locus_tag LOCUS_19470 gene glmM 414383 415726 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_19470 415967 417139 gene locus_tag LOCUS_19480 gene aroB 415967 417139 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545319.1 protein_id gnl|my_center|LOCUS_19480 417168 417572 gene locus_tag LOCUS_19490 417168 417572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 419461 417569 gene locus_tag LOCUS_19500 419461 417569 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_19500 419637 420575 gene locus_tag LOCUS_19510 419637 420575 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963680.1 protein_id gnl|my_center|LOCUS_19510 420735 421271 gene locus_tag LOCUS_19520 420735 421271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 422509 421544 gene locus_tag LOCUS_19530 422509 421544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19530 423265 422525 gene locus_tag LOCUS_19540 423265 422525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19540 425199 423352 gene locus_tag LOCUS_19550 gene dnaG 425199 423352 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190679.1 protein_id gnl|my_center|LOCUS_19550 425620 425423 gene locus_tag LOCUS_19560 425620 425423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 426254 425691 gene locus_tag LOCUS_19570 426254 425691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 428851 426365 gene locus_tag LOCUS_19580 428851 426365 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458990.1 protein_id gnl|my_center|LOCUS_19580 429361 428972 gene locus_tag LOCUS_19590 429361 428972 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962927.1 protein_id gnl|my_center|LOCUS_19590 429590 431254 gene locus_tag LOCUS_19600 429590 431254 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839376.1 protein_id gnl|my_center|LOCUS_19600 431273 432679 gene locus_tag LOCUS_19610 431273 432679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 432676 433293 gene locus_tag LOCUS_19620 432676 433293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19620 433211 434020 gene locus_tag LOCUS_19630 433211 434020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19630 434746 434285 gene locus_tag LOCUS_19640 gene msrB 434746 434285 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038734.1 protein_id gnl|my_center|LOCUS_19640 434880 438107 gene locus_tag LOCUS_19650 gene carB 434880 438107 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257643.1 protein_id gnl|my_center|LOCUS_19650 438568 439215 gene locus_tag LOCUS_19660 438568 439215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 439299 439811 gene locus_tag LOCUS_19670 439299 439811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 440022 440249 gene locus_tag LOCUS_19680 440022 440249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 441212 441871 gene locus_tag LOCUS_19690 441212 441871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 444023 441882 gene locus_tag LOCUS_19700 444023 441882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 445016 444033 gene locus_tag LOCUS_19710 445016 444033 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444695.1 protein_id gnl|my_center|LOCUS_19710 446911 445013 gene locus_tag LOCUS_19720 446911 445013 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107821429.1 protein_id gnl|my_center|LOCUS_19720 448051 446915 gene locus_tag LOCUS_19730 gene gltA 448051 446915 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420072.1 protein_id gnl|my_center|LOCUS_19730 448001 448219 gene locus_tag LOCUS_19740 448001 448219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 449959 449096 gene locus_tag LOCUS_19750 449959 449096 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868068.1 protein_id gnl|my_center|LOCUS_19750 450884 451516 gene locus_tag LOCUS_19760 450884 451516 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769904.1 protein_id gnl|my_center|LOCUS_19760 451835 453523 gene locus_tag LOCUS_19770 451835 453523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 454613 453951 gene locus_tag LOCUS_19780 gene phoU 454613 453951 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941756.1 protein_id gnl|my_center|LOCUS_19780 455486 454644 gene locus_tag LOCUS_19790 gene pstB 455486 454644 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538553.1 protein_id gnl|my_center|LOCUS_19790 456383 455493 gene locus_tag LOCUS_19800 gene pstA 456383 455493 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582861.1 protein_id gnl|my_center|LOCUS_19800 457317 456376 gene locus_tag LOCUS_19810 gene pstC 457317 456376 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582860.1 protein_id gnl|my_center|LOCUS_19810 458241 457318 gene locus_tag LOCUS_19820 458241 457318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 458787 460184 gene locus_tag LOCUS_19830 458787 460184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 462621 460564 gene locus_tag LOCUS_19840 gene katG 462621 460564 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167181779.1 protein_id gnl|my_center|LOCUS_19840 462796 462614 gene locus_tag LOCUS_19850 462796 462614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 462968 463153 gene locus_tag LOCUS_19860 462968 463153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 463199 463645 gene locus_tag LOCUS_19870 463199 463645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 464598 464344 gene locus_tag LOCUS_19880 464598 464344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 464726 466909 gene locus_tag LOCUS_19890 464726 466909 CDS product SBBP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144184.1 protein_id gnl|my_center|LOCUS_19890 467312 467127 gene locus_tag LOCUS_19900 467312 467127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 467406 468047 gene locus_tag LOCUS_19910 467406 468047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19910 >Feature sequence05 1047 595 gene locus_tag LOCUS_19920 1047 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 1197 1553 gene locus_tag LOCUS_19930 1197 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19930 1550 1768 gene locus_tag LOCUS_19940 1550 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19940 2040 2789 gene locus_tag LOCUS_19950 2040 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19950 2870 4078 gene locus_tag LOCUS_19960 2870 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 5548 4955 gene locus_tag LOCUS_19970 5548 4955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19970 5997 5674 gene locus_tag LOCUS_19980 5997 5674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 6351 6010 gene locus_tag LOCUS_19990 6351 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 7625 7041 gene locus_tag LOCUS_20000 7625 7041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20000 8257 7625 gene locus_tag LOCUS_20010 8257 7625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 9822 8320 gene locus_tag LOCUS_20020 9822 8320 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938119.1 protein_id gnl|my_center|LOCUS_20020 10673 10455 gene locus_tag LOCUS_20030 10673 10455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 11044 11247 gene locus_tag LOCUS_20040 11044 11247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 11273 11842 gene locus_tag LOCUS_20050 11273 11842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 11994 12737 gene locus_tag LOCUS_20060 11994 12737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 13070 14197 gene locus_tag LOCUS_20070 13070 14197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 14194 14850 gene locus_tag LOCUS_20080 14194 14850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 14874 15491 gene locus_tag LOCUS_20090 14874 15491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 15523 16185 gene locus_tag LOCUS_20100 15523 16185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 17066 17203 gene locus_tag LOCUS_20110 17066 17203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 17563 17733 gene locus_tag LOCUS_20120 17563 17733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 18615 19061 gene locus_tag LOCUS_20130 18615 19061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 19208 19657 gene locus_tag LOCUS_20140 19208 19657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 19703 20530 gene locus_tag LOCUS_20150 19703 20530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 20536 21075 gene locus_tag LOCUS_20160 20536 21075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 21707 23695 gene locus_tag LOCUS_20170 21707 23695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 23950 24312 gene locus_tag LOCUS_20180 23950 24312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 24379 24723 gene locus_tag LOCUS_20190 24379 24723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 24720 24914 gene locus_tag LOCUS_20200 24720 24914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 25033 25302 gene locus_tag LOCUS_20210 25033 25302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 25369 25563 gene locus_tag LOCUS_20220 25369 25563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 27501 25885 gene locus_tag LOCUS_20230 27501 25885 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_20230 28958 27513 gene locus_tag LOCUS_20240 28958 27513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 30316 28955 gene locus_tag LOCUS_20250 30316 28955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255956.1 protein_id gnl|my_center|LOCUS_20250 30789 30391 gene locus_tag LOCUS_20260 30789 30391 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174950.1 protein_id gnl|my_center|LOCUS_20260 31509 30922 gene locus_tag LOCUS_20270 31509 30922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 31675 32526 gene locus_tag LOCUS_20280 gene lpxC 31675 32526 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957401.1 protein_id gnl|my_center|LOCUS_20280 32934 33782 gene locus_tag LOCUS_20290 gene fdhD 32934 33782 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891497.1 protein_id gnl|my_center|LOCUS_20290 33782 36091 gene locus_tag LOCUS_20300 33782 36091 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729998.1 protein_id gnl|my_center|LOCUS_20300 36346 36786 gene locus_tag LOCUS_20310 36346 36786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20310 38606 37077 gene locus_tag LOCUS_20320 gene gndA 38606 37077 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413557.1 protein_id gnl|my_center|LOCUS_20320 38684 39598 gene locus_tag LOCUS_20330 38684 39598 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227827.1 protein_id gnl|my_center|LOCUS_20330 40326 39580 gene locus_tag LOCUS_20340 40326 39580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 41093 40416 gene locus_tag LOCUS_20350 41093 40416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035389.1 protein_id gnl|my_center|LOCUS_20350 41389 41090 gene locus_tag LOCUS_20360 41389 41090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 42466 41414 gene locus_tag LOCUS_20370 42466 41414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 43729 42479 gene locus_tag LOCUS_20380 43729 42479 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_20380 44304 43771 gene locus_tag LOCUS_20390 44304 43771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 45441 44824 gene locus_tag LOCUS_20400 45441 44824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 46012 45455 gene locus_tag LOCUS_20410 46012 45455 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_20410 46887 46006 gene locus_tag LOCUS_20420 46887 46006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 47402 48541 gene locus_tag LOCUS_20430 47402 48541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 48632 53884 gene locus_tag LOCUS_20440 48632 53884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 53895 54449 gene locus_tag LOCUS_20450 53895 54449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 56037 55402 gene locus_tag LOCUS_20460 56037 55402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 56504 56770 gene locus_tag LOCUS_20470 56504 56770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 57214 57477 gene locus_tag LOCUS_20480 57214 57477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 58859 58053 gene locus_tag LOCUS_20490 58859 58053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 59778 59347 gene locus_tag LOCUS_20500 59778 59347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20500 60425 59730 gene locus_tag LOCUS_20510 60425 59730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20510 61104 60499 gene locus_tag LOCUS_20520 61104 60499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 61864 61199 gene locus_tag LOCUS_20530 61864 61199 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391397.1 protein_id gnl|my_center|LOCUS_20530 62053 62727 gene locus_tag LOCUS_20540 62053 62727 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_20540 62747 65269 gene locus_tag LOCUS_20550 62747 65269 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403467.1 protein_id gnl|my_center|LOCUS_20550 67276 65915 gene locus_tag LOCUS_20560 67276 65915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 67524 68132 gene locus_tag LOCUS_20570 67524 68132 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545768.1 protein_id gnl|my_center|LOCUS_20570 68200 68276 gene locus_tag LOCUS_t00150 68200 68276 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 68392 68673 gene locus_tag LOCUS_20580 gene hupB 68392 68673 CDS product DNA-binding protein HupB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312721.1 protein_id gnl|my_center|LOCUS_20580 69025 69273 gene locus_tag LOCUS_20590 69025 69273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 71842 70049 gene locus_tag LOCUS_20600 71842 70049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 71944 72402 gene locus_tag LOCUS_20610 71944 72402 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932294.1 protein_id gnl|my_center|LOCUS_20610 72825 72391 gene locus_tag LOCUS_20620 72825 72391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 73862 72837 gene locus_tag LOCUS_20630 73862 72837 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_20630 74317 73946 gene locus_tag LOCUS_20640 gene rbfA 74317 73946 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967251.1 protein_id gnl|my_center|LOCUS_20640 77125 74375 gene locus_tag LOCUS_20650 77125 74375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 78717 77215 gene locus_tag LOCUS_20660 gene nusA 78717 77215 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942231.1 protein_id gnl|my_center|LOCUS_20660 79308 78823 gene locus_tag LOCUS_20670 gene rimP 79308 78823 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942230.1 protein_id gnl|my_center|LOCUS_20670 79839 79432 gene locus_tag LOCUS_20680 79839 79432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 80868 79924 gene locus_tag LOCUS_20690 80868 79924 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254542.1 protein_id gnl|my_center|LOCUS_20690 84486 80950 gene locus_tag LOCUS_20700 84486 80950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 85346 84693 gene locus_tag LOCUS_20710 85346 84693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 85720 85358 gene locus_tag LOCUS_20720 85720 85358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 87322 85724 gene locus_tag LOCUS_20730 87322 85724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 88772 87396 gene locus_tag LOCUS_20740 88772 87396 CDS product xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393517.1 protein_id gnl|my_center|LOCUS_20740 90655 88988 gene locus_tag LOCUS_20750 90655 88988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20750 91478 90714 gene locus_tag LOCUS_20760 91478 90714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20760 92658 91567 gene locus_tag LOCUS_20770 gene xylF 92658 91567 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936757.1 protein_id gnl|my_center|LOCUS_20770 94160 92790 gene locus_tag LOCUS_20780 94160 92790 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839714.1 protein_id gnl|my_center|LOCUS_20780 95554 94217 gene locus_tag LOCUS_20790 95554 94217 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038455.1 protein_id gnl|my_center|LOCUS_20790 95821 95642 gene locus_tag LOCUS_20800 95821 95642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 96179 96030 gene locus_tag LOCUS_20810 96179 96030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 96543 96163 gene locus_tag LOCUS_20820 96543 96163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 98410 96812 gene locus_tag LOCUS_20830 98410 96812 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203224.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20830 98703 98407 gene locus_tag LOCUS_20840 98703 98407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 100337 98814 gene locus_tag LOCUS_20850 gene malQ 100337 98814 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_20850 102275 100413 gene locus_tag LOCUS_20860 102275 100413 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839780.1 protein_id gnl|my_center|LOCUS_20860 102981 102295 gene locus_tag LOCUS_20870 102981 102295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 103791 102991 gene locus_tag LOCUS_20880 103791 102991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 105431 103800 gene locus_tag LOCUS_20890 105431 103800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 106975 105428 gene locus_tag LOCUS_20900 106975 105428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 107551 107072 gene locus_tag LOCUS_20910 107551 107072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 110621 107577 gene locus_tag LOCUS_20920 110621 107577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 112232 111039 gene locus_tag LOCUS_20930 112232 111039 CDS product xylose repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244935.1 protein_id gnl|my_center|LOCUS_20930 113409 112351 gene locus_tag LOCUS_20940 113409 112351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20940 114120 113455 gene locus_tag LOCUS_20950 114120 113455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 115856 114117 gene locus_tag LOCUS_20960 115856 114117 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_20960 116278 115955 gene locus_tag LOCUS_20970 116278 115955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 116629 116282 gene locus_tag LOCUS_20980 116629 116282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 118962 116656 gene locus_tag LOCUS_20990 118962 116656 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339535.1 protein_id gnl|my_center|LOCUS_20990 119345 119929 gene locus_tag LOCUS_21000 119345 119929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 120005 120718 gene locus_tag LOCUS_21010 120005 120718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 120846 122144 gene locus_tag LOCUS_21020 120846 122144 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389965.1 protein_id gnl|my_center|LOCUS_21020 122244 123200 gene locus_tag LOCUS_21030 122244 123200 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876019.1 protein_id gnl|my_center|LOCUS_21030 124274 123621 gene locus_tag LOCUS_21040 124274 123621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 125326 124184 gene locus_tag LOCUS_21050 125326 124184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 125720 125445 gene locus_tag LOCUS_21060 125720 125445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 126171 125647 gene locus_tag LOCUS_21070 126171 125647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 126990 126451 gene locus_tag LOCUS_21080 126990 126451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21080 127370 126990 gene locus_tag LOCUS_21090 127370 126990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 130022 127620 gene locus_tag LOCUS_21100 130022 127620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 131467 130118 gene locus_tag LOCUS_21110 131467 130118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 131655 132182 gene locus_tag LOCUS_21120 131655 132182 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_21120 132182 132880 gene locus_tag LOCUS_21130 132182 132880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21130 132877 133407 gene locus_tag LOCUS_21140 132877 133407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21140 133714 134580 gene locus_tag LOCUS_21150 133714 134580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 134528 134782 gene locus_tag LOCUS_21160 134528 134782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 135843 135391 gene locus_tag LOCUS_21170 135843 135391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21170 136067 136576 gene locus_tag LOCUS_21180 136067 136576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 136677 137219 gene locus_tag LOCUS_21190 136677 137219 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776976.1 protein_id gnl|my_center|LOCUS_21190 137358 138407 gene locus_tag LOCUS_21200 137358 138407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21200 138308 139564 gene locus_tag LOCUS_21210 138308 139564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21210 139574 139942 gene locus_tag LOCUS_21220 139574 139942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 139939 140157 gene locus_tag LOCUS_21230 139939 140157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 140495 140794 gene locus_tag LOCUS_21240 140495 140794 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057944.1 protein_id gnl|my_center|LOCUS_21240 140825 141100 gene locus_tag LOCUS_21250 140825 141100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 141271 141074 gene locus_tag LOCUS_21260 141271 141074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 142354 141986 gene locus_tag LOCUS_21270 142354 141986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 142742 142473 gene locus_tag LOCUS_21280 142742 142473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 142985 143278 gene locus_tag LOCUS_21290 142985 143278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 143531 143340 gene locus_tag LOCUS_21300 143531 143340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 144156 143617 gene locus_tag LOCUS_21310 144156 143617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 145074 144163 gene locus_tag LOCUS_21320 145074 144163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 146267 145764 gene locus_tag LOCUS_21330 146267 145764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 147726 147890 gene locus_tag LOCUS_21340 147726 147890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 149797 148967 gene locus_tag LOCUS_21350 149797 148967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 149990 149835 gene locus_tag LOCUS_21360 149990 149835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 151146 150253 gene locus_tag LOCUS_21370 151146 150253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 151799 151602 gene locus_tag LOCUS_21380 151799 151602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 152056 151796 gene locus_tag LOCUS_21390 152056 151796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 152582 152250 gene locus_tag LOCUS_21400 152582 152250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 153105 152638 gene locus_tag LOCUS_21410 153105 152638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 153727 153275 gene locus_tag LOCUS_21420 153727 153275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 155004 154612 gene locus_tag LOCUS_21430 155004 154612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21430 155812 155609 gene locus_tag LOCUS_21440 155812 155609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21440 157288 156131 gene locus_tag LOCUS_21450 157288 156131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21450 157529 157296 gene locus_tag LOCUS_21460 157529 157296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 158358 159284 gene locus_tag LOCUS_21470 gene miaA 158358 159284 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_21470 159363 159590 gene locus_tag LOCUS_21480 gene hfq 159363 159590 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965139.1 protein_id gnl|my_center|LOCUS_21480 159595 159834 gene locus_tag LOCUS_21490 159595 159834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21490 159946 160224 gene locus_tag LOCUS_21500 159946 160224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21500 160406 161449 gene locus_tag LOCUS_21510 gene holB 160406 161449 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_21510 161461 162411 gene locus_tag LOCUS_21520 161461 162411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 162418 162888 gene locus_tag LOCUS_21530 162418 162888 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028111.1 protein_id gnl|my_center|LOCUS_21530 164580 163471 gene locus_tag LOCUS_21540 gene ispG 164580 163471 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_21540 166017 164653 gene locus_tag LOCUS_21550 gene rseP 166017 164653 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881281.1 protein_id gnl|my_center|LOCUS_21550 167287 166124 gene locus_tag LOCUS_21560 167287 166124 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_21560 168482 167904 gene locus_tag LOCUS_21570 168482 167904 CDS product DUF1572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 protein_id gnl|my_center|LOCUS_21570 169433 168492 gene locus_tag LOCUS_21580 169433 168492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 170030 169572 gene locus_tag LOCUS_21590 170030 169572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 170114 173347 gene locus_tag LOCUS_21600 170114 173347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 173362 174015 gene locus_tag LOCUS_21610 173362 174015 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244073.1 protein_id gnl|my_center|LOCUS_21610 174178 178050 gene locus_tag LOCUS_21620 174178 178050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 179029 178577 gene locus_tag LOCUS_21630 179029 178577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 180032 179064 gene locus_tag LOCUS_21640 180032 179064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 182180 180165 gene locus_tag LOCUS_21650 182180 180165 CDS product DUF3160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064911.1 protein_id gnl|my_center|LOCUS_21650 182871 182206 gene locus_tag LOCUS_21660 182871 182206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 184055 182868 gene locus_tag LOCUS_21670 184055 182868 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940714.1 protein_id gnl|my_center|LOCUS_21670 185165 184302 gene locus_tag LOCUS_21680 185165 184302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 186590 185274 gene locus_tag LOCUS_21690 gene hisS 186590 185274 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964121.1 protein_id gnl|my_center|LOCUS_21690 187254 186625 gene locus_tag LOCUS_21700 187254 186625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 187809 187294 gene locus_tag LOCUS_21710 187809 187294 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940698.1 protein_id gnl|my_center|LOCUS_21710 187903 188484 gene locus_tag LOCUS_21720 187903 188484 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083508.1 protein_id gnl|my_center|LOCUS_21720 188723 189748 gene locus_tag LOCUS_21730 188723 189748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 189851 190930 gene locus_tag LOCUS_21740 gene dusB 189851 190930 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256119.1 protein_id gnl|my_center|LOCUS_21740 191006 191461 gene locus_tag LOCUS_21750 191006 191461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 192233 191475 gene locus_tag LOCUS_21760 192233 191475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 192865 192233 gene locus_tag LOCUS_21770 gene sigW 192865 192233 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_21770 193249 192971 gene locus_tag LOCUS_21780 193249 192971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 194467 193667 gene locus_tag LOCUS_21790 194467 193667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 196102 194885 gene locus_tag LOCUS_21800 196102 194885 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027385545.1 protein_id gnl|my_center|LOCUS_21800 196253 196438 gene locus_tag LOCUS_21810 196253 196438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 196632 197648 gene locus_tag LOCUS_21820 196632 197648 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957826.1 protein_id gnl|my_center|LOCUS_21820 197774 197697 gene locus_tag LOCUS_t00160 197774 197697 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 198373 197852 gene locus_tag LOCUS_21830 198373 197852 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357763.1 protein_id gnl|my_center|LOCUS_21830 198669 198394 gene locus_tag LOCUS_21840 198669 198394 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878321.1 protein_id gnl|my_center|LOCUS_21840 199548 198778 gene locus_tag LOCUS_21850 199548 198778 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869292.1 protein_id gnl|my_center|LOCUS_21850 199751 200329 gene locus_tag LOCUS_21860 199751 200329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 200372 201190 gene locus_tag LOCUS_21870 200372 201190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 204288 201169 gene locus_tag LOCUS_21880 204288 201169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 205909 204347 gene locus_tag LOCUS_21890 205909 204347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 207479 206055 gene locus_tag LOCUS_21900 207479 206055 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480302.1 protein_id gnl|my_center|LOCUS_21900 209158 207590 gene locus_tag LOCUS_21910 209158 207590 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106392.1 protein_id gnl|my_center|LOCUS_21910 210184 210897 gene locus_tag LOCUS_21920 210184 210897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 211219 210998 gene locus_tag LOCUS_21930 211219 210998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 212702 211611 gene locus_tag LOCUS_21940 212702 211611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 216402 212779 gene locus_tag LOCUS_21950 216402 212779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 219091 216602 gene locus_tag LOCUS_21960 219091 216602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 219691 219152 gene locus_tag LOCUS_21970 219691 219152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 220082 219681 gene locus_tag LOCUS_21980 220082 219681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21980 220250 221218 gene locus_tag LOCUS_21990 220250 221218 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922076.1 protein_id gnl|my_center|LOCUS_21990 221611 222513 gene locus_tag LOCUS_22000 gene murQ 221611 222513 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261744.1 protein_id gnl|my_center|LOCUS_22000 222510 223037 gene locus_tag LOCUS_22010 222510 223037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 223181 223918 gene locus_tag LOCUS_22020 223181 223918 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002683251.1 protein_id gnl|my_center|LOCUS_22020 224179 225690 gene locus_tag LOCUS_22030 224179 225690 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121424.1 protein_id gnl|my_center|LOCUS_22030 225986 225675 gene locus_tag LOCUS_22040 225986 225675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 226030 227853 gene locus_tag LOCUS_22050 226030 227853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 227887 229305 gene locus_tag LOCUS_22060 227887 229305 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132306.1 protein_id gnl|my_center|LOCUS_22060 230901 229402 gene locus_tag LOCUS_22070 230901 229402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 231719 231027 gene locus_tag LOCUS_22080 231719 231027 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143168.1 protein_id gnl|my_center|LOCUS_22080 233869 232379 gene locus_tag LOCUS_22090 233869 232379 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932252.1 protein_id gnl|my_center|LOCUS_22090 235272 233911 gene locus_tag LOCUS_22100 235272 233911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 237308 235617 gene locus_tag LOCUS_22110 237308 235617 CDS product vanadium-dependent haloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948038.1 protein_id gnl|my_center|LOCUS_22110 239605 237617 gene locus_tag LOCUS_22120 gene uvrB 239605 237617 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 protein_id gnl|my_center|LOCUS_22120 240979 239768 gene locus_tag LOCUS_22130 240979 239768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 241275 242177 gene locus_tag LOCUS_22140 241275 242177 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545457.1 protein_id gnl|my_center|LOCUS_22140 242174 242464 gene locus_tag LOCUS_22150 242174 242464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 243288 242479 gene locus_tag LOCUS_22160 243288 242479 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_22160 243649 243966 gene locus_tag LOCUS_22170 gene groES 243649 243966 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171493.1 protein_id gnl|my_center|LOCUS_22170 244043 245674 gene locus_tag LOCUS_22180 gene groL 244043 245674 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939262.1 protein_id gnl|my_center|LOCUS_22180 246010 247431 gene locus_tag LOCUS_22190 246010 247431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22190 247388 249043 gene locus_tag LOCUS_22200 247388 249043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 249279 252230 gene locus_tag LOCUS_22210 249279 252230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 252570 252310 gene locus_tag LOCUS_22220 252570 252310 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115476.1 protein_id gnl|my_center|LOCUS_22220 253341 252814 gene locus_tag LOCUS_22230 253341 252814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 254376 254561 gene locus_tag LOCUS_22240 254376 254561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 254657 254902 gene locus_tag LOCUS_22250 254657 254902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 255991 255236 gene locus_tag LOCUS_22260 255991 255236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 256620 258911 gene locus_tag LOCUS_22270 256620 258911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 262802 259560 gene locus_tag LOCUS_22280 262802 259560 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201854.1 protein_id gnl|my_center|LOCUS_22280 263855 263274 gene locus_tag LOCUS_22290 263855 263274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22290 264459 263845 gene locus_tag LOCUS_22300 264459 263845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22300 265289 264471 gene locus_tag LOCUS_22310 265289 264471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 266053 265286 gene locus_tag LOCUS_22320 266053 265286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 266267 266192 gene locus_tag LOCUS_t00170 266267 266192 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 267877 266780 gene locus_tag LOCUS_22330 267877 266780 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783481.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22330 268415 268023 gene locus_tag LOCUS_22340 268415 268023 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_22340 269337 268576 gene locus_tag LOCUS_22350 269337 268576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22350 269929 269219 gene locus_tag LOCUS_22360 269929 269219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22360 270145 271176 gene locus_tag LOCUS_22370 270145 271176 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530044.1 protein_id gnl|my_center|LOCUS_22370 271464 274283 gene locus_tag LOCUS_22380 271464 274283 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880620.1 protein_id gnl|my_center|LOCUS_22380 275214 277145 gene locus_tag LOCUS_22390 275214 277145 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_22390 277489 278058 gene locus_tag LOCUS_22400 277489 278058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 278116 278514 gene locus_tag LOCUS_22410 278116 278514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 279859 278483 gene locus_tag LOCUS_22420 279859 278483 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356901.1 protein_id gnl|my_center|LOCUS_22420 280555 279863 gene locus_tag LOCUS_22430 280555 279863 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074105.1 protein_id gnl|my_center|LOCUS_22430 280711 281223 gene locus_tag LOCUS_22440 280711 281223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 281474 281761 gene locus_tag LOCUS_22450 281474 281761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 282547 281915 gene locus_tag LOCUS_22460 282547 281915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 283024 283857 gene locus_tag LOCUS_22470 283024 283857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 284412 283858 gene locus_tag LOCUS_22480 284412 283858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 284577 284873 gene locus_tag LOCUS_22490 284577 284873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 284914 285792 gene locus_tag LOCUS_22500 284914 285792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 285859 286884 gene locus_tag LOCUS_22510 285859 286884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 287685 286888 gene locus_tag LOCUS_22520 287685 286888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 288131 287790 gene locus_tag LOCUS_22530 288131 287790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 288789 288247 gene locus_tag LOCUS_22540 288789 288247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 289734 288946 gene locus_tag LOCUS_22550 289734 288946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 290118 292925 gene locus_tag LOCUS_22560 gene uvrA 290118 292925 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403227.1 protein_id gnl|my_center|LOCUS_22560 293131 293742 gene locus_tag LOCUS_22570 293131 293742 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921338.1 protein_id gnl|my_center|LOCUS_22570 294210 293911 gene locus_tag LOCUS_22580 294210 293911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 296053 294791 gene locus_tag LOCUS_22590 296053 294791 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028234.1 protein_id gnl|my_center|LOCUS_22590 299144 296271 gene locus_tag LOCUS_22600 299144 296271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 300484 299252 gene locus_tag LOCUS_22610 300484 299252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 301846 300524 gene locus_tag LOCUS_22620 301846 300524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 302397 302158 gene locus_tag LOCUS_22630 302397 302158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22630 303559 302459 gene locus_tag LOCUS_22640 303559 302459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 304518 303901 gene locus_tag LOCUS_22650 304518 303901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 304886 304416 gene locus_tag LOCUS_22660 304886 304416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 305516 304899 gene locus_tag LOCUS_22670 305516 304899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 307926 305812 gene locus_tag LOCUS_22680 gene pnp 307926 305812 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970644.1 protein_id gnl|my_center|LOCUS_22680 308567 308232 gene locus_tag LOCUS_22690 gene rpsO 308567 308232 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_22690 310016 308670 gene locus_tag LOCUS_22700 gene accC 310016 308670 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_22700 310656 310105 gene locus_tag LOCUS_22710 310656 310105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 311118 310672 gene locus_tag LOCUS_22720 gene rplQ 311118 310672 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723675.1 protein_id gnl|my_center|LOCUS_22720 312332 311316 gene locus_tag LOCUS_22730 312332 311316 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_22730 312901 312419 gene locus_tag LOCUS_22740 gene rpsD 312901 312419 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_22740 313652 313254 gene locus_tag LOCUS_22750 gene rpsK 313652 313254 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943461.1 protein_id gnl|my_center|LOCUS_22750 314062 313733 gene locus_tag LOCUS_22760 314062 313733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 314583 314338 gene locus_tag LOCUS_22770 gene infA 314583 314338 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942395.1 protein_id gnl|my_center|LOCUS_22770 315508 314630 gene locus_tag LOCUS_22780 gene map 315508 314630 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_22780 316172 315516 gene locus_tag LOCUS_22790 316172 315516 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399686.1 protein_id gnl|my_center|LOCUS_22790 317677 316244 gene locus_tag LOCUS_22800 gene secY 317677 316244 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_22800 318177 317707 gene locus_tag LOCUS_22810 gene rplO 318177 317707 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081797.1 protein_id gnl|my_center|LOCUS_22810 318570 318304 gene locus_tag LOCUS_22820 318570 318304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 319097 318588 gene locus_tag LOCUS_22830 gene rpsE 319097 318588 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003328273.1 protein_id gnl|my_center|LOCUS_22830 319479 319084 gene locus_tag LOCUS_22840 gene rplR 319479 319084 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628816.1 protein_id gnl|my_center|LOCUS_22840 320110 319577 gene locus_tag LOCUS_22850 gene rplF 320110 319577 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546082.1 protein_id gnl|my_center|LOCUS_22850 320615 320223 gene locus_tag LOCUS_22860 gene rpsH 320615 320223 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925182.1 protein_id gnl|my_center|LOCUS_22860 321013 320708 gene locus_tag LOCUS_22870 gene rpsN 321013 320708 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897467.1 protein_id gnl|my_center|LOCUS_22870 321593 321054 gene locus_tag LOCUS_22880 gene rplE 321593 321054 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_22880 322085 321669 gene locus_tag LOCUS_22890 gene rplX 322085 321669 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729178.1 protein_id gnl|my_center|LOCUS_22890 322457 322089 gene locus_tag LOCUS_22900 gene rplN 322457 322089 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014346.1 protein_id gnl|my_center|LOCUS_22900 323059 322547 gene locus_tag LOCUS_22910 323059 322547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 323296 323078 gene locus_tag LOCUS_22920 323296 323078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 323692 323300 gene locus_tag LOCUS_22930 gene rplP 323692 323300 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357619.1 protein_id gnl|my_center|LOCUS_22930 324560 323817 gene locus_tag LOCUS_22940 gene rpsC 324560 323817 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393931.1 protein_id gnl|my_center|LOCUS_22940 325154 324573 gene locus_tag LOCUS_22950 325154 324573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 325531 325241 gene locus_tag LOCUS_22960 gene rpsS 325531 325241 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545511.1 protein_id gnl|my_center|LOCUS_22960 326458 325628 gene locus_tag LOCUS_22970 gene rplB 326458 325628 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938601.1 protein_id gnl|my_center|LOCUS_22970 326899 326582 gene locus_tag LOCUS_22980 326899 326582 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_22980 327677 326892 gene locus_tag LOCUS_22990 gene rplD 327677 326892 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393936.1 protein_id gnl|my_center|LOCUS_22990 328378 327773 gene locus_tag LOCUS_23000 gene rplC 328378 327773 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393937.1 protein_id gnl|my_center|LOCUS_23000 328824 328504 gene locus_tag LOCUS_23010 gene rpsJ 328824 328504 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943487.1 protein_id gnl|my_center|LOCUS_23010 330086 328899 gene locus_tag LOCUS_23020 gene tuf 330086 328899 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165809.1 protein_id gnl|my_center|LOCUS_23020 332210 330114 gene locus_tag LOCUS_23030 gene fusA 332210 330114 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_23030 332764 332294 gene locus_tag LOCUS_23040 gene rpsG 332764 332294 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938594.1 protein_id gnl|my_center|LOCUS_23040 333221 332841 gene locus_tag LOCUS_23050 gene rpsL 333221 332841 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393942.1 protein_id gnl|my_center|LOCUS_23050 334155 333700 gene locus_tag LOCUS_23060 334155 333700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 334795 335832 gene locus_tag LOCUS_23070 334795 335832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 335844 336731 gene locus_tag LOCUS_23080 335844 336731 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015839.1 protein_id gnl|my_center|LOCUS_23080 339493 336728 gene locus_tag LOCUS_23090 339493 336728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 339907 341793 gene locus_tag LOCUS_23100 339907 341793 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258194.1 protein_id gnl|my_center|LOCUS_23100 342046 342555 gene locus_tag LOCUS_23110 342046 342555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 343249 342746 gene locus_tag LOCUS_23120 343249 342746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 344362 343820 gene locus_tag LOCUS_23130 344362 343820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 345129 344362 gene locus_tag LOCUS_23140 345129 344362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 346259 345141 gene locus_tag LOCUS_23150 346259 345141 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020137.1 protein_id gnl|my_center|LOCUS_23150 347623 347141 gene locus_tag LOCUS_23160 347623 347141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 347766 348479 gene locus_tag LOCUS_23170 347766 348479 CDS product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327344.1 protein_id gnl|my_center|LOCUS_23170 348484 348702 gene locus_tag LOCUS_23180 348484 348702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23180 348778 349029 gene locus_tag LOCUS_23190 348778 349029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 349251 349907 gene locus_tag LOCUS_23200 349251 349907 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036499.1 protein_id gnl|my_center|LOCUS_23200 350120 350746 gene locus_tag LOCUS_23210 350120 350746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 350750 351532 gene locus_tag LOCUS_23220 350750 351532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 351733 352512 gene locus_tag LOCUS_23230 351733 352512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 352783 353376 gene locus_tag LOCUS_23240 gene dcd 352783 353376 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092017.1 protein_id gnl|my_center|LOCUS_23240 353529 354974 gene locus_tag LOCUS_23250 gene hpaE 353529 354974 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527965.1 protein_id gnl|my_center|LOCUS_23250 355054 355239 gene locus_tag LOCUS_23260 355054 355239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 355344 355904 gene locus_tag LOCUS_23270 355344 355904 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177622.1 protein_id gnl|my_center|LOCUS_23270 355914 356429 gene locus_tag LOCUS_23280 355914 356429 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356039.1 protein_id gnl|my_center|LOCUS_23280 356718 357101 gene locus_tag LOCUS_23290 356718 357101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 357158 357622 gene locus_tag LOCUS_23300 357158 357622 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145144.1 protein_id gnl|my_center|LOCUS_23300 357619 358347 gene locus_tag LOCUS_23310 357619 358347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 358349 358873 gene locus_tag LOCUS_23320 358349 358873 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964325.1 protein_id gnl|my_center|LOCUS_23320 358968 359963 gene locus_tag LOCUS_23330 358968 359963 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 protein_id gnl|my_center|LOCUS_23330 360093 360392 gene locus_tag LOCUS_23340 360093 360392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 360392 360787 gene locus_tag LOCUS_23350 360392 360787 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922377.1 protein_id gnl|my_center|LOCUS_23350 360805 361170 gene locus_tag LOCUS_23360 360805 361170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 361259 361990 gene locus_tag LOCUS_23370 gene ric 361259 361990 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073961.1 protein_id gnl|my_center|LOCUS_23370 362076 362888 gene locus_tag LOCUS_23380 362076 362888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 362885 363655 gene locus_tag LOCUS_23390 362885 363655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 363858 364436 gene locus_tag LOCUS_23400 363858 364436 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962853.1 protein_id gnl|my_center|LOCUS_23400 364474 365502 gene locus_tag LOCUS_23410 gene tdh 364474 365502 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031190.1 protein_id gnl|my_center|LOCUS_23410 365894 367660 gene locus_tag LOCUS_23420 365894 367660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 368402 368773 gene locus_tag LOCUS_23430 368402 368773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 368839 370020 gene locus_tag LOCUS_23440 368839 370020 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972198.1 protein_id gnl|my_center|LOCUS_23440 370164 371450 gene locus_tag LOCUS_23450 gene kynU 370164 371450 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964305.1 protein_id gnl|my_center|LOCUS_23450 371846 373135 gene locus_tag LOCUS_23460 371846 373135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 374025 373195 gene locus_tag LOCUS_23470 374025 373195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 374572 375369 gene locus_tag LOCUS_23480 374572 375369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 375407 376738 gene locus_tag LOCUS_23490 375407 376738 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964302.1 protein_id gnl|my_center|LOCUS_23490 376735 377550 gene locus_tag LOCUS_23500 376735 377550 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_23500 377932 377636 gene locus_tag LOCUS_23510 377932 377636 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214948.1 protein_id gnl|my_center|LOCUS_23510 378441 377992 gene locus_tag LOCUS_23520 378441 377992 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933657.1 protein_id gnl|my_center|LOCUS_23520 379882 378857 gene locus_tag LOCUS_23530 379882 378857 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930636.1 protein_id gnl|my_center|LOCUS_23530 380438 379815 gene locus_tag LOCUS_23540 380438 379815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 380541 381206 gene locus_tag LOCUS_23550 380541 381206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23550 381155 381544 gene locus_tag LOCUS_23560 381155 381544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23560 381936 381613 gene locus_tag LOCUS_23570 381936 381613 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206200.1 protein_id gnl|my_center|LOCUS_23570 382275 381940 gene locus_tag LOCUS_23580 382275 381940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 383348 382272 gene locus_tag LOCUS_23590 383348 382272 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880158.1 protein_id gnl|my_center|LOCUS_23590 385195 383495 gene locus_tag LOCUS_23600 385195 383495 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056105.1 protein_id gnl|my_center|LOCUS_23600 385330 385665 gene locus_tag LOCUS_23610 385330 385665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 385997 385803 gene locus_tag LOCUS_23620 385997 385803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 386460 388091 gene locus_tag LOCUS_23630 386460 388091 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140378.1 protein_id gnl|my_center|LOCUS_23630 388195 389610 gene locus_tag LOCUS_23640 388195 389610 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140378.1 protein_id gnl|my_center|LOCUS_23640 390271 389558 gene locus_tag LOCUS_23650 390271 389558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 390519 391292 gene locus_tag LOCUS_23660 390519 391292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 391526 392047 gene locus_tag LOCUS_23670 391526 392047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 392364 392900 gene locus_tag LOCUS_23680 392364 392900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 392993 393811 gene locus_tag LOCUS_23690 392993 393811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 393864 394268 gene locus_tag LOCUS_23700 393864 394268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 394277 394846 gene locus_tag LOCUS_23710 394277 394846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 394849 394983 gene locus_tag LOCUS_23720 394849 394983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 395101 395628 gene locus_tag LOCUS_23730 395101 395628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 395776 397392 gene locus_tag LOCUS_23740 395776 397392 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089481.1 protein_id gnl|my_center|LOCUS_23740 397680 397525 gene locus_tag LOCUS_23750 397680 397525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 397637 399334 gene locus_tag LOCUS_23760 397637 399334 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174555.1 protein_id gnl|my_center|LOCUS_23760 399625 399834 gene locus_tag LOCUS_23770 399625 399834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 399946 400947 gene locus_tag LOCUS_23780 399946 400947 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089483.1 protein_id gnl|my_center|LOCUS_23780 401234 401668 gene locus_tag LOCUS_23790 401234 401668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 401699 402736 gene locus_tag LOCUS_23800 gene ltaE 401699 402736 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_23800 402892 403575 gene locus_tag LOCUS_23810 gene cmk 402892 403575 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230555.1 protein_id gnl|my_center|LOCUS_23810 403621 403697 gene locus_tag LOCUS_t00180 403621 403697 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 403814 403890 gene locus_tag LOCUS_t00190 403814 403890 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 