>Feature sequence01 841 626 gene locus_tag LOCUS_00010 841 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1363 926 gene locus_tag LOCUS_00020 1363 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1584 1360 gene locus_tag LOCUS_00030 1584 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2548 1532 gene locus_tag LOCUS_00040 2548 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3222 2545 gene locus_tag LOCUS_00050 3222 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 8101 3113 gene locus_tag LOCUS_00060 8101 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 8431 9120 gene locus_tag LOCUS_00070 8431 9120 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392645.1 protein_id gnl|my_center|LOCUS_00070 9318 9617 gene locus_tag LOCUS_00080 9318 9617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9595 9682 gene locus_tag LOCUS_t00010 9595 9682 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10802 9750 gene locus_tag LOCUS_00090 10802 9750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11942 11073 gene locus_tag LOCUS_00100 11942 11073 CDS product SigB/SigF/SigG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227037.1 protein_id gnl|my_center|LOCUS_00100 12231 13655 gene locus_tag LOCUS_00110 12231 13655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00110 13652 14464 gene locus_tag LOCUS_00120 13652 14464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 14464 16248 gene locus_tag LOCUS_00130 gene ctaD 14464 16248 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976660.1 protein_id gnl|my_center|LOCUS_00130 17101 16232 gene locus_tag LOCUS_00140 17101 16232 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707632.1 protein_id gnl|my_center|LOCUS_00140 17588 17133 gene locus_tag LOCUS_00150 17588 17133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 17975 17616 gene locus_tag LOCUS_00160 17975 17616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 18162 19103 gene locus_tag LOCUS_00170 gene mmuM 18162 19103 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911868.1 protein_id gnl|my_center|LOCUS_00170 19393 19082 gene locus_tag LOCUS_00180 19393 19082 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031863.1 protein_id gnl|my_center|LOCUS_00180 20331 19390 gene locus_tag LOCUS_00190 20331 19390 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726632.1 protein_id gnl|my_center|LOCUS_00190 21130 20414 gene locus_tag LOCUS_00200 21130 20414 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804344.1 protein_id gnl|my_center|LOCUS_00200 21178 21597 gene locus_tag LOCUS_00210 21178 21597 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728346.1 protein_id gnl|my_center|LOCUS_00210 22581 21619 gene locus_tag LOCUS_00220 22581 21619 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812829.1 protein_id gnl|my_center|LOCUS_00220 22665 23678 gene locus_tag LOCUS_00230 22665 23678 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804399.1 protein_id gnl|my_center|LOCUS_00230 24571 23738 gene locus_tag LOCUS_00240 24571 23738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886916.1 protein_id gnl|my_center|LOCUS_00240 24918 24580 gene locus_tag LOCUS_00250 24918 24580 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112420.1 protein_id gnl|my_center|LOCUS_00250 25402 24962 gene locus_tag LOCUS_00260 25402 24962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 25634 25395 gene locus_tag LOCUS_00270 25634 25395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 26607 25669 gene locus_tag LOCUS_00280 26607 25669 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777056.1 protein_id gnl|my_center|LOCUS_00280 27031 26627 gene locus_tag LOCUS_00290 27031 26627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 27573 27028 gene locus_tag LOCUS_00300 27573 27028 CDS product DUF664 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224874.1 protein_id gnl|my_center|LOCUS_00300 27707 28138 gene locus_tag LOCUS_00310 gene trxA 27707 28138 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228708.1 protein_id gnl|my_center|LOCUS_00310 30712 28145 gene locus_tag LOCUS_00320 30712 28145 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051721.1 protein_id gnl|my_center|LOCUS_00320 31788 30856 gene locus_tag LOCUS_00330 31788 30856 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731542.1 protein_id gnl|my_center|LOCUS_00330 31255 31342 gene locus_tag LOCUS_t00020 31255 31342 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 31950 32237 gene locus_tag LOCUS_00340 31950 32237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 32234 32743 gene locus_tag LOCUS_00350 32234 32743 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404756.1 protein_id gnl|my_center|LOCUS_00350 33830 32850 gene locus_tag LOCUS_00360 33830 32850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 36791 34338 gene locus_tag LOCUS_00370 36791 34338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 36928 38301 gene locus_tag LOCUS_00380 36928 38301 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226021.1 protein_id gnl|my_center|LOCUS_00380 38448 39866 gene locus_tag LOCUS_00390 38448 39866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 39929 40183 gene locus_tag LOCUS_00400 39929 40183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 41237 40143 gene locus_tag LOCUS_00410 41237 40143 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014191.1 protein_id gnl|my_center|LOCUS_00410 42610 41234 gene locus_tag LOCUS_00420 42610 41234 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014192.1 protein_id gnl|my_center|LOCUS_00420 43088 42612 gene locus_tag LOCUS_00430 43088 42612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030585.1 protein_id gnl|my_center|LOCUS_00430 43132 43746 gene locus_tag LOCUS_00440 43132 43746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 43771 44289 gene locus_tag LOCUS_00450 43771 44289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 44294 44662 gene locus_tag LOCUS_00460 44294 44662 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226375.1 protein_id gnl|my_center|LOCUS_00460 44719 45105 gene locus_tag LOCUS_00470 gene arr 44719 45105 CDS product NAD(+)--rifampin ADP-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064798.1 protein_id gnl|my_center|LOCUS_00470 45797 45081 gene locus_tag LOCUS_00480 45797 45081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 45905 46633 gene locus_tag LOCUS_00490 45905 46633 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229251.1 protein_id gnl|my_center|LOCUS_00490 50753 46788 gene locus_tag LOCUS_00500 50753 46788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00500 56208 50716 gene locus_tag LOCUS_00510 56208 50716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00510 57344 56520 gene locus_tag LOCUS_00520 57344 56520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 57453 57683 gene locus_tag LOCUS_00530 57453 57683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 58258 57665 gene locus_tag LOCUS_00540 58258 57665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 58713 58255 gene locus_tag LOCUS_00550 58713 58255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 59774 58818 gene locus_tag LOCUS_00560 59774 58818 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110924.1 protein_id gnl|my_center|LOCUS_00560 60515 60111 gene locus_tag LOCUS_00570 60515 60111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 61945 60572 gene locus_tag LOCUS_00580 61945 60572 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704981.1 protein_id gnl|my_center|LOCUS_00580 62762 62130 gene locus_tag LOCUS_00590 62762 62130 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063706.1 protein_id gnl|my_center|LOCUS_00590 63056 62781 gene locus_tag LOCUS_00600 63056 62781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 63295 65058 gene locus_tag LOCUS_00610 63295 65058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 65325 66086 gene locus_tag LOCUS_00620 65325 66086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 66083 67003 gene locus_tag LOCUS_00630 66083 67003 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222248.1 protein_id gnl|my_center|LOCUS_00630 67000 68667 gene