403978 405519 gene locus_tag LOCUS_23820 403978 405519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 405726 406694 gene locus_tag LOCUS_23830 405726 406694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 406784 407770 gene locus_tag LOCUS_23840 gene rfaE1 406784 407770 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057610.1 protein_id gnl|my_center|LOCUS_23840 407767 408255 gene locus_tag LOCUS_23850 407767 408255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23850 408252 408857 gene locus_tag LOCUS_23860 408252 408857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 408854 409579 gene locus_tag LOCUS_23870 gene rsmE 408854 409579 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222501.1 protein_id gnl|my_center|LOCUS_23870 409974 409576 gene locus_tag LOCUS_23880 409974 409576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 411131 410538 gene locus_tag LOCUS_23890 411131 410538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 411504 411232 gene locus_tag LOCUS_23900 411504 411232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 412637 411501 gene locus_tag LOCUS_23910 412637 411501 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056882.1 protein_id gnl|my_center|LOCUS_23910 415182 412801 gene locus_tag LOCUS_23920 415182 412801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 416684 415374 gene locus_tag LOCUS_23930 416684 415374 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889017.1 protein_id gnl|my_center|LOCUS_23930 419512 416897 gene locus_tag LOCUS_23940 419512 416897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 419952 421088 gene locus_tag LOCUS_23950 419952 421088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 421085 421780 gene locus_tag LOCUS_23960 421085 421780 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083605.1 protein_id gnl|my_center|LOCUS_23960 422208 422471 gene locus_tag LOCUS_23970 422208 422471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 422485 424500 gene locus_tag LOCUS_23980 422485 424500 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225976.1 protein_id gnl|my_center|LOCUS_23980 424963 426738 gene locus_tag LOCUS_23990 424963 426738 CDS product bifunctional 3'-5' exonuclease/DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272653.1 protein_id gnl|my_center|LOCUS_23990 427471 426746 gene locus_tag LOCUS_24000 427471 426746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963352.1 protein_id gnl|my_center|LOCUS_24000 428130 427621 gene locus_tag LOCUS_24010 428130 427621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 428253 432359 gene locus_tag LOCUS_24020 428253 432359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 430473 430744 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccgaccgtcgaaccgacagc 432709 433593 gene locus_tag LOCUS_24030 432709 433593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 435755 433722 gene locus_tag LOCUS_24040 435755 433722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 436284 435826 gene locus_tag LOCUS_24050 gene rnhA 436284 435826 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262414.1 protein_id gnl|my_center|LOCUS_24050 439277 436605 gene locus_tag LOCUS_24060 439277 436605 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055983.1 protein_id gnl|my_center|LOCUS_24060 439462 441018 gene locus_tag LOCUS_24070 439462 441018 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865256.1 protein_id gnl|my_center|LOCUS_24070 441698 441465 gene locus_tag LOCUS_24080 441698 441465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_24080 442077 441853 gene locus_tag LOCUS_24090 442077 441853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 442842 442360 gene locus_tag LOCUS_24100 442842 442360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 443336 443151 gene locus_tag LOCUS_24110 443336 443151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 444783 444337 gene locus_tag LOCUS_24120 444783 444337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24120 445086 444868 gene locus_tag LOCUS_24130 445086 444868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 445348 445163 gene locus_tag LOCUS_24140 445348 445163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 446771 446472 gene locus_tag LOCUS_24150 446771 446472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 447279 447055 gene locus_tag LOCUS_24160 447279 447055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 448218 447859 gene locus_tag LOCUS_24170 448218 447859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 >Feature sequence06 2189 228 gene locus_tag LOCUS_24180 2189 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 2988 2176 gene locus_tag LOCUS_24190 2988 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 3142 3519 gene locus_tag LOCUS_24200 3142 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 5290 3602 gene locus_tag LOCUS_24210 gene ettA 5290 3602 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_24210 5742 8207 gene locus_tag LOCUS_24220 5742 8207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 10106 8208 gene locus_tag LOCUS_24230 gene asnB 10106 8208 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940273.1 protein_id gnl|my_center|LOCUS_24230 10958 10113 gene locus_tag LOCUS_24240 10958 10113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118889.1 protein_id gnl|my_center|LOCUS_24240 12069 11047 gene locus_tag LOCUS_24250 12069 11047 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941286.1 protein_id gnl|my_center|LOCUS_24250 12240 13277 gene locus_tag LOCUS_24260 12240 13277 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038037.1 protein_id gnl|my_center|LOCUS_24260 13606 13280 gene locus_tag LOCUS_24270 13606 13280 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804825.1 protein_id gnl|my_center|LOCUS_24270 14707 13946 gene locus_tag LOCUS_24280 14707 13946 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920731.1 protein_id gnl|my_center|LOCUS_24280 15374 14733 gene locus_tag LOCUS_24290 15374 14733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 16399 15371 gene locus_tag LOCUS_24300 16399 15371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 16931 16476 gene locus_tag LOCUS_24310 16931 16476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 17080 17925 gene locus_tag LOCUS_24320 gene thyA 17080 17925 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208311.1 protein_id gnl|my_center|LOCUS_24320 19248 17986 gene locus_tag LOCUS_24330 19248 17986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 21047 20151 gene locus_tag LOCUS_24340 21047 20151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 21362 21051 gene locus_tag LOCUS_24350 21362 21051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 21486 22028 gene locus_tag LOCUS_24360 21486 22028 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942963.1 protein_id gnl|my_center|LOCUS_24360 23365 22400 gene locus_tag LOCUS_24370 gene trxB 23365 22400 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405370.1 protein_id gnl|my_center|LOCUS_24370 24117 23818 gene locus_tag LOCUS_24380 24117 23818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 24531 24223 gene locus_tag LOCUS_24390 24531 24223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 25283 24684 gene locus_tag LOCUS_24400 25283 24684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 25810 25938 gene locus_tag LOCUS_24410 25810 25938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 26028 26807 gene locus_tag LOCUS_24420 26028 26807 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816058.1 protein_id gnl|my_center|LOCUS_24420 27029 27104 gene locus_tag LOCUS_t00200 27029 27104 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 27669 27890 gene locus_tag LOCUS_24430 27669 27890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 29268 28396 gene locus_tag LOCUS_24440 29268 28396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 30004 29573 gene locus_tag LOCUS_24450 gene tsaA 30004 29573 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868101.1 protein_id gnl|my_center|LOCUS_24450 30420 30806 gene locus_tag LOCUS_24460 30420 30806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24460 30803 30949 gene locus_tag LOCUS_24470 30803 30949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 31220 31753 gene locus_tag LOCUS_24480 31220 31753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 33179 32385 gene locus_tag LOCUS_24490 33179 32385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 33861 33406 gene locus_tag LOCUS_24500 33861 33406 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690774.1 protein_id gnl|my_center|LOCUS_24500 35227 33881 gene locus_tag LOCUS_24510 35227 33881 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223735.1 protein_id gnl|my_center|LOCUS_24510 35656 35411 gene locus_tag LOCUS_24520 35656 35411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 35871 35692 gene locus_tag LOCUS_24530 35871 35692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 36353 35889 gene locus_tag LOCUS_24540 36353 35889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 36669 36337 gene locus_tag LOCUS_24550 36669 36337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 36861 36727 gene locus_tag LOCUS_24560 36861 36727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 37595 37900 gene locus_tag LOCUS_24570 37595 37900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 38671 39480 gene locus_tag LOCUS_24580 38671 39480 CDS product DUF4344 domain-containing metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726965.1 protein_id gnl|my_center|LOCUS_24580 39683 41062 gene locus_tag LOCUS_24590 39683 41062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 42481 41510 gene locus_tag LOCUS_24600 42481 41510 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397112.1 protein_id gnl|my_center|LOCUS_24600 42762 43577 gene locus_tag LOCUS_24610 42762 43577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 46919 43932 gene locus_tag LOCUS_24620 46919 43932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 48121 47474 gene locus_tag LOCUS_24630 48121 47474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 48345 48130 gene locus_tag LOCUS_24640 48345 48130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 52204 48869 gene locus_tag LOCUS_24650 52204 48869 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459833.1 protein_id gnl|my_center|LOCUS_24650 52815 52219 gene locus_tag LOCUS_24660 52815 52219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 53591 52812 gene locus_tag LOCUS_24670 53591 52812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 53763 54197 gene locus_tag LOCUS_24680 53763 54197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 54618 54268 gene locus_tag LOCUS_24690 54618 54268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 63706 54890 gene locus_tag LOCUS_24700 63706 54890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 65249 63744 gene locus_tag LOCUS_24710 65249 63744 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941216.1 protein_id gnl|my_center|LOCUS_24710 65554 65402 gene locus_tag LOCUS_24720 65554 65402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 66137 65724 gene locus_tag LOCUS_24730 66137 65724 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023551.1 protein_id gnl|my_center|LOCUS_24730 66885 66343 gene locus_tag LOCUS_24740 66885 66343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 68595 67066 gene locus_tag LOCUS_24750 68595 67066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 70282 69524 gene locus_tag LOCUS_24760 70282 69524 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_24760 71127 70393 gene locus_tag LOCUS_24770 71127 70393 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_24770 71385 71990 gene locus_tag LOCUS_24780 71385 71990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 72251 72466 gene locus_tag LOCUS_24790 72251 72466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 72676 72957 gene locus_tag LOCUS_24800 72676 72957 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512149.1 protein_id gnl|my_center|LOCUS_24800 72998 73297 gene locus_tag LOCUS_24810 72998 73297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 73471 74379 gene locus_tag LOCUS_24820 73471 74379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 75113 74475 gene locus_tag LOCUS_24830 75113 74475 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940907.1 protein_id gnl|my_center|LOCUS_24830 75271 75840 gene locus_tag LOCUS_24840 75271 75840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 76402 75911 gene locus_tag LOCUS_24850 76402 75911 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_24850 76658 78337 gene locus_tag LOCUS_24860 76658 78337 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_24860 78975 78529 gene locus_tag LOCUS_24870 78975 78529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 79640 78981 gene locus_tag LOCUS_24880 79640 78981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 81727 79748 gene locus_tag LOCUS_24890 81727 79748 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190697803.1 protein_id gnl|my_center|LOCUS_24890 82888 81740 gene locus_tag LOCUS_24900 82888 81740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24900 82874 83128 gene locus_tag LOCUS_24910 82874 83128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 83503 84480 gene locus_tag LOCUS_24920 83503 84480 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112595.1 protein_id gnl|my_center|LOCUS_24920 84834 84472 gene locus_tag LOCUS_24930 84834 84472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24930 85709 84828 gene locus_tag LOCUS_24940 85709 84828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 86660 85710 gene locus_tag LOCUS_24950 86660 85710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 87507 86677 gene locus_tag LOCUS_24960 87507 86677 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257972.1 protein_id gnl|my_center|LOCUS_24960 87679 88623 gene locus_tag LOCUS_24970 87679 88623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 89537 88602 gene locus_tag LOCUS_24980 89537 88602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 89681 90790 gene locus_tag LOCUS_24990 89681 90790 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_24990 90787 91875 gene locus_tag LOCUS_25000 90787 91875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 92016 92705 gene locus_tag LOCUS_25010 gene aat 92016 92705 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964441.1 protein_id gnl|my_center|LOCUS_25010 92692 93747 gene locus_tag LOCUS_25020 92692 93747 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256493.1 protein_id gnl|my_center|LOCUS_25020 93790 95202 gene locus_tag LOCUS_25030 93790 95202 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142441.1 protein_id gnl|my_center|LOCUS_25030 95530 95330 gene locus_tag LOCUS_25040 95530 95330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 96094 95672 gene locus_tag LOCUS_25050 96094 95672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 96991 96161 gene locus_tag LOCUS_25060 96991 96161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 97700 97005 gene locus_tag LOCUS_25070 97700 97005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25070 97780 98526 gene locus_tag LOCUS_25080 97780 98526 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249303.1 protein_id gnl|my_center|LOCUS_25080 101314 98534 gene locus_tag LOCUS_25090 101314 98534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 101333 101551 gene locus_tag LOCUS_25100 101333 101551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 103371 102043 gene locus_tag LOCUS_25110 103371 102043 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_25110 105799 103469 gene locus_tag LOCUS_25120 105799 103469 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695564.1 protein_id gnl|my_center|LOCUS_25120 107299 105983 gene locus_tag LOCUS_25130 gene aceA 107299 105983 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259719.1 protein_id gnl|my_center|LOCUS_25130 108905 107334 gene locus_tag LOCUS_25140 gene aceB 108905 107334 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227987.1 protein_id gnl|my_center|LOCUS_25140 109055 109855 gene locus_tag LOCUS_25150 109055 109855 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_25150 110872 109886 gene locus_tag LOCUS_25160 110872 109886 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_25160 111740 110979 gene locus_tag LOCUS_25170 gene lgt 111740 110979 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880125.1 protein_id gnl|my_center|LOCUS_25170 112320 111823 gene locus_tag LOCUS_25180 gene lspA 112320 111823 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946027.1 protein_id gnl|my_center|LOCUS_25180 112794 112327 gene locus_tag LOCUS_25190 112794 112327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 115787 112893 gene locus_tag LOCUS_25200 gene ileS 115787 112893 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943758.1 protein_id gnl|my_center|LOCUS_25200 116089 116877 gene locus_tag LOCUS_25210 116089 116877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 117212 116916 gene locus_tag LOCUS_25220 117212 116916 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942007.1 protein_id gnl|my_center|LOCUS_25220 117482 117213 gene locus_tag LOCUS_25230 117482 117213 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942006.1 protein_id gnl|my_center|LOCUS_25230 120239 118017 gene locus_tag LOCUS_25240 120239 118017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 120633 120463 gene locus_tag LOCUS_25250 120633 120463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 122071 120701 gene locus_tag LOCUS_25260 122071 120701 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937988.1 protein_id gnl|my_center|LOCUS_25260 122293 122451 gene locus_tag LOCUS_25270 122293 122451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 122496 123248 gene locus_tag LOCUS_25280 122496 123248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 123415 124494 gene locus_tag LOCUS_25290 123415 124494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 124565 125041 gene locus_tag LOCUS_25300 124565 125041 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391513.1 protein_id gnl|my_center|LOCUS_25300 125047 125835 gene locus_tag LOCUS_25310 125047 125835 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776793.1 protein_id gnl|my_center|LOCUS_25310 125878 127071 gene locus_tag LOCUS_25320 125878 127071 CDS product galactokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776792.1 protein_id gnl|my_center|LOCUS_25320 127595 127461 gene locus_tag LOCUS_25330 127595 127461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 129097 127592 gene locus_tag LOCUS_25340 129097 127592 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100479.1 protein_id gnl|my_center|LOCUS_25340 130039 129653 gene locus_tag LOCUS_25350 130039 129653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 130894 130436 gene locus_tag LOCUS_25360 130894 130436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 132862 130937 gene locus_tag LOCUS_25370 132862 130937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 133023 134048 gene locus_tag LOCUS_25380 133023 134048 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 protein_id gnl|my_center|LOCUS_25380 134180 135028 gene locus_tag LOCUS_25390 134180 135028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 136779 135034 gene locus_tag LOCUS_25400 136779 135034 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 protein_id gnl|my_center|LOCUS_25400 137216 139327 gene locus_tag LOCUS_25410 137216 139327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 139386 139874 gene locus_tag LOCUS_25420 139386 139874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 139861 140403 gene locus_tag LOCUS_25430 139861 140403 CDS product DUF4112 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338413.1 protein_id gnl|my_center|LOCUS_25430 140540 141841 gene locus_tag LOCUS_25440 140540 141841 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778115.1 protein_id gnl|my_center|LOCUS_25440 142252 141860 gene locus_tag LOCUS_25450 142252 141860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 143060 142263 gene locus_tag LOCUS_25460 143060 142263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 143378 143184 gene locus_tag LOCUS_25470 143378 143184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 149384 143868 gene locus_tag LOCUS_25480 149384 143868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 150540 149446 gene locus_tag LOCUS_25490 150540 149446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 151746 151315 gene locus_tag LOCUS_25500 151746 151315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 152405 151935 gene locus_tag LOCUS_25510 gene ykuV 152405 151935 CDS product thiol-disulfide oxidoreductase YkuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245810.1 protein_id gnl|my_center|LOCUS_25510 153053 152508 gene locus_tag LOCUS_25520 153053 152508 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143150.1 protein_id gnl|my_center|LOCUS_25520 153543 153148 gene locus_tag LOCUS_25530 gene perR 153543 153148 CDS product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733104.1 protein_id gnl|my_center|LOCUS_25530 154336 153968 gene locus_tag LOCUS_25540 154336 153968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 155592 154447 gene locus_tag LOCUS_25550 155592 154447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 156715 155666 gene locus_tag LOCUS_25560 156715 155666 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036621.1 protein_id gnl|my_center|LOCUS_25560 156899 157117 gene locus_tag LOCUS_25570 156899 157117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 158076 157114 gene locus_tag LOCUS_25580 158076 157114 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_25580 158669 158241 gene locus_tag LOCUS_25590 158669 158241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 158792 159457 gene locus_tag LOCUS_25600 158792 159457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 159465 159656 gene locus_tag LOCUS_25610 159465 159656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 159593 159760 gene locus_tag LOCUS_25620 159593 159760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 160783 160223 gene locus_tag LOCUS_25630 160783 160223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 160791 161465 gene locus_tag LOCUS_25640 gene lipB 160791 161465 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963333.1 protein_id gnl|my_center|LOCUS_25640 161529 162296 gene locus_tag LOCUS_25650 161529 162296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 162367 163101 gene locus_tag LOCUS_25660 162367 163101 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895490.1 protein_id gnl|my_center|LOCUS_25660 165898 163331 gene locus_tag LOCUS_25670 165898 163331 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531366.1 protein_id gnl|my_center|LOCUS_25670 167074 165980 gene locus_tag LOCUS_25680 gene rodA 167074 165980 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_25680 169063 167174 gene locus_tag LOCUS_25690 gene mrdA 169063 167174 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_25690 169694 169146 gene locus_tag LOCUS_25700 169694 169146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 170612 169707 gene locus_tag LOCUS_25710 gene mreC 170612 169707 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641488.1 protein_id gnl|my_center|LOCUS_25710 171759 170713 gene locus_tag LOCUS_25720 171759 170713 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_25720 172246 172794 gene locus_tag LOCUS_25730 172246 172794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 172865 173215 gene locus_tag LOCUS_25740 172865 173215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 175714 173327 gene locus_tag LOCUS_25750 gene lon 175714 173327 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545466.1 protein_id gnl|my_center|LOCUS_25750 176295 175720 gene locus_tag LOCUS_25760 176295 175720 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143961.1 protein_id gnl|my_center|LOCUS_25760 176762 176403 gene locus_tag LOCUS_25770 176762 176403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 177356 176883 gene locus_tag LOCUS_25780 177356 176883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 177835 177602 gene locus_tag LOCUS_25790 177835 177602 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764038.1 protein_id gnl|my_center|LOCUS_25790 179288 178209 gene locus_tag LOCUS_25800 gene nadA 179288 178209 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389688.1 protein_id gnl|my_center|LOCUS_25800 180516 179647 gene locus_tag LOCUS_25810 180516 179647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 185977 180698 gene locus_tag LOCUS_25820 185977 180698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 186350 186162 gene locus_tag LOCUS_25830 186350 186162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 186640 186368 gene locus_tag LOCUS_25840 186640 186368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 187924 187091 gene locus_tag LOCUS_25850 187924 187091 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072850.1 protein_id gnl|my_center|LOCUS_25850 189027 187921 gene locus_tag LOCUS_25860 gene recF 189027 187921 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831795.1 protein_id gnl|my_center|LOCUS_25860 189152 189676 gene locus_tag LOCUS_25870 189152 189676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 189860 190312 gene locus_tag LOCUS_25880 189860 190312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 190278 190362 gene locus_tag LOCUS_t00210 190278 190362 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 190450 191451 gene locus_tag LOCUS_25890 gene pta 190450 191451 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943344.1 protein_id gnl|my_center|LOCUS_25890 191682 192110 gene locus_tag LOCUS_25900 gene mscL 191682 192110 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533610.1 protein_id gnl|my_center|LOCUS_25900 192680 192114 gene locus_tag LOCUS_25910 192680 192114 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962396.1 protein_id gnl|my_center|LOCUS_25910 193127 192687 gene locus_tag LOCUS_25920 193127 192687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 193413 193225 gene locus_tag LOCUS_25930 193413 193225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 194542 193433 gene locus_tag LOCUS_25940 gene mnmA 194542 193433 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_25940 195415 194660 gene locus_tag LOCUS_25950 195415 194660 CDS product ceramidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771218.1 protein_id gnl|my_center|LOCUS_25950 196537 195425 gene locus_tag LOCUS_25960 196537 195425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 197758 196628 gene locus_tag LOCUS_25970 197758 196628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 198879 197926 gene locus_tag LOCUS_25980 198879 197926 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255971.1 protein_id gnl|my_center|LOCUS_25980 199716 198964 gene locus_tag LOCUS_25990 199716 198964 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881611.1 protein_id gnl|my_center|LOCUS_25990 201266 199776 gene locus_tag LOCUS_26000 201266 199776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 202410 201373 gene locus_tag LOCUS_26010 202410 201373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 203519 202407 gene locus_tag LOCUS_26020 203519 202407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 207387 203647 gene locus_tag LOCUS_26030 207387 203647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 207375 207560 gene locus_tag LOCUS_26040 207375 207560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 209103 207694 gene locus_tag LOCUS_26050 209103 207694 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941261.1 protein_id gnl|my_center|LOCUS_26050 209178 209756 gene locus_tag LOCUS_26060 209178 209756 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272276.1 protein_id gnl|my_center|LOCUS_26060 212778 209974 gene locus_tag LOCUS_26070 212778 209974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 212988 213773 gene locus_tag LOCUS_26080 212988 213773 CDS product aldehyde dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061663.1 protein_id gnl|my_center|LOCUS_26080 213760 214746 gene locus_tag LOCUS_26090 213760 214746 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268938.1 protein_id gnl|my_center|LOCUS_26090 214848 217004 gene locus_tag LOCUS_26100 214848 217004 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087967.1 protein_id gnl|my_center|LOCUS_26100 217273 218250 gene locus_tag LOCUS_26110 217273 218250 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243519.1 protein_id gnl|my_center|LOCUS_26110 218566 219189 gene locus_tag LOCUS_26120 218566 219189 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037855.1 protein_id gnl|my_center|LOCUS_26120 219351 223163 gene locus_tag LOCUS_26130 219351 223163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 224043 223186 gene locus_tag LOCUS_26140 224043 223186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 226181 224067 gene locus_tag LOCUS_26150 226181 224067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 227471 226266 gene locus_tag LOCUS_26160 227471 226266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 227766 227476 gene locus_tag LOCUS_26170 227766 227476 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940377.1 protein_id gnl|my_center|LOCUS_26170 228456 228007 gene locus_tag LOCUS_26180 228456 228007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 229977 228556 gene locus_tag LOCUS_26190 229977 228556 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_26190 230192 231718 gene locus_tag LOCUS_26200 230192 231718 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_26200 231776 233383 gene locus_tag LOCUS_26210 231776 233383 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122885.1 protein_id gnl|my_center|LOCUS_26210 233455 235272 gene locus_tag LOCUS_26220 233455 235272 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144080476.1 protein_id gnl|my_center|LOCUS_26220 235404 236801 gene locus_tag LOCUS_26230 235404 236801 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233725.1 protein_id gnl|my_center|LOCUS_26230 239407 237410 gene locus_tag LOCUS_26240 gene ppiD 239407 237410 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208638.1 protein_id gnl|my_center|LOCUS_26240 239570 240619 gene locus_tag LOCUS_26250 239570 240619 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258073.1 protein_id gnl|my_center|LOCUS_26250 240619 241875 gene locus_tag LOCUS_26260 240619 241875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 242011 243645 gene locus_tag LOCUS_26270 242011 243645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26270 243626 243901 gene locus_tag LOCUS_26280 243626 243901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 244310 244098 gene locus_tag LOCUS_26290 244310 244098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 244450 245997 gene locus_tag LOCUS_26300 244450 245997 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958525.1 protein_id gnl|my_center|LOCUS_26300 245987 246172 gene locus_tag LOCUS_26310 245987 246172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 246238 247596 gene locus_tag LOCUS_26320 246238 247596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 248017 248844 gene locus_tag LOCUS_26330 248017 248844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 250417 249110 gene locus_tag LOCUS_26340 250417 249110 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038361.1 protein_id gnl|my_center|LOCUS_26340 250732 253467 gene locus_tag LOCUS_26350 250732 253467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 253591 254046 gene locus_tag LOCUS_26360 253591 254046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531700.1 protein_id gnl|my_center|LOCUS_26360 254046 254693 gene locus_tag LOCUS_26370 gene queE 254046 254693 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120697.1 protein_id gnl|my_center|LOCUS_26370 254817 255512 gene locus_tag LOCUS_26380 gene queC 254817 255512 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932219.1 protein_id gnl|my_center|LOCUS_26380 256193 255519 gene locus_tag LOCUS_26390 256193 255519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 257504 256236 gene locus_tag LOCUS_26400 257504 256236 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_26400 259240 257630 gene locus_tag LOCUS_26410 259240 257630 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155019.1 protein_id gnl|my_center|LOCUS_26410 259848 259279 gene locus_tag LOCUS_26420 259848 259279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 260201 259923 gene locus_tag LOCUS_26430 260201 259923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26430 262240 260150 gene locus_tag LOCUS_26440 262240 260150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26440 262354 262584 gene locus_tag LOCUS_26450 262354 262584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 262584 263012 gene locus_tag LOCUS_26460 262584 263012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 264397 263054 gene locus_tag LOCUS_26470 264397 263054 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_26470 264540 265715 gene locus_tag LOCUS_26480 264540 265715 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404076.1 protein_id gnl|my_center|LOCUS_26480 265760 266659 gene locus_tag LOCUS_26490 265760 266659 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888715.1 protein_id gnl|my_center|LOCUS_26490 267274 266843 gene locus_tag LOCUS_26500 267274 266843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 267741 267274 gene locus_tag LOCUS_26510 267741 267274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26510 267817 269889 gene locus_tag LOCUS_26520 267817 269889 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142622.1 protein_id gnl|my_center|LOCUS_26520 269939 270442 gene locus_tag LOCUS_26530 269939 270442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 270781 272184 gene locus_tag LOCUS_26540 gene mpl 270781 272184 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527766.1 protein_id gnl|my_center|LOCUS_26540 272398 272559 gene locus_tag LOCUS_26550 272398 272559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 272556 272957 gene locus_tag LOCUS_26560 272556 272957 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971327.1 protein_id gnl|my_center|LOCUS_26560 273129 272941 gene locus_tag LOCUS_26570 273129 272941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 273620 273126 gene locus_tag LOCUS_26580 273620 273126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 274579 274791 gene locus_tag LOCUS_26590 274579 274791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 275080 275538 gene locus_tag LOCUS_26600 275080 275538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 275535 275918 gene locus_tag LOCUS_26610 275535 275918 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395273.1 protein_id gnl|my_center|LOCUS_26610 276051 276233 gene locus_tag LOCUS_26620 276051 276233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 276815 276441 gene locus_tag LOCUS_26630 276815 276441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 278852 277188 gene locus_tag LOCUS_26640 gene dacB 278852 277188 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839168.1 protein_id gnl|my_center|LOCUS_26640 279996 278950 gene locus_tag LOCUS_26650 279996 278950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 280425 280147 gene locus_tag LOCUS_26660 280425 280147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 281637 280438 gene locus_tag LOCUS_26670 281637 280438 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142095.1 protein_id gnl|my_center|LOCUS_26670 282151 281780 gene locus_tag LOCUS_26680 282151 281780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 282531 283256 gene locus_tag LOCUS_26690 282531 283256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 283583 283311 gene locus_tag LOCUS_26700 283583 283311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 284614 283745 gene locus_tag LOCUS_26710 284614 283745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 285371 284820 gene locus_tag LOCUS_26720 285371 284820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 285597 285376 gene locus_tag LOCUS_26730 285597 285376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 288638 285723 gene locus_tag LOCUS_26740 288638 285723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 289544 288792 gene locus_tag LOCUS_26750 289544 288792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 289932 289690 gene locus_tag LOCUS_26760 289932 289690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 293427 290149 gene locus_tag LOCUS_26770 293427 290149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 294798 293974 gene locus_tag LOCUS_26780 294798 293974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 295275 295859 gene locus_tag LOCUS_26790 295275 295859 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_26790 295966 298704 gene locus_tag LOCUS_26800 295966 298704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 298673 299251 gene locus_tag LOCUS_26810 298673 299251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 299666 299256 gene locus_tag LOCUS_26820 299666 299256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 300574 299705 gene locus_tag LOCUS_26830 300574 299705 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140419.1 protein_id gnl|my_center|LOCUS_26830 301091 303445 gene locus_tag LOCUS_26840 301091 303445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 303534 305408 gene locus_tag LOCUS_26850 303534 305408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 305659 306543 gene locus_tag LOCUS_26860 305659 306543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 306647 307108 gene locus_tag LOCUS_26870 306647 307108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 307281 308390 gene locus_tag LOCUS_26880 307281 308390 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259330.1 protein_id gnl|my_center|LOCUS_26880 308489 311776 gene locus_tag LOCUS_26890 308489 311776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 311900 313069 gene locus_tag LOCUS_26900 311900 313069 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838120.1 protein_id gnl|my_center|LOCUS_26900 313107 316220 gene locus_tag LOCUS_26910 313107 316220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 316320 316976 gene locus_tag LOCUS_26920 316320 316976 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244073.1 protein_id gnl|my_center|LOCUS_26920 319592 317058 gene locus_tag LOCUS_26930 319592 317058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 319884 321905 gene locus_tag LOCUS_26940 319884 321905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 321889 322437 gene locus_tag LOCUS_26950 321889 322437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 322800 322519 gene locus_tag LOCUS_26960 322800 322519 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980242.1 protein_id gnl|my_center|LOCUS_26960 322880 323338 gene locus_tag LOCUS_26970 322880 323338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 323352 323855 gene locus_tag LOCUS_26980 323352 323855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 323860 325101 gene locus_tag LOCUS_26990 323860 325101 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_26990 326218 325142 gene locus_tag LOCUS_27000 326218 325142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 326787 326215 gene locus_tag LOCUS_27010 326787 326215 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_27010 327889 326909 gene locus_tag LOCUS_27020 327889 326909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 329460 327886 gene locus_tag LOCUS_27030 329460 327886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 330422 329487 gene locus_tag LOCUS_27040 330422 329487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 331082 330432 gene locus_tag LOCUS_27050 331082 330432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 331252 332307 gene locus_tag LOCUS_27060 331252 332307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 332322 332879 gene locus_tag LOCUS_27070 332322 332879 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228796.1 protein_id gnl|my_center|LOCUS_27070 332884 333387 gene locus_tag LOCUS_27080 332884 333387 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408018.1 protein_id gnl|my_center|LOCUS_27080 333377 333907 gene locus_tag LOCUS_27090 333377 333907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 334042 334821 gene locus_tag LOCUS_27100 334042 334821 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031047.1 protein_id gnl|my_center|LOCUS_27100 334917 335747 gene locus_tag LOCUS_27110 334917 335747 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_27110 336604 335777 gene locus_tag LOCUS_27120 336604 335777 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977279.1 protein_id gnl|my_center|LOCUS_27120 339839 336849 gene locus_tag LOCUS_27130 339839 336849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 341783 340050 gene locus_tag LOCUS_27140 341783 340050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 342014 342104 gene locus_tag LOCUS_t00220 342014 342104 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 342571 342906 gene locus_tag LOCUS_27150 342571 342906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 342913 344406 gene locus_tag LOCUS_27160 gene gltX 342913 344406 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545418.1 protein_id gnl|my_center|LOCUS_27160 344734 345228 gene locus_tag LOCUS_27170 344734 345228 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929165.1 protein_id gnl|my_center|LOCUS_27170 345501 346826 gene locus_tag LOCUS_27180 345501 346826 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142346.1 protein_id gnl|my_center|LOCUS_27180 346819 347694 gene locus_tag LOCUS_27190 346819 347694 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015684.1 protein_id gnl|my_center|LOCUS_27190 348039 347851 gene locus_tag LOCUS_27200 348039 347851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 348264 348716 gene locus_tag LOCUS_27210 348264 348716 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071200.1 protein_id gnl|my_center|LOCUS_27210 349241 349528 gene locus_tag LOCUS_27220 349241 349528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 349525 350196 gene locus_tag LOCUS_27230 349525 350196 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396738.1 protein_id gnl|my_center|LOCUS_27230 350297 351199 gene locus_tag LOCUS_27240 350297 351199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 352611 351535 gene locus_tag LOCUS_27250 352611 351535 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295283.1 protein_id gnl|my_center|LOCUS_27250 352861 352628 gene locus_tag LOCUS_27260 352861 352628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 352818 354824 gene locus_tag LOCUS_27270 352818 354824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 354835 356676 gene locus_tag LOCUS_27280 354835 356676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 356776 358770 gene locus_tag LOCUS_27290 356776 358770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 358793 360763 gene locus_tag LOCUS_27300 358793 360763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 362213 361539 gene locus_tag LOCUS_27310 362213 361539 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724156.1 protein_id gnl|my_center|LOCUS_27310 362451 363890 gene locus_tag LOCUS_27320 362451 363890 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140567.1 protein_id gnl|my_center|LOCUS_27320 364028 365179 gene locus_tag LOCUS_27330 364028 365179 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040295.1 protein_id gnl|my_center|LOCUS_27330 365329 368445 gene locus_tag LOCUS_27340 365329 368445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_27340 368836 368453 gene locus_tag LOCUS_27350 gene crcB 368836 368453 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975197.1 protein_id gnl|my_center|LOCUS_27350 369536 368844 gene locus_tag LOCUS_27360 369536 368844 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_27360 369858 371753 gene locus_tag LOCUS_27370 369858 371753 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256503.1 protein_id gnl|my_center|LOCUS_27370 372587 371856 gene locus_tag LOCUS_27380 372587 371856 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969534.1 protein_id gnl|my_center|LOCUS_27380 373108 372587 gene locus_tag LOCUS_27390 gene purE 373108 372587 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172593.1 protein_id gnl|my_center|LOCUS_27390 373386 373105 gene locus_tag LOCUS_27400 373386 373105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 >Feature sequence07 1036 1299 gene locus_tag LOCUS_27410 1036 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 1341 1511 gene locus_tag LOCUS_27420 1341 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 1790 1641 gene locus_tag LOCUS_27430 1790 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 3041 2793 gene locus_tag LOCUS_27440 3041 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 4153 3971 gene locus_tag LOCUS_27450 4153 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27450 4292 4459 gene locus_tag LOCUS_27460 4292 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 4525 6399 gene locus_tag LOCUS_27470 4525 6399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 6489 7235 gene locus_tag LOCUS_27480 6489 7235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 7387 7932 gene locus_tag LOCUS_27490 7387 7932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 7899 8519 gene locus_tag LOCUS_27500 7899 8519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 8497 9198 gene locus_tag LOCUS_27510 8497 9198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 9520 10416 gene locus_tag LOCUS_27520 9520 10416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 10421 11119 gene locus_tag LOCUS_27530 10421 11119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 11828 11520 gene locus_tag LOCUS_27540 11828 11520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 14260 13355 gene locus_tag LOCUS_27550 14260 13355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 15008 14247 gene locus_tag LOCUS_27560 15008 14247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 16551 15745 gene locus_tag LOCUS_27570 16551 15745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 17477 16491 gene locus_tag LOCUS_27580 17477 16491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 19321 17882 gene locus_tag LOCUS_27590 19321 17882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 20944 19532 gene locus_tag LOCUS_27600 20944 19532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27600 22439 20913 gene locus_tag LOCUS_27610 22439 20913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27610 23140 26112 gene locus_tag LOCUS_27620 23140 26112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 26559 26314 gene locus_tag LOCUS_27630 26559 26314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 26842 26594 gene locus_tag LOCUS_27640 26842 26594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 28412 26943 gene locus_tag LOCUS_27650 28412 26943 CDS product IS1182-like element ISBf5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203619.1 protein_id gnl|my_center|LOCUS_27650 28490 28711 gene locus_tag LOCUS_27660 28490 28711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 30005 28872 gene locus_tag LOCUS_27670 30005 28872 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942298.1 protein_id gnl|my_center|LOCUS_27670 30178 30264 gene locus_tag LOCUS_t00230 30178 30264 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 30329 31357 gene locus_tag LOCUS_27680 gene queA 30329 31357 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723535.1 protein_id gnl|my_center|LOCUS_27680 31683 32213 gene locus_tag LOCUS_27690 gene rimI 31683 32213 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868792.1 protein_id gnl|my_center|LOCUS_27690 32220 32837 gene locus_tag LOCUS_27700 gene thiE 32220 32837 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256280.1 protein_id gnl|my_center|LOCUS_27700 32988 34181 gene locus_tag LOCUS_27710 32988 34181 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545245.1 protein_id gnl|my_center|LOCUS_27710 34282 34962 gene locus_tag LOCUS_27720 34282 34962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 36528 35134 gene locus_tag LOCUS_27730 36528 35134 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886939.1 protein_id gnl|my_center|LOCUS_27730 37669 36623 gene locus_tag LOCUS_27740 37669 36623 CDS product bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038544.1 protein_id gnl|my_center|LOCUS_27740 37875 38651 gene locus_tag LOCUS_27750 37875 38651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 39894 39004 gene locus_tag LOCUS_27760 gene hslO 39894 39004 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296053.1 protein_id gnl|my_center|LOCUS_27760 40302 43955 gene locus_tag LOCUS_27770 40302 43955 CDS product ribonucleotide reductase N-terminal alpha domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459011.1 protein_id gnl|my_center|LOCUS_27770 46049 44145 gene locus_tag LOCUS_27780 46049 44145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 46198 48291 gene locus_tag LOCUS_27790 46198 48291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 48420 49223 gene locus_tag LOCUS_27800 48420 49223 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_27800 52601 49788 gene locus_tag LOCUS_27810 52601 49788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 53035 52598 gene locus_tag LOCUS_27820 53035 52598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 54338 53142 gene locus_tag LOCUS_27830 54338 53142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 55031 54375 gene locus_tag LOCUS_27840 55031 54375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 55145 55993 gene locus_tag LOCUS_27850 55145 55993 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928572.1 protein_id gnl|my_center|LOCUS_27850 58599 56644 gene locus_tag LOCUS_27860 58599 56644 CDS product conditioned medium factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275170.1 protein_id gnl|my_center|LOCUS_27860 59852 58719 gene locus_tag LOCUS_27870 59852 58719 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222142.1 protein_id gnl|my_center|LOCUS_27870 59829 59993 gene locus_tag LOCUS_27880 59829 59993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 61097 61172 gene locus_tag LOCUS_t00240 61097 61172 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 61708 61418 gene locus_tag LOCUS_27890 61708 61418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 62532 61777 gene locus_tag LOCUS_27900 62532 61777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 62825 63400 gene locus_tag LOCUS_27910 62825 63400 CDS product DUF4256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138383.1 protein_id gnl|my_center|LOCUS_27910 65041 63887 gene locus_tag LOCUS_27920 65041 63887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 65424 66584 gene locus_tag LOCUS_27930 65424 66584 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_27930 68100 66595 gene locus_tag LOCUS_27940 68100 66595 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_27940 68265 68846 gene locus_tag LOCUS_27950 68265 68846 CDS product DUF2585 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122157.1 protein_id gnl|my_center|LOCUS_27950 69792 69553 gene locus_tag LOCUS_27960 69792 69553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 70475 69759 gene locus_tag LOCUS_27970 70475 69759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 71521 70730 gene locus_tag LOCUS_27980 71521 70730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 72072 71527 gene locus_tag LOCUS_27990 72072 71527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 72196 74265 gene locus_tag LOCUS_28000 72196 74265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 74717 75880 gene locus_tag LOCUS_28010 gene vpsj 74717 75880 CDS product exopolysaccharide biosynthesis protein VpsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843487.1 protein_id gnl|my_center|LOCUS_28010 76279 77304 gene locus_tag LOCUS_28020 76279 77304 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496575.1 protein_id gnl|my_center|LOCUS_28020 77301 78773 gene locus_tag LOCUS_28030 77301 78773 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_28030 79033 79935 gene locus_tag LOCUS_28040 gene prmC 79033 79935 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_28040 80446 80901 gene locus_tag LOCUS_28050 80446 80901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 80989 81528 gene locus_tag LOCUS_28060 80989 81528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 82171 81818 gene locus_tag LOCUS_28070 82171 81818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 82608 82276 gene locus_tag LOCUS_28080 82608 82276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 82847 82611 gene locus_tag LOCUS_28090 82847 82611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 83077 85008 gene locus_tag LOCUS_28100 gene dxs 83077 85008 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_28100 85203 86000 gene locus_tag LOCUS_28110 85203 86000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 85997 86479 gene locus_tag LOCUS_28120 85997 86479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 86476 86841 gene locus_tag LOCUS_28130 86476 86841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 87031 89766 gene locus_tag LOCUS_28140 87031 89766 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640527.1 protein_id gnl|my_center|LOCUS_28140 90312 89911 gene locus_tag LOCUS_28150 90312 89911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 90803 90309 gene locus_tag LOCUS_28160 90803 90309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 91453 90800 gene locus_tag LOCUS_28170 91453 90800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 91718 93076 gene locus_tag LOCUS_28180 91718 93076 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057580.1 protein_id gnl|my_center|LOCUS_28180 93170 96400 gene locus_tag LOCUS_28190 93170 96400 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974031.1 