locus_tag LOCUS_00640 67000 68667 CDS product ABC transporter membrane-spanning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029130.1 protein_id gnl|my_center|LOCUS_00640 69159 68716 gene locus_tag LOCUS_00650 69159 68716 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414624.1 protein_id gnl|my_center|LOCUS_00650 69393 69163 gene locus_tag LOCUS_00660 69393 69163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 71125 69455 gene locus_tag LOCUS_00670 71125 69455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 71603 71205 gene locus_tag LOCUS_00680 71603 71205 CDS product DUF6394 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880147.1 protein_id gnl|my_center|LOCUS_00680 71722 72282 gene locus_tag LOCUS_00690 71722 72282 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225943.1 protein_id gnl|my_center|LOCUS_00690 72343 72807 gene locus_tag LOCUS_00700 72343 72807 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228769.1 protein_id gnl|my_center|LOCUS_00700 72859 73323 gene locus_tag LOCUS_00710 72859 73323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 73813 73346 gene locus_tag LOCUS_00720 73813 73346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 73871 76267 gene locus_tag LOCUS_00730 73871 76267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 76272 77000 gene locus_tag LOCUS_00740 76272 77000 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227776.1 protein_id gnl|my_center|LOCUS_00740 77178 77579 gene locus_tag LOCUS_00750 77178 77579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 77819 78226 gene locus_tag LOCUS_00760 77819 78226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 79205 78537 gene locus_tag LOCUS_00770 79205 78537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 82688 79323 gene locus_tag LOCUS_00780 82688 79323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 82627 83103 gene locus_tag LOCUS_00790 82627 83103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 83253 84170 gene locus_tag LOCUS_00800 83253 84170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 85307 84303 gene locus_tag LOCUS_00810 85307 84303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775834.1 protein_id gnl|my_center|LOCUS_00810 86256 85705 gene locus_tag LOCUS_00820 86256 85705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 86424 87200 gene locus_tag LOCUS_00830 86424 87200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 87676 87269 gene locus_tag LOCUS_00840 gene vapC26 87676 87269 CDS product type II toxin-antitoxin system toxin ribonuclease C26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403047.1 protein_id gnl|my_center|LOCUS_00840 87885 87673 gene locus_tag LOCUS_00850 gene vapB26 87885 87673 CDS product type II toxin-antitoxin system antitoxin VapB26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403039.1 protein_id gnl|my_center|LOCUS_00850 87986 88189 gene locus_tag LOCUS_00860 87986 88189 CDS product antitoxin MazE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729843.1 protein_id gnl|my_center|LOCUS_00860 88186 88512 gene locus_tag LOCUS_00870 88186 88512 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895797.1 protein_id gnl|my_center|LOCUS_00870 88779 88618 gene locus_tag LOCUS_00880 88779 88618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 89304 88963 gene locus_tag LOCUS_00890 89304 88963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 89810 89301 gene locus_tag LOCUS_00900 89810 89301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 91112 89931 gene locus_tag LOCUS_00910 91112 89931 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_00910 92413 91190 gene locus_tag LOCUS_00920 92413 91190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480131.1 protein_id gnl|my_center|LOCUS_00920 93278 92415 gene locus_tag LOCUS_00930 gene pdxY 93278 92415 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349874.1 protein_id gnl|my_center|LOCUS_00930 93688 93335 gene locus_tag LOCUS_00940 93688 93335 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222088.1 protein_id gnl|my_center|LOCUS_00940 94596 93736 gene locus_tag LOCUS_00950 94596 93736 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027460.1 protein_id gnl|my_center|LOCUS_00950 95713 94616 gene locus_tag LOCUS_00960 95713 94616 CDS product DUF2183 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930149.1 protein_id gnl|my_center|LOCUS_00960 95974 96369 gene locus_tag LOCUS_00970 95974 96369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 96382 97590 gene locus_tag LOCUS_00980 96382 97590 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400622.1 protein_id gnl|my_center|LOCUS_00980 98113 97565 gene locus_tag LOCUS_00990 98113 97565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776876.1 protein_id gnl|my_center|LOCUS_00990 98880 98110 gene locus_tag LOCUS_01000 gene ric 98880 98110 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963399.1 protein_id gnl|my_center|LOCUS_01000 99323 100444 gene locus_tag LOCUS_01010 99323 100444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 100495 100824 gene locus_tag LOCUS_01020 100495 100824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 102425 100917 gene locus_tag LOCUS_01030 102425 100917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974902.1 protein_id gnl|my_center|LOCUS_01030 103352 104464 gene locus_tag LOCUS_01040 103352 104464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 104598 106760 gene locus_tag LOCUS_01050 104598 106760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 106919 107323 gene locus_tag LOCUS_01060 106919 107323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 107619 109451 gene locus_tag LOCUS_01070 gene sulP 107619 109451 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085632.1 protein_id gnl|my_center|LOCUS_01070 109453 110115 gene locus_tag LOCUS_01080 109453 110115 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284363.1 protein_id gnl|my_center|LOCUS_01080 110266 110466 gene locus_tag LOCUS_01090 110266 110466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 110658 111413 gene locus_tag LOCUS_01100 110658 111413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 112421 111477 gene locus_tag LOCUS_01110 112421 111477 CDS product aldose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167549.1 protein_id gnl|my_center|LOCUS_01110 113798 112437 gene locus_tag LOCUS_01120 113798 112437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 113984 114259 gene locus_tag LOCUS_01130 113984 114259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 114518 115372 gene locus_tag LOCUS_01140 114518 115372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 115512 122267 gene locus_tag LOCUS_01150 115512 122267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 122267 125953 gene locus_tag LOCUS_01160 122267 125953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 126886 126041 gene locus_tag LOCUS_01170 126886 126041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976865.1 protein_id gnl|my_center|LOCUS_01170 127859 127260 gene locus_tag LOCUS_01180 127859 127260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 127897 128622 gene locus_tag LOCUS_01190 127897 128622 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326297.1 protein_id gnl|my_center|LOCUS_01190 128622 129953 gene locus_tag LOCUS_01200 128622 129953 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976000.1 protein_id gnl|my_center|LOCUS_01200 130480 130016 gene locus_tag LOCUS_01210 130480 130016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 130754 131203 gene locus_tag LOCUS_01220 130754 131203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 131218 132333 gene locus_tag LOCUS_01230 131218 132333 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227736.1 protein_id gnl|my_center|LOCUS_01230 132330 132878 gene locus_tag LOCUS_01240 132330 132878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 132875 134197 gene locus_tag LOCUS_01250 132875 134197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01250 134338 134484 gene locus_tag LOCUS_01260 134338 134484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 134950 134546 gene locus_tag LOCUS_01270 134950 134546 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403246.1 protein_id gnl|my_center|LOCUS_01270 135195 134947 gene locus_tag LOCUS_01280 135195 134947 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403244.1 protein_id gnl|my_center|LOCUS_01280 135485 135255 gene locus_tag LOCUS_01290 135485 135255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 136702 135488 gene locus_tag LOCUS_01300 gene rocD 136702 135488 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727654.1 protein_id gnl|my_center|LOCUS_01300 136741 136968 gene locus_tag LOCUS_01310 136741 136968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 138152 136923 gene locus_tag LOCUS_01320 gene hutI 138152 136923 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892542.1 protein_id gnl|my_center|LOCUS_01320 138830 138213 gene locus_tag LOCUS_01330 138830 138213 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095323.1 protein_id gnl|my_center|LOCUS_01330 139699 138827 gene locus_tag LOCUS_01340 139699 138827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01340 140271 139696 gene locus_tag LOCUS_01350 140271 139696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01350 141491 140268 gene locus_tag LOCUS_01360 141491 140268 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028750.1 protein_id gnl|my_center|LOCUS_01360 143355 141673 gene locus_tag LOCUS_01370 143355 141673 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727477.1 protein_id gnl|my_center|LOCUS_01370 143427 143690 gene locus_tag LOCUS_01380 143427 143690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 143687 144079 gene locus_tag LOCUS_01390 143687 144079 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414064.1 protein_id gnl|my_center|LOCUS_01390 144083 144532 gene locus_tag LOCUS_01400 144083 144532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 146181 144601 gene locus_tag LOCUS_01410 gene hutH 146181 144601 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727479.1 protein_id gnl|my_center|LOCUS_01410 146180 146389 gene locus_tag LOCUS_01420 146180 146389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 146353 146658 gene locus_tag LOCUS_01430 146353 146658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 146701 147474 gene locus_tag LOCUS_01440 146701 147474 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223166.1 protein_id gnl|my_center|LOCUS_01440 147658 148152 gene locus_tag LOCUS_01450 147658 148152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 149510 148215 gene locus_tag LOCUS_01460 149510 148215 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227556.1 protein_id gnl|my_center|LOCUS_01460 150127 149507 gene locus_tag LOCUS_01470 150127 149507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 151393 150131 gene locus_tag LOCUS_01480 151393 150131 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870846.1 protein_id gnl|my_center|LOCUS_01480 151513 152028 gene locus_tag LOCUS_01490 151513 152028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 152094 153287 gene locus_tag LOCUS_01500 152094 153287 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226315.1 protein_id gnl|my_center|LOCUS_01500 155100 153394 gene locus_tag LOCUS_01510 155100 153394 CDS product multidrug efflux MFS transporter NorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722177.1 protein_id gnl|my_center|LOCUS_01510 156293 155103 gene locus_tag LOCUS_01520 156293 155103 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857726.1 protein_id gnl|my_center|LOCUS_01520 156527 157690 gene locus_tag LOCUS_01530 156527 157690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 158263 158445 gene locus_tag LOCUS_01540 158263 158445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 158526 160181 gene locus_tag LOCUS_01550 158526 160181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 160435 161949 gene locus_tag LOCUS_01560 160435 161949 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140787.1 protein_id gnl|my_center|LOCUS_01560 162199 163440 gene locus_tag LOCUS_01570 162199 163440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 163433 164404 gene locus_tag LOCUS_01580 163433 164404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 166156 164489 gene locus_tag LOCUS_01590 166156 164489 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926478.1 protein_id gnl|my_center|LOCUS_01590 166807 166328 gene locus_tag LOCUS_01600 166807 166328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 167071 168411 gene locus_tag LOCUS_01610 167071 168411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 169445 168477 gene locus_tag LOCUS_01620 169445 168477 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139566.1 protein_id gnl|my_center|LOCUS_01620 170898 169672 gene locus_tag LOCUS_01630 170898 169672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 171806 170895 gene locus_tag LOCUS_01640 171806 170895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 172842 171883 gene locus_tag LOCUS_01650 172842 171883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 174812 172839 gene locus_tag LOCUS_01660 174812 172839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 176746 174809 gene locus_tag LOCUS_01670 176746 174809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 177360 176743 gene locus_tag LOCUS_01680 177360 176743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 178075 177596 gene locus_tag LOCUS_01690 178075 177596 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036604.1 protein_id gnl|my_center|LOCUS_01690 179154 178222 gene locus_tag LOCUS_01700 179154 178222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 179330 180187 gene locus_tag LOCUS_01710 179330 180187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 180429 181643 gene locus_tag LOCUS_01720 180429 181643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 181771 182520 gene locus_tag LOCUS_01730 181771 182520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 182683 182913 gene locus_tag LOCUS_01740 182683 182913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 183087 183818 gene locus_tag LOCUS_01750 183087 183818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 183927 184787 gene locus_tag LOCUS_01760 183927 184787 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115465.1 protein_id gnl|my_center|LOCUS_01760 184809 186434 gene locus_tag LOCUS_01770 184809 186434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 187089 186487 gene locus_tag LOCUS_01780 187089 186487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 187368 188612 gene locus_tag LOCUS_01790 187368 188612 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731181.1 protein_id gnl|my_center|LOCUS_01790 188997 188620 gene locus_tag LOCUS_01800 188997 188620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 189368 189117 gene locus_tag LOCUS_01810 189368 189117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 190476 189904 gene locus_tag LOCUS_01820 190476 189904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 191319 190546 gene locus_tag LOCUS_01830 191319 190546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 192136 191636 gene locus_tag LOCUS_01840 192136 191636 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730766.1 protein_id gnl|my_center|LOCUS_01840 192994 192209 gene locus_tag LOCUS_01850 192994 192209 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024997765.1 protein_id gnl|my_center|LOCUS_01850 193824 192991 gene locus_tag LOCUS_01860 193824 192991 CDS product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120708963.1 protein_id gnl|my_center|LOCUS_01860 195333 193834 gene locus_tag LOCUS_01870 195333 193834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 195835 195395 gene locus_tag LOCUS_01880 195835 195395 CDS product TIGR03668 family PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897940.1 protein_id gnl|my_center|LOCUS_01880 196913 195858 gene locus_tag LOCUS_01890 gene fgd 196913 195858 CDS product glucose-6-phosphate dehydrogenase (coenzyme-F420) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225239.1 protein_id gnl|my_center|LOCUS_01890 198037 196910 gene locus_tag LOCUS_01900 198037 