protein_id gnl|my_center|LOCUS_28190 96390 98153 gene locus_tag LOCUS_28200 96390 98153 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121893.1 protein_id gnl|my_center|LOCUS_28200 98320 100335 gene locus_tag LOCUS_28210 98320 100335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 100722 101579 gene locus_tag LOCUS_28220 gene hisG 100722 101579 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789131.1 protein_id gnl|my_center|LOCUS_28220 101930 103252 gene locus_tag LOCUS_28230 gene hisD 101930 103252 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766232.1 protein_id gnl|my_center|LOCUS_28230 103271 104320 gene locus_tag LOCUS_28240 gene hisC 103271 104320 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766231.1 protein_id gnl|my_center|LOCUS_28240 104317 105420 gene locus_tag LOCUS_28250 gene hisB 104317 105420 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963105.1 protein_id gnl|my_center|LOCUS_28250 105460 106050 gene locus_tag LOCUS_28260 gene hisH 105460 106050 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107745.1 protein_id gnl|my_center|LOCUS_28260 106118 106849 gene locus_tag LOCUS_28270 gene hisA 106118 106849 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764911.1 protein_id gnl|my_center|LOCUS_28270 106871 107629 gene locus_tag LOCUS_28280 gene hisF 106871 107629 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_28280 107631 108227 gene locus_tag LOCUS_28290 gene hisIE 107631 108227 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963101.1 protein_id gnl|my_center|LOCUS_28290 108399 111581 gene locus_tag LOCUS_28300 108399 111581 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256275.1 protein_id gnl|my_center|LOCUS_28300 111922 113310 gene locus_tag LOCUS_28310 111922 113310 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062283476.1 protein_id gnl|my_center|LOCUS_28310 113906 114565 gene locus_tag LOCUS_28320 113906 114565 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773049.1 protein_id gnl|my_center|LOCUS_28320 115438 115088 gene locus_tag LOCUS_28330 115438 115088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 115841 115560 gene locus_tag LOCUS_28340 115841 115560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 116395 115838 gene locus_tag LOCUS_28350 116395 115838 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925883.1 protein_id gnl|my_center|LOCUS_28350 116889 116404 gene locus_tag LOCUS_28360 116889 116404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 117825 116893 gene locus_tag LOCUS_28370 gene lipA 117825 116893 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258693.1 protein_id gnl|my_center|LOCUS_28370 118410 118075 gene locus_tag LOCUS_28380 118410 118075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 119265 118531 gene locus_tag LOCUS_28390 119265 118531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084123.1 protein_id gnl|my_center|LOCUS_28390 119845 119396 gene locus_tag LOCUS_28400 gene sodN 119845 119396 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125519.1 protein_id gnl|my_center|LOCUS_28400 120231 119899 gene locus_tag LOCUS_28410 120231 119899 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125388.1 protein_id gnl|my_center|LOCUS_28410 121115 120327 gene locus_tag LOCUS_28420 gene truA 121115 120327 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970846.1 protein_id gnl|my_center|LOCUS_28420 121571 121182 gene locus_tag LOCUS_28430 121571 121182 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189082.1 protein_id gnl|my_center|LOCUS_28430 122334 121699 gene locus_tag LOCUS_28440 gene coxH3 122334 121699 CDS product Dot/Icm type IV secretion system effector CoxH3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770384.1 protein_id gnl|my_center|LOCUS_28440 122483 124345 gene locus_tag LOCUS_28450 122483 124345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 124420 124791 gene locus_tag LOCUS_28460 124420 124791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 124812 126026 gene locus_tag LOCUS_28470 124812 126026 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243652.1 protein_id gnl|my_center|LOCUS_28470 127331 126273 gene locus_tag LOCUS_28480 127331 126273 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193771.1 protein_id gnl|my_center|LOCUS_28480 127932 127366 gene locus_tag LOCUS_28490 127932 127366 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_28490 128257 129669 gene locus_tag LOCUS_28500 128257 129669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 130360 129740 gene locus_tag LOCUS_28510 gene trmB 130360 129740 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057818.1 protein_id gnl|my_center|LOCUS_28510 131498 130461 gene locus_tag LOCUS_28520 131498 130461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 132258 131503 gene locus_tag LOCUS_28530 gene fabG 132258 131503 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_28530 132381 133805 gene locus_tag LOCUS_28540 132381 133805 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928742.1 protein_id gnl|my_center|LOCUS_28540 135151 133814 gene locus_tag LOCUS_28550 135151 133814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 136233 135403 gene locus_tag LOCUS_28560 136233 135403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 136489 136719 gene locus_tag LOCUS_28570 136489 136719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28570 138302 136755 gene locus_tag LOCUS_28580 138302 136755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 139309 138593 gene locus_tag LOCUS_28590 gene rph 139309 138593 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038353.1 protein_id gnl|my_center|LOCUS_28590 140315 139455 gene locus_tag LOCUS_28600 gene murI 140315 139455 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_28600 140659 140435 gene locus_tag LOCUS_28610 140659 140435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 140978 141481 gene locus_tag LOCUS_28620 140978 141481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 142004 141633 gene locus_tag LOCUS_tm00010 142004 141633 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 142179 145298 gene locus_tag LOCUS_28630 142179 145298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 147207 146023 gene locus_tag LOCUS_28640 147207 146023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 147417 147280 gene locus_tag LOCUS_28650 147417 147280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 147841 148362 gene locus_tag LOCUS_28660 147841 148362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 150245 148728 gene locus_tag LOCUS_28670 150245 148728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 151651 150461 gene locus_tag LOCUS_28680 151651 150461 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545786.1 protein_id gnl|my_center|LOCUS_28680 152195 151698 gene locus_tag LOCUS_28690 152195 151698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 152375 152199 gene locus_tag LOCUS_28700 152375 152199 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937959.1 protein_id gnl|my_center|LOCUS_28700 153675 152518 gene locus_tag LOCUS_28710 153675 152518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 153977 154879 gene locus_tag LOCUS_28720 153977 154879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 155110 157170 gene locus_tag LOCUS_28730 155110 157170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 157967 157473 gene locus_tag LOCUS_28740 157967 157473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 158230 157964 gene locus_tag LOCUS_28750 158230 157964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 159210 158335 gene locus_tag LOCUS_28760 159210 158335 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389782.1 protein_id gnl|my_center|LOCUS_28760 160810 159296 gene locus_tag LOCUS_28770 gene atpA 160810 159296 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940787.1 protein_id gnl|my_center|LOCUS_28770 161433 160891 gene locus_tag LOCUS_28780 gene atpH 161433 160891 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940786.1 protein_id gnl|my_center|LOCUS_28780 161995 161435 gene locus_tag LOCUS_28790 161995 161435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 162469 162014 gene locus_tag LOCUS_28800 162469 162014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 162657 162755 gene locus_tag LOCUS_t00250 162657 162755 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 162985 163368 gene locus_tag LOCUS_28810 162985 163368 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_28810 163373 164497 gene locus_tag LOCUS_28820 gene dprA 163373 164497 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_28820 164824 165369 gene locus_tag LOCUS_28830 164824 165369 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946524.1 protein_id gnl|my_center|LOCUS_28830 165982 168516 gene locus_tag LOCUS_28840 gene topA 165982 168516 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_28840 168633 169214 gene locus_tag LOCUS_28850 168633 169214 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229952.1 protein_id gnl|my_center|LOCUS_28850 169395 171113 gene locus_tag LOCUS_28860 169395 171113 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920401.1 protein_id gnl|my_center|LOCUS_28860 171212 171391 gene locus_tag LOCUS_28870 171212 171391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 171506 172324 gene locus_tag LOCUS_28880 171506 172324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 172312 173064 gene locus_tag LOCUS_28890 172312 173064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 173145 173300 gene locus_tag LOCUS_28900 173145 173300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 173874 173359 gene locus_tag LOCUS_28910 173874 173359 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902308.1 protein_id gnl|my_center|LOCUS_28910 174521 173871 gene locus_tag LOCUS_28920 174521 173871 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057751.1 protein_id gnl|my_center|LOCUS_28920 174688 175176 gene locus_tag LOCUS_28930 174688 175176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 175663 176151 gene locus_tag LOCUS_28940 175663 176151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 177245 176286 gene locus_tag LOCUS_28950 177245 176286 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964090.1 protein_id gnl|my_center|LOCUS_28950 181288 177596 gene locus_tag LOCUS_28960 181288 177596 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388324.1 protein_id gnl|my_center|LOCUS_28960 181514 184021 gene locus_tag LOCUS_28970 gene vpsO 181514 184021 CDS product exopolysaccharide regulatory tyrosine autokinase VpsO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_28970 184986 184144 gene locus_tag LOCUS_28980 gene rfbD 184986 184144 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877394.1 protein_id gnl|my_center|LOCUS_28980 185251 184994 gene locus_tag LOCUS_28990 185251 184994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 185832 185248 gene locus_tag LOCUS_29000 185832 185248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 186454 185870 gene locus_tag LOCUS_29010 186454 185870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 187408 186584 gene locus_tag LOCUS_29020 187408 186584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 187798 187577 gene locus_tag LOCUS_29030 187798 187577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 187893 189065 gene locus_tag LOCUS_29040 187893 189065 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030088.1 protein_id gnl|my_center|LOCUS_29040 189754 189494 gene locus_tag LOCUS_29050 189754 189494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 190601 189792 gene locus_tag LOCUS_29060 190601 189792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 191319 190651 gene locus_tag LOCUS_29070 191319 190651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 192109 191732 gene locus_tag LOCUS_29080 192109 191732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 193732 192812 gene locus_tag LOCUS_29090 193732 192812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 193998 193738 gene locus_tag LOCUS_29100 193998 193738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 194261 194097 gene locus_tag LOCUS_29110 194261 194097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 195169 194972 gene locus_tag LOCUS_29120 195169 194972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 196787 195972 gene locus_tag LOCUS_29130 196787 195972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 198405 196858 gene locus_tag LOCUS_29140 198405 196858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 198829 198578 gene locus_tag LOCUS_29150 198829 198578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 200907 198889 gene locus_tag LOCUS_29160 200907 198889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 201663 201220 gene locus_tag LOCUS_29170 201663 201220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29170 202276 201782 gene locus_tag LOCUS_29180 202276 201782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 203305 202868 gene locus_tag LOCUS_29190 203305 202868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29190 203946 203302 gene locus_tag LOCUS_29200 203946 203302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29200 204308 203976 gene locus_tag LOCUS_29210 204308 203976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 204341 205501 gene locus_tag LOCUS_29220 204341 205501 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072930.1 protein_id gnl|my_center|LOCUS_29220 205498 206880 gene locus_tag LOCUS_29230 205498 206880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 207095 207901 gene locus_tag LOCUS_29240 207095 207901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 207966 208427 gene locus_tag LOCUS_29250 207966 208427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 208430 208915 gene locus_tag LOCUS_29260 208430 208915 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728014.1 protein_id gnl|my_center|LOCUS_29260 208912 209436 gene locus_tag LOCUS_29270 208912 209436 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076326.1 protein_id gnl|my_center|LOCUS_29270 209529 212003 gene locus_tag LOCUS_29280 209529 212003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 213662 212280 gene locus_tag LOCUS_29290 213662 212280 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920680.1 protein_id gnl|my_center|LOCUS_29290 214569 213730 gene locus_tag LOCUS_29300 214569 213730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 214729 214535 gene locus_tag LOCUS_29310 214729 214535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 215236 214862 gene locus_tag LOCUS_29320 215236 214862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 215357 215160 gene locus_tag LOCUS_29330 215357 215160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 216696 215329 gene locus_tag LOCUS_29340 216696 215329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 217984 216923 gene locus_tag LOCUS_29350 217984 216923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 218918 218229 gene locus_tag LOCUS_29360 218918 218229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29360 219478 219900 gene locus_tag LOCUS_29370 219478 219900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 220602 220300 gene locus_tag LOCUS_29380 220602 220300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 220748 220999 gene locus_tag LOCUS_29390 220748 220999 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140360.1 protein_id gnl|my_center|LOCUS_29390 220980 221294 gene locus_tag LOCUS_29400 220980 221294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 221379 221798 gene locus_tag LOCUS_29410 221379 221798 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_29410 221925 223241 gene locus_tag LOCUS_29420 221925 223241 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190664.1 protein_id gnl|my_center|LOCUS_29420 223447 224001 gene locus_tag LOCUS_29430 223447 224001 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_29430 224430 224002 gene locus_tag LOCUS_29440 224430 224002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 225965 224967 gene locus_tag LOCUS_29450 225965 224967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 227289 225955 gene locus_tag LOCUS_29460 227289 225955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 227610 227326 gene locus_tag LOCUS_29470 227610 227326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 229187 228006 gene locus_tag LOCUS_29480 229187 228006 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811028.1 protein_id gnl|my_center|LOCUS_29480 230604 229513 gene locus_tag LOCUS_29490 230604 229513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 230801 232465 gene locus_tag LOCUS_29500 230801 232465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 233726 232530 gene locus_tag LOCUS_29510 233726 232530 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963843.1 protein_id gnl|my_center|LOCUS_29510 237900 233860 gene locus_tag LOCUS_29520 237900 233860 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941062.1 protein_id gnl|my_center|LOCUS_29520 239117 237918 gene locus_tag LOCUS_29530 239117 237918 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393804.1 protein_id gnl|my_center|LOCUS_29530 240579 239215 gene locus_tag LOCUS_29540 240579 239215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 240794 240603 gene locus_tag LOCUS_29550 240794 240603 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720756.1 protein_id gnl|my_center|LOCUS_29550 241474 240911 gene locus_tag LOCUS_29560 241474 240911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 242412 241471 gene locus_tag LOCUS_29570 242412 241471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 243404 242439 gene locus_tag LOCUS_29580 243404 242439 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943586.1 protein_id gnl|my_center|LOCUS_29580 243655 243392 gene locus_tag LOCUS_29590 243655 243392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 245093 244185 gene locus_tag LOCUS_29600 245093 244185 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632430.1 protein_id gnl|my_center|LOCUS_29600 245457 245155 gene locus_tag LOCUS_29610 245457 245155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29610 246415 245783 gene locus_tag LOCUS_29620 246415 245783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 247846 246461 gene locus_tag LOCUS_29630 247846 246461 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896784.1 protein_id gnl|my_center|LOCUS_29630 248703 247933 gene locus_tag LOCUS_29640 248703 247933 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730500.1 protein_id gnl|my_center|LOCUS_29640 249337 248789 gene locus_tag LOCUS_29650 249337 248789 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329717.1 protein_id gnl|my_center|LOCUS_29650 249762 249433 gene locus_tag LOCUS_29660 249762 249433 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929420.1 protein_id gnl|my_center|LOCUS_29660 250398 251204 gene locus_tag LOCUS_29670 250398 251204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 251472 252050 gene locus_tag LOCUS_29680 251472 252050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 252274 254205 gene locus_tag LOCUS_29690 gene dnaK 252274 254205 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_29690 254465 255625 gene locus_tag LOCUS_29700 gene dnaJ 254465 255625 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454751.1 protein_id gnl|my_center|LOCUS_29700 255947 256348 gene locus_tag LOCUS_29710 255947 256348 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880418.1 protein_id gnl|my_center|LOCUS_29710 256428 259856 gene locus_tag LOCUS_29720 256428 259856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 259941 261383 gene locus_tag LOCUS_29730 259941 261383 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231519.1 protein_id gnl|my_center|LOCUS_29730 262548 261418 gene locus_tag LOCUS_29740 262548 261418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 264002 262614 gene locus_tag LOCUS_29750 264002 262614 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880700.1 protein_id gnl|my_center|LOCUS_29750 265754 264066 gene locus_tag LOCUS_29760 265754 264066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29760 265906 266610 gene locus_tag LOCUS_29770 265906 266610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 266914 266762 gene locus_tag LOCUS_29780 266914 266762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 267848 266985 gene locus_tag LOCUS_29790 267848 266985 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928954.1 protein_id gnl|my_center|LOCUS_29790 267967 268992 gene locus_tag LOCUS_29800 267967 268992 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971076.1 protein_id gnl|my_center|LOCUS_29800 269868 269131 gene locus_tag LOCUS_29810 269868 269131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 270402 269950 gene locus_tag LOCUS_29820 270402 269950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 272422 270962 gene locus_tag LOCUS_29830 gene dhaS 272422 270962 CDS product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080288.1 protein_id gnl|my_center|LOCUS_29830 273466 272588 gene locus_tag LOCUS_29840 273466 272588 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810801.1 protein_id gnl|my_center|LOCUS_29840 273685 273470 gene locus_tag LOCUS_29850 273685 273470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 274844 273687 gene locus_tag LOCUS_29860 274844 273687 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809576.1 protein_id gnl|my_center|LOCUS_29860 275460 274942 gene locus_tag LOCUS_29870 275460 274942 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002393999.1 protein_id gnl|my_center|LOCUS_29870 276077 275457 gene locus_tag LOCUS_29880 276077 275457 CDS product N-carbamoylsarcosine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258125.1 protein_id gnl|my_center|LOCUS_29880 277116 276082 gene locus_tag LOCUS_29890 277116 276082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 278980 277178 gene locus_tag LOCUS_29900 278980 277178 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258126.1 protein_id gnl|my_center|LOCUS_29900 281178 279724 gene locus_tag LOCUS_29910 281178 279724 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399325.1 protein_id gnl|my_center|LOCUS_29910 282024 281257 gene locus_tag LOCUS_29920 282024 281257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 282998 282030 gene locus_tag LOCUS_29930 282998 282030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 285979 283094 gene locus_tag LOCUS_29940 285979 283094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 286122 286898 gene locus_tag LOCUS_29950 286122 286898 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876593.1 protein_id gnl|my_center|LOCUS_29950 286902 287471 gene locus_tag LOCUS_29960 286902 287471 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870105.1 protein_id gnl|my_center|LOCUS_29960 287482 288909 gene locus_tag LOCUS_29970 287482 288909 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794945.1 protein_id gnl|my_center|LOCUS_29970 289046 290419 gene locus_tag LOCUS_29980 289046 290419 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529380.1 protein_id gnl|my_center|LOCUS_29980 291002 291475 gene locus_tag LOCUS_29990 291002 291475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 291563 292297 gene locus_tag LOCUS_30000 291563 292297 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089900.1 protein_id gnl|my_center|LOCUS_30000 292624 292866 gene locus_tag LOCUS_30010 292624 292866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 292871 294238 gene locus_tag LOCUS_30020 292871 294238 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969629.1 protein_id gnl|my_center|LOCUS_30020 294258 295253 gene locus_tag LOCUS_30030 294258 295253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 295305 296810 gene locus_tag LOCUS_30040 gene hpaE 295305 296810 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173038.1 protein_id gnl|my_center|LOCUS_30040 296945 298471 gene locus_tag LOCUS_30050 296945 298471 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391938.1 protein_id gnl|my_center|LOCUS_30050 298473 299384 gene locus_tag LOCUS_30060 298473 299384 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812971.1 protein_id gnl|my_center|LOCUS_30060 299414 300283 gene locus_tag LOCUS_30070 299414 300283 CDS product DUF1838 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055925.1 protein_id gnl|my_center|LOCUS_30070 300440 301504 gene locus_tag LOCUS_30080 300440 301504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 302451 301618 gene locus_tag LOCUS_30090 302451 301618 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933909.1 protein_id gnl|my_center|LOCUS_30090 303456 303010 gene locus_tag LOCUS_30100 gene tnpA 303456 303010 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_30100 304625 303732 gene locus_tag LOCUS_30110 gene dapA 304625 303732 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939154.1 protein_id gnl|my_center|LOCUS_30110 304791 305345 gene locus_tag LOCUS_30120 304791 305345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 306024 305368 gene locus_tag LOCUS_30130 306024 305368 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065580.1 protein_id gnl|my_center|LOCUS_30130 307184 306063 gene locus_tag LOCUS_30140 307184 306063 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027223809.1 protein_id gnl|my_center|LOCUS_30140 308084 307509 gene locus_tag LOCUS_30150 308084 307509 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108257.1 protein_id gnl|my_center|LOCUS_30150 308815 308081 gene locus_tag LOCUS_30160 gene dapB 308815 308081 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_30160 309094 311196 gene locus_tag LOCUS_30170 309094 311196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 311201 312028 gene locus_tag LOCUS_30180 311201 312028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 313015 312014 gene locus_tag LOCUS_30190 313015 312014 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701251.1 protein_id gnl|my_center|LOCUS_30190 313571 313089 gene locus_tag LOCUS_30200 313571 313089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 314783 313653 gene locus_tag LOCUS_30210 314783 313653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 316427 315021 gene locus_tag LOCUS_30220 316427 315021 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261780.1 protein_id gnl|my_center|LOCUS_30220 317231 316734 gene locus_tag LOCUS_30230 317231 316734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141199.1 protein_id gnl|my_center|LOCUS_30230 317527 317228 gene locus_tag LOCUS_30240 317527 317228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 319236 317830 gene locus_tag LOCUS_30250 319236 317830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 319722 319345 gene locus_tag LOCUS_30260 gene cdd 319722 319345 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080780.1 protein_id gnl|my_center|LOCUS_30260 320363 319740 gene locus_tag LOCUS_30270 gene udk 320363 319740 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403303.1 protein_id gnl|my_center|LOCUS_30270 321299 320454 gene locus_tag LOCUS_30280 321299 320454 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078448.1 protein_id gnl|my_center|LOCUS_30280 321965 321510 gene locus_tag LOCUS_30290 321965 321510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 322207 321998 gene locus_tag LOCUS_30300 322207 321998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30300 323428 322349 gene locus_tag LOCUS_30310 323428 322349 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583515.1 protein_id gnl|my_center|LOCUS_30310 324042 323425 gene locus_tag LOCUS_30320 324042 323425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 324264 324731 gene locus_tag LOCUS_30330 324264 324731 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_30330 324859 327456 gene locus_tag LOCUS_30340 gene clpB 324859 327456 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941319.1 protein_id gnl|my_center|LOCUS_30340 327554 328225 gene locus_tag LOCUS_30350 327554 328225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 328655 330538 gene locus_tag LOCUS_30360 328655 330538 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30360 330535 330930 gene locus_tag LOCUS_30370 330535 330930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30370 332864 332304 gene locus_tag LOCUS_30380 332864 332304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 >Feature sequence08 1027 1419 gene locus_tag LOCUS_30390 1027 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 1853 2791 gene locus_tag LOCUS_30400 1853 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30400 2788 3060 gene locus_tag LOCUS_30410 2788 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30410 3696 3547 gene locus_tag LOCUS_30420 3696 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 3886 4272 gene locus_tag LOCUS_30430 3886 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30430 5307 5726 gene locus_tag LOCUS_30440 5307 5726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 5814 6149 gene locus_tag LOCUS_30450 5814 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 6480 7574 gene locus_tag LOCUS_30460 6480 7574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30460 7838 8674 gene locus_tag LOCUS_30470 7838 8674 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272232.1 protein_id gnl|my_center|LOCUS_30470 8737 9048 gene locus_tag LOCUS_30480 8737 9048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 9252 10334 gene locus_tag LOCUS_30490 9252 10334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 10331 10588 gene locus_tag LOCUS_30500 10331 10588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 10600 11115 gene locus_tag LOCUS_30510 10600 11115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 11772 12074 gene locus_tag LOCUS_30520 11772 12074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 12053 12526 gene locus_tag LOCUS_30530 12053 12526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 12574 12840 gene locus_tag LOCUS_30540 12574 12840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 13064 12990 gene locus_tag LOCUS_t00260 13064 12990 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 13284 13210 gene locus_tag LOCUS_t00270 13284 13210 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 15304 13721 gene locus_tag LOCUS_30550 15304 13721 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_30550 16419 15322 gene locus_tag LOCUS_30560 gene nagZ 16419 15322 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813606.1 protein_id gnl|my_center|LOCUS_30560 16581 17594 gene locus_tag LOCUS_30570 16581 17594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 20281 17591 gene locus_tag LOCUS_30580 gene mutS 20281 17591 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_30580 20408 21469 gene locus_tag LOCUS_30590 20408 21469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 21488 23971 gene locus_tag LOCUS_30600 21488 23971 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006742214.1 protein_id gnl|my_center|LOCUS_30600 23968 24903 gene locus_tag LOCUS_30610 23968 24903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 25907 25257 gene locus_tag LOCUS_30620 25907 25257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30620 26224 26030 gene locus_tag LOCUS_30630 26224 26030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30630 27132 26221 gene locus_tag LOCUS_30640 27132 26221 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056480.1 protein_id gnl|my_center|LOCUS_30640 27317 28555 gene locus_tag LOCUS_30650 27317 28555 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403060.1 protein_id gnl|my_center|LOCUS_30650 28552 30057 gene locus_tag LOCUS_30660 28552 30057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 30064 30738 gene locus_tag LOCUS_30670 30064 30738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 30746 31435 gene locus_tag LOCUS_30680 30746 31435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 31432 32970 gene locus_tag LOCUS_30690 31432 32970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 33199 34665 gene locus_tag LOCUS_30700 33199 34665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 34683 35696 gene locus_tag LOCUS_30710 34683 35696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 35722 36732 gene locus_tag LOCUS_30720 35722 36732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 36729 37703 gene locus_tag LOCUS_30730 36729 37703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 37700 38716 gene locus_tag LOCUS_30740 37700 38716 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255994.1 protein_id gnl|my_center|LOCUS_30740 39840 38731 gene locus_tag LOCUS_30750 39840 38731 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331373.1 protein_id gnl|my_center|LOCUS_30750 41644 39857 gene locus_tag LOCUS_30760 gene asnB 41644 39857 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957840.1 protein_id gnl|my_center|LOCUS_30760 42025 42834 gene locus_tag LOCUS_30770 42025 42834 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597457.1 protein_id gnl|my_center|LOCUS_30770 42843 43892 gene locus_tag LOCUS_30780 42843 43892 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390551.1 protein_id gnl|my_center|LOCUS_30780 43912 45000 gene locus_tag LOCUS_30790 gene wecB 43912 45000 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390550.1 protein_id gnl|my_center|LOCUS_30790 45009 46250 gene locus_tag LOCUS_30800 45009 46250 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202923.1 protein_id gnl|my_center|LOCUS_30800 46247 47212 gene locus_tag LOCUS_30810 46247 47212 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532713.1 protein_id gnl|my_center|LOCUS_30810 47209 48252 gene locus_tag LOCUS_30820 47209 48252 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391404.1 protein_id gnl|my_center|LOCUS_30820 48434 48943 gene locus_tag LOCUS_30830 48434 48943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 49005 49838 gene locus_tag LOCUS_30840 49005 49838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 49835 50740 gene locus_tag LOCUS_30850 49835 50740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 50737 51327 gene locus_tag LOCUS_30860 50737 51327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 51345 51803 gene locus_tag LOCUS_30870 gene rimI 51345 51803 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445945.1 protein_id gnl|my_center|LOCUS_30870 51923 52153 gene locus_tag LOCUS_30880 51923 52153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 52832 52215 gene locus_tag LOCUS_30890 52832 52215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 53379 53825 gene locus_tag LOCUS_30900 53379 53825 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_30900 54706 53864 gene locus_tag LOCUS_30910 54706 53864 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_30910 56523 54694 gene locus_tag LOCUS_30920 56523 54694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30920 57233 56538 gene locus_tag LOCUS_30930 57233 56538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30930 58233 57403 gene locus_tag LOCUS_30940 58233 57403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30940 58301 59614 gene locus_tag LOCUS_30950 58301 59614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 59616 60086 gene locus_tag LOCUS_30960 59616 60086 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880135.1 protein_id gnl|my_center|LOCUS_30960 60104 60859 gene locus_tag LOCUS_30970 60104 60859 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462327.1 protein_id gnl|my_center|LOCUS_30970 60885 61700 gene locus_tag LOCUS_30980 60885 61700 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721719.1 protein_id gnl|my_center|LOCUS_30980 62531 61794 gene locus_tag LOCUS_30990 62531 61794 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_30990 63885 62839 gene locus_tag LOCUS_31000 63885 62839 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941236.1 protein_id gnl|my_center|LOCUS_31000 64338 63907 gene locus_tag LOCUS_31010 64338 63907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 65536 64811 gene locus_tag LOCUS_31020 65536 64811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 67479 65644 gene locus_tag LOCUS_31030 67479 65644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 68872 67472 gene locus_tag LOCUS_31040 68872 67472 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_31040 69217 70380 gene locus_tag LOCUS_31050 gene metK 69217 70380 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546806.1 protein_id gnl|my_center|LOCUS_31050 70572 71831 gene locus_tag LOCUS_31060 gene ahcY 70572 71831 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058222.1 protein_id gnl|my_center|LOCUS_31060 74326 72032 gene locus_tag LOCUS_31070 74326 72032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 75076 74333 gene locus_tag LOCUS_31080 75076 74333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 75250 75080 gene locus_tag LOCUS_31090 75250 75080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 75627 75247 gene locus_tag LOCUS_31100 75627 75247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 76933 75749 gene locus_tag LOCUS_31110 76933 75749 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_31110 77674 76937 gene locus_tag LOCUS_31120 77674 76937 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393651.1 protein_id gnl|my_center|LOCUS_31120 77733 78287 gene locus_tag LOCUS_31130 gene hslV 77733 78287 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392543.1 protein_id gnl|my_center|LOCUS_31130 78289 79671 gene locus_tag LOCUS_31140 gene hslU 78289 79671 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081401.1 protein_id gnl|my_center|LOCUS_31140 79688 80788 gene locus_tag LOCUS_31150 79688 80788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 80792 81559 gene locus_tag LOCUS_31160 80792 81559 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162828730.1 protein_id gnl|my_center|LOCUS_31160 81573 82223 gene locus_tag LOCUS_31170 gene fsa 81573 82223 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403055.1 protein_id gnl|my_center|LOCUS_31170 82334 82756 gene locus_tag LOCUS_31180 82334 82756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 82871 83323 gene locus_tag LOCUS_31190 82871 83323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 83327 83815 gene locus_tag LOCUS_31200 83327 83815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 83830 84558 gene locus_tag LOCUS_31210 83830 84558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31210 84801 85391 gene locus_tag LOCUS_31220 84801 85391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 85982 85467 gene locus_tag LOCUS_31230 85982 85467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 85887 86639 gene locus_tag LOCUS_31240 85887 86639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 86644 87273 gene locus_tag LOCUS_31250 gene cruD 86644 87273 CDS product hydroxychlorobactene glucoside lauroyltransferase CruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932647.1 protein_id gnl|my_center|LOCUS_31250 87558 87355 gene locus_tag LOCUS_31260 87558 87355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 87660 88349 gene locus_tag LOCUS_31270 87660 88349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 88367 89236 gene locus_tag LOCUS_31280 88367 89236 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048320.1 protein_id gnl|my_center|LOCUS_31280 89233 90267 gene locus_tag LOCUS_31290 89233 90267 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583968.1 protein_id gnl|my_center|LOCUS_31290 90276 90491 gene locus_tag LOCUS_31300 90276 90491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 90600 91523 gene locus_tag LOCUS_31310 90600 91523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 91513 92721 gene locus_tag LOCUS_31320 91513 92721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 94115 92808 gene locus_tag LOCUS_31330 94115 92808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 94582 94145 gene locus_tag LOCUS_31340 94582 94145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 96335 94731 gene locus_tag LOCUS_31350 96335 94731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 96777 97049 gene locus_tag LOCUS_31360 96777 97049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 97512 97057 gene locus_tag LOCUS_31370 97512 97057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 97984 98223 gene locus_tag LOCUS_31380 97984 98223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 99729 99280 gene locus_tag LOCUS_31390 99729 99280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 100323 100081 gene locus_tag LOCUS_31400 100323 100081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 100514 100320 gene locus_tag LOCUS_31410 100514 100320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 101454 101176 gene locus_tag LOCUS_31420 101454 101176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 102007 101468 gene locus_tag LOCUS_31430 102007 101468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 102997 102203 gene locus_tag LOCUS_31440 102997 102203 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263020.1 protein_id gnl|my_center|LOCUS_31440 103554 103261 gene locus_tag LOCUS_31450 103554 103261 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526806.1 protein_id gnl|my_center|LOCUS_31450 104519 104594 gene locus_tag LOCUS_t00280 104519 104594 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 105345 104920 gene locus_tag LOCUS_31460 105345 104920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 107086 105350 gene locus_tag LOCUS_31470 107086 105350 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_31470 107608 107114 gene locus_tag LOCUS_31480 107608 107114 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355791.1 protein_id gnl|my_center|LOCUS_31480 107762 109072 gene locus_tag LOCUS_31490 gene asnS 107762 109072 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257312.1 protein_id gnl|my_center|LOCUS_31490 109509 109988 gene locus_tag LOCUS_31500 109509 109988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 110477 109989 gene locus_tag LOCUS_31510 110477 109989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 110642 111880 gene locus_tag LOCUS_31520 110642 111880 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098062761.1 protein_id gnl|my_center|LOCUS_31520 112275 116675 gene locus_tag LOCUS_31530 112275 116675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 116647 119973 gene locus_tag LOCUS_31540 116647 119973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 120325 120603 gene locus_tag LOCUS_31550 120325 120603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 120654 121253 gene locus_tag LOCUS_31560 120654 121253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 122264 121866 gene locus_tag LOCUS_31570 122264 121866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31570 123042 122248 gene locus_tag LOCUS_31580 123042 122248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31580 124204 123320 gene locus_tag LOCUS_31590 124204 123320 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066855.1 protein_id gnl|my_center|LOCUS_31590 125958 124201 gene locus_tag LOCUS_31600 125958 124201 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871433.1 protein_id gnl|my_center|LOCUS_31600 127527 126052 gene locus_tag LOCUS_31610 127527 126052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31610 128866 127517 gene locus_tag LOCUS_31620 128866 127517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31620 129310 129044 gene locus_tag LOCUS_31630 129310 129044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31630 129891 129307 gene locus_tag LOCUS_31640 129891 129307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31640 131739 130009 gene locus_tag LOCUS_31650 131739 130009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 133071 131884 gene locus_tag LOCUS_31660 133071 131884 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459196.1 protein_id gnl|my_center|LOCUS_31660 134160 133156 gene locus_tag LOCUS_31670 134160 133156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 134319 136391 gene locus_tag LOCUS_31680 134319 136391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 136476 138158 gene locus_tag LOCUS_31690 136476 138158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 138155 138361 gene locus_tag LOCUS_31700 138155 138361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 138716 139093 gene locus_tag LOCUS_31710 138716 139093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 139090 140076 gene locus_tag LOCUS_31720 139090 140076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 140165 141145 gene locus_tag LOCUS_31730 140165 141145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 141208 141510 gene locus_tag LOCUS_31740 141208 141510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 141769 142137 gene locus_tag LOCUS_31750 141769 142137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 142220 142738 gene locus_tag LOCUS_31760 142220 142738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 143096 143473 gene locus_tag LOCUS_31770 143096 143473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 143451 143885 gene locus_tag LOCUS_31780 143451 143885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 143958 144494 gene locus_tag LOCUS_31790 143958 144494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 144527 144784 gene locus_tag LOCUS_31800 144527 144784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 145185 145691 gene locus_tag LOCUS_31810 145185 145691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 145827 146105 gene locus_tag LOCUS_31820 145827 146105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 147590 146118 gene locus_tag LOCUS_31830 gene proS 147590 146118 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107525.1 protein_id gnl|my_center|LOCUS_31830 147724 148902 gene locus_tag LOCUS_31840 147724 148902 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_31840 148911 149408 gene locus_tag LOCUS_31850 148911 149408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 149744 149388 gene locus_tag LOCUS_31860 149744 149388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 149908 150363 gene locus_tag LOCUS_31870 149908 150363 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038585.1 protein_id gnl|my_center|LOCUS_31870 151523 150357 gene locus_tag LOCUS_31880 gene aroC 151523 150357 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879991.1 protein_id gnl|my_center|LOCUS_31880 152406 151525 gene locus_tag LOCUS_31890 152406 151525 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185528.1 protein_id gnl|my_center|LOCUS_31890 152591 152403 gene locus_tag LOCUS_31900 152591 152403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 153361 152591 gene locus_tag LOCUS_31910 153361 152591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 154138 153584 gene locus_tag LOCUS_31920 gene rsmD 154138 153584 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941900.1 protein_id gnl|my_center|LOCUS_31920 154757 154188 gene locus_tag LOCUS_31930 gene rsmD 154757 154188 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871849.1 protein_id gnl|my_center|LOCUS_31930 155005 154754 gene locus_tag LOCUS_31940 155005 154754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 157640 155328 gene locus_tag LOCUS_31950 gene recG 157640 155328 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941980.1 protein_id gnl|my_center|LOCUS_31950 158387 157683 gene locus_tag LOCUS_31960 158387 157683 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 protein_id gnl|my_center|LOCUS_31960 159655 158384 gene locus_tag LOCUS_31970 gene purD 159655 158384 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_31970 159862 160248 gene locus_tag LOCUS_31980 159862 160248 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815560.1 protein_id gnl|my_center|LOCUS_31980 162252 160261 gene locus_tag LOCUS_31990 162252 160261 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225976.1 protein_id gnl|my_center|LOCUS_31990 163834 162578 gene locus_tag LOCUS_32000 163834 162578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 164093 163893 gene locus_tag LOCUS_32010 164093 163893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 165218 164190 gene locus_tag LOCUS_32020 165218 164190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 166423 165428 gene locus_tag LOCUS_32030 166423 165428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 166524 166688 gene locus_tag LOCUS_32040 166524 166688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 166690 166920 gene locus_tag LOCUS_32050 166690 166920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 167697 166912 gene locus_tag LOCUS_32060 167697 166912 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_32060 168474 167713 gene locus_tag LOCUS_32070 gene fabG 168474 167713 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_32070 168856 168629 gene locus_tag LOCUS_32080 168856 168629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 169606 169115 gene locus_tag LOCUS_32090 169606 169115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 169667 169828 gene locus_tag LOCUS_32100 169667 169828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 170173 171927 gene locus_tag LOCUS_32110 170173 171927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 172349 171924 gene locus_tag LOCUS_32120 172349 171924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 172623 173945 gene locus_tag LOCUS_32130 172623 173945 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403883.1 protein_id gnl|my_center|LOCUS_32130 173945 175159 gene locus_tag LOCUS_32140 173945 175159 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838600.1 protein_id gnl|my_center|LOCUS_32140 175163 176677 gene locus_tag LOCUS_32150 175163 176677 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257170.1 protein_id gnl|my_center|LOCUS_32150 176680 177159 gene locus_tag LOCUS_32160 176680 177159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 177594 177247 gene locus_tag LOCUS_32170 177594 177247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 178274 177789 gene locus_tag LOCUS_32180 178274 177789 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817323.1 protein_id gnl|my_center|LOCUS_32180 178688 178278 gene locus_tag LOCUS_32190 178688 178278 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704912.1 protein_id gnl|my_center|LOCUS_32190 178993 178757 gene locus_tag LOCUS_32200 178993 178757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 180450 178990 gene locus_tag LOCUS_32210 180450 178990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 181412 180558 gene locus_tag LOCUS_32220 gene cntI 181412 180558 CDS product pseudopaline transport inner membrane protein CntI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104336.1 protein_id gnl|my_center|LOCUS_32220 181617 182447 gene locus_tag LOCUS_32230 181617 182447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 182598 183149 gene locus_tag LOCUS_32240 182598 183149 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_32240 183151 183843 gene locus_tag LOCUS_32250 183151 183843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 183863 184372 gene locus_tag LOCUS_32260 183863 184372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 184492 185262 gene locus_tag LOCUS_32270 184492 185262 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941592.1 protein_id gnl|my_center|LOCUS_32270 185288 186169 gene locus_tag LOCUS_32280 185288 186169 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433117.1 protein_id gnl|my_center|LOCUS_32280 186182 187387 gene locus_tag LOCUS_32290 186182 187387 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941594.1 protein_id gnl|my_center|LOCUS_32290 188214 187441 gene locus_tag LOCUS_32300 188214 187441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 188884 188800 gene locus_tag LOCUS_t00290 188884 188800 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 189324 188917 gene locus_tag LOCUS_32310 189324 188917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 190057 189329 gene locus_tag LOCUS_32320 gene tpiA 190057 189329 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942272.1 protein_id gnl|my_center|LOCUS_32320 191879 190641 gene locus_tag LOCUS_32330 191879 190641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 192321 191974 gene locus_tag LOCUS_32340 192321 191974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 192209 192457 gene locus_tag LOCUS_32350 192209 192457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 193497 192490 gene locus_tag LOCUS_32360 gene gap 193497 192490 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161236.1 protein_id gnl|my_center|LOCUS_32360 193690 195525 gene locus_tag LOCUS_32370 193690 195525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 195669 196427 gene locus_tag LOCUS_32380 195669 196427 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239224.1 protein_id gnl|my_center|LOCUS_32380 196514 197167 gene locus_tag LOCUS_32390 196514 197167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 197178 197723 gene locus_tag LOCUS_32400 197178 197723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 197733 198641 gene locus_tag LOCUS_32410 197733 198641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 199787 198654 gene locus_tag LOCUS_32420 199787 198654 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161427.1 protein_id gnl|my_center|LOCUS_32420 200769 199807 gene locus_tag LOCUS_32430 gene rocF 200769 199807 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226959.1 protein_id gnl|my_center|LOCUS_32430 201051 200779 gene locus_tag LOCUS_32440 201051 200779 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942527.1 protein_id gnl|my_center|LOCUS_32440 201265 201044 gene locus_tag LOCUS_32450 201265 201044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32450 202392 201496 gene locus_tag LOCUS_32460 gene rapZ 202392 201496 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942529.1 protein_id gnl|my_center|LOCUS_32460 203313 202402 gene locus_tag LOCUS_32470 gene hprK 203313 202402 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942530.1 protein_id gnl|my_center|LOCUS_32470 203763 203419 gene locus_tag LOCUS_32480 203763 203419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 205378 203837 