196910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 199027 198041 gene locus_tag LOCUS_01910 199027 198041 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225353.1 protein_id gnl|my_center|LOCUS_01910 200574 200945 gene locus_tag LOCUS_01920 200574 200945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 202585 201026 gene locus_tag LOCUS_01930 202585 201026 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730671.1 protein_id gnl|my_center|LOCUS_01930 203439 202681 gene locus_tag LOCUS_01940 gene cofC 203439 202681 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973437.1 protein_id gnl|my_center|LOCUS_01940 204206 203436 gene locus_tag LOCUS_01950 204206 203436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01950 205354 204167 gene locus_tag LOCUS_01960 205354 204167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01960 206199 205351 gene locus_tag LOCUS_01970 206199 205351 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256765.1 protein_id gnl|my_center|LOCUS_01970 206972 206667 gene locus_tag LOCUS_01980 206972 206667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 210008 207255 gene locus_tag LOCUS_01990 210008 207255 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387994.1 protein_id gnl|my_center|LOCUS_01990 210242 210015 gene locus_tag LOCUS_02000 210242 210015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 211044 210625 gene locus_tag LOCUS_02010 211044 210625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 211472 210987 gene locus_tag LOCUS_02020 211472 210987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02020 211897 211601 gene locus_tag LOCUS_02030 211897 211601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 212097 211867 gene locus_tag LOCUS_02040 212097 211867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02040 212134 212502 gene locus_tag LOCUS_02050 212134 212502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 212626 212414 gene locus_tag LOCUS_02060 212626 212414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02060 214007 214579 gene locus_tag LOCUS_02070 214007 214579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 215267 214929 gene locus_tag LOCUS_02080 215267 214929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 217217 216660 gene locus_tag LOCUS_02090 217217 216660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02090 217465 217220 gene locus_tag LOCUS_02100 217465 217220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 217725 217426 gene locus_tag LOCUS_02110 217725 217426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02110 218343 217822 gene locus_tag LOCUS_02120 218343 217822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 218542 218321 gene locus_tag LOCUS_02130 218542 218321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 219634 218543 gene locus_tag LOCUS_02140 219634 218543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02140 219927 219634 gene locus_tag LOCUS_02150 219927 219634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02150 221165 220122 gene locus_tag LOCUS_02160 221165 220122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02160 223839 221167 gene locus_tag LOCUS_02170 223839 221167 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 protein_id gnl|my_center|LOCUS_02170 227345 223836 gene locus_tag LOCUS_02180 227345 223836 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968627.1 protein_id gnl|my_center|LOCUS_02180 227680 227910 gene locus_tag LOCUS_02190 227680 227910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 228042 229016 gene locus_tag LOCUS_02200 228042 229016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 229055 230650 gene locus_tag LOCUS_02210 229055 230650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 230951 230866 gene locus_tag LOCUS_t00030 230951 230866 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 231404 232270 gene locus_tag LOCUS_02220 231404 232270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02220 232300 232635 gene locus_tag LOCUS_02230 232300 232635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 >Feature sequence02 170 99 gene locus_tag LOCUS_t00040 170 99 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 263 190 gene locus_tag LOCUS_t00050 263 190 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1626 442 gene locus_tag LOCUS_02240 1626 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 1829 2476 gene locus_tag LOCUS_02250 1829 2476 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069213.1 protein_id gnl|my_center|LOCUS_02250 2488 3543 gene locus_tag LOCUS_02260 2488 3543 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005121850.1 protein_id gnl|my_center|LOCUS_02260 4641 3562 gene locus_tag LOCUS_02270 gene ligD 4641 3562 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972287.1 protein_id gnl|my_center|LOCUS_02270 4741 5181 gene locus_tag LOCUS_02280 gene msrB 4741 5181 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972860.1 protein_id gnl|my_center|LOCUS_02280 5352 6401 gene locus_tag LOCUS_02290 5352 6401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 7220 6384 gene locus_tag LOCUS_02300 7220 6384 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083532.1 protein_id gnl|my_center|LOCUS_02300 7344 7910 gene locus_tag LOCUS_02310 7344 7910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 7907 9277 gene locus_tag LOCUS_02320 7907 9277 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972895.1 protein_id gnl|my_center|LOCUS_02320 9384 10604 gene locus_tag LOCUS_02330 9384 10604 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224501.1 protein_id gnl|my_center|LOCUS_02330 10608 12740 gene locus_tag LOCUS_02340 10608 12740 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030602.1 protein_id gnl|my_center|LOCUS_02340 12852 14378 gene locus_tag LOCUS_02350 12852 14378 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972925.1 protein_id gnl|my_center|LOCUS_02350 15335 14433 gene locus_tag LOCUS_02360 15335 14433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 17203 15332 gene locus_tag LOCUS_02370 gene dxs 17203 15332 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972908.1 protein_id gnl|my_center|LOCUS_02370 18713 17331 gene locus_tag LOCUS_02380 18713 17331 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113135.1 protein_id gnl|my_center|LOCUS_02380 18631 18942 gene locus_tag LOCUS_02390 18631 18942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 19522 19205 gene locus_tag LOCUS_02400 19522 19205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 22397 19695 gene locus_tag LOCUS_02410 gene acnA 22397 19695 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972923.1 protein_id gnl|my_center|LOCUS_02410 23780 22572 gene locus_tag LOCUS_02420 23780 22572 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030522.1 protein_id gnl|my_center|LOCUS_02420 25897 23879 gene locus_tag LOCUS_02430 25897 23879 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742167.1 protein_id gnl|my_center|LOCUS_02430 26038 26685 gene locus_tag LOCUS_02440 26038 26685 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_02440 26733 27422 gene locus_tag LOCUS_02450 26733 27422 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973146.1 protein_id gnl|my_center|LOCUS_02450 28300 27440 gene locus_tag LOCUS_02460 28300 27440 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230310.1 protein_id gnl|my_center|LOCUS_02460 28721 28293 gene locus_tag LOCUS_02470 28721 28293 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327459.1 protein_id gnl|my_center|LOCUS_02470 29509 28724 gene locus_tag LOCUS_02480 29509 28724 CDS product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805053.1 protein_id gnl|my_center|LOCUS_02480 30039 29563 gene locus_tag LOCUS_02490 gene dut 30039 29563 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973153.1 protein_id gnl|my_center|LOCUS_02490 30335 30036 gene locus_tag LOCUS_02500 30335 30036 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057245.1 protein_id gnl|my_center|LOCUS_02500 31406 30567 gene locus_tag LOCUS_02510 31406 30567 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014746.1 protein_id gnl|my_center|LOCUS_02510 31563 32837 gene locus_tag LOCUS_02520 gene sepH 31563 32837 CDS product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805049.1 protein_id gnl|my_center|LOCUS_02520 33599 32898 gene locus_tag LOCUS_02530 33599 32898 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973175.1 protein_id gnl|my_center|LOCUS_02530 34735 33578 gene locus_tag LOCUS_02540 34735 33578 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030493.1 protein_id gnl|my_center|LOCUS_02540 35350 34751 gene locus_tag LOCUS_02550 35350 34751 CDS product DUF5998 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030492.1 protein_id gnl|my_center|LOCUS_02550 38054 35364 gene locus_tag LOCUS_02560 38054 35364 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 protein_id gnl|my_center|LOCUS_02560 38113 38820 gene locus_tag LOCUS_02570 38113 38820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 38841 41336 gene locus_tag LOCUS_02580 38841 41336 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929932.1 protein_id gnl|my_center|LOCUS_02580 41620 42945 gene locus_tag LOCUS_02590 41620 42945 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930026.1 protein_id gnl|my_center|LOCUS_02590 43017 44000 gene locus_tag LOCUS_02600 43017 44000 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930288.1 protein_id gnl|my_center|LOCUS_02600 43997 44920 gene locus_tag LOCUS_02610 43997 44920 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776594.1 protein_id gnl|my_center|LOCUS_02610 45009 46619 gene locus_tag LOCUS_02620 45009 46619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 46754 47677 gene locus_tag LOCUS_02630 46754 47677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 47674 49854 gene locus_tag LOCUS_02640 47674 49854 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020639906.1 protein_id gnl|my_center|LOCUS_02640 50054 51082 gene locus_tag LOCUS_02650 50054 51082 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869311.1 protein_id gnl|my_center|LOCUS_02650 53277 51094 gene locus_tag LOCUS_02660 53277 51094 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805040.1 protein_id gnl|my_center|LOCUS_02660 53546 53806 gene locus_tag LOCUS_02670 53546 53806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 53803 54291 gene locus_tag LOCUS_02680 53803 54291 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079757.1 protein_id gnl|my_center|LOCUS_02680 54751 54368 gene locus_tag LOCUS_02690 54751 54368 CDS product spore wall synthesis complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028137.1 protein_id gnl|my_center|LOCUS_02690 56094 54850 gene locus_tag LOCUS_02700 gene dinB 56094 54850 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228056.1 protein_id gnl|my_center|LOCUS_02700 56949 56167 gene locus_tag LOCUS_02710 56949 56167 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028138.1 protein_id gnl|my_center|LOCUS_02710 56985 57926 gene locus_tag LOCUS_02720 56985 57926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 62354 58032 gene locus_tag LOCUS_02730 62354 58032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 62848 62366 gene locus_tag LOCUS_02740 62848 62366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 63244 62975 gene locus_tag LOCUS_02750 63244 62975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 63620 64189 gene locus_tag LOCUS_02760 63620 64189 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224204.1 protein_id gnl|my_center|LOCUS_02760 64518 65228 gene locus_tag LOCUS_02770 64518 65228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 66167 65256 gene locus_tag LOCUS_02780 66167 65256 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224200.1 protein_id gnl|my_center|LOCUS_02780 66326 67414 gene locus_tag LOCUS_02790 66326 67414 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_02790 67818 67411 gene locus_tag LOCUS_02800 67818 67411 CDS product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805032.1 protein_id gnl|my_center|LOCUS_02800 67902 69956 gene locus_tag LOCUS_02810 67902 69956 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390081.1 protein_id gnl|my_center|LOCUS_02810 69999 70877 gene locus_tag LOCUS_02820 69999 70877 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889019.1 protein_id gnl|my_center|LOCUS_02820 72017 70941 gene locus_tag LOCUS_02830 72017 70941 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142473.1 protein_id gnl|my_center|LOCUS_02830 73413 72034 gene locus_tag LOCUS_02840 73413 72034 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265947.1 protein_id gnl|my_center|LOCUS_02840 73511 74341 gene locus_tag LOCUS_02850 73511 74341 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228982.1 protein_id gnl|my_center|LOCUS_02850 74410 74907 gene locus_tag LOCUS_02860 gene tpx 74410 74907 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776224.1 protein_id gnl|my_center|LOCUS_02860 75692 74955 gene locus_tag LOCUS_02870 75692 74955 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976695.1 protein_id gnl|my_center|LOCUS_02870 76849 75692 gene locus_tag LOCUS_02880 76849 75692 CDS product DUF5931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976694.1 protein_id gnl|my_center|LOCUS_02880 77741 76878 gene locus_tag LOCUS_02890 77741 76878 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469516.1 protein_id gnl|my_center|LOCUS_02890 77853 78446 gene locus_tag LOCUS_02900 77853 78446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224328.1 protein_id gnl|my_center|LOCUS_02900 79591 78485 gene locus_tag LOCUS_02910 79591 78485 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030775.1 protein_id gnl|my_center|LOCUS_02910 79995 79588 gene locus_tag LOCUS_02920 79995 79588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 80465 80019 gene locus_tag LOCUS_02930 80465 80019 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224321.1 protein_id gnl|my_center|LOCUS_02930 81777 80518 gene locus_tag LOCUS_02940 81777 80518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869422.1 protein_id gnl|my_center|LOCUS_02940 82131 81838 gene locus_tag LOCUS_02950 82131 81838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 82289 83998 gene locus_tag LOCUS_02960 82289 83998 CDS product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224085.1 protein_id gnl|my_center|LOCUS_02960 83995 84273 gene locus_tag LOCUS_02970 83995 84273 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976675.1 protein_id gnl|my_center|LOCUS_02970 85397 84336 gene locus_tag LOCUS_02980 gene trpD 85397 84336 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028166.1 protein_id gnl|my_center|LOCUS_02980 85850 85401 gene locus_tag LOCUS_02990 85850 85401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976663.1 protein_id gnl|my_center|LOCUS_02990 86261 86839 gene locus_tag LOCUS_03000 86261 86839 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976664.1 protein_id gnl|my_center|LOCUS_03000 86889 87671 gene locus_tag LOCUS_03010 86889 87671 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805020.1 protein_id gnl|my_center|LOCUS_03010 87711 88739 gene locus_tag LOCUS_03020 87711 88739 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805019.1 protein_id gnl|my_center|LOCUS_03020 88736 90466 gene locus_tag LOCUS_03030 88736 90466 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805018.1 protein_id gnl|my_center|LOCUS_03030 90839 90564 gene locus_tag LOCUS_03040 90839 90564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 91897 90830 gene locus_tag LOCUS_03050 91897 90830 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905888.1 protein_id gnl|my_center|LOCUS_03050 92041 92409 gene locus_tag LOCUS_03060 92041 92409 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029427.1 protein_id gnl|my_center|LOCUS_03060 92894 92493 gene locus_tag LOCUS_03070 92894 92493 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976661.1 protein_id gnl|my_center|LOCUS_03070 94637 92898 gene locus_tag LOCUS_03080 gene ctaD 94637 92898 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976660.1 protein_id gnl|my_center|LOCUS_03080 95419 94637 gene locus_tag LOCUS_03090 gene coxB 95419 94637 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805014.1 protein_id gnl|my_center|LOCUS_03090 