gene locus_tag LOCUS_32490 gene rpoN 205378 203837 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546561.1 protein_id gnl|my_center|LOCUS_32490 206292 205519 gene locus_tag LOCUS_32500 gene lptB 206292 205519 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721595.1 protein_id gnl|my_center|LOCUS_32500 209035 206297 gene locus_tag LOCUS_32510 209035 206297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 210749 209040 gene locus_tag LOCUS_32520 210749 209040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 211661 210765 gene locus_tag LOCUS_32530 211661 210765 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932021.1 protein_id gnl|my_center|LOCUS_32530 212521 211736 gene locus_tag LOCUS_32540 212521 211736 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535488.1 protein_id gnl|my_center|LOCUS_32540 212955 212515 gene locus_tag LOCUS_32550 212955 212515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 213109 214617 gene locus_tag LOCUS_32560 213109 214617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 216104 215616 gene locus_tag LOCUS_32570 216104 215616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 217343 216219 gene locus_tag LOCUS_32580 217343 216219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 219014 217350 gene locus_tag LOCUS_32590 219014 217350 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943734.1 protein_id gnl|my_center|LOCUS_32590 219238 219056 gene locus_tag LOCUS_32600 219238 219056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 219619 220605 gene locus_tag LOCUS_32610 219619 220605 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258073.1 protein_id gnl|my_center|LOCUS_32610 220702 221712 gene locus_tag LOCUS_32620 220702 221712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 222534 221713 gene locus_tag LOCUS_32630 gene rsmA 222534 221713 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113212.1 protein_id gnl|my_center|LOCUS_32630 222835 224829 gene locus_tag LOCUS_32640 222835 224829 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106392.1 protein_id gnl|my_center|LOCUS_32640 224851 226329 gene locus_tag LOCUS_32650 224851 226329 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920272.1 protein_id gnl|my_center|LOCUS_32650 227385 226486 gene locus_tag LOCUS_32660 gene ribD 227385 226486 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32660 228463 227426 gene locus_tag LOCUS_32670 gene ftsY 228463 227426 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941793.1 protein_id gnl|my_center|LOCUS_32670 229655 228627 gene locus_tag LOCUS_32680 229655 228627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 229690 230049 gene locus_tag LOCUS_32690 229690 230049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 230332 229943 gene locus_tag LOCUS_32700 230332 229943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 230923 230393 gene locus_tag LOCUS_32710 230923 230393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 231894 230839 gene locus_tag LOCUS_32720 231894 230839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 232967 232107 gene locus_tag LOCUS_32730 232967 232107 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711605.1 protein_id gnl|my_center|LOCUS_32730 234411 233104 gene locus_tag LOCUS_32740 234411 233104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 234682 235986 gene locus_tag LOCUS_32750 234682 235986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 235993 236721 gene locus_tag LOCUS_32760 gene ubiE 235993 236721 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228961.1 protein_id gnl|my_center|LOCUS_32760 236749 237846 gene locus_tag LOCUS_32770 236749 237846 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_32770 237851 238663 gene locus_tag LOCUS_32780 237851 238663 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868768.1 protein_id gnl|my_center|LOCUS_32780 238670 239353 gene locus_tag LOCUS_32790 gene pxpB 238670 239353 CDS product 5-oxoprolinase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234420.1 protein_id gnl|my_center|LOCUS_32790 239353 240318 gene locus_tag LOCUS_32800 gene pxpC 239353 240318 CDS product 5-oxoprolinase subunit PxpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234419.1 protein_id gnl|my_center|LOCUS_32800 240305 241054 gene locus_tag LOCUS_32810 240305 241054 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815133.1 protein_id gnl|my_center|LOCUS_32810 241506 241168 gene locus_tag LOCUS_32820 241506 241168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 242118 241576 gene locus_tag LOCUS_32830 gene bstA 242118 241576 CDS product bacillithiol transferase BstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999077.1 protein_id gnl|my_center|LOCUS_32830 245479 242093 gene locus_tag LOCUS_32840 245479 242093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 246004 245549 gene locus_tag LOCUS_32850 246004 245549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32850 246657 246127 gene locus_tag LOCUS_32860 gene rplI 246657 246127 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933786.1 protein_id gnl|my_center|LOCUS_32860 246963 246676 gene locus_tag LOCUS_32870 246963 246676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 247365 246979 gene locus_tag LOCUS_32880 247365 246979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 248076 247510 gene locus_tag LOCUS_32890 gene pth 248076 247510 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892068.1 protein_id gnl|my_center|LOCUS_32890 248510 248118 gene locus_tag LOCUS_32900 248510 248118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 248966 248625 gene locus_tag LOCUS_32910 248966 248625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32910 249600 249157 gene locus_tag LOCUS_32920 249600 249157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32920 249706 249632 gene locus_tag LOCUS_t00300 249706 249632 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 250636 249716 gene locus_tag LOCUS_32930 gene ispE 250636 249716 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356061.1 protein_id gnl|my_center|LOCUS_32930 251311 250709 gene locus_tag LOCUS_32940 251311 250709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 253557 251521 gene locus_tag LOCUS_32950 253557 251521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 254092 253616 gene locus_tag LOCUS_32960 254092 253616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 255648 254101 gene locus_tag LOCUS_32970 255648 254101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 256345 255656 gene locus_tag LOCUS_32980 gene rpe 256345 255656 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_32980 257019 256396 gene locus_tag LOCUS_32990 257019 256396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 258416 257154 gene locus_tag LOCUS_33000 gene rsmB 258416 257154 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_33000 259162 258413 gene locus_tag LOCUS_33010 259162 258413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 260085 259159 gene locus_tag LOCUS_33020 gene fmt 260085 259159 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_33020 261060 260164 gene locus_tag LOCUS_33030 261060 260164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 261725 261057 gene locus_tag LOCUS_33040 261725 261057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33040 262632 261715 gene locus_tag LOCUS_33050 262632 261715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33050 265342 262760 gene locus_tag LOCUS_33060 265342 262760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 265540 265779 gene locus_tag LOCUS_33070 265540 265779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 265770 266894 gene locus_tag LOCUS_33080 265770 266894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33080 266836 267294 gene locus_tag LOCUS_33090 266836 267294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33090 267845 267291 gene locus_tag LOCUS_33100 267845 267291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 268343 267864 gene locus_tag LOCUS_33110 268343 267864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 268972 268496 gene locus_tag LOCUS_33120 268972 268496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 269396 269034 gene locus_tag LOCUS_33130 269396 269034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 269593 270525 gene locus_tag LOCUS_33140 269593 270525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 270543 271613 gene locus_tag LOCUS_33150 gene crtC 270543 271613 CDS product hydroxyneurosporene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931993.1 protein_id gnl|my_center|LOCUS_33150 272244 271924 gene locus_tag LOCUS_33160 272244 271924 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945958.1 protein_id gnl|my_center|LOCUS_33160 273475 272309 gene locus_tag LOCUS_33170 273475 272309 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357458.1 protein_id gnl|my_center|LOCUS_33170 273648 273478 gene locus_tag LOCUS_33180 273648 273478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 274268 273579 gene locus_tag LOCUS_33190 274268 273579 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357457.1 protein_id gnl|my_center|LOCUS_33190 275048 274350 gene locus_tag LOCUS_33200 275048 274350 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530243.1 protein_id gnl|my_center|LOCUS_33200 275224 275415 gene locus_tag LOCUS_33210 275224 275415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 275888 275487 gene locus_tag LOCUS_33220 275888 275487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 276085 275816 gene locus_tag LOCUS_33230 276085 275816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 278956 276167 gene locus_tag LOCUS_33240 gene acnA 278956 276167 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187807.1 protein_id gnl|my_center|LOCUS_33240 279281 280588 gene locus_tag LOCUS_33250 279281 280588 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966601.1 protein_id gnl|my_center|LOCUS_33250 280628 282118 gene locus_tag LOCUS_33260 280628 282118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 285263 282150 gene locus_tag LOCUS_33270 285263 282150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 286233 285154 gene locus_tag LOCUS_33280 286233 285154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 286554 286327 gene locus_tag LOCUS_33290 286554 286327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 287055 286630 gene locus_tag LOCUS_33300 287055 286630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 287670 287422 gene locus_tag LOCUS_33310 287670 287422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 288106 287552 gene locus_tag LOCUS_33320 288106 287552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33320 288403 288107 gene locus_tag LOCUS_33330 288403 288107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 289597 289367 gene locus_tag LOCUS_33340 289597 289367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33340 290325 289594 gene locus_tag LOCUS_33350 290325 289594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 291588 291166 gene locus_tag LOCUS_33360 291588 291166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 291883 291509 gene locus_tag LOCUS_33370 291883 291509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 292542 292718 gene locus_tag LOCUS_33380 292542 292718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 >Feature sequence09 3425 519 gene locus_tag LOCUS_33390 3425 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 8261 3651 gene locus_tag LOCUS_33400 8261 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 10068 8599 gene locus_tag LOCUS_33410 10068 8599 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_33410 12278 10269 gene locus_tag LOCUS_33420 12278 10269 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902257.1 protein_id gnl|my_center|LOCUS_33420 12512 13072 gene locus_tag LOCUS_33430 12512 13072 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596187.1 protein_id gnl|my_center|LOCUS_33430 13688 13446 gene locus_tag LOCUS_33440 13688 13446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 13659 15440 gene locus_tag LOCUS_33450 13659 15440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 16323 15730 gene locus_tag LOCUS_33460 16323 15730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 18566 16419 gene locus_tag LOCUS_33470 18566 16419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 18807 21152 gene locus_tag LOCUS_33480 18807 21152 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389619.1 protein_id gnl|my_center|LOCUS_33480 27339 21322 gene locus_tag LOCUS_33490 27339 21322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 29874 27517 gene locus_tag LOCUS_33500 29874 27517 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_33500 30878 29958 gene locus_tag LOCUS_33510 gene xerC 30878 29958 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941160.1 protein_id gnl|my_center|LOCUS_33510 31822 31058 gene locus_tag LOCUS_33520 31822 31058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 32121 31819 gene locus_tag LOCUS_33530 32121 31819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 32629 32174 gene locus_tag LOCUS_33540 32629 32174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 33370 32639 gene locus_tag LOCUS_33550 33370 32639 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014858053.1 protein_id gnl|my_center|LOCUS_33550 35274 33952 gene locus_tag LOCUS_33560 gene trmFO 35274 33952 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943183.1 protein_id gnl|my_center|LOCUS_33560 37511 35361 gene locus_tag LOCUS_33570 37511 35361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 37669 37917 gene locus_tag LOCUS_33580 37669 37917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 37953 38462 gene locus_tag LOCUS_33590 37953 38462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 39002 40690 gene locus_tag LOCUS_33600 39002 40690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 43029 40801 gene locus_tag LOCUS_33610 43029 40801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 43233 44861 gene locus_tag LOCUS_33620 43233 44861 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_33620 44950 48549 gene locus_tag LOCUS_33630 gene nifJ 44950 48549 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705395.1 protein_id gnl|my_center|LOCUS_33630 48682 49680 gene locus_tag LOCUS_33640 48682 49680 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_33640 51363 49807 gene locus_tag LOCUS_33650 51363 49807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33650 53113 51317 gene locus_tag LOCUS_33660 53113 51317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33660 53350 53922 gene locus_tag LOCUS_33670 53350 53922 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921338.1 protein_id gnl|my_center|LOCUS_33670 53990 55192 gene locus_tag LOCUS_33680 gene pheA 53990 55192 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_33680 55333 56436 gene locus_tag LOCUS_33690 gene aroF 55333 56436 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546648.1 protein_id gnl|my_center|LOCUS_33690 58127 56685 gene locus_tag LOCUS_33700 58127 56685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 58281 58868 gene locus_tag LOCUS_33710 58281 58868 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_33710 58976 64687 gene locus_tag LOCUS_33720 58976 64687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 65611 64814 gene locus_tag LOCUS_33730 65611 64814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 66911 65679 gene locus_tag LOCUS_33740 gene preA 66911 65679 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338051.1 protein_id gnl|my_center|LOCUS_33740 67859 67122 gene locus_tag LOCUS_33750 67859 67122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 69122 68046 gene locus_tag LOCUS_33760 69122 68046 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766899.1 protein_id gnl|my_center|LOCUS_33760 70465 69119 gene locus_tag LOCUS_33770 70465 69119 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530893.1 protein_id gnl|my_center|LOCUS_33770 70884 70486 gene locus_tag LOCUS_33780 70884 70486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 71711 70911 gene locus_tag LOCUS_33790 71711 70911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 72671 71802 gene locus_tag LOCUS_33800 72671 71802 CDS product nitrilase-related carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084641929.1 protein_id gnl|my_center|LOCUS_33800 73059 72817 gene locus_tag LOCUS_33810 73059 72817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33810 74419 73403 gene locus_tag LOCUS_33820 74419 73403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 76619 74745 gene locus_tag LOCUS_33830 76619 74745 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974101.1 protein_id gnl|my_center|LOCUS_33830 78178 76721 gene locus_tag LOCUS_33840 78178 76721 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808433.1 protein_id gnl|my_center|LOCUS_33840 79725 78208 gene locus_tag LOCUS_33850 79725 78208 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228418.1 protein_id gnl|my_center|LOCUS_33850 80070 79918 gene locus_tag LOCUS_33860 80070 79918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 80014 81138 gene locus_tag LOCUS_33870 80014 81138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 81232 82761 gene locus_tag LOCUS_33880 81232 82761 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076056374.1 protein_id gnl|my_center|LOCUS_33880 83118 82777 gene locus_tag LOCUS_33890 83118 82777 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938742.1 protein_id gnl|my_center|LOCUS_33890 83346 84884 gene locus_tag LOCUS_33900 83346 84884 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803973.1 protein_id gnl|my_center|LOCUS_33900 85892 84996 gene locus_tag LOCUS_33910 85892 84996 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404185.1 protein_id gnl|my_center|LOCUS_33910 86371 86658 gene locus_tag LOCUS_33920 86371 86658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 86928 87500 gene locus_tag LOCUS_33930 86928 87500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 87982 89622 gene locus_tag LOCUS_33940 87982 89622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 90896 89964 gene locus_tag LOCUS_33950 90896 89964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 91303 90986 gene locus_tag LOCUS_33960 91303 90986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33960 91647 91300 gene locus_tag LOCUS_33970 91647 91300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33970 92247 91675 gene locus_tag LOCUS_33980 92247 91675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 94042 93269 gene locus_tag LOCUS_33990 94042 93269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 94259 94047 gene locus_tag LOCUS_34000 94259 94047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34000 95080 94223 gene locus_tag LOCUS_34010 95080 94223 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143046.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34010 95784 95218 gene locus_tag LOCUS_34020 95784 95218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 96140 95907 gene locus_tag LOCUS_34030 96140 95907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 97887 96202 gene locus_tag LOCUS_34040 97887 96202 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_34040 99420 97897 gene locus_tag LOCUS_34050 99420 97897 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275523.1 protein_id gnl|my_center|LOCUS_34050 99673 99488 gene locus_tag LOCUS_34060 99673 99488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 99896 99687 gene locus_tag LOCUS_34070 99896 99687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 102059 99900 gene locus_tag LOCUS_34080 102059 99900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 102472 102131 gene locus_tag LOCUS_34090 102472 102131 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928563.1 protein_id gnl|my_center|LOCUS_34090 102717 102469 gene locus_tag LOCUS_34100 102717 102469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 104164 102785 gene locus_tag LOCUS_34110 gene hydA 104164 102785 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030900.1 protein_id gnl|my_center|LOCUS_34110 105178 104240 gene locus_tag LOCUS_34120 105178 104240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 105643 105347 gene locus_tag LOCUS_34130 105643 105347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 106070 105780 gene locus_tag LOCUS_34140 106070 105780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 107741 106170 gene locus_tag LOCUS_34150 107741 106170 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922193.1 protein_id gnl|my_center|LOCUS_34150 110250 108028 gene locus_tag LOCUS_34160 110250 108028 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921395.1 protein_id gnl|my_center|LOCUS_34160 112816 110357 gene locus_tag LOCUS_34170 112816 110357 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_34170 115017 113362 gene locus_tag LOCUS_34180 115017 113362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 121964 115014 gene locus_tag LOCUS_34190 121964 115014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 122812 121961 gene locus_tag LOCUS_34200 122812 121961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 122872 123288 gene locus_tag LOCUS_34210 122872 123288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 123306 123584 gene locus_tag LOCUS_34220 123306 123584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 126133 124268 gene locus_tag LOCUS_34230 126133 124268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 126715 127461 gene locus_tag LOCUS_34240 126715 127461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 127458 128729 gene locus_tag LOCUS_34250 127458 128729 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919381.1 protein_id gnl|my_center|LOCUS_34250 128807 128947 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gattccagagattccaggaattc 129104 129922 gene locus_tag LOCUS_34260 gene legD1 129104 129922 CDS product Dot/Icm type IV secretion system effector LegD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948394.1 protein_id gnl|my_center|LOCUS_34260 132772 129968 gene locus_tag LOCUS_34270 132772 129968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 133752 132832 gene locus_tag LOCUS_34280 133752 132832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 134398 133772 gene locus_tag LOCUS_34290 134398 133772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 134599 134973 gene locus_tag LOCUS_34300 134599 134973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 135070 135510 gene locus_tag LOCUS_34310 135070 135510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 135559 136323 gene locus_tag LOCUS_34320 135559 136323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 136995 136777 gene locus_tag LOCUS_34330 136995 136777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 137039 137881 gene locus_tag LOCUS_34340 137039 137881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 137891 139828 gene locus_tag LOCUS_34350 137891 139828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 140628 140413 gene locus_tag LOCUS_34360 140628 140413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 140555 141547 gene locus_tag LOCUS_34370 140555 141547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 141544 142404 gene locus_tag LOCUS_34380 141544 142404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 142415 143725 gene locus_tag LOCUS_34390 142415 143725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 143739 144827 gene locus_tag LOCUS_34400 143739 144827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 146666 144891 gene locus_tag LOCUS_34410 146666 144891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 147460 146645 gene locus_tag LOCUS_34420 147460 146645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 148973 147510 gene locus_tag LOCUS_34430 148973 147510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 150096 149155 gene locus_tag LOCUS_34440 150096 149155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 152652 150145 gene locus_tag LOCUS_34450 152652 150145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 153822 152722 gene locus_tag LOCUS_34460 153822 152722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 154761 153940 gene locus_tag LOCUS_34470 154761 153940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 155360 154719 gene locus_tag LOCUS_34480 155360 154719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 156146 155379 gene locus_tag LOCUS_34490 156146 155379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 156771 156160 gene locus_tag LOCUS_34500 156771 156160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 157555 157205 gene locus_tag LOCUS_34510 157555 157205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34510 157864 157556 gene locus_tag LOCUS_34520 157864 157556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34520 159221 157866 gene locus_tag LOCUS_34530 159221 157866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34530 159906 159226 gene locus_tag LOCUS_34540 159906 159226 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064926.1 protein_id gnl|my_center|LOCUS_34540 160995 160087 gene locus_tag LOCUS_34550 160995 160087 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120072.1 protein_id gnl|my_center|LOCUS_34550 162623 161523 gene locus_tag LOCUS_34560 162623 161523 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404453.1 protein_id gnl|my_center|LOCUS_34560 162987 163571 gene locus_tag LOCUS_34570 162987 163571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 164075 163665 gene locus_tag LOCUS_34580 164075 163665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 165819 164812 gene locus_tag LOCUS_34590 165819 164812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 166516 166914 gene locus_tag LOCUS_34600 166516 166914 CDS product DUF2177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009912062.1 protein_id gnl|my_center|LOCUS_34600 166911 167714 gene locus_tag LOCUS_34610 166911 167714 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_34610 167859 167785 gene locus_tag LOCUS_t00310 167859 167785 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 168368 169213 gene locus_tag LOCUS_34620 168368 169213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34620 169210 169893 gene locus_tag LOCUS_34630 169210 169893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34630 170338 171537 gene locus_tag LOCUS_34640 170338 171537 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197309.1 protein_id gnl|my_center|LOCUS_34640 171549 171908 gene locus_tag LOCUS_34650 171549 171908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 171972 172415 gene locus_tag LOCUS_34660 171972 172415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 172412 173227 gene locus_tag LOCUS_34670 gene lpxI 172412 173227 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791912.1 protein_id gnl|my_center|LOCUS_34670 173291 174961 gene locus_tag LOCUS_34680 173291 174961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 176124 175291 gene locus_tag LOCUS_34690 gene rsmI 176124 175291 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310149.1 protein_id gnl|my_center|LOCUS_34690 177042 176473 gene locus_tag LOCUS_34700 177042 176473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 178780 177347 gene locus_tag LOCUS_34710 178780 177347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 179038 178853 gene locus_tag LOCUS_34720 179038 178853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 179931 179398 gene locus_tag LOCUS_34730 179931 179398 CDS product DUF2085 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871015.1 protein_id gnl|my_center|LOCUS_34730 180002 180283 gene locus_tag LOCUS_34740 180002 180283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 181258 180215 gene locus_tag LOCUS_34750 gene glpX 181258 180215 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545655.1 protein_id gnl|my_center|LOCUS_34750 181408 181704 gene locus_tag LOCUS_34760 181408 181704 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771072.1 protein_id gnl|my_center|LOCUS_34760 181968 183191 gene locus_tag LOCUS_34770 gene wecB 181968 183191 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393864.1 protein_id gnl|my_center|LOCUS_34770 183193 184890 gene locus_tag LOCUS_34780 183193 184890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 184942 186186 gene locus_tag LOCUS_34790 184942 186186 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763569.1 protein_id gnl|my_center|LOCUS_34790 186281 187333 gene locus_tag LOCUS_34800 186281 187333 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_34800 187438 188046 gene locus_tag LOCUS_34810 187438 188046 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259738.1 protein_id gnl|my_center|LOCUS_34810 188137 189510 gene locus_tag LOCUS_34820 188137 189510 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921284.1 protein_id gnl|my_center|LOCUS_34820 189537 190484 gene locus_tag LOCUS_34830 189537 190484 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229150.1 protein_id gnl|my_center|LOCUS_34830 190506 191429 gene locus_tag LOCUS_34840 190506 191429 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256409.1 protein_id gnl|my_center|LOCUS_34840 191450 192946 gene locus_tag LOCUS_34850 191450 192946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 192952 193821 gene locus_tag LOCUS_34860 192952 193821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 193818 195338 gene locus_tag LOCUS_34870 193818 195338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 195335 195544 gene locus_tag LOCUS_34880 195335 195544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 195589 196074 gene locus_tag LOCUS_34890 gene def 195589 196074 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869773.1 protein_id gnl|my_center|LOCUS_34890 198344 197490 gene locus_tag LOCUS_34900 198344 197490 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809159.1 protein_id gnl|my_center|LOCUS_34900 201301 198344 gene locus_tag LOCUS_34910 201301 198344 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809161.1 protein_id gnl|my_center|LOCUS_34910 201852 201352 gene locus_tag LOCUS_34920 201852 201352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 202457 202023 gene locus_tag LOCUS_34930 202457 202023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34930 202765 202418 gene locus_tag LOCUS_34940 202765 202418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34940 203258 202740 gene locus_tag LOCUS_34950 203258 202740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34950 203508 203266 gene locus_tag LOCUS_34960 203508 203266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 203804 203562 gene locus_tag LOCUS_34970 203804 203562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 203845 204180 gene locus_tag LOCUS_34980 203845 204180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 204271 206184 gene locus_tag LOCUS_34990 204271 206184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 206469 207770 gene locus_tag LOCUS_35000 206469 207770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 207771 208097 gene locus_tag LOCUS_35010 207771 208097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 208268 209785 gene locus_tag LOCUS_35020 208268 209785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 209801 209989 gene locus_tag LOCUS_35030 209801 209989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 210557 210988 gene locus_tag LOCUS_35040 210557 210988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 211502 211798 gene locus_tag LOCUS_35050 211502 211798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 211795 212043 gene locus_tag LOCUS_35060 211795 212043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 212334 212873 gene locus_tag LOCUS_35070 212334 212873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 212881 213321 gene locus_tag LOCUS_35080 212881 213321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 213636 214046 gene locus_tag LOCUS_35090 213636 214046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 214157 214456 gene locus_tag LOCUS_35100 214157 214456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 214652 215440 gene locus_tag LOCUS_35110 214652 215440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 215337 216023 gene locus_tag LOCUS_35120 215337 216023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 216025 216594 gene locus_tag LOCUS_35130 216025 216594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 216657 216929 gene locus_tag LOCUS_35140 216657 216929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 216933 217151 gene locus_tag LOCUS_35150 216933 217151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 218093 217638 gene locus_tag LOCUS_35160 gene tnpA 218093 217638 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_35160 218390 219316 gene locus_tag LOCUS_35170 218390 219316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 219322 219633 gene locus_tag LOCUS_35180 219322 219633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 219897 220880 gene locus_tag LOCUS_35190 219897 220880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 220909 221316 gene locus_tag LOCUS_35200 220909 221316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 221446 222624 gene locus_tag LOCUS_35210 221446 222624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 222682 223128 gene locus_tag LOCUS_35220 222682 223128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 223242 224978 gene locus_tag LOCUS_35230 223242 224978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 224975 225193 gene locus_tag LOCUS_35240 224975 225193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 225222 225419 gene locus_tag LOCUS_35250 225222 225419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 225477 226013 gene locus_tag LOCUS_35260 225477 226013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 226052 226813 gene locus_tag LOCUS_35270 226052 226813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 227078 227452 gene locus_tag LOCUS_35280 227078 227452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 227465 227824 gene locus_tag LOCUS_35290 227465 227824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 227967 229349 gene locus_tag LOCUS_35300 227967 229349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 229370 229711 gene locus_tag LOCUS_35310 229370 229711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 229836 230213 gene locus_tag LOCUS_35320 229836 230213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 230575 231039 gene locus_tag LOCUS_35330 230575 231039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 231956 232177 gene locus_tag LOCUS_35340 231956 232177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 232419 233660 gene locus_tag LOCUS_35350 232419 233660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 233846 234253 gene locus_tag LOCUS_35360 233846 234253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 234675 235112 gene locus_tag LOCUS_35370 234675 235112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 235677 236000 gene locus_tag LOCUS_35380 235677 236000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 236446 237990 gene locus_tag LOCUS_35390 236446 237990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 238308 238697 gene locus_tag LOCUS_35400 238308 238697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 238984 238775 gene locus_tag LOCUS_35410 238984 238775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 240101 240802 gene locus_tag LOCUS_35420 240101 240802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 240978 240817 gene locus_tag LOCUS_35430 240978 240817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 240923 241135 gene locus_tag LOCUS_35440 240923 241135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 242723 242481 gene locus_tag LOCUS_35450 242723 242481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 243086 242727 gene locus_tag LOCUS_35460 243086 242727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 >Feature sequence10 3147 1891 gene locus_tag LOCUS_35470 3147 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 4825 3860 gene locus_tag LOCUS_35480 4825 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 5417 4845 gene locus_tag LOCUS_35490 5417 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 5799 5422 gene locus_tag LOCUS_35500 5799 5422 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122309.1 protein_id gnl|my_center|LOCUS_35500 6377 5811 gene locus_tag LOCUS_35510 6377 5811 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_35510 7349 6567 gene locus_tag LOCUS_35520 7349 6567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 7254 7493 gene locus_tag LOCUS_35530 7254 7493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 7895 7548 gene locus_tag LOCUS_35540 7895 7548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 8652 8011 gene locus_tag LOCUS_35550 8652 8011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 11107 8657 gene locus_tag LOCUS_35560 11107 8657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 11986 11363 gene locus_tag LOCUS_35570 11986 11363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35570 13045 12002 gene locus_tag LOCUS_35580 13045 12002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35580 13249 13064 gene locus_tag LOCUS_35590 13249 13064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 14186 13215 gene locus_tag LOCUS_35600 14186 13215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35600 14641 15072 gene locus_tag LOCUS_35610 14641 15072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 15069 15575 gene locus_tag LOCUS_35620 15069 15575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 15589 16668 gene locus_tag LOCUS_35630 15589 16668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 17637 17077 gene locus_tag LOCUS_35640 17637 17077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 18345 18184 gene locus_tag LOCUS_35650 18345 18184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 19445 18717 gene locus_tag LOCUS_35660 19445 18717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 20005 19442 gene locus_tag LOCUS_35670 20005 19442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 20571 20254 gene locus_tag LOCUS_35680 gene pduA 20571 20254 CDS product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183614.1 protein_id gnl|my_center|LOCUS_35680 21060 20608 gene locus_tag LOCUS_35690 21060 20608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 21554 21078 gene locus_tag LOCUS_35700 21554 21078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 23228 21579 gene locus_tag LOCUS_35710 23228 21579 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868830.1 protein_id gnl|my_center|LOCUS_35710 23524 23300 gene locus_tag LOCUS_35720 23524 23300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 23765 24595 gene locus_tag LOCUS_35730 23765 24595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 24735 26210 gene locus_tag LOCUS_35740 gene guaB 24735 26210 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942835.1 protein_id gnl|my_center|LOCUS_35740 28635 26683 gene locus_tag LOCUS_35750 28635 26683 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256937.1 protein_id gnl|my_center|LOCUS_35750 30023 28809 gene locus_tag LOCUS_35760 30023 28809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 30171 30365 gene locus_tag LOCUS_35770 gene rpmB 30171 30365 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938507.1 protein_id gnl|my_center|LOCUS_35770 30830 30453 gene locus_tag LOCUS_35780 30830 30453 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964577.1 protein_id gnl|my_center|LOCUS_35780 33234 30976 gene locus_tag LOCUS_35790 33234 30976 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_35790 34167 33286 gene locus_tag LOCUS_35800 34167 33286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 34703 34233 gene locus_tag LOCUS_35810 gene tolR 34703 34233 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_35810 35178 34738 gene locus_tag LOCUS_35820 gene tolR 35178 34738 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_35820 35935 35207 gene locus_tag LOCUS_35830 35935 35207 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206768.1 protein_id gnl|my_center|LOCUS_35830 36844 36029 gene locus_tag LOCUS_35840 36844 36029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 38344 37283 gene locus_tag LOCUS_35850 gene secF 38344 37283 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085009790.1 protein_id gnl|my_center|LOCUS_35850 40093 38363 gene locus_tag LOCUS_35860 40093 38363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35860 40419 40108 gene locus_tag LOCUS_35870 40419 40108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 41717 40545 gene locus_tag LOCUS_35880 gene tgt 41717 40545 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_35880 43197 41719 gene locus_tag LOCUS_35890 43197 41719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 44625 43273 gene locus_tag LOCUS_35900 gene der 44625 43273 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727996.1 protein_id gnl|my_center|LOCUS_35900 45049 44801 gene locus_tag LOCUS_35910 45049 44801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 44931 46847 gene locus_tag LOCUS_35920 44931 46847 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203179.1 protein_id gnl|my_center|LOCUS_35920 47564 46878 gene locus_tag LOCUS_35930 47564 46878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 47687 48568 gene locus_tag LOCUS_35940 47687 48568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 49107 48598 gene locus_tag LOCUS_35950 49107 48598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 49013 49279 gene locus_tag LOCUS_35960 49013 49279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 49453 50418 gene locus_tag LOCUS_35970 49453 50418 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_35970 53441 50709 gene locus_tag LOCUS_35980 53441 50709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 54092 53523 gene locus_tag LOCUS_35990 54092 53523 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922477.1 protein_id gnl|my_center|LOCUS_35990 54273 57215 gene locus_tag LOCUS_36000 54273 57215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 63679 57362 gene locus_tag LOCUS_36010 63679 57362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 65233 63881 gene locus_tag LOCUS_36020 65233 63881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255956.1 protein_id gnl|my_center|LOCUS_36020 65596 66375 gene locus_tag LOCUS_36030 gene pspA 65596 66375 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950768.1 protein_id gnl|my_center|LOCUS_36030 66372 67082 gene locus_tag LOCUS_36040 66372 67082 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144138.1 protein_id gnl|my_center|LOCUS_36040 67099 67947 gene locus_tag LOCUS_36050 67099 67947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 68217 69176 gene locus_tag LOCUS_36060 68217 69176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255955.1 protein_id gnl|my_center|LOCUS_36060 69714 69262 gene locus_tag LOCUS_36070 69714 69262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 71078 69711 gene locus_tag LOCUS_36080 71078 69711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 72507 71323 gene locus_tag LOCUS_36090 gene egtB 72507 71323 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921716.1 protein_id gnl|my_center|LOCUS_36090 72591 73394 gene locus_tag LOCUS_36100 72591 73394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 73396 74934 gene locus_tag LOCUS_36110 73396 74934 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986277.1 protein_id gnl|my_center|LOCUS_36110 75913 74915 gene locus_tag LOCUS_36120 gene egtD 75913 74915 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967207.1 protein_id gnl|my_center|LOCUS_36120 76879 76040 gene locus_tag LOCUS_36130 76879 76040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 77268 77966 gene locus_tag LOCUS_36140 77268 77966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 78565 79167 gene locus_tag LOCUS_36150 78565 79167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 79660 79472 gene locus_tag LOCUS_36160 79660 79472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 80617 80294 gene locus_tag LOCUS_36170 80617 80294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36170 81620 80868 gene locus_tag LOCUS_36180 81620 80868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 82253 81684 gene locus_tag LOCUS_36190 82253 81684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 82748 82272 gene locus_tag LOCUS_36200 82748 82272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 83326 83177 gene locus_tag LOCUS_36210 83326 83177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 84224 83802 gene locus_tag LOCUS_36220 84224 83802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36220 85673 86083 gene locus_tag LOCUS_36230 85673 86083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 86137 86547 gene locus_tag LOCUS_36240 86137 86547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 86793 86869 gene locus_tag LOCUS_t00320 86793 86869 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 87457 87215 gene locus_tag LOCUS_36250 87457 87215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 87983 88849 gene locus_tag LOCUS_36260 87983 88849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 88992 89666 gene locus_tag LOCUS_36270 88992 89666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 89977 89849 gene locus_tag LOCUS_36280 89977 89849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 90308 90129 gene locus_tag LOCUS_36290 90308 90129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 90746 90315 gene locus_tag LOCUS_36300 90746 90315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 91289 90840 gene locus_tag LOCUS_36310 91289 90840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 91509 91330 gene locus_tag LOCUS_36320 91509 91330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 91950 91564 gene locus_tag LOCUS_36330 91950 91564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 95960 92979 gene locus_tag LOCUS_36340 95960 92979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 97891 96200 gene locus_tag LOCUS_36350 97891 96200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 98986 97913 gene locus_tag LOCUS_36360 98986 97913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 99079 99342 gene locus_tag LOCUS_36370 99079 99342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 100438 99668 gene locus_tag LOCUS_36380 100438 99668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 101829 100438 gene locus_tag LOCUS_36390 gene xseA 101829 100438 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705853.1 protein_id gnl|my_center|LOCUS_36390 103531 101831 gene locus_tag LOCUS_36400 103531 101831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 105804 103531 gene locus_tag LOCUS_36410 105804 103531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 107254 106265 gene locus_tag LOCUS_36420 107254 106265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 108131 107286 gene locus_tag LOCUS_36430 108131 107286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 108714 108133 gene locus_tag LOCUS_36440 108714 108133 CDS product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392473.1 protein_id gnl|my_center|LOCUS_36440 109293 108781 gene locus_tag LOCUS_36450 109293 108781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 109736 110419 gene locus_tag LOCUS_36460 109736 110419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 111326 110328 gene locus_tag LOCUS_36470 111326 110328 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_36470 111472 111657 gene locus_tag LOCUS_36480 111472 111657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 111663 112028 gene locus_tag LOCUS_36490 111663 112028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 112127 112201 gene locus_tag LOCUS_t00330 112127 112201 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 112880 112356 gene locus_tag LOCUS_36500 112880 112356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 113345 113133 gene locus_tag LOCUS_36510 113345 113133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 113679 113422 gene locus_tag LOCUS_36520 113679 113422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 115197 113857 gene locus_tag LOCUS_36530 115197 113857 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213326.1 protein_id gnl|my_center|LOCUS_36530 115259 115993 gene locus_tag LOCUS_36540 115259 115993 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258856.1 protein_id gnl|my_center|LOCUS_36540 116416 117846 gene locus_tag LOCUS_36550 gene aroE 116416 117846 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327789.1 protein_id gnl|my_center|LOCUS_36550 117847 118551 gene locus_tag LOCUS_36560 117847 118551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 118560 119579 gene locus_tag LOCUS_36570 118560 119579 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158098.1 protein_id gnl|my_center|LOCUS_36570 119767 121068 gene locus_tag LOCUS_36580 119767 121068 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038851.1 protein_id gnl|my_center|LOCUS_36580 121163 123289 gene locus_tag LOCUS_36590 121163 123289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 123342 124178 gene locus_tag LOCUS_36600 123342 124178 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103932.1 protein_id gnl|my_center|LOCUS_36600 124661 124191 gene locus_tag LOCUS_36610 124661 124191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 125445 124918 gene locus_tag LOCUS_36620 125445 124918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36620 125762 125376 gene locus_tag LOCUS_36630 125762 125376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 126715 125759 gene locus_tag LOCUS_36640 126715 125759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 127071 127781 gene locus_tag LOCUS_36650 127071 127781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 127869 128141 gene locus_tag LOCUS_36660 127869 128141 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234978.1 protein_id gnl|my_center|LOCUS_36660 128870 128160 gene locus_tag LOCUS_36670 128870 128160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 129394 128867 gene locus_tag LOCUS_36680 129394 128867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 129952 130398 gene locus_tag LOCUS_36690 129952 130398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 132146 130509 gene locus_tag LOCUS_36700 132146 130509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 132428 133552 gene locus_tag LOCUS_36710 132428 133552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 133895 133593 gene locus_tag LOCUS_36720 133895 133593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 134479 134162 gene locus_tag LOCUS_36730 134479 134162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 134552 135199 gene locus_tag LOCUS_36740 134552 135199 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545137.1 protein_id gnl|my_center|LOCUS_36740 135298 136887 gene locus_tag LOCUS_36750 135298 136887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 137369 136968 gene locus_tag LOCUS_36760 137369 136968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 139698 137479 gene locus_tag LOCUS_36770 139698 137479 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197954.1 protein_id gnl|my_center|LOCUS_36770 139943 141853 gene locus_tag LOCUS_36780 139943 141853 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062080.1 protein_id gnl|my_center|LOCUS_36780 142182 143261 gene locus_tag LOCUS_36790 142182 143261 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839725.1 protein_id gnl|my_center|LOCUS_36790 143343 144047 gene locus_tag LOCUS_36800 143343 144047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 144635 145273 gene locus_tag LOCUS_36810 144635 145273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 145292 145540 gene locus_tag LOCUS_36820 145292 145540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 146656 146916 gene locus_tag LOCUS_36830 146656 146916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 146898 147107 gene locus_tag LOCUS_36840 146898 147107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 147819 148049 gene locus_tag LOCUS_36850 147819 148049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 149470 148472 gene locus_tag LOCUS_36860 149470 148472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 151377 149860 gene locus_tag LOCUS_36870 151377 149860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 153525 151390 gene locus_tag LOCUS_36880 153525 151390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 154725 153568 gene locus_tag LOCUS_36890 154725 153568 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235191056.1 protein_id gnl|my_center|LOCUS_36890 155503 154826 gene locus_tag LOCUS_36900 155503 154826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 156228 155515 gene locus_tag LOCUS_36910 156228 155515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 157316 156231 gene locus_tag LOCUS_36920 157316 156231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 157459 158211 gene locus_tag LOCUS_36930 157459 158211 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109255.1 protein_id gnl|my_center|LOCUS_36930 159409 158333 gene locus_tag LOCUS_36940 159409 158333 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529688.1 protein_id gnl|my_center|LOCUS_36940 160232 159411 gene locus_tag LOCUS_36950 gene cysT 160232 159411 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036155.1 protein_id gnl|my_center|LOCUS_36950 161252 160242 gene locus_tag LOCUS_36960 161252 160242 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056129.1 protein_id gnl|my_center|LOCUS_36960 161936 161265 gene locus_tag LOCUS_36970 161936 161265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 162138 161875 gene locus_tag LOCUS_36980 162138 161875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 163239 162457 gene locus_tag LOCUS_36990 gene ddaH 163239 162457 CDS product N(G),N(G)-dimethylarginine dimethylaminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972278.1 protein_id gnl|my_center|LOCUS_36990 163553 163392 gene locus_tag LOCUS_37000 163553 163392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 