95968 95660 gene locus_tag LOCUS_03100 95968 95660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 95891 96826 gene locus_tag LOCUS_03110 95891 96826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03110 96823 97125 gene locus_tag LOCUS_03120 96823 97125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03120 97796 97122 gene locus_tag LOCUS_03130 gene aat 97796 97122 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072572.1 protein_id gnl|my_center|LOCUS_03130 98807 97821 gene locus_tag LOCUS_03140 98807 97821 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326033.1 protein_id gnl|my_center|LOCUS_03140 99317 98940 gene locus_tag LOCUS_03150 gene erpA 99317 98940 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805013.1 protein_id gnl|my_center|LOCUS_03150 100077 99529 gene locus_tag LOCUS_03160 100077 99529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 100787 100377 gene locus_tag LOCUS_03170 100787 100377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 100756 100965 gene locus_tag LOCUS_03180 100756 100965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 101231 101106 gene locus_tag LOCUS_03190 101231 101106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 101956 101228 gene locus_tag LOCUS_03200 101956 101228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 102582 101953 gene locus_tag LOCUS_03210 102582 101953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 103033 102686 gene locus_tag LOCUS_03220 103033 102686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 102990 103154 gene locus_tag LOCUS_03230 102990 103154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 104162 103533 gene locus_tag LOCUS_03240 104162 103533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 104714 104268 gene locus_tag LOCUS_03250 104714 104268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 105565 105125 gene locus_tag LOCUS_03260 105565 105125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 105507 105716 gene locus_tag LOCUS_03270 105507 105716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 106982 105876 gene locus_tag LOCUS_03280 106982 105876 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554710.1 protein_id gnl|my_center|LOCUS_03280 108627 107038 gene locus_tag LOCUS_03290 108627 107038 CDS product aspartate:alanine exchanger family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258651.1 protein_id gnl|my_center|LOCUS_03290 108688 109887 gene locus_tag LOCUS_03300 gene nadA 108688 109887 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869444.1 protein_id gnl|my_center|LOCUS_03300 111340 109955 gene locus_tag LOCUS_03310 111340 109955 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878135.1 protein_id gnl|my_center|LOCUS_03310 111333 111974 gene locus_tag LOCUS_03320 111333 111974 CDS product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805010.1 protein_id gnl|my_center|LOCUS_03320 113379 112012 gene locus_tag LOCUS_03330 113379 112012 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230185.1 protein_id gnl|my_center|LOCUS_03330 113597 113376 gene locus_tag LOCUS_03340 113597 113376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976644.1 protein_id gnl|my_center|LOCUS_03340 113908 114618 gene locus_tag LOCUS_03350 113908 114618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 114659 115747 gene locus_tag LOCUS_03360 114659 115747 CDS product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028280.1 protein_id gnl|my_center|LOCUS_03360 115744 117444 gene locus_tag LOCUS_03370 115744 117444 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028281.1 protein_id gnl|my_center|LOCUS_03370 117491 118294 gene locus_tag LOCUS_03380 117491 118294 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028282.1 protein_id gnl|my_center|LOCUS_03380 119351 118254 gene locus_tag LOCUS_03390 gene gcvT 119351 118254 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085318.1 protein_id gnl|my_center|LOCUS_03390 119631 119407 gene locus_tag LOCUS_03400 119631 119407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 119930 119628 gene locus_tag LOCUS_03410 119930 119628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 120059 121168 gene locus_tag LOCUS_03420 120059 121168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 121221 122600 gene locus_tag LOCUS_03430 gene lpdA 121221 122600 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224051.1 protein_id gnl|my_center|LOCUS_03430 122649 124529 gene locus_tag LOCUS_03440 gene sucB 122649 124529 CDS product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775679.1 protein_id gnl|my_center|LOCUS_03440 124526 125449 gene locus_tag LOCUS_03450 124526 125449 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870932.1 protein_id gnl|my_center|LOCUS_03450 127037 125439 gene locus_tag LOCUS_03460 127037 125439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 128247 127201 gene locus_tag LOCUS_03470 128247 127201 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975953.1 protein_id gnl|my_center|LOCUS_03470 128283 128984 gene locus_tag LOCUS_03480 gene lipB 128283 128984 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224047.1 protein_id gnl|my_center|LOCUS_03480 129107 130132 gene locus_tag LOCUS_03490 gene lipA 129107 130132 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060750.1 protein_id gnl|my_center|LOCUS_03490 130138 130863 gene locus_tag LOCUS_03500 130138 130863 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976619.1 protein_id gnl|my_center|LOCUS_03500 131373 130909 gene locus_tag LOCUS_03510 131373 130909 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976618.1 protein_id gnl|my_center|LOCUS_03510 131573 132997 gene locus_tag LOCUS_03520 gene glnA 131573 132997 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775685.1 protein_id gnl|my_center|LOCUS_03520 133156 133305 gene locus_tag LOCUS_03530 133156 133305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 133654 133364 gene locus_tag LOCUS_03540 133654 133364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 134496 133675 gene locus_tag LOCUS_03550 134496 133675 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082945.1 protein_id gnl|my_center|LOCUS_03550 134880 134647 gene locus_tag LOCUS_03560 134880 134647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 134873 135343 gene locus_tag LOCUS_03570 134873 135343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 135880 135416 gene locus_tag LOCUS_03580 135880 135416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 137514 135958 gene locus_tag LOCUS_03590 137514 135958 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029333.1 protein_id gnl|my_center|LOCUS_03590 137980 137555 gene locus_tag LOCUS_03600 137980 137555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 138707 138036 gene locus_tag LOCUS_03610 138707 138036 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226222.1 protein_id gnl|my_center|LOCUS_03610 141767 138744 gene locus_tag LOCUS_03620 141767 138744 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028215.1 protein_id gnl|my_center|LOCUS_03620 143116 141779 gene locus_tag LOCUS_03630 gene glnA 143116 141779 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976572.1 protein_id gnl|my_center|LOCUS_03630 143445 143245 gene locus_tag LOCUS_03640 143445 143245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 143593 144402 gene locus_tag LOCUS_03650 gene map 143593 144402 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976546.1 protein_id gnl|my_center|LOCUS_03650 144483 145241 gene locus_tag LOCUS_03660 144483 145241 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413941.1 protein_id gnl|my_center|LOCUS_03660 145952 145299 gene locus_tag LOCUS_03670 145952 145299 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403989.1 protein_id gnl|my_center|LOCUS_03670 146115 147791 gene locus_tag LOCUS_03680 gene pgi 146115 147791 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804725.1 protein_id gnl|my_center|LOCUS_03680 147860 148081 gene locus_tag LOCUS_03690 147860 148081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 148810 147962 gene locus_tag LOCUS_03700 148810 147962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 