165342 164092 gene locus_tag LOCUS_37010 165342 164092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 166643 165336 gene locus_tag LOCUS_37020 166643 165336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 167784 166879 gene locus_tag LOCUS_37030 167784 166879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 170450 168252 gene locus_tag LOCUS_37040 170450 168252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 172881 170773 gene locus_tag LOCUS_37050 172881 170773 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_37050 173367 173110 gene locus_tag LOCUS_37060 173367 173110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 175897 173753 gene locus_tag LOCUS_37070 175897 173753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 178607 176382 gene locus_tag LOCUS_37080 178607 176382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 181200 179074 gene locus_tag LOCUS_37090 181200 179074 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140133.1 protein_id gnl|my_center|LOCUS_37090 182550 181411 gene locus_tag LOCUS_37100 gene citZ 182550 181411 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398810.1 protein_id gnl|my_center|LOCUS_37100 183881 182847 gene locus_tag LOCUS_37110 183881 182847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 187187 184647 gene locus_tag LOCUS_37120 187187 184647 CDS product DUF5916 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925729.1 protein_id gnl|my_center|LOCUS_37120 190516 187979 gene locus_tag LOCUS_37130 190516 187979 CDS product DUF5916 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925729.1 protein_id gnl|my_center|LOCUS_37130 192476 190635 gene locus_tag LOCUS_37140 192476 190635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 192824 194059 gene locus_tag LOCUS_37150 192824 194059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 194073 195359 gene locus_tag LOCUS_37160 194073 195359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 195352 196170 gene locus_tag LOCUS_37170 195352 196170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 196203 196808 gene locus_tag LOCUS_37180 196203 196808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 196814 198169 gene locus_tag LOCUS_37190 196814 198169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 198286 199386 gene locus_tag LOCUS_37200 198286 199386 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817388.1 protein_id gnl|my_center|LOCUS_37200 199590 200819 gene locus_tag LOCUS_37210 199590 200819 CDS product DUF3419 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972070.1 protein_id gnl|my_center|LOCUS_37210 200820 201500 gene locus_tag LOCUS_37220 200820 201500 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530940.1 protein_id gnl|my_center|LOCUS_37220 202567 201731 gene locus_tag LOCUS_37230 202567 201731 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113465.1 protein_id gnl|my_center|LOCUS_37230 203940 202564 gene locus_tag LOCUS_37240 203940 202564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 207533 203994 gene locus_tag LOCUS_37250 gene mfd 207533 203994 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097100.1 protein_id gnl|my_center|LOCUS_37250 208134 207721 gene locus_tag LOCUS_37260 208134 207721 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719468.1 protein_id gnl|my_center|LOCUS_37260 208290 209933 gene locus_tag LOCUS_37270 gene lysS 208290 209933 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003075.1 protein_id gnl|my_center|LOCUS_37270 210596 210027 gene locus_tag LOCUS_37280 210596 210027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 210871 211941 gene locus_tag LOCUS_37290 210871 211941 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048382.1 protein_id gnl|my_center|LOCUS_37290 211954 212334 gene locus_tag LOCUS_37300 211954 212334 CDS product DUF2203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222744.1 protein_id gnl|my_center|LOCUS_37300 212880 214184 gene locus_tag LOCUS_37310 212880 214184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 214306 215448 gene locus_tag LOCUS_37320 214306 215448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 216654 215914 gene locus_tag LOCUS_37330 216654 215914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 217382 216945 gene locus_tag LOCUS_37340 217382 216945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 218324 217410 gene locus_tag LOCUS_37350 218324 217410 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258073.1 protein_id gnl|my_center|LOCUS_37350 219182 220588 gene locus_tag LOCUS_37360 219182 220588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 220601 221020 gene locus_tag LOCUS_37370 220601 221020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 221649 221035 gene locus_tag LOCUS_37380 221649 221035 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039104.1 protein_id gnl|my_center|LOCUS_37380 222480 221959 gene locus_tag LOCUS_37390 222480 221959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 223186 223770 gene locus_tag LOCUS_37400 223186 223770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 223838 224320 gene locus_tag LOCUS_37410 223838 224320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 225279 226967 gene locus_tag LOCUS_37420 225279 226967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 226988 229132 gene locus_tag LOCUS_37430 226988 229132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 229309 232113 gene locus_tag LOCUS_37440 229309 232113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 233412 234176 gene locus_tag LOCUS_37450 233412 234176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 234774 235271 gene locus_tag LOCUS_37460 234774 235271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 235511 235966 gene locus_tag LOCUS_37470 235511 235966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 236104 236634 gene locus_tag LOCUS_37480 236104 236634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240467.1 protein_id gnl|my_center|LOCUS_37480 236918 236763 gene locus_tag LOCUS_37490 236918 236763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 236860 237420 gene locus_tag LOCUS_37500 236860 237420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 238263 238093 gene locus_tag LOCUS_37510 238263 238093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 239285 239070 gene locus_tag LOCUS_37520 239285 239070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 >Feature sequence11 354 5000 gene locus_tag LOCUS_37530 354 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 5667 6026 gene locus_tag LOCUS_37540 5667 6026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 6138 6518 gene locus_tag LOCUS_37550 6138 6518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 7315 7641 gene locus_tag LOCUS_37560 7315 7641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 7638 7820 gene locus_tag LOCUS_37570 7638 7820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 7835 8743 gene locus_tag LOCUS_37580 7835 8743 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962522.1 protein_id gnl|my_center|LOCUS_37580 8786 9952 gene locus_tag LOCUS_37590 8786 9952 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_37590 10669 9956 gene locus_tag LOCUS_37600 10669 9956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 11704 10781 gene locus_tag LOCUS_37610 11704 10781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 12215 11754 gene locus_tag LOCUS_37620 12215 11754 CDS product DUF1203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969354.1 protein_id gnl|my_center|LOCUS_37620 13231 12212 gene locus_tag LOCUS_37630 gene ada 13231 12212 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190110.1 protein_id gnl|my_center|LOCUS_37630 13505 13317 gene locus_tag LOCUS_37640 13505 13317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 13487 15070 gene locus_tag LOCUS_37650 13487 15070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37650 17662 15080 gene locus_tag LOCUS_37660 17662 15080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 18955 18041 gene locus_tag LOCUS_37670 18955 18041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37670 19577 18882 gene locus_tag LOCUS_37680 19577 18882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37680 22286 19653 gene locus_tag LOCUS_37690 22286 19653 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383264.1 protein_id gnl|my_center|LOCUS_37690 24004 22283 gene locus_tag LOCUS_37700 24004 22283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 27148 24218 gene locus_tag LOCUS_37710 27148 24218 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039200.1 protein_id gnl|my_center|LOCUS_37710 29253 27298 gene locus_tag LOCUS_37720 gene mutL 29253 27298 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257019.1 protein_id gnl|my_center|LOCUS_37720 31060 29378 gene locus_tag LOCUS_37730 gene bshC 31060 29378 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231847126.1 protein_id gnl|my_center|LOCUS_37730 33895 31763 gene locus_tag LOCUS_37740 33895 31763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 36636 34216 gene locus_tag LOCUS_37750 36636 34216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 37462 37271 gene locus_tag LOCUS_37760 37462 37271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 38422 37583 gene locus_tag LOCUS_37770 gene larE 38422 37583 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461498.1 protein_id gnl|my_center|LOCUS_37770 38598 39980 gene locus_tag LOCUS_37780 38598 39980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 40001 40576 gene locus_tag LOCUS_37790 40001 40576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 40573 41118 gene locus_tag LOCUS_37800 40573 41118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 41267 42373 gene locus_tag LOCUS_37810 gene gcvT 41267 42373 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_37810 42456 42845 gene locus_tag LOCUS_37820 gene gcvH 42456 42845 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393442.1 protein_id gnl|my_center|LOCUS_37820 42994 44343 gene locus_tag LOCUS_37830 gene gcvPA 42994 44343 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460675.1 protein_id gnl|my_center|LOCUS_37830 44484 45029 gene locus_tag LOCUS_37840 44484 45029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 45059 46375 gene locus_tag LOCUS_37850 45059 46375 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965326.1 protein_id gnl|my_center|LOCUS_37850 46559 48082 gene locus_tag LOCUS_37860 gene gcvPB 46559 48082 CDS product aminomethyl-transferring glycine dehydrogenase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795703.1 protein_id gnl|my_center|LOCUS_37860 48227 48667 gene locus_tag LOCUS_37870 48227 48667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 49074 48724 gene locus_tag LOCUS_37880 49074 48724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 49998 49318 gene locus_tag LOCUS_37890 49998 49318 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 protein_id gnl|my_center|LOCUS_37890 51879 50065 gene locus_tag LOCUS_37900 51879 50065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 52063 53148 gene locus_tag LOCUS_37910 52063 53148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 55392 53221 gene locus_tag LOCUS_37920 gene recQ 55392 53221 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941564.1 protein_id gnl|my_center|LOCUS_37920 56471 55491 gene locus_tag LOCUS_37930 56471 55491 CDS product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831121.1 protein_id gnl|my_center|LOCUS_37930 57015 56734 gene locus_tag LOCUS_37940 57015 56734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 57678 57028 gene locus_tag LOCUS_37950 57678 57028 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008274486.1 protein_id gnl|my_center|LOCUS_37950 58568 57690 gene locus_tag LOCUS_37960 58568 57690 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_37960 59180 58569 gene locus_tag LOCUS_37970 59180 58569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 59231 60316 gene locus_tag LOCUS_37980 59231 60316 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928792.1 protein_id gnl|my_center|LOCUS_37980 60580 60906 gene locus_tag LOCUS_37990 gene erpA 60580 60906 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881213.1 protein_id gnl|my_center|LOCUS_37990 61391 62050 gene locus_tag LOCUS_38000 61391 62050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 62369 62160 gene locus_tag LOCUS_38010 62369 62160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 62690 64072 gene locus_tag LOCUS_38020 62690 64072 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480084.1 protein_id gnl|my_center|LOCUS_38020 64523 66460 gene locus_tag LOCUS_38030 64523 66460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 67981 66539 gene locus_tag LOCUS_38040 gene accC 67981 66539 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761157.1 protein_id gnl|my_center|LOCUS_38040 68380 68090 gene locus_tag LOCUS_38050 68380 68090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 68807 68382 gene locus_tag LOCUS_38060 68807 68382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 69449 68814 gene locus_tag LOCUS_38070 69449 68814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 70038 69574 gene locus_tag LOCUS_38080 gene greA 70038 69574 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071421.1 protein_id gnl|my_center|LOCUS_38080 71419 70334 gene locus_tag LOCUS_38090 71419 70334 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256167.1 protein_id gnl|my_center|LOCUS_38090 71561 72799 gene locus_tag LOCUS_38100 gene chrA 71561 72799 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206681.1 protein_id gnl|my_center|LOCUS_38100 72810 73967 gene locus_tag LOCUS_38110 72810 73967 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_38110 75904 74285 gene locus_tag LOCUS_38120 75904 74285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 76097 76834 gene locus_tag LOCUS_38130 76097 76834 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_38130 76940 77689 gene locus_tag LOCUS_38140 76940 77689 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942449.1 protein_id gnl|my_center|LOCUS_38140 78151 77696 gene locus_tag LOCUS_38150 78151 77696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 78305 78093 gene locus_tag LOCUS_38160 78305 78093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 78759 80330 gene locus_tag LOCUS_38170 gene nrfD 78759 80330 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259049.1 protein_id gnl|my_center|LOCUS_38170 80811 80948 gene locus_tag LOCUS_38180 80811 80948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 81090 84080 gene locus_tag LOCUS_38190 81090 84080 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_38190 84834 85073 gene locus_tag LOCUS_38200 84834 85073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 85924 86280 gene locus_tag LOCUS_38210 85924 86280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 88164 88634 gene locus_tag LOCUS_38220 88164 88634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 88631 89020 gene locus_tag LOCUS_38230 88631 89020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 89805 89347 gene locus_tag LOCUS_38240 89805 89347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 90265 89780 gene locus_tag LOCUS_38250 90265 89780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 90650 90258 gene locus_tag LOCUS_38260 90650 90258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 91708 92214 gene locus_tag LOCUS_38270 91708 92214 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263336.1 protein_id gnl|my_center|LOCUS_38270 92874 92290 gene locus_tag LOCUS_38280 92874 92290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 93296 97198 gene locus_tag LOCUS_38290 93296 97198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 97347 98063 gene locus_tag LOCUS_38300 97347 98063 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948365.1 protein_id gnl|my_center|LOCUS_38300 101530 98222 gene locus_tag LOCUS_38310 101530 98222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 104563 101738 gene locus_tag LOCUS_38320 gene uvrA 104563 101738 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943938.1 protein_id gnl|my_center|LOCUS_38320 104676 104843 gene locus_tag LOCUS_38330 104676 104843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 105945 105262 gene locus_tag LOCUS_38340 105945 105262 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941866.1 protein_id gnl|my_center|LOCUS_38340 106882 105890 gene locus_tag LOCUS_38350 106882 105890 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250141.1 protein_id gnl|my_center|LOCUS_38350 107664 106918 gene locus_tag LOCUS_38360 gene gpmA 107664 106918 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932091.1 protein_id gnl|my_center|LOCUS_38360 109082 107802 gene locus_tag LOCUS_38370 109082 107802 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_38370 110503 109589 gene locus_tag LOCUS_38380 gene accD 110503 109589 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943005.1 protein_id gnl|my_center|LOCUS_38380 110657 110884 gene locus_tag LOCUS_38390 110657 110884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 110941 112542 gene locus_tag LOCUS_38400 110941 112542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 113875 113114 gene locus_tag LOCUS_38410 113875 113114 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141322.1 protein_id gnl|my_center|LOCUS_38410 114417 113962 gene locus_tag LOCUS_38420 114417 113962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 115383 114475 gene locus_tag LOCUS_38430 115383 114475 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760470.1 protein_id gnl|my_center|LOCUS_38430 115689 115402 gene locus_tag LOCUS_38440 115689 115402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 116701 115793 gene locus_tag LOCUS_38450 116701 115793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 117167 116733 gene locus_tag LOCUS_38460 117167 116733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 117643 117164 gene locus_tag LOCUS_38470 117643 117164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 117677 118144 gene locus_tag LOCUS_38480 gene tadA 117677 118144 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771930.1 protein_id gnl|my_center|LOCUS_38480 118207 118296 gene locus_tag LOCUS_t00340 118207 118296 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 118437 118526 gene locus_tag LOCUS_t00350 118437 118526 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 118868 118939 gene locus_tag LOCUS_t00360 118868 118939 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 118956 119810 gene locus_tag LOCUS_38490 118956 119810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 120548 119988 gene locus_tag LOCUS_38500 120548 119988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 120733 120545 gene locus_tag LOCUS_38510 120733 120545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 121483 122925 gene locus_tag LOCUS_38520 121483 122925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38520 122999 123205 gene locus_tag LOCUS_38530 122999 123205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140805.1 protein_id gnl|my_center|LOCUS_38530 123370 123990 gene locus_tag LOCUS_38540 123370 123990 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545974.1 protein_id gnl|my_center|LOCUS_38540 124042 124917 gene locus_tag LOCUS_38550 gene pssA 124042 124917 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957377.1 protein_id gnl|my_center|LOCUS_38550 126464 125085 gene locus_tag LOCUS_38560 126464 125085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 127835 126600 gene locus_tag LOCUS_38570 127835 126600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 129039 127924 gene locus_tag LOCUS_38580 129039 127924 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870391.1 protein_id gnl|my_center|LOCUS_38580 129112 130485 gene locus_tag LOCUS_38590 129112 130485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 130529 131011 gene locus_tag LOCUS_38600 130529 131011 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199373.1 protein_id gnl|my_center|LOCUS_38600 132092 131418 gene locus_tag LOCUS_38610 132092 131418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38610 132488 132093 gene locus_tag LOCUS_38620 132488 132093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38620 133290 132538 gene locus_tag LOCUS_38630 133290 132538 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070665.1 protein_id gnl|my_center|LOCUS_38630 133564 133301 gene locus_tag LOCUS_38640 133564 133301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 134910 133810 gene locus_tag LOCUS_38650 gene hypD 134910 133810 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_38650 135315 135034 gene locus_tag LOCUS_38660 135315 135034 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258619.1 protein_id gnl|my_center|LOCUS_38660 136984 135410 gene locus_tag LOCUS_38670 136984 135410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38670 138501 137824 gene locus_tag LOCUS_38680 gene hypB 138501 137824 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258628.1 protein_id gnl|my_center|LOCUS_38680 138841 138479 gene locus_tag LOCUS_38690 gene hypA 138841 138479 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258629.1 protein_id gnl|my_center|LOCUS_38690 139578 139213 gene locus_tag LOCUS_38700 139578 139213 CDS product iron chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921246.1 protein_id gnl|my_center|LOCUS_38700 140221 140637 gene locus_tag LOCUS_38710 140221 140637 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406877.1 protein_id gnl|my_center|LOCUS_38710 140757 141275 gene locus_tag LOCUS_38720 140757 141275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 141286 141525 gene locus_tag LOCUS_38730 141286 141525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 141522 141743 gene locus_tag LOCUS_38740 141522 141743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 143532 142420 gene locus_tag LOCUS_38750 gene dnaJ 143532 142420 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940712.1 protein_id gnl|my_center|LOCUS_38750 144456 143794 gene locus_tag LOCUS_38760 144456 143794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 146361 144556 gene locus_tag LOCUS_38770 gene dnaK 146361 144556 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545409.1 protein_id gnl|my_center|LOCUS_38770 147233 146415 gene locus_tag LOCUS_38780 147233 146415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 148398 147274 gene locus_tag LOCUS_38790 gene hrcA 148398 147274 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_38790 148702 149433 gene locus_tag LOCUS_38800 148702 149433 CDS product SprT-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491603.1 protein_id gnl|my_center|LOCUS_38800 150357 149452 gene locus_tag LOCUS_38810 150357 149452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 150726 150358 gene locus_tag LOCUS_38820 150726 150358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 151496 150726 gene locus_tag LOCUS_38830 151496 150726 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941251.1 protein_id gnl|my_center|LOCUS_38830 151876 151676 gene locus_tag LOCUS_38840 151876 151676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 152836 151913 gene locus_tag LOCUS_38850 152836 151913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 153130 153618 gene locus_tag LOCUS_38860 153130 153618 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_38860 153705 154352 gene locus_tag LOCUS_38870 153705 154352 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081859.1 protein_id gnl|my_center|LOCUS_38870 154417 154893 gene locus_tag LOCUS_38880 154417 154893 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941008.1 protein_id gnl|my_center|LOCUS_38880 154951 156165 gene locus_tag LOCUS_38890 gene nuoD 154951 156165 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_38890 156242 156592 gene locus_tag LOCUS_38900 156242 156592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 156637 157068 gene locus_tag LOCUS_38910 156637 157068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 157109 157447 gene locus_tag LOCUS_38920 157109 157447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 157461 157988 gene locus_tag LOCUS_38930 gene nuoE 157461 157988 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540773.1 protein_id gnl|my_center|LOCUS_38930 157994 158377 gene locus_tag LOCUS_38940 157994 158377 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530093.1 protein_id gnl|my_center|LOCUS_38940 158481 159389 gene locus_tag LOCUS_38950 158481 159389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 159430 160710 gene locus_tag LOCUS_38960 gene nuoF 159430 160710 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964317.1 protein_id gnl|my_center|LOCUS_38960 160943 163168 gene locus_tag LOCUS_38970 gene nuoG 160943 163168 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967796.1 protein_id gnl|my_center|LOCUS_38970 163173 163652 gene locus_tag LOCUS_38980 163173 163652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 163677 164798 gene locus_tag LOCUS_38990 gene nuoH 163677 164798 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104353.1 protein_id gnl|my_center|LOCUS_38990 164855 165412 gene locus_tag LOCUS_39000 164855 165412 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941015.1 protein_id gnl|my_center|LOCUS_39000 165624 165929 gene locus_tag LOCUS_39010 gene nuoK 165624 165929 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941016.1 protein_id gnl|my_center|LOCUS_39010 166025 167257 gene locus_tag LOCUS_39020 166025 167257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 167327 169516 gene locus_tag LOCUS_39030 gene nuoL 167327 169516 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_39030 169597 171207 gene locus_tag LOCUS_39040 169597 171207 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_39040 171207 171830 gene locus_tag LOCUS_39050 171207 171830 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963857.1 protein_id gnl|my_center|LOCUS_39050 171847 172071 gene locus_tag LOCUS_39060 171847 172071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 172072 173385 gene locus_tag LOCUS_39070 172072 173385 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39070 173395 174027 gene locus_tag LOCUS_39080 173395 174027 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765580.1 protein_id gnl|my_center|LOCUS_39080 174024 174515 gene locus_tag LOCUS_39090 174024 174515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 174744 175670 gene locus_tag LOCUS_39100 174744 175670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 176238 175744 gene locus_tag LOCUS_39110 176238 175744 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107997.1 protein_id gnl|my_center|LOCUS_39110 176565 177416 gene locus_tag LOCUS_39120 176565 177416 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929069.1 protein_id gnl|my_center|LOCUS_39120 178721 180415 gene locus_tag LOCUS_39130 178721 180415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 180962 180519 gene locus_tag LOCUS_39140 180962 180519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 181290 181006 gene locus_tag LOCUS_39150 181290 181006 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202715939.1 protein_id gnl|my_center|LOCUS_39150 181549 182052 gene locus_tag LOCUS_39160 181549 182052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 182058 182450 gene locus_tag LOCUS_39170 182058 182450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 182392 183402 gene locus_tag LOCUS_39180 182392 183402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 183892 184941 gene locus_tag LOCUS_39190 183892 184941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 185323 184976 gene locus_tag LOCUS_39200 185323 184976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 185418 185588 gene locus_tag LOCUS_39210 185418 185588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 188425 186524 gene locus_tag LOCUS_39220 188425 186524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 189643 188825 gene locus_tag LOCUS_39230 189643 188825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 190290 190027 gene locus_tag LOCUS_39240 190290 190027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 191192 190998 gene locus_tag LOCUS_39250 191192 190998 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096582717.1 protein_id gnl|my_center|LOCUS_39250 192651 192340 gene locus_tag LOCUS_39260 192651 192340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 194046 193717 gene locus_tag LOCUS_39270 194046 193717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 194947 194183 gene locus_tag LOCUS_39280 gene istB 194947 194183 CDS product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_39280 195719 194988 gene locus_tag LOCUS_39290 195719 194988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39290 196387 195716 gene locus_tag LOCUS_39300 196387 195716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39300 197330 197854 gene locus_tag LOCUS_39310 197330 197854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 197895 198407 gene locus_tag LOCUS_39320 197895 198407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 198851 198552 gene locus_tag LOCUS_39330 198851 198552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 199080 198862 gene locus_tag LOCUS_39340 199080 198862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 199381 199106 gene locus_tag LOCUS_39350 199381 199106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 200610 200380 gene locus_tag LOCUS_39360 200610 200380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 201065 200607 gene locus_tag LOCUS_39370 201065 200607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 >Feature sequence12 562 92 gene locus_tag LOCUS_39380 562 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39380 756 1046 gene locus_tag LOCUS_39390 756 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 1255 1509 gene locus_tag LOCUS_39400 1255 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 3145 2801 gene locus_tag LOCUS_39410 3145 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 4236 3142 gene locus_tag LOCUS_39420 4236 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 4600 4911 gene locus_tag LOCUS_39430 4600 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 5173 4799 gene locus_tag LOCUS_39440 5173 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 5579 5265 gene locus_tag LOCUS_39450 5579 5265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 5473 5700 gene locus_tag LOCUS_39460 5473 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 6978 5917 gene locus_tag LOCUS_39470 6978 5917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 7116 7466 gene locus_tag LOCUS_39480 7116 7466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 7635 7889 gene locus_tag LOCUS_39490 7635 7889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 9352 8087 gene locus_tag LOCUS_39500 9352 8087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 9620 9820 gene locus_tag LOCUS_39510 9620 9820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 10957 10052 gene locus_tag LOCUS_39520 10957 10052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 11198 11530 gene locus_tag LOCUS_39530 11198 11530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 11698 11549 gene locus_tag LOCUS_39540 11698 11549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 12686 11673 gene locus_tag LOCUS_39550 12686 11673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 14352 13357 gene locus_tag LOCUS_39560 14352 13357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 15588 15184 gene locus_tag LOCUS_39570 15588 15184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 16040 15645 gene locus_tag LOCUS_39580 16040 15645 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224021.1 protein_id gnl|my_center|LOCUS_39580 16245 17114 gene locus_tag LOCUS_39590 16245 17114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 17541 17879 gene locus_tag LOCUS_39600 17541 17879 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815797.1 protein_id gnl|my_center|LOCUS_39600 19849 18269 gene locus_tag LOCUS_39610 19849 18269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 19733 19969 gene locus_tag LOCUS_39620 19733 19969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 21446 20178 gene locus_tag LOCUS_39630 21446 20178 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973184.1 protein_id gnl|my_center|LOCUS_39630 22338 21520 gene locus_tag LOCUS_39640 22338 21520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 23125 22370 gene locus_tag LOCUS_39650 23125 22370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 23372 25114 gene locus_tag LOCUS_39660 23372 25114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 29124 25444 gene locus_tag LOCUS_39670 29124 25444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 30371 29415 gene locus_tag LOCUS_39680 30371 29415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 30952 30479 gene locus_tag LOCUS_39690 30952 30479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 32723 30933 gene locus_tag LOCUS_39700 32723 30933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39700 34206 33481 gene locus_tag LOCUS_39710 34206 33481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 34513 34211 gene locus_tag LOCUS_39720 34513 34211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 34605 35543 gene locus_tag LOCUS_39730 34605 35543 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383472.1 protein_id gnl|my_center|LOCUS_39730 35691 36419 gene locus_tag LOCUS_39740 35691 36419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 39675 36523 gene locus_tag LOCUS_39750 39675 36523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 40784 39780 gene locus_tag LOCUS_39760 40784 39780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 40799 41053 gene locus_tag LOCUS_39770 40799 41053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 41363 42973 gene locus_tag LOCUS_39780 gene msbA 41363 42973 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39780 42883 43251 gene locus_tag LOCUS_39790 42883 43251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39790 43973 43533 gene locus_tag LOCUS_39800 43973 43533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 44353 44991 gene locus_tag LOCUS_39810 44353 44991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39810 45275 45481 gene locus_tag LOCUS_39820 45275 45481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39820 45705 45529 gene locus_tag LOCUS_39830 45705 45529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 45656 45925 gene locus_tag LOCUS_39840 45656 45925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39840 45918 46178 gene locus_tag LOCUS_39850 45918 46178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 48508 46586 gene locus_tag LOCUS_39860 48508 46586 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035873.1 protein_id gnl|my_center|LOCUS_39860 49874 49011 gene locus_tag LOCUS_39870 49874 49011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 50610 50101 gene locus_tag LOCUS_39880 50610 50101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 53943 50746 gene locus_tag LOCUS_39890 53943 50746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 54743 55066 gene locus_tag LOCUS_39900 54743 55066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021271.1 protein_id gnl|my_center|LOCUS_39900 55812 56270 gene locus_tag LOCUS_39910 55812 56270 CDS product MerC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037787.1 protein_id gnl|my_center|LOCUS_39910 57861 56740 gene locus_tag LOCUS_39920 57861 56740 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143099.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39920 58172 57816 gene locus_tag LOCUS_39930 58172 57816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 59599 58175 gene locus_tag LOCUS_39940 59599 58175 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143098.1 protein_id gnl|my_center|LOCUS_39940 60307 59603 gene locus_tag LOCUS_39950 60307 59603 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_39950 61054 61287 gene locus_tag LOCUS_39960 61054 61287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 61325 62113 gene locus_tag LOCUS_39970 61325 62113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 62110 62976 gene locus_tag LOCUS_39980 62110 62976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 62973 64958 gene locus_tag LOCUS_39990 62973 64958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 65106 67739 gene locus_tag LOCUS_40000 65106 67739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 69333 68167 gene locus_tag LOCUS_40010 gene sucC 69333 68167 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020785.1 protein_id gnl|my_center|LOCUS_40010 70080 69475 gene locus_tag LOCUS_40020 70080 69475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 70372 70109 gene locus_tag LOCUS_40030 70372 70109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 70780 70418 gene locus_tag LOCUS_40040 70780 70418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 72607 71108 gene locus_tag LOCUS_40050 72607 71108 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092867.1 protein_id gnl|my_center|LOCUS_40050 73120 72659 gene locus_tag LOCUS_40060 gene smpB 73120 72659 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942353.1 protein_id gnl|my_center|LOCUS_40060 73290 73363 gene locus_tag LOCUS_t00370 73290 73363 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 73426 73833 gene locus_tag LOCUS_40070 73426 73833 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811622.1 protein_id gnl|my_center|LOCUS_40070 74038 73820 gene locus_tag LOCUS_40080 74038 73820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 75865 74213 gene locus_tag LOCUS_40090 75865 74213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 76184 75888 gene locus_tag LOCUS_40100 76184 75888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 78661 76202 gene locus_tag LOCUS_40110 78661 76202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 79381 78803 gene locus_tag LOCUS_40120 79381 78803 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259645.1 protein_id gnl|my_center|LOCUS_40120 79645 80622 gene locus_tag LOCUS_40130 79645 80622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40130 80603 81229 gene locus_tag LOCUS_40140 80603 81229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40140 81232 81978 gene locus_tag LOCUS_40150 81232 81978 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_40150 82260 83513 gene locus_tag LOCUS_40160 82260 83513 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_40160 83741 84949 gene locus_tag LOCUS_40170 83741 84949 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_40170 85409 86644 gene locus_tag LOCUS_40180 85409 86644 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405554.1 protein_id gnl|my_center|LOCUS_40180 86646 87911 gene locus_tag LOCUS_40190 86646 87911 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809406.1 protein_id gnl|my_center|LOCUS_40190 89069 88284 gene locus_tag LOCUS_40200 89069 88284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 90126 89143 gene locus_tag LOCUS_40210 90126 89143 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 protein_id gnl|my_center|LOCUS_40210 90964 90194 gene locus_tag LOCUS_40220 90964 90194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 91115 92881 gene locus_tag LOCUS_40230 91115 92881 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962632.1 protein_id gnl|my_center|LOCUS_40230 93188 93021 gene locus_tag LOCUS_40240 93188 93021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 95476 94058 gene locus_tag LOCUS_40250 95476 94058 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_40250 95641 97704 gene locus_tag LOCUS_40260 95641 97704 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640383.1 protein_id gnl|my_center|LOCUS_40260 97780 98562 gene locus_tag LOCUS_40270 97780 98562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40270 98538 99461 gene locus_tag LOCUS_40280 98538 99461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40280 100255 99713 gene locus_tag LOCUS_40290 100255 99713 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 protein_id gnl|my_center|LOCUS_40290 100956 100264 gene locus_tag LOCUS_40300 100956 100264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 101862 100960 gene locus_tag LOCUS_40310 gene cyoE 101862 100960 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062574.1 protein_id gnl|my_center|LOCUS_40310 102066 102701 gene locus_tag LOCUS_40320 102066 102701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 102695 103681 gene locus_tag LOCUS_40330 102695 103681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 103703 105337 gene locus_tag LOCUS_40340 103703 105337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 105937 106314 gene locus_tag LOCUS_40350 105937 106314 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939303.1 protein_id gnl|my_center|LOCUS_40350 107488 106460 gene locus_tag LOCUS_40360 107488 106460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 107949 107491 gene locus_tag LOCUS_40370 107949 107491 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921390.1 protein_id gnl|my_center|LOCUS_40370 111564 108010 gene locus_tag LOCUS_40380 111564 108010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 111810 112928 gene locus_tag LOCUS_40390 111810 112928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 114127 113090 gene locus_tag LOCUS_40400 114127 113090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 114258 114686 gene locus_tag LOCUS_40410 114258 114686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 115117 115193 gene locus_tag LOCUS_t00380 115117 115193 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 115245 115433 gene locus_tag LOCUS_40420 115245 115433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 116657 115461 gene locus_tag LOCUS_40430 116657 115461 CDS product xylose repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244935.1 protein_id gnl|my_center|LOCUS_40430 118058 116898 gene locus_tag LOCUS_40440 gene xylA 118058 116898 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977662.1 protein_id gnl|my_center|LOCUS_40440 119553 118051 gene locus_tag LOCUS_40450 gene xylB 119553 118051 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_40450 120690 119659 gene locus_tag LOCUS_40460 120690 119659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 123271 120710 gene locus_tag LOCUS_40470 123271 120710 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038016.1 protein_id gnl|my_center|LOCUS_40470 124107 123283 gene locus_tag LOCUS_40480 124107 123283 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971569.1 protein_id gnl|my_center|LOCUS_40480 125309 124152 gene locus_tag LOCUS_40490 125309 124152 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194770.1 protein_id gnl|my_center|LOCUS_40490 127560 125533 gene locus_tag LOCUS_40500 127560 125533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 127844 127575 gene locus_tag LOCUS_40510 127844 127575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 128798 128031 gene locus_tag LOCUS_40520 128798 128031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 129549 128971 gene locus_tag LOCUS_40530 129549 128971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 130123 129596 gene locus_tag LOCUS_40540 130123 129596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 130248 131909 gene locus_tag LOCUS_40550 130248 131909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 132013 131834 gene locus_tag LOCUS_40560 132013 131834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 133103 132183 gene locus_tag LOCUS_40570 133103 132183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 133838 133113 gene locus_tag LOCUS_40580 133838 133113 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 protein_id gnl|my_center|LOCUS_40580 135567 133846 gene locus_tag LOCUS_40590 135567 133846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 135984 135574 gene locus_tag LOCUS_40600 135984 135574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 136526 135981 gene locus_tag LOCUS_40610 136526 135981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 138112 136556 gene locus_tag LOCUS_40620 gene hutH 138112 136556 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256862.1 protein_id gnl|my_center|LOCUS_40620 138158 140329 gene locus_tag LOCUS_40630 138158 140329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 141676 140369 gene locus_tag LOCUS_40640 gene hutI 141676 140369 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256863.1 protein_id gnl|my_center|LOCUS_40640 141780 142376 gene locus_tag LOCUS_40650 141780 142376 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_40650 142487 144964 gene locus_tag LOCUS_40660 142487 144964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 145014 145598 gene locus_tag LOCUS_40670 145014 145598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 145643 146053 gene locus_tag LOCUS_40680 145643 146053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 146076 147302 gene locus_tag LOCUS_40690 146076 147302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 147311 149020 gene locus_tag LOCUS_40700 147311 149020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 151697 149064 gene locus_tag LOCUS_40710 151697 149064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 152226 151990 gene locus_tag LOCUS_40720 152226 151990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 152556 152275 gene locus_tag LOCUS_40730 152556 152275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 153129 152719 gene locus_tag LOCUS_40740 153129 152719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40740 154010 153129 gene locus_tag LOCUS_40750 154010 153129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40750 157179 154225 gene locus_tag LOCUS_40760 157179 154225 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147390609.1 protein_id gnl|my_center|LOCUS_40760 158623 157439 gene locus_tag LOCUS_40770 gene cax 158623 157439 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242902.1 protein_id gnl|my_center|LOCUS_40770 158773 158630 gene locus_tag LOCUS_40780 158773 158630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 159191 158994 gene locus_tag LOCUS_40790 159191 158994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 159247 159675 gene locus_tag LOCUS_40800 159247 159675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 160410 159706 gene locus_tag LOCUS_40810 160410 159706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 162429 160417 gene locus_tag LOCUS_40820 162429 160417 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839793.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40820 162835 162344 gene locus_tag LOCUS_40830 162835 162344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40830 163313 163149 gene locus_tag LOCUS_40840 163313 163149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 163761 163375 gene locus_tag LOCUS_40850 163761 163375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 164558 164004 gene locus_tag LOCUS_40860 164558 164004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 166205 164562 gene locus_tag LOCUS_40870 166205 164562 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839369.1 protein_id gnl|my_center|LOCUS_40870 167750 166305 gene locus_tag LOCUS_40880 gene pepP 167750 166305 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098626.1 protein_id gnl|my_center|LOCUS_40880 168354 168539 gene locus_tag LOCUS_40890 168354 168539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 169205 168690 gene locus_tag LOCUS_40900 169205 168690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40900 171352 169148 gene locus_tag LOCUS_40910 171352 169148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 171849 171655 gene locus_tag LOCUS_40920 171849 171655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40920 172946 172647 gene locus_tag LOCUS_40930 172946 172647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 173575 172997 gene locus_tag LOCUS_40940 173575 172997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 173825 173556 gene locus_tag LOCUS_40950 173825 173556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40950 174353 174069 gene locus_tag LOCUS_40960 174353 174069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40960 174506 174835 gene locus_tag LOCUS_40970 174506 174835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 175185 174754 gene locus_tag LOCUS_40980 175185 174754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40980 176936 176313 gene locus_tag LOCUS_40990 176936 176313 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146717.1 protein_id gnl|my_center|LOCUS_40990 >Feature sequence13 1927 1649 gene locus_tag LOCUS_41000 1927 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41000 2888 2451 gene locus_tag LOCUS_41010 2888 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 3463 3062 gene locus_tag LOCUS_41020 3463 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 4388 3483 gene locus_tag LOCUS_41030 4388 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 4614 4390 gene locus_tag LOCUS_41040 4614 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 4896 4633 gene locus_tag LOCUS_41050 4896 4633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41050 5113 4835 gene locus_tag LOCUS_41060 5113 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 6334 5654 gene locus_tag LOCUS_41070 6334 5654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 7119 6331 gene locus_tag LOCUS_41080 7119 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 8608 7403 gene locus_tag LOCUS_41090 8608 7403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 9718 9239 gene locus_tag LOCUS_41100 9718 9239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 10267 9944 gene locus_tag LOCUS_41110 10267 9944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41110 10955 10161 gene locus_tag LOCUS_41120 10955 10161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41120 11511 10891 gene locus_tag LOCUS_41130 11511 10891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41130 11854 11504 gene locus_tag LOCUS_41140 11854 11504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41140 12309 11788 gene locus_tag LOCUS_41150 12309 11788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41150 12628 12287 gene locus_tag LOCUS_41160 12628 12287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41160 13898 12732 gene locus_tag LOCUS_41170 13898 12732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41170 14913 14332 gene locus_tag LOCUS_41180 14913 14332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41180 16154 15084 gene locus_tag LOCUS_41190 16154 15084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 16560 16039 gene locus_tag LOCUS_41200 16560 16039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 17032 16640 gene locus_tag LOCUS_41210 17032 16640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41210 17555 16917 gene locus_tag LOCUS_41220 17555 16917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41220 17686 17558 gene locus_tag LOCUS_41230 17686 17558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 18081 18380 gene locus_tag LOCUS_41240 18081 18380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 18801 20318 gene locus_tag LOCUS_41250 18801 20318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41250 20315 21361 gene locus_tag LOCUS_41260 20315 21361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41260 21345 21500 gene locus_tag LOCUS_41270 21345 21500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41270 22126 21680 gene locus_tag LOCUS_41280 22126 21680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41280 23830 23171 gene locus_tag LOCUS_41290 23830 23171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 24556 23927 gene locus_tag LOCUS_41300 24556 23927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 24873 24553 gene locus_tag LOCUS_41310 24873 24553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41310 25592 24873 gene locus_tag LOCUS_41320 25592 24873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41320 26399 25992 gene locus_tag LOCUS_41330 26399 25992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41330 27210 26563 gene locus_tag LOCUS_41340 27210 26563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41340 27470 27180 gene locus_tag LOCUS_41350 27470 27180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41350 28170 27793 gene locus_tag LOCUS_41360 28170 27793 CDS product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642310.1 protein_id gnl|my_center|LOCUS_41360 28154 28372 gene locus_tag LOCUS_41370 28154 28372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 28437 28598 gene locus_tag LOCUS_41380 28437 28598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 31128 29638 gene locus_tag LOCUS_41390 31128 29638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41390 31967 31125 gene locus_tag LOCUS_41400 31967 31125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 33358 32231 gene locus_tag LOCUS_41410 33358 32231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 33849 33773 gene locus_tag LOCUS_t00390 33849 33773 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 34244 33993 gene locus_tag LOCUS_41420 34244 33993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 35754 34525 gene locus_tag LOCUS_41430 35754 34525 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397428.1 protein_id gnl|my_center|LOCUS_41430 37051 35840 gene locus_tag LOCUS_41440 37051 35840 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027385545.1 protein_id gnl|my_center|LOCUS_41440 37182 37880 gene locus_tag LOCUS_41450 37182 37880 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958411.1 protein_id gnl|my_center|LOCUS_41450 37883 39004 gene locus_tag LOCUS_41460 gene trpS 37883 39004 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706960.1 protein_id gnl|my_center|LOCUS_41460 40519 39146 gene locus_tag LOCUS_41470 40519 39146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 40931 41227 gene locus_tag LOCUS_41480 40931 41227 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022410.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41480 41533 41880 gene locus_tag LOCUS_41490 41533 41880 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245961.1 protein_id gnl|my_center|LOCUS_41490 41880 42347 gene locus_tag LOCUS_41500 41880 42347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 43131 42418 gene locus_tag LOCUS_41510 43131 42418 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142608.1 protein_id gnl|my_center|LOCUS_41510 44081 43131 gene locus_tag LOCUS_41520 44081 43131 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156007451.1 protein_id gnl|my_center|LOCUS_41520 44356 44078 gene locus_tag LOCUS_41530 44356 44078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 45959 44343 gene locus_tag LOCUS_41540 45959 44343 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973686.1 protein_id gnl|my_center|LOCUS_41540 48094 45956 gene locus_tag LOCUS_41550 48094 45956 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027257.1 protein_id gnl|my_center|LOCUS_41550 49906 48197 gene locus_tag LOCUS_41560 49906 48197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 51583 50069 gene locus_tag LOCUS_41570 51583 50069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 52994 51663 gene locus_tag LOCUS_41580 52994 51663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 56985 53194 gene locus_tag LOCUS_41590 56985 53194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 58159 57212 gene locus_tag LOCUS_41600 58159 57212 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141728.1 protein_id gnl|my_center|LOCUS_41600 58535 58197 gene locus_tag LOCUS_41610 58535 58197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 59517 58615 gene locus_tag LOCUS_41620 59517 58615 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928612.1 protein_id gnl|my_center|LOCUS_41620 61076 59514 gene locus_tag LOCUS_41630 61076 59514 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256992.1 protein_id gnl|my_center|LOCUS_41630 61481 61242 gene locus_tag LOCUS_41640 61481 61242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 62703 61492 gene locus_tag LOCUS_41650 62703 61492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 67638 62863 gene locus_tag LOCUS_41660 67638 62863 CDS product NEW3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003910172.1 protein_id gnl|my_center|LOCUS_41660 68366 67635 gene locus_tag LOCUS_41670 68366 67635 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014894892.1 protein_id gnl|my_center|LOCUS_41670 68638 69417 gene locus_tag LOCUS_41680 68638 69417 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545170.1 protein_id gnl|my_center|LOCUS_41680 69554 70081 gene locus_tag LOCUS_41690 gene scpB 69554 70081 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842431.1 protein_id gnl|my_center|LOCUS_41690 70160 70735 gene locus_tag LOCUS_41700 70160 70735 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_41700 70852 71391 gene locus_tag LOCUS_41710 70852 71391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 71375 71893 gene locus_tag LOCUS_41720 71375 71893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 72414 71941 gene locus_tag LOCUS_41730 72414 71941 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941451.1 protein_id gnl|my_center|LOCUS_41730 73087 72389 gene locus_tag LOCUS_41740 gene cybH 73087 72389 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932460.1 protein_id gnl|my_center|LOCUS_41740 74886 73171 gene locus_tag LOCUS_41750 74886 73171 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012502532.1 protein_id gnl|my_center|LOCUS_41750 76039 74879 gene locus_tag LOCUS_41760 76039 74879 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338265.1 protein_id gnl|my_center|LOCUS_41760 76433 77281 gene locus_tag LOCUS_41770 76433 77281 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_41770 77290 77655 gene locus_tag LOCUS_41780 77290 77655 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583024.1 protein_id gnl|my_center|LOCUS_41780 77717 78859 gene locus_tag LOCUS_41790 77717 78859 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816051.1 protein_id gnl|my_center|LOCUS_41790 78906 79895 gene locus_tag LOCUS_41800 78906 79895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 79892 81604 gene locus_tag LOCUS_41810 79892 81604 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_41810 81632 82639 gene locus_tag LOCUS_41820 81632 82639 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810382.1 protein_id gnl|my_center|LOCUS_41820 82708 83040 gene locus_tag LOCUS_41830 82708 83040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 83037 85982 gene locus_tag LOCUS_41840 83037 85982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 86247 88013 gene locus_tag LOCUS_41850 86247 88013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 88144 88968 gene locus_tag LOCUS_41860 88144 88968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 89050 89574 gene locus_tag LOCUS_41870 89050 89574 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284980.1 protein_id gnl|my_center|LOCUS_41870 89602 90189 gene locus_tag LOCUS_41880 89602 90189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 90566 91504 gene locus_tag LOCUS_41890 gene meaB 90566 91504 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 protein_id gnl|my_center|LOCUS_41890 91620 92021 gene locus_tag LOCUS_41900 gene mce 91620 92021 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249285.1 protein_id gnl|my_center|LOCUS_41900 92251 93633 gene locus_tag LOCUS_41910 92251 93633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 93765 94595 gene locus_tag LOCUS_41920 93765 94595 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479789.1 protein_id gnl|my_center|LOCUS_41920 94678 95160 gene locus_tag LOCUS_41930 94678 95160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 95328 96203 gene locus_tag LOCUS_41940 95328 96203 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142419.1 protein_id gnl|my_center|LOCUS_41940 96596 98215 gene locus_tag LOCUS_41950 gene pntA 96596 98215 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096869.1 protein_id gnl|my_center|LOCUS_41950 98323 99720 gene locus_tag LOCUS_41960 gene pntB 98323 99720 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014036.1 protein_id gnl|my_center|LOCUS_41960 100464 100922 gene locus_tag LOCUS_41970 100464 100922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 101047 101424 gene locus_tag LOCUS_41980 101047 101424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 101791 102726 gene locus_tag LOCUS_41990 101791 102726 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_41990 103072 102671 gene locus_tag LOCUS_42000 103072 102671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 103383 104138 gene locus_tag LOCUS_42010 103383 104138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 104253 105014 gene locus_tag LOCUS_42020 104253 105014 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582796.1 protein_id gnl|my_center|LOCUS_42020 105112 105903 gene locus_tag LOCUS_42030 105112 105903 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222950.1 protein_id gnl|my_center|LOCUS_42030 106024 106344 gene locus_tag LOCUS_42040 106024 106344 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144175.1 protein_id gnl|my_center|LOCUS_42040 107403 106417 gene locus_tag LOCUS_42050 107403 106417 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056486.1 protein_id gnl|my_center|LOCUS_42050 108681 107491 gene locus_tag LOCUS_42060 gene rlmD 108681 107491 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_42060 109665 108748 gene locus_tag LOCUS_42070 109665 108748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 110386 109709 gene locus_tag LOCUS_42080 110386 109709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 110744 110487 gene locus_tag LOCUS_42090 110744 110487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 114051 110908 gene locus_tag LOCUS_42100 114051 110908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 114129 116123 gene locus_tag LOCUS_42110 114129 116123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 116227 117819 gene locus_tag LOCUS_42120 116227 117819 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943914.1 protein_id gnl|my_center|LOCUS_42120 117918 118406 gene locus_tag LOCUS_42130 117918 118406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 118590 118844 gene locus_tag LOCUS_42140 118590 118844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 118846 119091 gene locus_tag LOCUS_42150 118846 119091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 119088 119483 gene locus_tag LOCUS_42160 119088 119483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 119549 120280 gene locus_tag LOCUS_42170 119549 120280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 122384 120570 gene locus_tag LOCUS_42180 gene aspS 122384 120570 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_42180 123601 122789 gene locus_tag LOCUS_42190 123601 122789 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392553.1 protein_id gnl|my_center|LOCUS_42190 125486 124713 gene locus_tag LOCUS_42200 125486 124713 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460415.1 protein_id gnl|my_center|LOCUS_42200 125814 125479 gene locus_tag LOCUS_42210 125814 125479 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142756.1 protein_id gnl|my_center|LOCUS_42210 126341 125817 gene locus_tag LOCUS_42220 126341 125817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 126999 126433 gene locus_tag LOCUS_42230 126999 126433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42230 127662 127207 gene locus_tag LOCUS_42240 127662 127207 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732167.1 protein_id gnl|my_center|LOCUS_42240 128293 127715 gene locus_tag LOCUS_42250 gene pyrE 128293 127715 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460653.1 protein_id gnl|my_center|LOCUS_42250 128407 129222 gene locus_tag LOCUS_42260 128407 129222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 129311 129724 gene locus_tag LOCUS_42270 gene queF 129311 129724 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143582.1 protein_id gnl|my_center|LOCUS_42270 130322 129729 gene locus_tag LOCUS_42280 130322 129729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 131541 130471 gene locus_tag LOCUS_42290 131541 130471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 132221 131538 gene locus_tag LOCUS_42300 132221 131538 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986854.1 protein_id gnl|my_center|LOCUS_42300 132975 132319 gene locus_tag LOCUS_42310 gene phoU 132975 132319 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986850.1 protein_id gnl|my_center|LOCUS_42310 133601 133113 gene locus_tag LOCUS_42320 133601 133113 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532447.1 protein_id gnl|my_center|LOCUS_42320 134144 133692 gene locus_tag LOCUS_42330 134144 133692 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976090.1 protein_id gnl|my_center|LOCUS_42330 134208 135800 gene locus_tag LOCUS_42340 134208 135800 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943196.1 protein_id gnl|my_center|LOCUS_42340 135954 136556 gene locus_tag LOCUS_42350 135954 136556 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405414.1 protein_id gnl|my_center|LOCUS_42350 136558 137106 gene locus_tag LOCUS_42360 136558 137106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 137271 137771 gene locus_tag LOCUS_42370 137271 137771 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399152.1 protein_id gnl|my_center|LOCUS_42370 137738 137941 gene locus_tag LOCUS_42380 137738 137941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 138280 138095 gene locus_tag LOCUS_42390 138280 138095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 139127 138510 gene locus_tag LOCUS_42400 139127 138510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 139295 141595 gene locus_tag LOCUS_42410 gene purL 139295 141595 CDS product phosphoribosylformylglycinamidine synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055555.1 protein_id gnl|my_center|LOCUS_42410 141694 143250 gene locus_tag LOCUS_42420 141694 143250 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868784.1 protein_id gnl|my_center|LOCUS_42420 143867 143481 gene locus_tag LOCUS_42430 143867 143481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 144043 144867 gene locus_tag LOCUS_42440 144043 144867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 >Feature sequence14 3005 297 gene locus_tag LOCUS_42450 3005 297 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144060.1 protein_id gnl|my_center|LOCUS_42450 3673 4638 gene locus_tag LOCUS_42460 3673 4638 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813319.1 protein_id gnl|my_center|LOCUS_42460 4727 6190 gene locus_tag LOCUS_42470 4727 6190 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404788.1 protein_id gnl|my_center|LOCUS_42470 6552 6331 gene locus_tag LOCUS_42480 6552 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42480 6567 7328 gene locus_tag LOCUS_42490 gene mtgA 6567 7328 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842177.1 protein_id gnl|my_center|LOCUS_42490 10268 8088 gene locus_tag LOCUS_42500 10268 8088 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141815383.1 protein_id gnl|my_center|LOCUS_42500 11238 10408 gene locus_tag LOCUS_42510 11238 10408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 11727 11512 gene locus_tag LOCUS_42520 11727 11512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 12541 11810 gene locus_tag LOCUS_42530 12541 11810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 13311 12538 gene locus_tag LOCUS_42540 13311 12538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 14047 13388 gene locus_tag LOCUS_42550 14047 13388 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_42550 14175 15311 gene locus_tag LOCUS_42560 14175 15311 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942134.1 protein_id gnl|my_center|LOCUS_42560 15657 16154 gene locus_tag LOCUS_42570 gene nrdR 15657 16154 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459010.1 protein_id gnl|my_center|LOCUS_42570 16333 18765 gene locus_tag LOCUS_42580 gene lon 16333 18765 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545466.1 protein_id gnl|my_center|LOCUS_42580 18988 20748 gene locus_tag LOCUS_42590 18988 20748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 20908 20729 gene locus_tag LOCUS_42600 20908 20729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 20907 22790 gene locus_tag LOCUS_42610 20907 22790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 22796 23578 gene locus_tag LOCUS_42620 22796 23578 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405048.1 protein_id gnl|my_center|LOCUS_42620 26063 24282 gene locus_tag LOCUS_42630 26063 24282 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_42630 26620 28848 gene locus_tag LOCUS_42640 26620 28848 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037788.1 protein_id gnl|my_center|LOCUS_42640 31768 28937 gene locus_tag LOCUS_42650 31768 28937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 32932 32039 gene locus_tag LOCUS_42660 32932 32039 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532147.1 protein_id gnl|my_center|LOCUS_42660 34563 33331 gene locus_tag LOCUS_42670 34563 33331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 35168 34680 gene locus_tag LOCUS_42680 35168 34680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 35481 35155 gene locus_tag LOCUS_42690 35481 35155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 35671 37446 gene locus_tag LOCUS_42700 35671 37446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 37534 39327 gene locus_tag LOCUS_42710 37534 39327 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888050.1 protein_id gnl|my_center|LOCUS_42710 39604 40863 gene locus_tag LOCUS_42720 39604 40863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 40924 42597 gene locus_tag LOCUS_42730 gene sulP 40924 42597 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926914.1 protein_id gnl|my_center|LOCUS_42730 43306 42776 gene locus_tag LOCUS_42740 43306 42776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 47760 43243 gene locus_tag LOCUS_42750 47760 43243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 48713 47751 gene locus_tag LOCUS_42760 48713 47751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 48595 48900 gene locus_tag LOCUS_42770 48595 48900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 48965 49162 gene locus_tag LOCUS_42780 48965 49162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 50372 50650 gene locus_tag LOCUS_42790 50372 50650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 52174 51086 gene locus_tag LOCUS_42800 52174 51086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42800 52401 52144 gene locus_tag LOCUS_42810 52401 52144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 52757 52398 gene locus_tag LOCUS_42820 52757 52398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 52920 54824 gene locus_tag LOCUS_42830 52920 54824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 54900 55220 gene locus_tag LOCUS_42840 54900 55220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 57028 55265 gene locus_tag LOCUS_42850 57028 55265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 60605 57228 gene locus_tag LOCUS_42860 60605 57228 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403927.1 protein_id gnl|my_center|LOCUS_42860 60969 60643 gene locus_tag LOCUS_42870 60969 60643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 64154 62079 gene locus_tag LOCUS_42880 64154 62079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 66034 64448 gene locus_tag LOCUS_42890 66034 64448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42890 66540 66031 gene locus_tag LOCUS_42900 66540 66031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 67421 66783 gene locus_tag LOCUS_42910 67421 66783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 68551 67424 gene locus_tag LOCUS_42920 68551 67424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 69037 68567 gene locus_tag LOCUS_42930 gene nusB 69037 68567 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393030.1 protein_id gnl|my_center|LOCUS_42930 69600 69043 gene locus_tag LOCUS_42940 gene ribE 69600 69043 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942334.1 protein_id gnl|my_center|LOCUS_42940 70728 69658 gene locus_tag LOCUS_42950 70728 69658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42950 71408 71863 gene locus_tag LOCUS_42960 71408 71863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 71909 72553 gene locus_tag LOCUS_42970 71909 72553 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977465.1 protein_id gnl|my_center|LOCUS_42970 72621 73796 gene locus_tag LOCUS_42980 gene acdA 72621 73796 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_42980 74107 74649 gene locus_tag LOCUS_42990 74107 74649 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029744075.1 protein_id gnl|my_center|LOCUS_42990 75432 74884 gene locus_tag LOCUS_43000 75432 74884 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084272.1 protein_id gnl|my_center|LOCUS_43000 77497 75650 gene locus_tag LOCUS_43010 77497 75650 CDS product SpoIVB peptidase S55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869562.1 protein_id gnl|my_center|LOCUS_43010 77647 78624 gene locus_tag LOCUS_43020 77647 78624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 79316 78618 gene locus_tag LOCUS_43030 79316 78618 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058292.1 protein_id gnl|my_center|LOCUS_43030 80578 79322 gene locus_tag LOCUS_43040 80578 79322 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055915.1 protein_id gnl|my_center|LOCUS_43040 80858 81652 gene locus_tag LOCUS_43050 80858 81652 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528434.1 protein_id gnl|my_center|LOCUS_43050 82224 83777 gene locus_tag LOCUS_43060 82224 83777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 84322 84098 gene locus_tag LOCUS_43070 84322 84098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 84997 86832 gene locus_tag LOCUS_43080 84997 86832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 87403 88815 gene locus_tag LOCUS_43090 87403 88815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 88890 90401 gene locus_tag LOCUS_43100 88890 90401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 90594 92192 gene locus_tag LOCUS_43110 90594 92192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 92865 92500 gene locus_tag LOCUS_43120 92865 92500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 94437 94952 gene locus_tag LOCUS_43130 94437 94952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 96414 96650 gene locus_tag LOCUS_43140 96414 96650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 97322 97954 gene locus_tag LOCUS_43150 97322 97954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 97939 100380 gene locus_tag LOCUS_43160 97939 100380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 100305 100490 gene locus_tag LOCUS_43170 100305 100490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 100852 101754 gene locus_tag LOCUS_43180 100852 101754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 103323 103511 gene locus_tag LOCUS_43190 103323 103511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 104223 105197 gene locus_tag LOCUS_43200 104223 105197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43200 105266 107509 gene locus_tag LOCUS_43210 105266 107509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43210 107502 108155 gene locus_tag LOCUS_43220 107502 108155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 108212 109573 gene locus_tag LOCUS_43230 108212 109573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 109593 110702 gene locus_tag LOCUS_43240 109593 110702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 110875 111522 gene locus_tag LOCUS_43250 110875 111522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 111522 112163 gene locus_tag LOCUS_43260 111522 112163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43260 112177 113985 gene locus_tag LOCUS_43270 112177 113985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43270 113975 114604 gene locus_tag LOCUS_43280 113975 114604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43280 114832 115131 gene locus_tag LOCUS_43290 114832 115131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43290 115172 115975 gene locus_tag LOCUS_43300 115172 115975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43300 116021 116548 gene locus_tag LOCUS_43310 116021 116548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43310 116574 117191 gene locus_tag LOCUS_43320 116574 117191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 118585 118953 gene locus_tag LOCUS_43330 118585 118953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 119322 119612 gene locus_tag LOCUS_43340 119322 119612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 120106 120459 gene locus_tag LOCUS_43350 120106 120459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 120702 120956 gene locus_tag LOCUS_43360 120702 120956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 121882 123150 gene locus_tag LOCUS_43370 121882 123150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 123147 123734 gene locus_tag LOCUS_43380 123147 123734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 124619 125020 gene locus_tag LOCUS_43390 124619 125020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43390 125020 126093 gene locus_tag LOCUS_43400 gene mcrC 125020 126093 CDS product 5-methylcytosine-specific restriction endonuclease system specificity protein McrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922381.1 protein_id gnl|my_center|LOCUS_43400 126554 127756 gene locus_tag LOCUS_43410 126554 127756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 127764 130016 gene locus_tag LOCUS_43420 127764 130016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 129943 130455 gene locus_tag LOCUS_43430 129943 130455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 130642 130893 gene locus_tag LOCUS_43440 130642 130893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 131047 131649 gene locus_tag LOCUS_43450 131047 131649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 131825 132745 gene locus_tag LOCUS_43460 131825 132745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 132787 133701 gene locus_tag LOCUS_43470 132787 133701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 133680 133847 gene locus_tag LOCUS_43480 133680 133847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 134211 134579 gene locus_tag LOCUS_43490 134211 134579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 134576 135229 gene locus_tag LOCUS_43500 134576 135229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43500 >Feature sequence15 72 2114 gene locus_tag LOCUS_43510 72 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 2782 6189 gene locus_tag LOCUS_43520 2782 6189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43520 6502 6723 gene locus_tag LOCUS_43530 6502 6723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 6826 7584 gene locus_tag LOCUS_43540 gene surE 6826 7584 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880503.1 protein_id gnl|my_center|LOCUS_43540 7627 8295 gene locus_tag LOCUS_43550 7627 8295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 9159 9863 gene locus_tag LOCUS_43560 9159 9863 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364337.1 protein_id gnl|my_center|LOCUS_43560 9878 10645 gene locus_tag LOCUS_43570 9878 10645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 10722 10798 gene locus_tag LOCUS_t00400 10722 10798 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 11675 12988 gene locus_tag LOCUS_43580 11675 12988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 13287 14696 gene locus_tag LOCUS_43590 13287 14696 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_43590 14714 16279 gene locus_tag LOCUS_43600 14714 16279 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929287.1 protein_id gnl|my_center|LOCUS_43600 16251 16493 gene locus_tag LOCUS_43610 16251 16493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 17318 17130 gene locus_tag LOCUS_43620 17318 17130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 20281 17522 gene locus_tag LOCUS_43630 20281 17522 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640527.1 protein_id gnl|my_center|LOCUS_43630 20758 20375 gene locus_tag LOCUS_43640 gene queD 20758 20375 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546681.1 protein_id gnl|my_center|LOCUS_43640 22765 20768 gene locus_tag LOCUS_43650 22765 20768 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105733.1 protein_id gnl|my_center|LOCUS_43650 22989 27068 gene locus_tag LOCUS_43660 22989 27068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 27208 27056 gene locus_tag LOCUS_43670 27208 27056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 27554 31546 gene locus_tag LOCUS_43680 27554 31546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 31777 33822 gene locus_tag LOCUS_43690 gene ppk1 31777 33822 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233899.1 protein_id gnl|my_center|LOCUS_43690 33910 35346 gene locus_tag LOCUS_43700 33910 35346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 37153 35873 gene locus_tag LOCUS_43710 37153 35873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43710 40211 37227 gene locus_tag LOCUS_43720 40211 37227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 40783 40211 gene locus_tag LOCUS_43730 40783 40211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 41424 40786 gene locus_tag LOCUS_43740 41424 40786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 42001 41675 gene locus_tag LOCUS_43750 42001 41675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 43343 41994 gene locus_tag LOCUS_43760 43343 41994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43760 43994 43458 gene locus_tag LOCUS_43770 43994 43458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43770 44985 43945 gene locus_tag LOCUS_43780 44985 43945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 45778 45251 gene locus_tag LOCUS_43790 45778 45251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 46833 45775 gene locus_tag LOCUS_43800 gene pilM 46833 45775 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_43800 48416 47631 gene locus_tag LOCUS_43810 48416 47631 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524730.1 protein_id gnl|my_center|LOCUS_43810 48906 48409 gene locus_tag LOCUS_43820 48906 48409 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235787673.1 protein_id gnl|my_center|LOCUS_43820 50070 49057 gene locus_tag LOCUS_43830 50070 49057 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889455.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43830 50399 51436 gene locus_tag LOCUS_43840 50399 51436 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098170.1 protein_id gnl|my_center|LOCUS_43840 51526 52944 gene locus_tag LOCUS_43850 51526 52944 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_43850 53041 53607 gene locus_tag LOCUS_43860 gene folK 53041 53607 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933595.1 protein_id gnl|my_center|LOCUS_43860 53717 54577 gene locus_tag LOCUS_43870 gene panB 53717 54577 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439367.1 protein_id gnl|my_center|LOCUS_43870 54745 55572 gene locus_tag LOCUS_43880 gene panC 54745 55572 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_43880 55646 56134 gene locus_tag LOCUS_43890 55646 56134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 57483 56917 gene locus_tag LOCUS_43900 57483 56917 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226290.1 protein_id gnl|my_center|LOCUS_43900 57542 58042 gene locus_tag LOCUS_43910 57542 58042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 58032 58313 gene locus_tag LOCUS_43920 gene gatC 58032 58313 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_43920 58464 58850 gene locus_tag LOCUS_43930 58464 58850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43930 58854 60248 gene locus_tag LOCUS_43940 gene gatA 58854 60248 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920797.1 protein_id gnl|my_center|LOCUS_43940 61124 60561 gene locus_tag LOCUS_43950 61124 60561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 64122 61138 gene locus_tag LOCUS_43960 64122 61138 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258514.1 protein_id gnl|my_center|LOCUS_43960 65692 64349 gene locus_tag LOCUS_43970 gene pvdM 65692 64349 CDS product pyoverdine-tailoring dipeptidase-like protein PvdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267353.1 protein_id gnl|my_center|LOCUS_43970 65915 66325 gene locus_tag LOCUS_43980 65915 66325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 68399 66306 gene locus_tag LOCUS_43990 68399 66306 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_43990 69424 68459 gene locus_tag LOCUS_44000 69424 68459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 69791 69982 gene locus_tag LOCUS_44010 69791 69982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 70199 72640 gene locus_tag LOCUS_44020 70199 72640 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444445.1 protein_id gnl|my_center|LOCUS_44020 73012 72668 gene locus_tag LOCUS_44030 73012 72668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44030 73340 73083 gene locus_tag LOCUS_44040 73340 73083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 73473 75428 gene locus_tag LOCUS_44050 73473 75428 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918824.1 protein_id gnl|my_center|LOCUS_44050 75961 75602 gene locus_tag LOCUS_44060 75961 75602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44060 77011 76106 gene locus_tag LOCUS_44070 77011 76106 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018647871.1 protein_id gnl|my_center|LOCUS_44070 77396 77016 gene locus_tag LOCUS_44080 77396 77016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44080 77862 78416 gene locus_tag LOCUS_44090 77862 78416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 78429 78947 gene locus_tag LOCUS_44100 78429 78947 CDS product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675062.1 protein_id gnl|my_center|LOCUS_44100 78944 79375 gene locus_tag LOCUS_44110 78944 79375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 80794 79361 gene locus_tag LOCUS_44120 80794 79361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 81764 80877 gene locus_tag LOCUS_44130 81764 80877 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118048.1 protein_id gnl|my_center|LOCUS_44130 81917 84760 gene locus_tag LOCUS_44140 81917 84760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 84817 85098 gene locus_tag LOCUS_44150 84817 85098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 85178 85960 gene locus_tag LOCUS_44160 85178 85960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44160 85948 87333 gene locus_tag LOCUS_44170 85948 87333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 89354 87441 gene locus_tag LOCUS_44180 89354 87441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44180 90121 89366 gene locus_tag LOCUS_44190 90121 89366 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977726.1 protein_id gnl|my_center|LOCUS_44190 90791 91231 gene locus_tag LOCUS_44200 90791 91231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44200 92645 91500 gene locus_tag LOCUS_44210 92645 91500 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401993.1 protein_id gnl|my_center|LOCUS_44210 95106 92770 gene locus_tag LOCUS_44220 95106 92770 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640158.1 protein_id gnl|my_center|LOCUS_44220 96575 95385 gene locus_tag LOCUS_44230 96575 95385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 96790 96981 gene locus_tag LOCUS_44240 96790 96981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 97151 97444 gene locus_tag LOCUS_44250 97151 97444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 97431 99869 gene locus_tag LOCUS_44260 97431 99869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 99913 100179 gene locus_tag LOCUS_44270 99913 100179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 100215 101762 gene locus_tag LOCUS_44280 100215 101762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 101941 102414 gene locus_tag LOCUS_44290 101941 102414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 102398 102634 gene locus_tag LOCUS_44300 102398 102634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 103337 102732 gene locus_tag LOCUS_44310 103337 102732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_44310 103761 103399 gene locus_tag LOCUS_44320 103761 103399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 104129 103932 gene locus_tag LOCUS_44330 104129 103932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44330 >Feature sequence16 1481 1654 gene locus_tag LOCUS_44340 1481 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 2084 1905 gene locus_tag LOCUS_44350 2084 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 3805 4506 gene locus_tag LOCUS_44360 3805 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44360 4541 4702 gene locus_tag LOCUS_44370 4541 4702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 4935 5225 gene locus_tag LOCUS_44380 4935 5225 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143513.1 protein_id gnl|my_center|LOCUS_44380 5222 5569 gene locus_tag LOCUS_44390 5222 5569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 5572 5700 gene locus_tag LOCUS_44400 5572 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 6299 6541 gene locus_tag LOCUS_44410 6299 6541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 6538 6876 gene locus_tag LOCUS_44420 6538 6876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44420 6986 7420 gene locus_tag LOCUS_44430 6986 7420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 8422 8204 gene locus_tag LOCUS_44440 8422 8204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 8764 8994 gene locus_tag LOCUS_44450 8764 8994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 8987 9403 gene locus_tag LOCUS_44460 8987 9403 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484774.1 protein_id gnl|my_center|LOCUS_44460 9536 9979 gene locus_tag LOCUS_44470 9536 9979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 10641 11678 gene locus_tag LOCUS_44480 10641 11678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 11732 12112 gene locus_tag LOCUS_44490 11732 12112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 12090 12611 gene locus_tag LOCUS_44500 12090 12611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 12613 13404 gene locus_tag LOCUS_44510 12613 13404 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265642.1 protein_id gnl|my_center|LOCUS_44510 13534 13719 gene locus_tag LOCUS_44520 13534 13719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 14421 14723 gene locus_tag LOCUS_44530 14421 14723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44530 14859 15392 gene locus_tag LOCUS_44540 14859 15392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44540 15492 16187 gene locus_tag LOCUS_44550 15492 16187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 16249 16773 gene locus_tag LOCUS_44560 16249 16773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 17648 16791 gene locus_tag LOCUS_44570 17648 16791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 17715 17981 gene locus_tag LOCUS_44580 17715 17981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 19215 18097 gene locus_tag LOCUS_44590 19215 18097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 20801 19254 gene locus_tag LOCUS_44600 20801 19254 CDS product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405139.1 protein_id gnl|my_center|LOCUS_44600 20947 21102 gene locus_tag LOCUS_44610 20947 21102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 21190 21678 gene locus_tag LOCUS_44620 21190 21678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44620 21575 22177 gene locus_tag LOCUS_44630 21575 22177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44630 22359 23381 gene locus_tag LOCUS_44640 22359 23381 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 protein_id gnl|my_center|LOCUS_44640 23999 23388 gene locus_tag LOCUS_44650 23999 23388 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417984.1 protein_id gnl|my_center|LOCUS_44650 24185 25276 gene locus_tag LOCUS_44660 24185 25276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 25725 26696 gene locus_tag LOCUS_44670 25725 26696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44670 27064 28434 gene locus_tag LOCUS_44680 gene tldD 27064 28434 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098866.1 protein_id gnl|my_center|LOCUS_44680 28557 29906 gene locus_tag LOCUS_44690 28557 29906 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174621.1 protein_id gnl|my_center|LOCUS_44690 30302 30916 gene locus_tag LOCUS_44700 30302 30916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 30897 31355 gene locus_tag LOCUS_44710 30897 31355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 32374 33009 gene locus_tag LOCUS_44720 32374 33009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 33125 33430 gene locus_tag LOCUS_44730 33125 33430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 33661 33885 gene locus_tag LOCUS_44740 33661 33885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 34462 35559 gene locus_tag LOCUS_44750 gene nhaA 34462 35559 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963884.1 protein_id gnl|my_center|LOCUS_44750 36136 36573 gene locus_tag LOCUS_44760 36136 36573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 36880 36695 gene locus_tag LOCUS_44770 36880 36695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 37448 36903 gene locus_tag LOCUS_44780 37448 36903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44780 38938 37409 gene locus_tag LOCUS_44790 38938 37409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 39101 40999 gene locus_tag LOCUS_44800 39101 40999 CDS product M61 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640643.1 protein_id gnl|my_center|LOCUS_44800 40986 41399 gene locus_tag LOCUS_44810 40986 41399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44810 41642 43351 gene locus_tag LOCUS_44820 gene sucB 41642 43351 CDS product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775679.1 protein_id gnl|my_center|LOCUS_44820 44252 45220 gene locus_tag LOCUS_44830 44252 45220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44830 45305 46390 gene locus_tag LOCUS_44840 45305 46390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44840 47168 46647 gene locus_tag LOCUS_44850 47168 46647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 47627 47779 gene locus_tag LOCUS_44860 47627 47779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 47804 48901 gene locus_tag LOCUS_44870 47804 48901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 49642 50940 gene locus_tag LOCUS_44880 49642 50940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 51751 51939 gene locus_tag LOCUS_44890 51751 51939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44890 51936 53078 gene locus_tag LOCUS_44900 gene ltrA 51936 53078 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561483.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44900 53097 54479 gene locus_tag LOCUS_44910 53097 54479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 54568 54807 gene locus_tag LOCUS_44920 54568 54807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 54876 55157 gene locus_tag LOCUS_44930 54876 55157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 55181 55393 gene locus_tag LOCUS_44940 55181 55393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 55347 55607 gene locus_tag LOCUS_44950 55347 55607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 55604 55996 gene locus_tag LOCUS_44960 55604 55996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 56084 56482 gene locus_tag LOCUS_44970 56084 56482 CDS product DUF6258 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173513078.1 protein_id gnl|my_center|LOCUS_44970 56668 57132 gene locus_tag LOCUS_44980 56668 57132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44980 57324 57689 gene locus_tag LOCUS_44990 57324 57689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 57763 58905 gene locus_tag LOCUS_45000 57763 58905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45000 58895 59161 gene locus_tag LOCUS_45010 58895 59161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812455.1 protein_id gnl|my_center|LOCUS_45010 59503 59961 gene locus_tag LOCUS_45020 59503 59961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 60721 61125 gene locus_tag LOCUS_45030 60721 61125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 61907 66409 gene locus_tag LOCUS_45040 61907 66409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 67359 66439 gene locus_tag LOCUS_45050 67359 66439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45050 67671 70490 gene locus_tag LOCUS_45060 67671 70490 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 protein_id gnl|my_center|LOCUS_45060 70588 71607 gene locus_tag LOCUS_45070 70588 71607 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_45070 72437 74011 gene locus_tag LOCUS_45080 72437 74011 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_45080 74004 74420 gene locus_tag LOCUS_45090 74004 74420 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525071.1 protein_id gnl|my_center|LOCUS_45090 74707 75147 gene locus_tag LOCUS_45100 gene tsaE 74707 75147 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679136.1 protein_id gnl|my_center|LOCUS_45100 75273 75746 gene locus_tag LOCUS_45110 75273 75746 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117417247.1 protein_id gnl|my_center|LOCUS_45110 75870 76313 gene locus_tag LOCUS_45120 75870 76313 CDS product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923583.1 protein_id gnl|my_center|LOCUS_45120 77068 76400 gene locus_tag LOCUS_45130 77068 76400 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963792.1 protein_id gnl|my_center|LOCUS_45130 77166 77621 gene locus_tag LOCUS_45140 77166 77621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45140 79021 77618 gene locus_tag LOCUS_45150 79021 77618 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027563.1 protein_id gnl|my_center|LOCUS_45150 79576 79034 gene locus_tag LOCUS_45160 79576 79034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45160 79640 80203 gene locus_tag LOCUS_45170 79640 80203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 82390 80210 gene locus_tag LOCUS_45180 82390 80210 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203279.1 protein_id gnl|my_center|LOCUS_45180 83200 82406 gene locus_tag LOCUS_45190 83200 82406 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948031.1 protein_id gnl|my_center|LOCUS_45190 83870 83208 gene locus_tag LOCUS_45200 83870 83208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 84516 84064 gene locus_tag LOCUS_45210 84516 84064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45210 84959 84483 gene locus_tag LOCUS_45220 84959 84483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 86738 85347 gene locus_tag LOCUS_45230 gene radA 86738 85347 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940957.1 protein_id gnl|my_center|LOCUS_45230 87328 86738 gene locus_tag LOCUS_45240 87328 86738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45240 87422 88120 gene locus_tag LOCUS_45250 87422 88120 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391964.1 protein_id gnl|my_center|LOCUS_45250 88165 89298 gene locus_tag LOCUS_45260 88165 89298 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235014.1 protein_id gnl|my_center|LOCUS_45260 89306 89668 gene locus_tag LOCUS_45270 89306 89668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45270 89665 90003 gene locus_tag LOCUS_45280 89665 90003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45280 90039 90515 gene locus_tag LOCUS_45290 gene ispF 90039 90515 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404396.1 protein_id gnl|my_center|LOCUS_45290 91170 90673 gene locus_tag LOCUS_45300 91170 90673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 91836 92600 gene locus_tag LOCUS_45310 91836 92600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45310 92709 93713 gene locus_tag LOCUS_45320 92709 93713 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228437.1 protein_id gnl|my_center|LOCUS_45320 93940 95433 gene locus_tag LOCUS_45330 93940 95433 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970667.1 protein_id gnl|my_center|LOCUS_45330 96639 95662 gene locus_tag LOCUS_45340 96639 95662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45340 97651 99285 gene locus_tag LOCUS_45350 97651 99285 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766069.1 protein_id gnl|my_center|LOCUS_45350 >Feature sequence17 1585 1848 gene locus_tag LOCUS_45360 1585 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45360 1910 2503 gene locus_tag LOCUS_45370 1910 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 3075 2884 gene locus_tag LOCUS_45380 3075 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 5153 4773 gene locus_tag LOCUS_45390 5153 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 7257 7015 gene locus_tag LOCUS_45400 7257 7015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 8106 7930 gene locus_tag LOCUS_45410 8106 7930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45410 8861 8727 gene locus_tag LOCUS_45420 8861 8727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45420 9217 8861 gene locus_tag LOCUS_45430 9217 8861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45430 9651 9463 gene locus_tag LOCUS_45440 9651 9463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45440 10252 9698 gene locus_tag LOCUS_45450 10252 9698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45450 10610 10296 gene locus_tag LOCUS_45460 10610 10296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45460 10805 10635 gene locus_tag LOCUS_45470 10805 10635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 11665 11862 gene locus_tag LOCUS_45480 11665 11862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 12899 12486 gene locus_tag LOCUS_45490 12899 12486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45490 13527 12985 gene locus_tag LOCUS_45500 13527 12985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45500 14030 14293 gene locus_tag LOCUS_45510 14030 14293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45510 14259 14717 gene locus_tag LOCUS_45520 14259 14717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45520 15387 15157 gene locus_tag LOCUS_45530 15387 15157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 15299 15787 gene locus_tag LOCUS_45540 15299 15787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45540 15792 16373 gene locus_tag LOCUS_45550 15792 16373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 16540 17337 gene locus_tag LOCUS_45560 16540 17337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45560 17484 18533 gene locus_tag LOCUS_45570 17484 18533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 19350 18556 gene locus_tag LOCUS_45580 gene trpA 19350 18556 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391175.1 protein_id gnl|my_center|LOCUS_45580 20673 19486 gene locus_tag LOCUS_45590 gene trpB 20673 19486 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258563.1 protein_id gnl|my_center|LOCUS_45590 23131 20663 gene locus_tag LOCUS_45600 23131 20663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 23681 23121 gene locus_tag LOCUS_45610 23681 23121 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_45610 23912 24427 gene locus_tag LOCUS_45620 23912 24427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 24424 27189 gene locus_tag LOCUS_45630 24424 27189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45630 27134 31840 gene locus_tag LOCUS_45640 27134 31840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 32757 32119 gene locus_tag LOCUS_45650 32757 32119 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_45650 33250 32744 gene locus_tag LOCUS_45660 33250 32744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 34029 33247 gene locus_tag LOCUS_45670 gene trpC 34029 33247 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337146.1 protein_id gnl|my_center|LOCUS_45670 35173 34088 gene locus_tag LOCUS_45680 gene trpD 35173 34088 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_45680 35384 36337 gene locus_tag LOCUS_45690 35384 36337 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259643.1 protein_id gnl|my_center|LOCUS_45690 37872 36604 gene locus_tag LOCUS_45700 37872 36604 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257055.1 protein_id gnl|my_center|LOCUS_45700 39228 37939 gene locus_tag LOCUS_45710 39228 37939 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140349.1 protein_id gnl|my_center|LOCUS_45710 39496 39570 gene locus_tag LOCUS_t00410 39496 39570 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 39837 41807 gene locus_tag LOCUS_45720 gene thrS 39837 41807 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881086.1 protein_id gnl|my_center|LOCUS_45720 42025 42453 gene locus_tag LOCUS_45730 gene infC 42025 42453 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_45730 42538 42741 gene locus_tag LOCUS_45740 gene rpmI 42538 42741 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300673.1 protein_id gnl|my_center|LOCUS_45740 42838 43215 gene locus_tag LOCUS_45750 gene rplT 42838 43215 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942165.1 protein_id gnl|my_center|LOCUS_45750 43425 44450 gene locus_tag LOCUS_45760 gene pheS 43425 44450 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965654.1 protein_id gnl|my_center|LOCUS_45760 44519 44824 gene locus_tag LOCUS_45770 44519 44824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 44829 46907 gene locus_tag LOCUS_45780 gene pheT 44829 46907 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545282.1 protein_id gnl|my_center|LOCUS_45780 47499 47780 gene locus_tag LOCUS_45790 47499 47780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 47786 48175 gene locus_tag LOCUS_45800 47786 48175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45800 48744 49508 gene locus_tag LOCUS_45810 48744 49508 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_45810 51023 49620 gene locus_tag LOCUS_45820 gene rho 51023 49620 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_45820 51827 51234 gene locus_tag LOCUS_45830 gene yihA 51827 51234 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229621.1 protein_id gnl|my_center|LOCUS_45830 52038 52304 gene locus_tag LOCUS_45840 52038 52304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45840 52297 52587 gene locus_tag LOCUS_45850 52297 52587 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143494.1 protein_id gnl|my_center|LOCUS_45850 53366 52944 gene locus_tag LOCUS_45860 53366 52944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 55899 53473 gene locus_tag LOCUS_45870 gene lon 55899 53473 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071918.1 protein_id gnl|my_center|LOCUS_45870 57425 56256 gene locus_tag LOCUS_45880 gene clpX 57425 56256 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_45880 58207 57635 gene locus_tag LOCUS_45890 gene clpP 58207 57635 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880859.1 protein_id gnl|my_center|LOCUS_45890 59813 58398 gene locus_tag LOCUS_45900 gene tig 59813 58398 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729253.1 protein_id gnl|my_center|LOCUS_45900 59965 59881 gene locus_tag LOCUS_t00420 59965 59881 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 60406 60095 gene locus_tag LOCUS_45910 60406 60095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 60470 62182 gene locus_tag LOCUS_45920 60470 62182 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943699.1 protein_id gnl|my_center|LOCUS_45920 62893 62567 gene locus_tag LOCUS_45930 62893 62567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45930 64377 62890 gene locus_tag LOCUS_45940 64377 62890 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_45940 64511 66031 gene locus_tag LOCUS_45950 64511 66031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45950 66064 67425 gene locus_tag LOCUS_45960 gene pabB 66064 67425 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015796.1 protein_id gnl|my_center|LOCUS_45960 67993 68427 gene locus_tag LOCUS_45970 gene tolR 67993 68427 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086126.1 protein_id gnl|my_center|LOCUS_45970 68509 69309 gene locus_tag LOCUS_45980 68509 69309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 69434 69700 gene locus_tag LOCUS_45990 gene rpsT 69434 69700 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273615.1 protein_id gnl|my_center|LOCUS_45990 71289 70237 gene locus_tag LOCUS_46000 gene holA 71289 70237 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362655.1 protein_id gnl|my_center|LOCUS_46000 71847 71296 gene locus_tag LOCUS_46010 71847 71296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46010 72635 71844 gene locus_tag LOCUS_46020 gene folP 72635 71844 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545277.1 protein_id gnl|my_center|LOCUS_46020 74679 72760 gene locus_tag LOCUS_46030 gene ftsH 74679 72760 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_46030 75938 74928 gene locus_tag LOCUS_46040 75938 74928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46040 77343 75955 gene locus_tag LOCUS_46050 gene argH 77343 75955 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368911.1 protein_id gnl|my_center|LOCUS_46050 77465 77890 gene locus_tag LOCUS_46060 gene argR 77465 77890 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810957.1 protein_id gnl|my_center|LOCUS_46060 78092 79291 gene locus_tag LOCUS_46070 78092 79291 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227831.1 protein_id gnl|my_center|LOCUS_46070 79482 80564 gene locus_tag LOCUS_46080 79482 80564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 80793 82193 gene locus_tag LOCUS_46090 gene cysS 80793 82193 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570132.1 protein_id gnl|my_center|LOCUS_46090 82785 82228 gene locus_tag LOCUS_46100 82785 82228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 83747 82767 gene locus_tag LOCUS_46110 83747 82767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46110 84320 83751 gene locus_tag LOCUS_46120 84320 83751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46120 85493 84321 gene locus_tag LOCUS_46130 85493 84321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 85686 86822 gene locus_tag LOCUS_46140 gene pdhA 85686 86822 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596096.1 protein_id gnl|my_center|LOCUS_46140 86966 87355 gene locus_tag LOCUS_46150 86966 87355 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 protein_id gnl|my_center|LOCUS_46150 87511 88485 gene locus_tag LOCUS_46160 87511 88485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46160 88924 90186 gene locus_tag LOCUS_46170 88924 90186 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404704.1 protein_id gnl|my_center|LOCUS_46170 91270 90509 gene locus_tag LOCUS_46180 91270 90509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46180 91397 92353 gene locus_tag LOCUS_46190 91397 92353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46190 92868 92398 gene locus_tag LOCUS_46200 92868 92398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46200 93386 92943 gene locus_tag LOCUS_46210 93386 92943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 93975 93412 gene locus_tag LOCUS_46220 93975 93412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 94817 93972 gene locus_tag LOCUS_46230 gene iolI 94817 93972 CDS product 2-keto-myo-inositol isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244546.1 protein_id gnl|my_center|LOCUS_46230 95612 95094 gene locus_tag LOCUS_46240 95612 95094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46240 97195 95612 gene locus_tag LOCUS_46250 97195 95612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46250 98219 97263 gene locus_tag LOCUS_46260 98219 97263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46260 98404 99786 gene locus_tag LOCUS_46270 98404 99786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 >Feature sequence18 354 611 gene locus_tag LOCUS_46280 354 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46280 611 1084 gene locus_tag LOCUS_46290 611 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46290 1481 1813 gene locus_tag LOCUS_46300 1481 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 3081 2758 gene locus_tag LOCUS_46310 3081 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46310 4805 3063 gene locus_tag LOCUS_46320 4805 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 6188 5922 gene locus_tag LOCUS_46330 6188 5922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46330 6652 6185 gene locus_tag LOCUS_46340 6652 6185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46340 7985 6729 gene locus_tag LOCUS_46350 7985 6729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46350 8833 8264 gene locus_tag LOCUS_46360 8833 8264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46360 9410 8847 gene locus_tag LOCUS_46370 9410 8847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 11406 9388 gene locus_tag LOCUS_46380 11406 9388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46380 11678 11403 gene locus_tag LOCUS_46390 11678 11403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 12777 11587 gene locus_tag LOCUS_46400 gene ltrA 12777 11587 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561483.