151342 148919 gene locus_tag LOCUS_03710 151342 148919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 153194 151512 gene locus_tag LOCUS_03720 153194 151512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 153352 153624 gene locus_tag LOCUS_03730 153352 153624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 154242 154148 gene locus_tag LOCUS_t00060 154242 154148 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 156026 154563 gene locus_tag LOCUS_03740 156026 154563 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223097.1 protein_id gnl|my_center|LOCUS_03740 156174 156920 gene locus_tag LOCUS_03750 gene yaaA 156174 156920 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976516.1 protein_id gnl|my_center|LOCUS_03750 158170 156917 gene locus_tag LOCUS_03760 158170 156917 CDS product bifunctional RNase H/acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223079.1 protein_id gnl|my_center|LOCUS_03760 158881 158174 gene locus_tag LOCUS_03770 158881 158174 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028262.1 protein_id gnl|my_center|LOCUS_03770 159762 158911 gene locus_tag LOCUS_03780 159762 158911 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028263.1 protein_id gnl|my_center|LOCUS_03780 159837 159763 gene locus_tag LOCUS_t00070 159837 159763 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 160395 159919 gene locus_tag LOCUS_03790 160395 159919 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224001.1 protein_id gnl|my_center|LOCUS_03790 160956 160531 gene locus_tag LOCUS_03800 160956 160531 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060606.1 protein_id gnl|my_center|LOCUS_03800 161191 163977 gene locus_tag LOCUS_03810 gene aceE 161191 163977 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729733.1 protein_id gnl|my_center|LOCUS_03810 163970 164731 gene locus_tag LOCUS_03820 163970 164731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 165438 165851 gene locus_tag LOCUS_03830 165438 165851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 166020 167369 gene locus_tag LOCUS_03840 gene argG 166020 167369 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226260.1 protein_id gnl|my_center|LOCUS_03840 167445 168602 gene locus_tag LOCUS_03850 gene fasR 167445 168602 CDS product fatty acid biosynthesis transcriptional regulator FasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028321.1 protein_id gnl|my_center|LOCUS_03850 168697 169953 gene locus_tag LOCUS_03860 168697 169953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 169950 170972 gene locus_tag LOCUS_03870 169950 170972 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976418.1 protein_id gnl|my_center|LOCUS_03870 171051 171296 gene locus_tag LOCUS_03880 171051 171296 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775709.1 protein_id gnl|my_center|LOCUS_03880 171430 172680 gene locus_tag LOCUS_03890 171430 172680 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028323.1 protein_id gnl|my_center|LOCUS_03890 173298 172783 gene locus_tag LOCUS_03900 173298 172783 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223984.1 protein_id gnl|my_center|LOCUS_03900 173654 173454 gene locus_tag LOCUS_03910 173654 173454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 173934 176408 gene locus_tag LOCUS_03920 173934 176408 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206901.1 protein_id gnl|my_center|LOCUS_03920 176526 176600 gene locus_tag LOCUS_t00080 176526 176600 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 176728 178089 gene locus_tag LOCUS_03930 176728 178089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 178192 180060 gene locus_tag LOCUS_03940 178192 180060 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542552.1 protein_id gnl|my_center|LOCUS_03940 180053 180676 gene locus_tag LOCUS_03950 180053 180676 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942383.1 protein_id gnl|my_center|LOCUS_03950 180766 181080 gene locus_tag LOCUS_03960 180766 181080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 181327 181665 gene locus_tag LOCUS_03970 181327 181665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 183207 181720 gene locus_tag LOCUS_03980 183207 181720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 183359 183805 gene locus_tag LOCUS_03990 183359 183805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 185136 183859 gene locus_tag LOCUS_04000 185136 183859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 185210 185986 gene locus_tag LOCUS_04010 185210 185986 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973246.1 protein_id gnl|my_center|LOCUS_04010 186060 186860 gene locus_tag LOCUS_04020 186060 186860 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894111.1 protein_id gnl|my_center|LOCUS_04020 186938 187603 gene locus_tag LOCUS_04030 186938 187603 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776275.1 protein_id gnl|my_center|LOCUS_04030 187600 188532 gene locus_tag LOCUS_04040 187600 188532 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728545.1 protein_id gnl|my_center|LOCUS_04040 188695 189474 gene locus_tag LOCUS_04050 188695 189474 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027565.1 protein_id gnl|my_center|LOCUS_04050 189550 190542 gene locus_tag LOCUS_04060 189550 190542 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027564.1 protein_id gnl|my_center|LOCUS_04060 >Feature sequence03 409 960 gene locus_tag LOCUS_04070 409 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04070 1213 1878 gene locus_tag LOCUS_04080 1213 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04080 2386 2129 gene locus_tag LOCUS_04090 2386 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 2495 3610 gene locus_tag LOCUS_04100 gene ald 2495 3610 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868159.1 protein_id gnl|my_center|LOCUS_04100 3658 4557 gene locus_tag LOCUS_04110 gene xerD 3658 4557 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729303.1 protein_id gnl|my_center|LOCUS_04110 4615 5520 gene locus_tag LOCUS_04120 4615 5520 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805130.1 protein_id gnl|my_center|LOCUS_04120 5504 6397 gene locus_tag LOCUS_04130 5504 6397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 6390 6998 gene locus_tag LOCUS_04140 gene scpB 6390 6998 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027964.1 protein_id gnl|my_center|LOCUS_04140 6995 7957 gene locus_tag LOCUS_04150 6995 7957 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408439.1 protein_id gnl|my_center|LOCUS_04150 8018 9109 gene locus_tag LOCUS_04160 8018 9109 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805132.1 protein_id gnl|my_center|LOCUS_04160 9106 9855 gene locus_tag LOCUS_04170 9106 9855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 9845 10555 gene locus_tag LOCUS_04180 9845 10555 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977065.1 protein_id gnl|my_center|LOCUS_04180 10572 12101 gene locus_tag LOCUS_04190 gene der 10572 12101 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977066.1 protein_id gnl|my_center|LOCUS_04190 12214 12290 gene locus_tag LOCUS_t00090 12214 12290 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 12548 12342 gene locus_tag LOCUS_04200 12548 12342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 12670 12930 gene locus_tag LOCUS_04210 12670 12930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 13794 14429 gene locus_tag LOCUS_04220 13794 14429 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221514425.1 protein_id gnl|my_center|LOCUS_04220 14426 15448 gene locus_tag LOCUS_04230 14426 15448 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977439.1 protein_id gnl|my_center|LOCUS_04230 15465 15797 gene locus_tag LOCUS_04240 15465 15797 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977440.1 protein_id gnl|my_center|LOCUS_04240 16147 16851 gene locus_tag LOCUS_04250 16147 16851 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027758.1 protein_id gnl|my_center|LOCUS_04250 16922 17311 gene locus_tag LOCUS_04260 gene gcvH 16922 17311 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908706.1 protein_id gnl|my_center|LOCUS_04260 17476 17916 