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46400 13534 14361 gene locus_tag LOCUS_46410 13534 14361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46410 14253 14861 gene locus_tag LOCUS_46420 14253 14861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46420 15224 14985 gene locus_tag LOCUS_46430 15224 14985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 15445 15110 gene locus_tag LOCUS_46440 15445 15110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46440 16226 15555 gene locus_tag LOCUS_46450 16226 15555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 16725 16255 gene locus_tag LOCUS_46460 16725 16255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46460 17224 16784 gene locus_tag LOCUS_46470 17224 16784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 17834 17130 gene locus_tag LOCUS_46480 17834 17130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 18712 17831 gene locus_tag LOCUS_46490 18712 17831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46490 19131 18697 gene locus_tag LOCUS_46500 19131 18697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46500 20104 19094 gene locus_tag LOCUS_46510 20104 19094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 20428 21945 gene locus_tag LOCUS_46520 20428 21945 CDS product IS5-like element ISLca3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673997.1 protein_id gnl|my_center|LOCUS_46520 22514 22065 gene locus_tag LOCUS_46530 22514 22065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46530 22876 22511 gene locus_tag LOCUS_46540 22876 22511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46540 24275 22905 gene locus_tag LOCUS_46550 24275 22905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46550 25038 24244 gene locus_tag LOCUS_46560 25038 24244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 25478 25047 gene locus_tag LOCUS_46570 25478 25047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46570 25360 25650 gene locus_tag LOCUS_46580 25360 25650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 26347 25685 gene locus_tag LOCUS_46590 26347 25685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 27623 26640 gene locus_tag LOCUS_46600 27623 26640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 30910 28073 gene locus_tag LOCUS_46610 30910 28073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46610 31540 31082 gene locus_tag LOCUS_46620 31540 31082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 32088 31747 gene locus_tag LOCUS_46630 32088 31747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 32394 32699 gene locus_tag LOCUS_46640 32394 32699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 33006 32605 gene locus_tag LOCUS_46650 33006 32605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 33786 33019 gene locus_tag LOCUS_46660 33786 33019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 34618 33779 gene locus_tag LOCUS_46670 34618 33779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46670 35300 34692 gene locus_tag LOCUS_46680 35300 34692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46680 36201 35863 gene locus_tag LOCUS_46690 36201 35863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46690 37658 36201 gene locus_tag LOCUS_46700 37658 36201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46700 37998 37711 gene locus_tag LOCUS_46710 37998 37711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108081.1 protein_id gnl|my_center|LOCUS_46710 39414 38002 gene locus_tag LOCUS_46720 39414 38002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46720 40115 39414 gene locus_tag LOCUS_46730 40115 39414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46730 41581 40298 gene locus_tag LOCUS_46740 41581 40298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 42414 41653 gene locus_tag LOCUS_46750 42414 41653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46750 43007 42408 gene locus_tag LOCUS_46760 43007 42408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46760 45318 43495 gene locus_tag LOCUS_46770 45318 43495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46770 45609 46394 gene locus_tag LOCUS_46780 45609 46394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46780 47720 46722 gene locus_tag LOCUS_46790 47720 46722 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143051.1 protein_id gnl|my_center|LOCUS_46790 48694 47807 gene locus_tag LOCUS_46800 gene truB 48694 47807 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399352.1 protein_id gnl|my_center|LOCUS_46800 48801 49337 gene locus_tag LOCUS_46810 48801 49337 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392594.1 protein_id gnl|my_center|LOCUS_46810 49439 49777 gene locus_tag LOCUS_46820 49439 49777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46820 49869 50378 gene locus_tag LOCUS_46830 49869 50378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46830 50439 52622 gene locus_tag LOCUS_46840 50439 52622 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962866.1 protein_id gnl|my_center|LOCUS_46840 52752 52952 gene locus_tag LOCUS_46850 52752 52952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 53069 53344 gene locus_tag LOCUS_46860 53069 53344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 53341 56076 gene locus_tag LOCUS_46870 gene alaS 53341 56076 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940824.1 protein_id gnl|my_center|LOCUS_46870 56433 56149 gene locus_tag LOCUS_46880 56433 56149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46880 56799 56981 gene locus_tag LOCUS_46890 56799 56981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46890 57205 57281 gene locus_tag LOCUS_t00430 57205 57281 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 58109 59428 gene locus_tag LOCUS_46900 58109 59428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46900 59582 61252 gene locus_tag LOCUS_46910 gene recN 59582 61252 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_46910 61323 62330 gene locus_tag LOCUS_46920 61323 62330 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227687.1 protein_id gnl|my_center|LOCUS_46920 62507 63001 gene locus_tag LOCUS_46930 62507 63001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 63829 63017 gene locus_tag LOCUS_46940 63829 63017 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928448.1 protein_id gnl|my_center|LOCUS_46940 64390 63953 gene locus_tag LOCUS_46950 64390 63953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46950 64440 65306 gene locus_tag LOCUS_46960 64440 65306 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047532.1 protein_id gnl|my_center|LOCUS_46960 65477 65755 gene locus_tag LOCUS_46970 65477 65755 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939083.1 protein_id gnl|my_center|LOCUS_46970 65848 66870 gene locus_tag LOCUS_46980 65848 66870 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903481.1 protein_id gnl|my_center|LOCUS_46980 66943 69258 gene locus_tag LOCUS_46990 66943 69258 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035498.1 protein_id gnl|my_center|LOCUS_46990 71660 70629 gene locus_tag LOCUS_47000 71660 70629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47000 73090 72488 gene locus_tag LOCUS_47010 73090 72488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47010 74065 73763 gene locus_tag LOCUS_47020 74065 73763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47020 75524 75219 gene locus_tag LOCUS_47030 75524 75219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47030 77010 76621 gene locus_tag LOCUS_47040 77010 76621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47040 77585 77274 gene locus_tag LOCUS_47050 77585 77274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47050 78507 78043 gene locus_tag LOCUS_47060 78507 78043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47060 80505 79579 gene locus_tag LOCUS_47070 80505 79579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47070 81227 80922 gene locus_tag LOCUS_47080 81227 80922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47080 81478 81230 gene locus_tag LOCUS_47090 81478 81230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47090 81756 81514 gene locus_tag LOCUS_47100 81756 81514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 83942 83493 gene locus_tag LOCUS_47110 83942 83493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47110 84649 83918 gene locus_tag LOCUS_47120 84649 83918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47120 84938 84717 gene locus_tag LOCUS_47130 84938 84717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 88080 86155 gene locus_tag LOCUS_47140 88080 86155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47140 88830 89072 gene locus_tag LOCUS_47150 88830 89072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47150 89079 89216 gene locus_tag LOCUS_47160 89079 89216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47160 89567 90058 gene locus_tag LOCUS_47170 89567 90058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_47170 >Feature sequence19 813 610 gene locus_tag LOCUS_47180 813 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47180 2036 2314 gene locus_tag LOCUS_47190 2036 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_47190 2419 2607 gene locus_tag LOCUS_47200 2419 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_47200 2798 2962 gene locus_tag LOCUS_47210 2798 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47210 3119 3349 gene locus_tag LOCUS_47220 3119 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47220 3598 4023 gene locus_tag LOCUS_47230 3598 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47230 4238 4011 gene locus_tag LOCUS_47240 4238 4011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 4237 5862 gene locus_tag LOCUS_47250 4237 5862 CDS product heme peroxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929330.1 protein_id gnl|my_center|LOCUS_47250 5873 6196 gene locus_tag LOCUS_47260 5873 6196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 8792 7578 gene locus_tag LOCUS_47270 8792 7578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47270 10111 8750 gene locus_tag LOCUS_47280 10111 8750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 10683 10108 gene locus_tag LOCUS_47290 10683 10108 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_47290 10824 11279 gene locus_tag LOCUS_47300 10824 11279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47300 11279 11965 gene locus_tag LOCUS_47310 11279 11965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47310 13032 12157 gene locus_tag LOCUS_47320 13032 12157 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490863.1 protein_id gnl|my_center|LOCUS_47320 16082 13608 gene locus_tag LOCUS_47330 16082 13608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 16242 17597 gene locus_tag LOCUS_47340 16242 17597 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_47340 18088 17594 gene locus_tag LOCUS_47350 18088 17594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 18283 19926 gene locus_tag LOCUS_47360 18283 19926 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257715.1 protein_id gnl|my_center|LOCUS_47360 20241 20438 gene locus_tag LOCUS_47370 20241 20438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47370 20643 21200 gene locus_tag LOCUS_47380 20643 21200 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082850.1 protein_id gnl|my_center|LOCUS_47380 21361 23196 gene locus_tag LOCUS_47390 21361 23196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47390 23204 25114 gene locus_tag LOCUS_47400 23204 25114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47400 25211 25360 gene locus_tag LOCUS_47410 25211 25360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47410 25579 27324 gene locus_tag LOCUS_47420 25579 27324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47420 27328 28629 gene locus_tag LOCUS_47430 27328 28629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47430 28647 29600 gene locus_tag LOCUS_47440 28647 29600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47440 29760 30110 gene locus_tag LOCUS_47450 29760 30110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47450 30125 30940 gene locus_tag LOCUS_47460 30125 30940 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919320.1 protein_id gnl|my_center|LOCUS_47460 30945 31670 gene locus_tag LOCUS_47470 30945 31670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47470 31684 32088 gene locus_tag LOCUS_47480 31684 32088 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_47480 32132 33499 gene locus_tag LOCUS_47490 32132 33499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 34504 33551 gene locus_tag LOCUS_47500 34504 33551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47500 34597 35148 gene locus_tag LOCUS_47510 34597 35148 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808789.1 protein_id gnl|my_center|LOCUS_47510 35148 35654 gene locus_tag LOCUS_47520 35148 35654 CDS product DUF1648 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927006.1 protein_id gnl|my_center|LOCUS_47520 35651 35995 gene locus_tag LOCUS_47530 35651 35995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389227.1 protein_id gnl|my_center|LOCUS_47530 36067 37365 gene locus_tag LOCUS_47540 36067 37365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47540 37481 39724 gene locus_tag LOCUS_47550 37481 39724 CDS product transferrin receptor-like dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928760.1 protein_id gnl|my_center|LOCUS_47550 40675 39725 gene locus_tag LOCUS_47560 40675 39725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47560 41212 41973 gene locus_tag LOCUS_47570 41212 41973 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_47570 44023 42170 gene locus_tag LOCUS_47580 44023 42170 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_47580 44629 44054 gene locus_tag LOCUS_47590 44629 44054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47590 44659 45276 gene locus_tag LOCUS_47600 44659 45276 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872152.1 protein_id gnl|my_center|LOCUS_47600 45657 45283 gene locus_tag LOCUS_47610 45657 45283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 45885 46487 gene locus_tag LOCUS_47620 45885 46487 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762241.1 protein_id gnl|my_center|LOCUS_47620 46484 47185 gene locus_tag LOCUS_47630 46484 47185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47630 48200 47160 gene locus_tag LOCUS_47640 gene corA 48200 47160 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233650.1 protein_id gnl|my_center|LOCUS_47640 48330 49208 gene locus_tag LOCUS_47650 48330 49208 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405383.1 protein_id gnl|my_center|LOCUS_47650 49543 49947 gene locus_tag LOCUS_47660 49543 49947 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_47660 49995 51347 gene locus_tag LOCUS_47670 49995 51347 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839941.1 protein_id gnl|my_center|LOCUS_47670 51349 51900 gene locus_tag LOCUS_47680 51349 51900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47680 51911 52684 gene locus_tag LOCUS_47690 51911 52684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47690 55680 52885 gene locus_tag LOCUS_47700 55680 52885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47700 56804 55731 gene locus_tag LOCUS_47710 56804 55731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47710 57389 56811 gene locus_tag LOCUS_47720 57389 56811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47720 58106 57423 gene locus_tag LOCUS_47730 58106 57423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47730 58376 59632 gene locus_tag LOCUS_47740 58376 59632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47740 59636 61516 gene locus_tag LOCUS_47750 59636 61516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47750 61513 63267 gene locus_tag LOCUS_47760 61513 63267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47760 63302 64906 gene locus_tag LOCUS_47770 63302 64906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47770 65949 65182 gene locus_tag LOCUS_47780 65949 65182 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256575.1 protein_id gnl|my_center|LOCUS_47780 66171 66097 gene locus_tag LOCUS_t00440 66171 66097 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 67097 66438 gene locus_tag LOCUS_47790 67097 66438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47790 67554 67105 gene locus_tag LOCUS_47800 gene dtd 67554 67105 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426448.1 protein_id gnl|my_center|LOCUS_47800 68162 67677 gene locus_tag LOCUS_47810 68162 67677 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566814.1 protein_id gnl|my_center|LOCUS_47810 69175 68300 gene locus_tag LOCUS_47820 69175 68300 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391801.1 protein_id gnl|my_center|LOCUS_47820 70361 69291 gene locus_tag LOCUS_47830 gene mltG 70361 69291 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941176.1 protein_id gnl|my_center|LOCUS_47830 70438 71007 gene locus_tag LOCUS_47840 gene thpR 70438 71007 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583814.1 protein_id gnl|my_center|LOCUS_47840 71595 71014 gene locus_tag LOCUS_47850 71595 71014 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244088.1 protein_id gnl|my_center|LOCUS_47850 72623 71607 gene locus_tag LOCUS_47860 72623 71607 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080738.1 protein_id gnl|my_center|LOCUS_47860 72891 74123 gene locus_tag LOCUS_47870 gene ilvA 72891 74123 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259722.1 protein_id gnl|my_center|LOCUS_47870 76195 74456 gene locus_tag LOCUS_47880 76195 74456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47880 81323 76095 gene locus_tag LOCUS_47890 81323 76095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47890 81730 81446 gene locus_tag LOCUS_47900 81730 81446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47900 >Feature sequence20 1096 1458 gene locus_tag LOCUS_47910 1096 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47910 1523 1831 gene locus_tag LOCUS_47920 1523 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47920 1749 3131 gene locus_tag LOCUS_47930 1749 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47930 3461 3856 gene locus_tag LOCUS_47940 3461 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 3953 4471 gene locus_tag LOCUS_47950 3953 4471 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970949.1 protein_id gnl|my_center|LOCUS_47950 4679 7909 gene locus_tag LOCUS_47960 4679 7909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47960 7906 9723 gene locus_tag LOCUS_47970 7906 9723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47970 9651 9842 gene locus_tag LOCUS_47980 9651 9842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47980 9856 10758 gene locus_tag LOCUS_47990 9856 10758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47990 10846 11076 gene locus_tag LOCUS_48000 10846 11076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48000 11286 11669 gene locus_tag LOCUS_48010 11286 11669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48010 11666 12142 gene locus_tag LOCUS_48020 11666 12142 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131384.1 protein_id gnl|my_center|LOCUS_48020 12320 12877 gene locus_tag LOCUS_48030 12320 12877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48030 12914 16510 gene locus_tag LOCUS_48040 12914 16510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 16517 17371 gene locus_tag LOCUS_48050 16517 17371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48050 17868 18137 gene locus_tag LOCUS_48060 17868 18137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48060 18142 18966 gene locus_tag LOCUS_48070 18142 18966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 20153 19764 gene locus_tag LOCUS_48080 20153 19764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48080 24057 20164 gene locus_tag LOCUS_48090 24057 20164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48090 24607 23954 gene locus_tag LOCUS_48100 24607 23954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48100 24897 25178 gene locus_tag LOCUS_48110 24897 25178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48110 27783 25453 gene locus_tag LOCUS_48120 27783 25453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48120 27877 28218 gene locus_tag LOCUS_48130 27877 28218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48130 30938 28536 gene locus_tag LOCUS_48140 30938 28536 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928597.1 protein_id gnl|my_center|LOCUS_48140 30937 31725 gene locus_tag LOCUS_48150 30937 31725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48150 31749 31988 gene locus_tag LOCUS_48160 31749 31988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48160 32073 32273 gene locus_tag LOCUS_48170 32073 32273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48170 32283 33104 gene locus_tag LOCUS_48180 32283 33104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48180 33270 34460 gene locus_tag LOCUS_48190 33270 34460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48190 35190 34447 gene locus_tag LOCUS_48200 35190 34447 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_48200 35532 35212 gene locus_tag LOCUS_48210 35532 35212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48210 36352 35546 gene locus_tag LOCUS_48220 36352 35546 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114171.1 protein_id gnl|my_center|LOCUS_48220 37565 36834 gene locus_tag LOCUS_48230 37565 36834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48230 38422 37562 gene locus_tag LOCUS_48240 38422 37562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48240 38647 38426 gene locus_tag LOCUS_48250 38647 38426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48250 40301 39066 gene locus_tag LOCUS_48260 40301 39066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48260 41261 40440 gene locus_tag LOCUS_48270 41261 40440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48270 41631 43043 gene locus_tag LOCUS_48280 41631 43043 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827171.1 protein_id gnl|my_center|LOCUS_48280 43466 44473 gene locus_tag LOCUS_48290 43466 44473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 44621 46255 gene locus_tag LOCUS_48300 44621 46255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48300 46325 46828 gene locus_tag LOCUS_48310 46325 46828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48310 46831 47892 gene locus_tag LOCUS_48320 46831 47892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48320 47910 49019 gene locus_tag LOCUS_48330 47910 49019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48330 49024 50334 gene locus_tag LOCUS_48340 49024 50334 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147744042.1 protein_id gnl|my_center|LOCUS_48340 50277 50426 gene locus_tag LOCUS_48350 50277 50426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48350 50432 51109 gene locus_tag LOCUS_48360 50432 51109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48360 51097 51252 gene locus_tag LOCUS_48370 51097 51252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48370 51923 51609 gene locus_tag LOCUS_48380 51923 51609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48380 51994 52284 gene locus_tag LOCUS_48390 51994 52284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48390 52293 52976 gene locus_tag LOCUS_48400 52293 52976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48400 53082 53270 gene locus_tag LOCUS_48410 53082 53270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48410 53880 53656 gene locus_tag LOCUS_48420 53880 53656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48420 54783 54454 gene locus_tag LOCUS_48430 54783 54454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48430 55419 55153 gene locus_tag LOCUS_48440 55419 55153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48440 56682 55837 gene locus_tag LOCUS_48450 56682 55837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48450 57591 56809 gene locus_tag LOCUS_48460 57591 56809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48460 57950 57609 gene locus_tag LOCUS_48470 57950 57609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48470 58531 58034 gene locus_tag LOCUS_48480 58531 58034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48480 59753 58545 gene locus_tag LOCUS_48490 59753 58545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48490 60788 60240 gene locus_tag LOCUS_48500 60788 60240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48500 61405 60797 gene locus_tag LOCUS_48510 61405 60797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48510 63690 62584 gene locus_tag LOCUS_48520 63690 62584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 64609 63821 gene locus_tag LOCUS_48530 64609 63821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48530 64982 64623 gene locus_tag LOCUS_48540 64982 64623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48540 66070 65192 gene locus_tag LOCUS_48550 66070 65192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48550 66774 66079 gene locus_tag LOCUS_48560 66774 66079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48560 68947 68588 gene locus_tag LOCUS_48570 68947 68588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48570 >Feature sequence21 697 996 gene locus_tag LOCUS_48580 697 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48580 2341 2189 gene locus_tag LOCUS_48590 2341 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48590 2734 2561 gene locus_tag LOCUS_48600 2734 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48600 3398 3096 gene locus_tag LOCUS_48610 3398 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48610 3444 3644 gene locus_tag LOCUS_48620 3444 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48620 3635 4243 gene locus_tag LOCUS_48630 3635 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48630 4248 4448 gene locus_tag LOCUS_48640 4248 4448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48640 4487 5107 gene locus_tag LOCUS_48650 4487 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48650 5274 5651 gene locus_tag LOCUS_48660 5274 5651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48660 5648 6592 gene locus_tag LOCUS_48670 5648 6592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48670 7131 6721 gene locus_tag LOCUS_48680 7131 6721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48680 7222 8505 gene locus_tag LOCUS_48690 7222 8505 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_48690 8502 9005 gene locus_tag LOCUS_48700 8502 9005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 9423 8941 gene locus_tag LOCUS_48710 gene dps 9423 8941 CDS product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258826.1 protein_id gnl|my_center|LOCUS_48710 9915 9739 gene locus_tag LOCUS_48720 9915 9739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48720 10205 10011 gene locus_tag LOCUS_48730 10205 10011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48730 10917 10486 gene locus_tag LOCUS_48740 10917 10486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48740 13212 12193 gene locus_tag LOCUS_48750 13212 12193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48750 13890 13681 gene locus_tag LOCUS_48760 13890 13681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48760 14940 13900 gene locus_tag LOCUS_48770 14940 13900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48770 15588 15226 gene locus_tag LOCUS_48780 15588 15226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48780 16168 15974 gene locus_tag LOCUS_48790 16168 15974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48790 16489 16193 gene locus_tag LOCUS_48800 16489 16193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48800 17670 17260 gene locus_tag LOCUS_48810 17670 17260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48810 17900 17667 gene locus_tag LOCUS_48820 17900 17667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48820 19137 18004 gene locus_tag LOCUS_48830 19137 18004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48830 20010 19147 gene locus_tag LOCUS_48840 20010 19147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48840 20633 20007 gene locus_tag LOCUS_48850 20633 20007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48850 20783 21310 gene locus_tag LOCUS_48860 20783 21310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48860 22243 21296 gene locus_tag LOCUS_48870 22243 21296 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262600.1 protein_id gnl|my_center|LOCUS_48870 22444 23484 gene locus_tag LOCUS_48880 gene waaC 22444 23484 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942882.1 protein_id gnl|my_center|LOCUS_48880 23481 24557 gene locus_tag LOCUS_48890 23481 24557 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121221.1 protein_id gnl|my_center|LOCUS_48890 24663 25343 gene locus_tag LOCUS_48900 24663 25343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48900 25714 26070 gene locus_tag LOCUS_48910 25714 26070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48910 26201 26446 gene locus_tag LOCUS_48920 26201 26446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48920 27766 28044 gene locus_tag LOCUS_48930 27766 28044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_48930 28140 28967 gene locus_tag LOCUS_48940 28140 28967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48940 30823 31413 gene locus_tag LOCUS_48950 30823 31413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48950 33027 31846 gene locus_tag LOCUS_48960 33027 31846 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881286.1 protein_id gnl|my_center|LOCUS_48960 33428 33162 gene locus_tag LOCUS_48970 33428 33162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48970 34936 34502 gene locus_tag LOCUS_48980 34936 34502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48980 35327 35091 gene locus_tag LOCUS_48990 35327 35091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48990 35878 35324 gene locus_tag LOCUS_49000 35878 35324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49000 35968 36642 gene locus_tag LOCUS_49010 35968 36642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49010 36706 36954 gene locus_tag LOCUS_49020 36706 36954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49020 37587 39203 gene locus_tag LOCUS_49030 37587 39203 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459733.1 protein_id gnl|my_center|LOCUS_49030 40038 39310 gene locus_tag LOCUS_49040 40038 39310 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107771.1 protein_id gnl|my_center|LOCUS_49040 41822 40158 gene locus_tag LOCUS_49050 41822 40158 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392090.1 protein_id gnl|my_center|LOCUS_49050 42727 41981 gene locus_tag LOCUS_49060 42727 41981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49060 42825 43529 gene locus_tag LOCUS_49070 42825 43529 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938961.1 protein_id gnl|my_center|LOCUS_49070 43614 45263 gene locus_tag LOCUS_49080 43614 45263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49080 46315 45374 gene locus_tag LOCUS_49090 46315 45374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49090 46470 47321 gene locus_tag LOCUS_49100 gene pqqB 46470 47321 CDS product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229609.1 protein_id gnl|my_center|LOCUS_49100 47318 48097 gene locus_tag LOCUS_49110 47318 48097 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_49110 48120 48314 gene locus_tag LOCUS_49120 48120 48314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49120 48775 48302 gene locus_tag LOCUS_49130 48775 48302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49130 48890 49507 gene locus_tag LOCUS_49140 48890 49507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49140 49554 50729 gene locus_tag LOCUS_49150 gene megL 49554 50729 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017138.1 protein_id gnl|my_center|LOCUS_49150 50800 51861 gene locus_tag LOCUS_49160 gene arsB 50800 51861 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943585.1 protein_id gnl|my_center|LOCUS_49160 51858 52289 gene locus_tag LOCUS_49170 51858 52289 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_49170 52347 53012 gene locus_tag LOCUS_49180 52347 53012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49180 53186 54058 gene locus_tag LOCUS_49190 53186 54058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49190 54432 55907 gene locus_tag LOCUS_49200 gene glpK 54432 55907 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888563.1 protein_id gnl|my_center|LOCUS_49200 57328 56126 gene locus_tag LOCUS_49210 57328 56126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49210 59072 57750 gene locus_tag LOCUS_49220 59072 57750 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_49220 59369 60379 gene locus_tag LOCUS_49230 59369 60379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49230 60408 60638 gene locus_tag LOCUS_49240 60408 60638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49240 61804 62133 gene locus_tag LOCUS_49250 61804 62133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49250 65279 65491 gene locus_tag LOCUS_49260 65279 65491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49260 >Feature sequence22 1979 1083 gene locus_tag LOCUS_49270 gene prfB 1979 1083 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 protein_id gnl|my_center|LOCUS_49270 4379 3216 gene locus_tag LOCUS_49280 4379 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49280 4551 4823 gene locus_tag LOCUS_49290 4551 4823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49290 7369 5615 gene locus_tag LOCUS_49300 7369 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49300 7667 7592 gene locus_tag LOCUS_t00450 7667 7592 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 12728 7857 gene locus_tag LOCUS_49310 12728 7857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49310 13379 12741 gene locus_tag LOCUS_49320 13379 12741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49320 13797 13402 gene locus_tag LOCUS_49330 13797 13402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49330 14487 13801 gene locus_tag LOCUS_49340 14487 13801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49340 15062 14532 gene locus_tag LOCUS_49350 15062 14532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49350 17810 15198 gene locus_tag LOCUS_49360 17810 15198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49360 19371 18784 gene locus_tag LOCUS_49370 19371 18784 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946524.1 protein_id gnl|my_center|LOCUS_49370 20824 20213 gene locus_tag LOCUS_49380 20824 20213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49380 22328 20778 gene locus_tag LOCUS_49390 22328 20778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49390 23329 22325 gene locus_tag LOCUS_49400 23329 22325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49400 25479 25183 gene locus_tag LOCUS_49410 25479 25183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49410 26914 25442 gene locus_tag LOCUS_49420 26914 25442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_49420 27415 26951 gene locus_tag LOCUS_49430 27415 26951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49430 28402 27563 gene locus_tag LOCUS_49440 28402 27563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49440 29234 28386 gene locus_tag LOCUS_49450 29234 28386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49450 29764 29231 gene locus_tag LOCUS_49460 29764 29231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49460 31053 29761 gene locus_tag LOCUS_49470 31053 29761 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49470 31369 31061 gene locus_tag LOCUS_49480 31369 31061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49480 31716 32105 gene locus_tag LOCUS_49490 31716 32105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49490 32627 34969 gene locus_tag LOCUS_49500 gene polA 32627 34969 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704214.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49500 34852 35310 gene locus_tag LOCUS_49510 34852 35310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49510 36986 35493 gene locus_tag LOCUS_49520 36986 35493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49520 38368 36983 gene locus_tag LOCUS_49530 38368 36983 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920567.1 protein_id gnl|my_center|LOCUS_49530 41490 38365 gene locus_tag LOCUS_49540 41490 38365 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941986.1 protein_id gnl|my_center|LOCUS_49540 41786 41598 gene locus_tag LOCUS_49550 41786 41598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49550 41974 41783 gene locus_tag LOCUS_49560 41974 41783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49560 42404 41997 gene locus_tag LOCUS_49570 42404 41997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49570 42918 42538 gene locus_tag LOCUS_49580 42918 42538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49580 44179 43100 gene locus_tag LOCUS_49590 44179 43100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 45776 44232 gene locus_tag LOCUS_49600 45776 44232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49600 46697 46041 gene locus_tag LOCUS_49610 46697 46041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49610 46769 46975 gene locus_tag LOCUS_49620 46769 46975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49620 47653 47578 gene locus_tag LOCUS_t00460 47653 47578 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 48094 47747 gene locus_tag LOCUS_49630 48094 47747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49630 48544 48326 gene locus_tag LOCUS_49640 48544 48326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49640 48980 48597 gene locus_tag LOCUS_49650 48980 48597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49650 51233 51382 gene locus_tag LOCUS_49660 51233 51382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49660 51404 51613 gene locus_tag LOCUS_49670 51404 51613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49670 >Feature sequence23 51 395 gene locus_tag LOCUS_49680 51 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49680 414 3074 gene locus_tag LOCUS_49690 414 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49690 4261 3125 gene locus_tag LOCUS_49700 4261 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49700 6258 4417 gene locus_tag LOCUS_49710 6258 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49710 8238 6409 gene locus_tag LOCUS_49720 8238 6409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49720 9144 8437 gene locus_tag LOCUS_49730 9144 8437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49730 9285 10274 gene locus_tag LOCUS_49740 gene msrP 9285 10274 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257868.1 protein_id gnl|my_center|LOCUS_49740 10330 10977 gene locus_tag LOCUS_49750 gene msrQ 10330 10977 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527905.1 protein_id gnl|my_center|LOCUS_49750 11819 11112 gene locus_tag LOCUS_49760 11819 11112 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880556.1 protein_id gnl|my_center|LOCUS_49760 11866 12108 gene locus_tag LOCUS_49770 11866 12108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49770 12105 12563 gene locus_tag LOCUS_49780 12105 12563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49780 12792 12595 gene locus_tag LOCUS_49790 12792 12595 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243869.1 protein_id gnl|my_center|LOCUS_49790 12919 13737 gene locus_tag LOCUS_49800 12919 13737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49800 14379 13816 gene locus_tag LOCUS_49810 14379 13816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49810 14859 14536 gene locus_tag LOCUS_49820 14859 14536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49820 17866 15098 gene locus_tag LOCUS_49830 17866 15098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49830 18260 18063 gene locus_tag LOCUS_49840 18260 18063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49840 19247 18384 gene locus_tag LOCUS_49850 19247 18384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49850 19974 19489 gene locus_tag LOCUS_49860 19974 19489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49860 22843 20522 gene locus_tag LOCUS_49870 22843 20522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49870 23268 22927 gene locus_tag LOCUS_49880 23268 22927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49880 23819 23262 gene locus_tag LOCUS_49890 23819 23262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49890 24470 23868 gene locus_tag LOCUS_49900 24470 23868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49900 25299 24487 gene locus_tag LOCUS_49910 25299 24487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49910 25847 25383 gene locus_tag LOCUS_49920 25847 25383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49920 27036 25750 gene locus_tag LOCUS_49930 27036 25750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49930 28583 27033 gene locus_tag LOCUS_49940 28583 27033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49940 29036 28671 gene locus_tag LOCUS_49950 29036 28671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49950 29613 29092 gene locus_tag LOCUS_49960 29613 29092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49960 29968 29537 gene locus_tag LOCUS_49970 29968 29537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49970 30239 29958 gene locus_tag LOCUS_49980 30239 29958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49980 31110 31035 gene locus_tag LOCUS_t00470 31110 31035 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 31711 31436 gene locus_tag LOCUS_49990 31711 31436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49990 31632 31859 gene locus_tag LOCUS_50000 31632 31859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50000 33138 32116 gene locus_tag LOCUS_50010 gene recA 33138 32116 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_50010 35037 33451 gene locus_tag LOCUS_50020 35037 33451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50020 35167 36555 gene locus_tag LOCUS_50030 35167 36555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50030 36592 39051 gene locus_tag LOCUS_50040 36592 39051 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144060.1 protein_id gnl|my_center|LOCUS_50040 39320 39048 gene locus_tag LOCUS_50050 39320 39048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50050 39590 39883 gene locus_tag LOCUS_50060 39590 39883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50060 39896 40252 gene locus_tag LOCUS_50070 39896 40252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50070 40343 41302 gene locus_tag LOCUS_50080 40343 41302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50080 41386 41646 gene locus_tag LOCUS_50090 41386 41646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50090 41698 42591 gene locus_tag LOCUS_50100 41698 42591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50100 42600 42839 gene locus_tag LOCUS_50110 42600 42839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50110 42849 43538 gene locus_tag LOCUS_50120 42849 43538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50120 44083 44496 gene locus_tag LOCUS_50130 44083 44496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50130 44502 45929 gene locus_tag LOCUS_50140 44502 45929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50140 >Feature sequence24 479 300 gene locus_tag LOCUS_50150 479 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50150 601 726 gene locus_tag LOCUS_50160 601 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50160 1237 1401 gene locus_tag LOCUS_50170 1237 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50170 1906 1727 gene locus_tag LOCUS_50180 1906 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50180 3299 3060 gene locus_tag LOCUS_50190 3299 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50190 3827 3591 gene locus_tag LOCUS_50200 3827 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50200 5575 5348 gene locus_tag LOCUS_50210 5575 5348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50210 6555 5758 gene locus_tag LOCUS_50220 6555 5758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_50220 6916 6743 gene locus_tag LOCUS_50230 6916 6743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50230 7449 6835 gene locus_tag LOCUS_50240 7449 6835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50240 7989 7573 gene locus_tag LOCUS_50250 7989 7573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50250 8440 8835 gene locus_tag LOCUS_50260 8440 8835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50260 8909 9205 gene locus_tag LOCUS_50270 8909 9205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50270 9217 9531 gene locus_tag LOCUS_50280 9217 9531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_50280 9528 10481 gene locus_tag LOCUS_50290 9528 10481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50290 10524 10757 gene locus_tag LOCUS_50300 10524 10757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50300 10754 10921 gene locus_tag LOCUS_50310 10754 10921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50310 11035 11598 gene locus_tag LOCUS_50320 11035 11598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50320 11908 12096 gene locus_tag LOCUS_50330 11908 12096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50330 12125 12616 gene locus_tag LOCUS_50340 12125 12616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50340 13972 14703 gene locus_tag LOCUS_50350 13972 14703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50350 14739 15377 gene locus_tag LOCUS_50360 14739 15377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50360 15374 15625 gene locus_tag LOCUS_50370 15374 15625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50370 15622 15930 gene locus_tag LOCUS_50380 15622 15930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50380 15914 16747 gene locus_tag LOCUS_50390 15914 16747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50390 17283 17732 gene locus_tag LOCUS_50400 17283 17732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50400 18075 19727 gene locus_tag LOCUS_50410 18075 19727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50410 19964 20479 gene locus_tag LOCUS_50420 19964 20479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50420 21015 21371 gene locus_tag LOCUS_50430 21015 21371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50430 21613 21915 gene locus_tag LOCUS_50440 21613 21915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50440 22237 22581 gene locus_tag LOCUS_50450 22237 22581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50450 23121 24671 gene locus_tag LOCUS_50460 23121 24671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50460 24694 24906 gene locus_tag LOCUS_50470 24694 24906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50470 25673 25810 gene locus_tag LOCUS_50480 25673 25810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50480 26313 26594 gene locus_tag LOCUS_50490 26313 26594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50490 26984 27325 gene locus_tag LOCUS_50500 26984 27325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50500 27338 27898 gene locus_tag LOCUS_50510 27338 27898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50510 27868 28047 gene locus_tag LOCUS_50520 27868 28047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50520 28132 28665 gene locus_tag LOCUS_50530 28132 28665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50530 28598 28942 gene locus_tag LOCUS_50540 28598 28942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50540 29120 29488 gene locus_tag LOCUS_50550 29120 29488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50550 29859 30077 gene locus_tag LOCUS_50560 29859 30077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50560 30978 30706 gene locus_tag LOCUS_50570 30978 30706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50570 >Feature sequence25 671 102 gene locus_tag LOCUS_50580 671 102 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_50580 1246 806 gene locus_tag LOCUS_50590 1246 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50590 1588 1791 gene locus_tag LOCUS_50600 1588 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50600 2194 2012 gene locus_tag LOCUS_50610 2194 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50610 4465 4301 gene locus_tag LOCUS_50620 4465 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50620 5329 5015 gene locus_tag LOCUS_50630 5329 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50630 5800 5528 gene locus_tag LOCUS_50640 5800 5528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50640 6496 5849 gene locus_tag LOCUS_50650 6496 5849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50650 8116 6905 gene locus_tag LOCUS_50660 8116 6905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50660 8756 9070 gene locus_tag LOCUS_50670 8756 9070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50670 9219 9413 gene locus_tag LOCUS_50680 9219 9413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50680 9427 10062 gene locus_tag LOCUS_50690 9427 10062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50690 10114 10608 gene locus_tag LOCUS_50700 10114 10608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50700 11265 10912 gene locus_tag LOCUS_50710 11265 10912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50710 12221 11697 gene locus_tag LOCUS_50720 12221 11697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50720 12676 12377 gene locus_tag LOCUS_50730 12676 12377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50730 13714 12968 gene locus_tag LOCUS_50740 13714 12968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50740 14076 13711 gene locus_tag LOCUS_50750 14076 13711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50750 15029 14469 gene locus_tag LOCUS_50760 15029 14469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50760 16008 15058 gene locus_tag LOCUS_50770 16008 15058 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096831545.1 protein_id gnl|my_center|LOCUS_50770 16532 17743 gene locus_tag LOCUS_50780 gene istA 16532 17743 CDS product IS21-like element ISMac3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023663.1 protein_id gnl|my_center|LOCUS_50780 17743 18561 gene locus_tag LOCUS_50790 gene istB 17743 18561 CDS product IS21-like element IS21 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544830.1 protein_id gnl|my_center|LOCUS_50790 19541 18804 gene locus_tag LOCUS_50800 19541 18804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50800 19961 19671 gene locus_tag LOCUS_50810 19961 19671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50810 20941 20252 gene locus_tag LOCUS_50820 20941 20252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50820 21791 21438 gene locus_tag LOCUS_50830 21791 21438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50830 22360 21788 gene locus_tag LOCUS_50840 22360 21788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50840 22935 22738 gene locus_tag LOCUS_50850 22935 22738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50850 24619 22976 gene locus_tag LOCUS_50860 24619 22976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50860 25885 25679 gene locus_tag LOCUS_50870 25885 25679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50870 26373 25897 gene locus_tag LOCUS_50880 26373 25897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50880 26820 26386 gene locus_tag LOCUS_50890 26820 26386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50890 27463 27026 gene locus_tag LOCUS_50900 27463 27026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50900 28371 28553 gene locus_tag LOCUS_50910 28371 28553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50910 29014 28625 gene locus_tag LOCUS_50920 29014 28625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50920 30617 31063 gene locus_tag LOCUS_50930 30617 31063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_50930 >Feature sequence26 1387 1226 gene locus_tag LOCUS_50940 1387 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50940 3934 4128 gene locus_tag LOCUS_50950 3934 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50950 4064 4405 gene locus_tag LOCUS_50960 4064 4405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50960 4878 5072 gene locus_tag LOCUS_50970 4878 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50970 5127 5351 gene locus_tag LOCUS_50980 5127 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50980 5348 5986 gene locus_tag LOCUS_50990 5348 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50990 5893 6351 gene locus_tag LOCUS_51000 5893 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51000 7261 6494 gene locus_tag LOCUS_51010 7261 6494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51010 7668 7351 gene locus_tag LOCUS_51020 7668 7351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51020 8158 7871 gene locus_tag LOCUS_51030 8158 7871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51030 8754 8269 gene locus_tag LOCUS_51040 8754 8269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51040 9454 10542 gene locus_tag LOCUS_51050 9454 10542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51050 12483 11851 gene locus_tag LOCUS_51060 12483 11851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51060 13286 12729 gene locus_tag LOCUS_51070 13286 12729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51070 13758 13363 gene locus_tag LOCUS_51080 13758 13363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51080 14543 14247 gene locus_tag LOCUS_51090 14543 14247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51090 15115 14558 gene locus_tag LOCUS_51100 15115 14558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51100 16239 15967 gene locus_tag LOCUS_51110 16239 15967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51110 17941 17264 gene locus_tag LOCUS_51120 17941 17264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51120 18301 18026 gene locus_tag LOCUS_51130 18301 18026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51130 18979 18779 gene locus_tag LOCUS_51140 18979 18779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51140 19622 19437 gene locus_tag LOCUS_51150 19622 19437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51150 19945 19622 gene locus_tag LOCUS_51160 19945 19622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51160 20833 20621 gene locus_tag LOCUS_51170 20833 20621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51170 23315 23710 gene locus_tag LOCUS_51180 23315 23710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51180 24256 24068 gene locus_tag LOCUS_51190 24256 24068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51190 25679 26131 gene locus_tag LOCUS_51200 25679 26131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51200 26228 26605 gene locus_tag LOCUS_51210 26228 26605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51210 27022 27423 gene locus_tag LOCUS_51220 27022 27423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51220 27640 27780 gene locus_tag LOCUS_51230 27640 27780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51230 28459 28226 gene locus_tag LOCUS_51240 gene rplU 28459 28226 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392094.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51240 29450 29824 gene locus_tag LOCUS_51250 29450 29824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51250 29933 30100 gene locus_tag LOCUS_51260 29933 30100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51260 >Feature sequence27 1142 1423 gene locus_tag LOCUS_51270 1142 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51270 1561 1746 gene locus_tag LOCUS_51280 1561 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51280 1911 2141 gene locus_tag LOCUS_51290 1911 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51290 2651 3211 gene locus_tag LOCUS_51300 2651 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51300 3214 3657 gene locus_tag LOCUS_51310 3214 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51310 4395 4574 gene locus_tag LOCUS_51320 4395 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51320 5025 5465 gene locus_tag LOCUS_51330 5025 5465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51330 5431 5877 gene locus_tag LOCUS_51340 5431 5877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51340 6097 6468 gene locus_tag LOCUS_51350 6097 6468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51350 6680 7057 gene locus_tag LOCUS_51360 6680 7057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51360 7085 7327 gene locus_tag LOCUS_51370 7085 7327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51370 7386 8144 gene locus_tag LOCUS_51380 7386 8144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51380 8182 9477 gene locus_tag LOCUS_51390 8182 9477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51390 9696 10817 gene locus_tag LOCUS_51400 9696 10817 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119728.1 protein_id gnl|my_center|LOCUS_51400 11056 11811 gene locus_tag LOCUS_51410 11056 11811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51410 12001 12216 gene locus_tag LOCUS_51420 12001 12216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51420 12474 12788 gene locus_tag LOCUS_51430 12474 12788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51430 13493 13891 gene locus_tag LOCUS_51440 13493 13891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51440 14150 15220 gene locus_tag LOCUS_51450 14150 15220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51450 15236 16360 gene locus_tag LOCUS_51460 15236 16360 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533192.1 protein_id gnl|my_center|LOCUS_51460 16368 17198 gene locus_tag LOCUS_51470 16368 17198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51470 17213 17929 gene locus_tag LOCUS_51480 17213 17929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51480 17931 19289 gene locus_tag LOCUS_51490 17931 19289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51490 19293 21176 gene locus_tag LOCUS_51500 gene asnB 19293 21176 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_51500 21467 22219 gene locus_tag LOCUS_51510 21467 22219 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_51510 22474 23190 gene locus_tag LOCUS_51520 22474 23190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51520 23430 24158 gene locus_tag LOCUS_51530 23430 24158 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022168.1 protein_id gnl|my_center|LOCUS_51530 24320 25594 gene locus_tag LOCUS_51540 24320 25594 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211395.1 protein_id gnl|my_center|LOCUS_51540 26630 25884 gene locus_tag LOCUS_51550 26630 25884 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927117.1 protein_id gnl|my_center|LOCUS_51550 >Feature sequence28 524 1072 gene locus_tag LOCUS_51560 524 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_51560 2048 2413 gene locus_tag LOCUS_51570 2048 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51570 2474 3451 gene locus_tag LOCUS_51580 2474 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51580 4475 4852 gene locus_tag LOCUS_51590 4475 4852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51590 5128 5685 gene locus_tag LOCUS_51600 5128 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51600 5857 6489 gene locus_tag LOCUS_51610 5857 6489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51610 6900 7184 gene locus_tag LOCUS_51620 6900 7184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51620 7926 8351 gene locus_tag LOCUS_51630 7926 8351 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675692.1 protein_id gnl|my_center|LOCUS_51630 10387 8753 gene locus_tag LOCUS_51640 10387 8753 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_51640 10776 10384 gene locus_tag LOCUS_51650 10776 10384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51650 10913 12274 gene locus_tag LOCUS_51660 gene fumC 10913 12274 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857390.1 protein_id gnl|my_center|LOCUS_51660 12870 12370 gene locus_tag LOCUS_51670 12870 12370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51670 13961 12882 gene locus_tag LOCUS_51680 13961 12882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51680 15177 13972 gene locus_tag LOCUS_51690 15177 13972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51690 15786 15274 gene locus_tag LOCUS_51700 15786 15274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51700 16442 15726 gene locus_tag LOCUS_51710 16442 15726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51710 18195 16414 gene locus_tag LOCUS_51720 18195 16414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51720 18762 18232 gene locus_tag LOCUS_51730 18762 18232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51730 19798 18851 gene locus_tag LOCUS_51740 19798 18851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51740 20351 19854 gene locus_tag LOCUS_51750 20351 19854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51750 21256 20240 gene locus_tag LOCUS_51760 21256 20240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51760 21428 21216 gene locus_tag LOCUS_51770 21428 21216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51770 22367 21663 gene locus_tag LOCUS_51780 22367 21663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51780 22543 22367 gene locus_tag LOCUS_51790 22543 22367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51790 23229 22831 gene locus_tag LOCUS_51800 23229 22831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51800 25048 24758 gene locus_tag LOCUS_51810 25048 24758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51810 25527 25255 gene locus_tag LOCUS_51820 25527 25255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51820 25824 25693 gene locus_tag LOCUS_51830 25824 25693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51830 26093 25821 gene locus_tag LOCUS_51840 26093 25821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51840 26410 26282 gene locus_tag LOCUS_51850 26410 26282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51850 >Feature sequence29 813 1280 gene locus_tag LOCUS_51860 813 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51860 1277 1567 gene locus_tag LOCUS_51870 1277 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51870 1603 1857 gene locus_tag LOCUS_51880 1603 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51880 2249 2070 gene locus_tag LOCUS_51890 2249 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51890 2602 3174 gene locus_tag LOCUS_51900 2602 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51900 3150 3527 gene locus_tag LOCUS_51910 3150 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51910 3560 3748 gene locus_tag LOCUS_51920 3560 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51920 4137 3919 gene locus_tag LOCUS_51930 4137 3919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51930 4593 5546 gene locus_tag LOCUS_51940 4593 5546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51940 5574 5915 gene locus_tag LOCUS_51950 5574 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51950 5906 6181 gene locus_tag LOCUS_51960 5906 6181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51960 6552 7478 gene locus_tag LOCUS_51970 6552 7478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51970 10228 10545 gene locus_tag LOCUS_51980 10228 10545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51980 11709 12305 gene locus_tag LOCUS_51990 11709 12305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51990 12277 13383 gene locus_tag LOCUS_52000 12277 13383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52000 13843 16080 gene locus_tag LOCUS_52010 13843 16080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52010 16711 17133 gene locus_tag LOCUS_52020 16711 17133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52020 17166 17501 gene locus_tag LOCUS_52030 17166 17501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52030 17756 18178 gene locus_tag LOCUS_52040 17756 18178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52040 18197 18601 gene locus_tag LOCUS_52050 18197 18601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52050 18887 19216 gene locus_tag LOCUS_52060 18887 19216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52060 19213 19428 gene locus_tag LOCUS_52070 19213 19428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52070 19647 20702 gene locus_tag LOCUS_52080 gene asd 19647 20702 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496420.1 protein_id gnl|my_center|LOCUS_52080 20806 21315 gene locus_tag LOCUS_52090 20806 21315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52090 21315 21677 gene locus_tag LOCUS_52100 21315 21677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52100 23371 23565 gene locus_tag LOCUS_52110 23371 23565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52110 24913 25161 gene locus_tag LOCUS_52120 24913 25161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52120 25100 25369 gene locus_tag LOCUS_52130 25100 25369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52130 25772 25563 gene locus_tag LOCUS_52140 25772 25563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52140 25920 26183 gene locus_tag LOCUS_52150 gene purS 25920 26183 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088473.1 protein_id gnl|my_center|LOCUS_52150 >Feature sequence30 1701 2078 gene locus_tag LOCUS_52160 1701 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52160 2310 2582 gene locus_tag LOCUS_52170 2310 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52170 3166 3414 gene locus_tag LOCUS_52180 3166 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52180 3570 3818 gene locus_tag LOCUS_52190 3570 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52190 5985 5824 gene locus_tag LOCUS_52200 5985 5824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52200 7649 7359 gene locus_tag LOCUS_52210 7649 7359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52210 7924 7724 gene locus_tag LOCUS_52220 7924 7724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52220 8547 8852 gene locus_tag LOCUS_52230 8547 8852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52230 9807 10157 gene locus_tag LOCUS_52240 9807 10157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52240 10154 10417 gene locus_tag LOCUS_52250 10154 10417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52250 10414 10752 gene locus_tag LOCUS_52260 10414 10752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52260 10998 11306 gene locus_tag LOCUS_52270 10998 11306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52270 11284 12099 gene locus_tag LOCUS_52280 11284 12099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52280 12554 12862 gene locus_tag LOCUS_52290 12554 12862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52290 12849 13001 gene locus_tag LOCUS_52300 12849 13001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52300 13120 13551 gene locus_tag LOCUS_52310 13120 13551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52310 13782 14009 gene locus_tag LOCUS_52320 13782 14009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52320 14559 14395 gene locus_tag LOCUS_52330 14559 14395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52330 15433 14561 gene locus_tag LOCUS_52340 15433 14561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52340 15903 15454 gene locus_tag LOCUS_52350 15903 15454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52350 16355 16795 gene locus_tag LOCUS_52360 16355 16795 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256436.1 protein_id gnl|my_center|LOCUS_52360 17922 16792 gene locus_tag LOCUS_52370 17922 16792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52370 19108 19941 gene locus_tag LOCUS_52380 19108 19941 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164736349.1 protein_id gnl|my_center|LOCUS_52380 21308 20451 gene locus_tag LOCUS_52390 21308 20451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52390 22158 21742 gene locus_tag LOCUS_52400 22158 21742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52400 22531 22142 gene locus_tag LOCUS_52410 22531 22142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52410 23077 22775 gene locus_tag LOCUS_52420 23077 22775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52420 24086 23901 gene locus_tag LOCUS_52430 24086 23901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52430 >Feature sequence31 3548 3006 gene locus_tag LOCUS_52440 3548 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52440 5859 5083 gene locus_tag LOCUS_52450 5859 5083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52450 6865 6473 gene locus_tag LOCUS_52460 6865 6473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52460 7830 6877 gene locus_tag LOCUS_52470 7830 6877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52470 8123 7827 gene locus_tag LOCUS_52480 8123 7827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52480 8602 8324 gene locus_tag LOCUS_52490 8602 8324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52490 9161 8631 gene locus_tag LOCUS_52500 9161 8631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52500 11326 9986 gene locus_tag LOCUS_52510 11326 9986 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941040.1 protein_id gnl|my_center|LOCUS_52510 12583 11345 gene locus_tag LOCUS_52520 12583 11345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52520 12674 13531 gene locus_tag LOCUS_52530 12674 13531 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925938.1 protein_id gnl|my_center|LOCUS_52530 13711 15012 gene locus_tag LOCUS_52540 13711 15012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52540 15012 16040 gene locus_tag LOCUS_52550 15012 16040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52550 16058 16735 gene locus_tag LOCUS_52560 16058 16735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52560 16716 17267 gene locus_tag LOCUS_52570 16716 17267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52570 18929 18417 gene locus_tag LOCUS_52580 18929 18417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52580 19311 19108 gene locus_tag LOCUS_52590 19311 19108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52590 20039 19476 gene locus_tag LOCUS_52600 20039 19476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52600 20347 20090 gene locus_tag LOCUS_52610 20347 20090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52610 20678 20475 gene locus_tag LOCUS_52620 20678 20475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52620 20649 20960 gene locus_tag LOCUS_52630 20649 20960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52630 21482 21141 gene locus_tag LOCUS_52640 21482 21141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52640 21999 21469 gene locus_tag LOCUS_52650 21999 21469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52650 22262 22107 gene locus_tag LOCUS_52660 22262 22107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52660 23345 22821 gene locus_tag LOCUS_52670 23345 22821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52670 23629 23432 gene locus_tag LOCUS_52680 23629 23432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52680 24852 25079 gene locus_tag LOCUS_52690 24852 25079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52690 >Feature sequence32 512 793 gene locus_tag LOCUS_52700 512 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52700 1055 1213 gene locus_tag LOCUS_52710 1055 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52710 1198 1629 gene locus_tag LOCUS_52720 1198 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52720 1653 2321 gene locus_tag LOCUS_52730 1653 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52730 2406 2972 gene locus_tag LOCUS_52740 2406 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52740 3573 3857 gene locus_tag LOCUS_52750 3573 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52750 4171 5163 gene locus_tag LOCUS_52760 4171 5163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52760 5569 5294 gene locus_tag LOCUS_52770 5569 5294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52770 5831 7222 gene locus_tag LOCUS_52780 5831 7222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52780 7665 8726 gene locus_tag LOCUS_52790 7665 8726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52790 8977 9270 gene locus_tag LOCUS_52800 8977 9270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52800 10321 9719 gene locus_tag LOCUS_52810 10321 9719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52810 11045 10455 gene locus_tag LOCUS_52820 11045 10455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52820 12246 12884 gene locus_tag LOCUS_52830 12246 12884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52830 13143 13379 gene locus_tag LOCUS_52840 13143 13379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52840 13715 14053 gene locus_tag LOCUS_52850 13715 14053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52850 14224 14556 gene locus_tag LOCUS_52860 14224 14556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52860 14917 15108 gene locus_tag LOCUS_52870 14917 15108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52870 15130 15321 gene locus_tag LOCUS_52880 15130 15321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52880 15394 15522 gene locus_tag LOCUS_52890 15394 15522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52890 16353 15541 gene locus_tag LOCUS_52900 16353 15541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52900 16756 16358 gene locus_tag LOCUS_52910 16756 16358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52910 17208 16978 gene locus_tag LOCUS_52920 17208 16978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52920 17360 17205 gene locus_tag LOCUS_52930 17360 17205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52930 17518 17348 gene locus_tag LOCUS_52940 17518 17348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52940 17992 17663 gene locus_tag LOCUS_52950 17992 17663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52950 18426 18103 gene locus_tag LOCUS_52960 18426 18103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52960 18973 18695 gene locus_tag LOCUS_52970 18973 18695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52970 19194 18973 gene locus_tag LOCUS_52980 19194 18973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52980 19918 19511 gene locus_tag LOCUS_52990 19918 19511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52990 20238 19951 gene locus_tag LOCUS_53000 20238 19951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53000 20666 21232 gene locus_tag LOCUS_53010 20666 21232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53010 21246 21479 gene locus_tag LOCUS_53020 21246 21479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53020 21608 21736 gene locus_tag LOCUS_53030 21608 21736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53030 22133 22360 gene locus_tag LOCUS_53040 22133 22360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53040 22752 22444 gene locus_tag LOCUS_53050 22752 22444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53050 >Feature sequence33 3659 3414 gene locus_tag LOCUS_53060 3659 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53060 4756 4268 gene locus_tag LOCUS_53070 4756 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53070 5815 6090 gene locus_tag LOCUS_53080 5815 6090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_53080 6652 6338 gene locus_tag LOCUS_53090 6652 6338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53090 7146 6844 gene locus_tag LOCUS_53100 7146 6844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53100 9321 8737 gene locus_tag LOCUS_53110 9321 8737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53110 9821 9627 gene locus_tag LOCUS_53120 9821 9627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53120 11899 10931 gene locus_tag LOCUS_53130 gene trxB 11899 10931 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265863.1 protein_id gnl|my_center|LOCUS_53130 12264 12626 gene locus_tag LOCUS_53140 12264 12626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53140 13119 13493 gene locus_tag LOCUS_53150 13119 13493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53150 13815 13890 gene locus_tag LOCUS_t00480 13815 13890 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 14380 14715 gene locus_tag LOCUS_53160 14380 14715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53160 15044 15268 gene locus_tag LOCUS_53170 15044 15268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53170 16057 15335 gene locus_tag LOCUS_53180 16057 15335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53180 16866 16435 gene locus_tag LOCUS_53190 gene tsaA 16866 16435 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868101.1 protein_id gnl|my_center|LOCUS_53190 17227 17757 gene locus_tag LOCUS_53200 17227 17757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53200 18259 19662 gene locus_tag LOCUS_53210 18259 19662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53210 19659 20156 gene locus_tag LOCUS_53220 19659 20156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_53220 >Feature sequence34 2131 1649 gene locus_tag LOCUS_53230 2131 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53230 3518 3300 gene locus_tag LOCUS_53240 3518 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53240 3860 4294 gene locus_tag LOCUS_53250 3860 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53250 5625 5260 gene locus_tag LOCUS_53260 5625 5260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53260 5652 5906 gene locus_tag LOCUS_53270 5652 5906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53270 6798 6556 gene locus_tag LOCUS_53280 6798 6556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53280 8449 8006 gene locus_tag LOCUS_53290 8449 8006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53290 9207 8884 gene locus_tag LOCUS_53300 9207 8884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53300 9628 9864 gene locus_tag LOCUS_53310 9628 9864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53310 10244 11242 gene locus_tag LOCUS_53320 10244 11242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53320 11823 11383 gene locus_tag LOCUS_53330 11823 11383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53330 11972 12841 gene locus_tag LOCUS_53340 11972 12841 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965023.1 protein_id gnl|my_center|LOCUS_53340 13119 13754 gene locus_tag LOCUS_53350 gene gmk 13119 13754 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222146.1 protein_id gnl|my_center|LOCUS_53350 13763 14014 gene locus_tag LOCUS_53360 13763 14014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53360 14214 14447 gene locus_tag LOCUS_53370 14214 14447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53370 14461 14670 gene locus_tag LOCUS_53380 14461 14670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53380 16088 14655 gene locus_tag LOCUS_53390 16088 14655 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035873.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53390 16351 16040 gene locus_tag LOCUS_53400 16351 16040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53400 16659 17267 gene locus_tag LOCUS_53410 16659 17267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53410 17412 17708 gene locus_tag LOCUS_53420 17412 17708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53420 17674 18063 gene locus_tag LOCUS_53430 17674 18063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53430 18836 18651 gene locus_tag LOCUS_53440 18836 18651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53440 19458 19823 gene locus_tag LOCUS_53450 19458 19823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53450 20144 20566 gene locus_tag LOCUS_53460 20144 20566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53460 20533 20784 gene locus_tag LOCUS_53470 20533 20784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53470 >Feature sequence35 1807 1454 gene locus_tag LOCUS_53480 1807 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53480 2267 2049 gene locus_tag LOCUS_53490 2267 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53490 2775 2626 gene locus_tag LOCUS_53500 2775 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53500 3368 3195 gene locus_tag LOCUS_53510 3368 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53510 3664 3488 gene locus_tag LOCUS_53520 3664 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53520 3881 3729 gene locus_tag LOCUS_53530 3881 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53530 4275 4856 gene locus_tag LOCUS_53540 4275 4856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53540 4793 5305 gene locus_tag LOCUS_53550 4793 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53550 5332 5517 gene locus_tag LOCUS_53560 5332 5517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53560 5564 5740 gene locus_tag LOCUS_53570 5564 5740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53570 5958 6155 gene locus_tag LOCUS_53580 5958 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53580 6795 7085 gene locus_tag LOCUS_53590 6795 7085 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055138255.1 protein_id gnl|my_center|LOCUS_53590 7409 7765 gene locus_tag LOCUS_53600 7409 7765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53600 7729 7887 gene locus_tag LOCUS_53610 7729 7887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53610 7897 8442 gene locus_tag LOCUS_53620 7897 8442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53620 8516 9730 gene locus_tag LOCUS_53630 8516 9730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53630 9738 10166 gene locus_tag LOCUS_53640 9738 10166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53640 10508 10777 gene locus_tag LOCUS_53650 10508 10777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53650 11143 12045 gene locus_tag LOCUS_53660 11143 12045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53660 12246 12551 gene locus_tag LOCUS_53670 12246 12551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53670 12689 13354 gene locus_tag LOCUS_53680 12689 13354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53680 13348 13812 gene locus_tag LOCUS_53690 13348 13812 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181773.1 protein_id gnl|my_center|LOCUS_53690 14213 14734 gene locus_tag LOCUS_53700 14213 14734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53700 14950 15558 gene locus_tag LOCUS_53710 14950 15558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53710 15555 15884 gene locus_tag LOCUS_53720 15555 15884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53720 15908 16228 gene locus_tag LOCUS_53730 15908 16228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53730 16280 17152 gene locus_tag LOCUS_53740 16280 17152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53740 17308 17868 gene locus_tag LOCUS_53750 17308 17868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53750 18167 18574 gene locus_tag LOCUS_53760 18167 18574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53760 >Feature sequence36 431 685 gene locus_tag LOCUS_53770 431 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53770 1334 1510 gene locus_tag LOCUS_53780 1334 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53780 2319 2705 gene locus_tag LOCUS_53790 2319 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53790 3373 3762 gene locus_tag LOCUS_53800 3373 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53800 3970 4509 gene locus_tag LOCUS_53810 3970 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53810 4585 5043 gene locus_tag LOCUS_53820 4585 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53820 5108 5587 gene locus_tag LOCUS_53830 5108 5587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53830 5603 6484 gene locus_tag LOCUS_53840 5603 6484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53840 6614 6901 gene locus_tag LOCUS_53850 6614 6901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53850 6919 7128 gene locus_tag LOCUS_53860 6919 7128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53860 7095 7370 gene locus_tag LOCUS_53870 7095 7370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53870 7651 7845 gene locus_tag LOCUS_53880 7651 7845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53880 7899 8345 gene locus_tag LOCUS_53890 7899 8345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53890 8599 8778 gene locus_tag LOCUS_53900 8599 8778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53900 9825 10280 gene locus_tag LOCUS_53910 9825 10280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53910 11437 10391 gene locus_tag LOCUS_53920 gene mtnA 11437 10391 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943990.1 protein_id gnl|my_center|LOCUS_53920 11587 11823 gene locus_tag LOCUS_53930 11587 11823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53930 11874 12251 gene locus_tag LOCUS_53940 11874 12251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53940 12950 15136 gene locus_tag LOCUS_53950 12950 15136 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_53950 15217 15897 gene locus_tag LOCUS_53960 15217 15897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53960 15901 16239 gene locus_tag LOCUS_53970 gene ytxJ 15901 16239 CDS product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404063.1 protein_id gnl|my_center|LOCUS_53970 16239 16535 gene locus_tag LOCUS_53980 16239 16535 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057944.1 protein_id gnl|my_center|LOCUS_53980 17638 17342 gene locus_tag LOCUS_53990 17638 17342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53990 18772 17783 gene locus_tag LOCUS_54000 18772 17783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54000 >Feature sequence37 885 1055 gene locus_tag LOCUS_54010 885 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54010 2461 1169 gene locus_tag LOCUS_54020 2461 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54020 2988 2623 gene locus_tag LOCUS_54030 2988 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54030 5123 3723 gene locus_tag LOCUS_54040 5123 3723 CDS product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042159660.1 protein_id gnl|my_center|LOCUS_54040 5576 5500 gene locus_tag LOCUS_t00490 5576 5500 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 5776 5701 gene locus_tag LOCUS_t00500 5776 5701 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6085 5870 gene locus_tag LOCUS_54050 6085 5870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54050 7871 6015 gene locus_tag LOCUS_54060 7871 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54060 8230 9333 gene locus_tag LOCUS_54070 8230 9333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54070 9318 10211 gene locus_tag LOCUS_54080 9318 10211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54080 10962 10474 gene locus_tag LOCUS_54090 10962 10474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54090 11535 11332 gene locus_tag LOCUS_54100 11535 11332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54100 12314 11532 gene locus_tag LOCUS_54110 12314 11532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54110 13284 13105 gene locus_tag LOCUS_54120 13284 13105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54120 14354 13890 gene locus_tag LOCUS_54130 14354 13890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54130 15624 15373 gene locus_tag LOCUS_54140 15624 15373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54140 16001 16147 gene locus_tag LOCUS_54150 16001 16147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54150 16536 16844 gene locus_tag LOCUS_54160 16536 16844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54160 17026 17253 gene locus_tag LOCUS_54170 17026 17253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54170 17792 17601 gene locus_tag LOCUS_54180 17792 17601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54180 >Feature sequence38 832 1056 gene locus_tag LOCUS_54190 832 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54190 1147 1389 gene locus_tag LOCUS_54200 1147 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54200 1880 2395 gene locus_tag LOCUS_54210 1880 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54210 2513 2710 gene locus_tag LOCUS_54220 2513 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54220 3324 3019 gene locus_tag LOCUS_54230 3324 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54230 3808 5553 gene locus_tag LOCUS_54240 3808 5553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54240 5559 5855 gene locus_tag LOCUS_54250 5559 5855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54250 6069 6395 gene locus_tag LOCUS_54260 6069 6395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54260 6493 6813 gene locus_tag LOCUS_54270 6493 6813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54270 6845 7153 gene locus_tag LOCUS_54280 6845 7153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54280 7202 9433 gene locus_tag LOCUS_54290 7202 9433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54290 10283 10459 gene locus_tag LOCUS_54300 10283 10459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54300 10446 11072 gene locus_tag LOCUS_54310 10446 11072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54310 10987 12096 gene locus_tag LOCUS_54320 10987 12096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54320 12411 12665 gene locus_tag LOCUS_54330 12411 12665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54330 12873 13427 gene locus_tag LOCUS_54340 12873 13427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54340 13698 13976 gene locus_tag LOCUS_54350 13698 13976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54350 13984 14547 gene locus_tag LOCUS_54360 13984 14547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54360 15289 16008 gene locus_tag LOCUS_54370 15289 16008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54370 16251 16817 gene locus_tag LOCUS_54380 16251 16817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54380 17027 17470 gene locus_tag LOCUS_54390 17027 17470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54390 >Feature sequence39 1630 953 gene locus_tag LOCUS_54400 1630 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54400 2480 2325 gene locus_tag LOCUS_54410 2480 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54410 3266 2571 gene locus_tag LOCUS_54420 3266 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54420 3900 3190 gene locus_tag LOCUS_54430 3900 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54430 4526 4032 gene locus_tag LOCUS_54440 4526 4032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54440 4869 4462 gene locus_tag LOCUS_54450 4869 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54450 5075 4866 gene locus_tag LOCUS_54460 5075 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54460 6215 5406 gene locus_tag LOCUS_54470 6215 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54470 6526 6260 gene locus_tag LOCUS_54480 6526 6260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54480 6774 6487 gene locus_tag LOCUS_54490 6774 6487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54490 7160 6906 gene locus_tag LOCUS_54500 7160 6906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54500 8613 7495 gene locus_tag LOCUS_54510 8613 7495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54510 9709 9443 gene locus_tag LOCUS_54520 9709 9443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_54520 10166 9726 gene locus_tag LOCUS_54530 10166 9726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_54530 10719 10261 gene locus_tag LOCUS_54540 10719 10261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54540 11653 10727 gene locus_tag LOCUS_54550 11653 10727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54550 11957 11625 gene locus_tag LOCUS_54560 11957 11625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54560 12799 12503 gene locus_tag LOCUS_54570 12799 12503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54570 12916 13242 gene locus_tag LOCUS_54580 12916 13242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54580 13239 13943 gene locus_tag LOCUS_54590 13239 13943 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143961.1 protein_id gnl|my_center|LOCUS_54590 14444 14214 gene locus_tag LOCUS_54600 14444 14214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54600 15066 15950 gene locus_tag LOCUS_54610 15066 15950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255955.1 protein_id gnl|my_center|LOCUS_54610 16757 16527 gene locus_tag LOCUS_54620 16757 16527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54620 >Feature sequence40 214 468 gene locus_tag LOCUS_54630 214 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54630 514 882 gene locus_tag LOCUS_54640 514 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_54640 1101 1271 gene locus_tag LOCUS_54650 1101 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_54650 1734 2027 gene locus_tag LOCUS_54660 1734 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54660 2153 2323 gene locus_tag LOCUS_54670 2153 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54670 3194 3376 gene locus_tag LOCUS_54680 3194 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54680 6334 5579 gene locus_tag LOCUS_54690 6334 5579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54690 6763 6374 gene locus_tag LOCUS_54700 6763 6374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54700 7037 7591 gene locus_tag LOCUS_54710 7037 7591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54710 7546 8226 gene locus_tag LOCUS_54720 7546 8226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54720 8441 8827 gene locus_tag LOCUS_54730 8441 8827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54730 8820 10085 gene locus_tag LOCUS_54740 8820 10085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54740 10109 10555 gene locus_tag LOCUS_54750 10109 10555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54750 10555 11559 gene locus_tag LOCUS_54760 10555 11559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54760 11563 12042 gene locus_tag LOCUS_54770 11563 12042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54770 12427 13050 gene locus_tag LOCUS_54780 12427 13050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54780 13193 13720 gene locus_tag LOCUS_54790 13193 13720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54790 13874 14122 gene locus_tag LOCUS_54800 13874 14122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54800 15745 14219 gene locus_tag LOCUS_54810 15745 14219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54810 16025 15816 gene locus_tag LOCUS_54820 16025 15816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54820 >Feature sequence41 637 143 gene locus_tag LOCUS_54830 637 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54830 3095 621 gene locus_tag LOCUS_54840 3095 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54840 4268 3510 gene locus_tag LOCUS_54850 4268 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54850 4830 4327 gene locus_tag LOCUS_54860 4830 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54860 5417 4827 gene locus_tag LOCUS_54870 5417 4827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54870 6394 5441 gene locus_tag LOCUS_54880 6394 5441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54880 6968 6429 gene locus_tag LOCUS_54890 6968 6429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54890 7768 7304 gene locus_tag LOCUS_54900 7768 7304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54900 9168 7837 gene locus_tag LOCUS_54910 9168 7837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54910 13249 9704 gene locus_tag LOCUS_54920 13249 9704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54920 13604 13230 gene locus_tag LOCUS_54930 13604 13230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54930 14065 13667 gene locus_tag LOCUS_54940 14065 13667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54940 15444 13963 gene locus_tag LOCUS_54950 15444 13963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54950 >Feature sequence42 1342 1656 gene locus_tag LOCUS_54960 1342 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54960 3487 3233 gene locus_tag LOCUS_54970 3487 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54970 3672 4223 gene locus_tag LOCUS_54980 3672 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54980 4838 5368 gene locus_tag LOCUS_54990 4838 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54990 5573 5887 gene locus_tag LOCUS_55000 5573 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_55000 5933 6292 gene locus_tag LOCUS_55010 5933 6292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_55010 6298 6453 gene locus_tag LOCUS_55020 6298 6453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55020 6681 6959 gene locus_tag LOCUS_55030 6681 6959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55030 8669 8316 gene locus_tag LOCUS_55040 8669 8316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55040 10309 10013 gene locus_tag LOCUS_55050 10309 10013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55050 10743 10309 gene locus_tag LOCUS_55060 10743 10309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55060 11251 10634 gene locus_tag LOCUS_55070 11251 10634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55070 11892 11608 gene locus_tag LOCUS_55080 11892 11608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55080 12289 11870 gene locus_tag LOCUS_55090 12289 11870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55090 13050 12532 gene locus_tag LOCUS_55100 13050 12532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55100 13586 13206 gene locus_tag LOCUS_55110 13586 13206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55110 14590 14423 gene locus_tag LOCUS_55120 14590 14423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55120 >Feature sequence43 619 422 gene locus_tag LOCUS_55130 619 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55130 1043 1255 gene locus_tag LOCUS_55140 1043 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55140 2609 2534 gene locus_tag LOCUS_t00510 2609 2534 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3450 3049 gene locus_tag LOCUS_55150 3450 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_55150 4102 3884 gene locus_tag LOCUS_55160 4102 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55160 4310 3996 gene locus_tag LOCUS_55170 4310 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55170 4695 4408 gene locus_tag LOCUS_55180 4695 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55180 5710 5222 gene locus_tag LOCUS_55190 5710 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55190 6084 5836 gene locus_tag LOCUS_55200 6084 5836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55200 6643 6326 gene locus_tag LOCUS_55210 6643 6326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55210 7305 6985 gene locus_tag LOCUS_55220 7305 6985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55220 8573 8854 gene locus_tag LOCUS_55230 8573 8854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55230 8781 8969 gene locus_tag LOCUS_55240 8781 8969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55240 9120 9278 gene locus_tag LOCUS_55250 9120 9278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55250 9954 10328 gene locus_tag LOCUS_55260 9954 10328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55260 10875 11168 gene locus_tag LOCUS_55270 10875 11168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55270 11436 11876 gene locus_tag LOCUS_55280 11436 11876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55280 12253 12035 gene locus_tag LOCUS_55290 12253 12035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55290 13049 13336 gene locus_tag LOCUS_55300 13049 13336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55300 13275 13481 gene locus_tag LOCUS_55310 13275 13481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55310 >Feature sequence44 485 1054 gene locus_tag LOCUS_55320 485 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55320 1364 2155 gene locus_tag LOCUS_55330 1364 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55330 3386 3180 gene locus_tag LOCUS_55340 3386 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55340 3750 3562 gene locus_tag LOCUS_55350 3750 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55350 4309 3659 gene locus_tag LOCUS_55360 4309 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55360 4818 4306 gene locus_tag LOCUS_55370 4818 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55370 6542 5784 gene locus_tag LOCUS_55380 6542 5784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55380 6882 6520 gene locus_tag LOCUS_55390 6882 6520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55390 8003 6918 gene locus_tag LOCUS_55400 8003 6918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55400 9213 8860 gene locus_tag LOCUS_55410 9213 8860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55410 9744 9379 gene locus_tag LOCUS_55420 9744 9379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55420 10782 10961 gene locus_tag LOCUS_55430 10782 10961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55430 >Feature sequence45 3773 1473 gene locus_tag LOCUS_55440 3773 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55440 4499 3783 gene locus_tag LOCUS_55450 4499 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55450 5156 5338 gene locus_tag LOCUS_55460 5156 5338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55460 5339 6265 gene locus_tag LOCUS_55470 5339 6265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55470 6817 8049 gene locus_tag LOCUS_55480 6817 8049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55480 8046 8765 gene locus_tag LOCUS_55490 8046 8765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55490 8999 9352 gene locus_tag LOCUS_55500 8999 9352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55500 10704 9835 gene locus_tag LOCUS_55510 10704 9835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55510 >Feature sequence46 464 213 gene locus_tag LOCUS_55520 464 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55520 1300 1112 gene locus_tag LOCUS_55530 1300 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55530 1576 1346 gene locus_tag LOCUS_55540 1576 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55540 2991 2638 gene locus_tag LOCUS_55550 2991 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55550 4470 4306 gene locus_tag LOCUS_55560 4470 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55560 5193 4810 gene locus_tag LOCUS_55570 5193 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55570 7794 7006 gene locus_tag LOCUS_55580 7794 7006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_55580 8243 7797 gene locus_tag LOCUS_55590 8243 7797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55590