gene locus_tag LOCUS_04270 17476 17916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 17999 18658 gene locus_tag LOCUS_04280 17999 18658 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467185.1 protein_id gnl|my_center|LOCUS_04280 18725 19213 gene locus_tag LOCUS_04290 18725 19213 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977444.1 protein_id gnl|my_center|LOCUS_04290 19476 20045 gene locus_tag LOCUS_04300 19476 20045 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805153.1 protein_id gnl|my_center|LOCUS_04300 20267 23161 gene locus_tag LOCUS_04310 gene gcvP 20267 23161 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027754.1 protein_id gnl|my_center|LOCUS_04310 23280 25391 gene locus_tag LOCUS_04320 23280 25391 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898994.1 protein_id gnl|my_center|LOCUS_04320 28548 25408 gene locus_tag LOCUS_04330 28548 25408 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776704.1 protein_id gnl|my_center|LOCUS_04330 29708 28545 gene locus_tag LOCUS_04340 29708 28545 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977530.1 protein_id gnl|my_center|LOCUS_04340 29838 31322 gene locus_tag LOCUS_04350 29838 31322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731144.1 protein_id gnl|my_center|LOCUS_04350 31325 32305 gene locus_tag LOCUS_04360 31325 32305 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813574.1 protein_id gnl|my_center|LOCUS_04360 33112 32330 gene locus_tag LOCUS_04370 33112 32330 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229721.1 protein_id gnl|my_center|LOCUS_04370 33233 35209 gene locus_tag LOCUS_04380 33233 35209 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887578.1 protein_id gnl|my_center|LOCUS_04380 35315 35692 gene locus_tag LOCUS_04390 35315 35692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 36865 35708 gene locus_tag LOCUS_04400 gene rlmC 36865 35708 CDS product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208756.1 protein_id gnl|my_center|LOCUS_04400 36903 37259 gene locus_tag LOCUS_04410 36903 37259 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930294.1 protein_id gnl|my_center|LOCUS_04410 37260 37763 gene locus_tag LOCUS_04420 37260 37763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 38431 37760 gene locus_tag LOCUS_04430 38431 37760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 38505 38804 gene locus_tag LOCUS_04440 38505 38804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 39405 39007 gene locus_tag LOCUS_04450 39405 39007 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969348.1 protein_id gnl|my_center|LOCUS_04450 39641 39402 gene locus_tag LOCUS_04460 39641 39402 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528289.1 protein_id gnl|my_center|LOCUS_04460 40390 39998 gene locus_tag LOCUS_04470 gene vapC29 40390 39998 CDS product type II toxin-antitoxin system ribonuclease VapC29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403218.1 protein_id gnl|my_center|LOCUS_04470 40617 40387 gene locus_tag LOCUS_04480 40617 40387 CDS product antitoxin VapB29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403213.1 protein_id gnl|my_center|LOCUS_04480 40790 42310 gene locus_tag LOCUS_04490 40790 42310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 42814 42344 gene locus_tag LOCUS_04500 42814 42344 CDS product hotdog fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083165620.1 protein_id gnl|my_center|LOCUS_04500 42858 43985 gene locus_tag LOCUS_04510 42858 43985 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230849.1 protein_id gnl|my_center|LOCUS_04510 44757 43975 gene locus_tag LOCUS_04520 44757 43975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 45674 44811 gene locus_tag LOCUS_04530 45674 44811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 45774 47324 gene locus_tag LOCUS_04540 45774 47324 CDS product YjjI family glycine radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111683.1 protein_id gnl|my_center|LOCUS_04540 47296 48153 gene locus_tag LOCUS_04550 47296 48153 CDS product YjjW family glycine radical enzyme activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263780.1 protein_id gnl|my_center|LOCUS_04550 48180 49619 gene locus_tag LOCUS_04560 48180 49619 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258886.1 protein_id gnl|my_center|LOCUS_04560 49777 50136 gene locus_tag LOCUS_04570 49777 50136 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805194.1 protein_id gnl|my_center|LOCUS_04570 50668 50204 gene locus_tag LOCUS_04580 50668 50204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 51486 50689 gene locus_tag LOCUS_04590 51486 50689 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027779.1 protein_id gnl|my_center|LOCUS_04590 53105 51483 gene locus_tag LOCUS_04600 gene lnt 53105 51483 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027519.1 protein_id gnl|my_center|LOCUS_04600 53936 53541 gene locus_tag LOCUS_04610 53936 53541 CDS product 3-aminobutyryl-CoA ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902967.1 protein_id gnl|my_center|LOCUS_04610 54727 53933 gene locus_tag LOCUS_04620 54727 53933 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 protein_id gnl|my_center|LOCUS_04620 56358 54727 gene locus_tag LOCUS_04630 56358 54727 CDS product D-lysine 5,6-aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015881.1 protein_id gnl|my_center|LOCUS_04630 57376 56687 gene locus_tag LOCUS_04640 57376 56687 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803691.1 protein_id gnl|my_center|LOCUS_04640 59721 57397 gene locus_tag LOCUS_04650 59721 57397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 60284 59844 gene locus_tag LOCUS_04660 gene aroQ 60284 59844 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312617.1 protein_id gnl|my_center|LOCUS_04660 61429 60317 gene locus_tag LOCUS_04670 gene kdd 61429 60317 CDS product L-erythro-3,5-diaminohexanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015884.1 protein_id gnl|my_center|LOCUS_04670 61532 62968 gene locus_tag LOCUS_04680 61532 62968 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742083.1 protein_id gnl|my_center|LOCUS_04680 64436 62997 gene locus_tag LOCUS_04690 64436 62997 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107859.1 protein_id gnl|my_center|LOCUS_04690 64453 65007 gene locus_tag LOCUS_04700 gene ybaK 64453 65007 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976757.1 protein_id gnl|my_center|LOCUS_04700 65041 66234 gene locus_tag LOCUS_04710 65041 66234 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036313.1 protein_id gnl|my_center|LOCUS_04710 66687 66226 gene locus_tag LOCUS_04720 66687 66226 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019983923.1 protein_id gnl|my_center|LOCUS_04720 66755 67693 gene locus_tag LOCUS_04730 66755 67693 CDS product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027889.1 protein_id gnl|my_center|LOCUS_04730 69227 67719 gene locus_tag LOCUS_04740 69227 67719 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886129.1 protein_id gnl|my_center|LOCUS_04740 72123 69352 gene locus_tag LOCUS_04750 72123 69352 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027893.1 protein_id gnl|my_center|LOCUS_04750 73025 72120 gene locus_tag LOCUS_04760 73025 72120 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411603.1 protein_id gnl|my_center|LOCUS_04760 73856 73035 gene locus_tag LOCUS_04770 gene tatC 73856 73035 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977194.1 protein_id gnl|my_center|LOCUS_04770 74150 73887 gene locus_tag LOCUS_04780 gene tatA 74150 73887 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115899.1 protein_id gnl|my_center|LOCUS_04780 74542 74147 gene locus_tag LOCUS_04790 74542 74147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 75522 74539 gene locus_tag LOCUS_04800 75522 74539 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226714.1 protein_id gnl|my_center|LOCUS_04800 76559 75519 gene locus_tag LOCUS_04810 76559 75519 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027895.1 protein_id gnl|my_center|LOCUS_04810 76978 76592 gene locus_tag LOCUS_04820 76978 76592 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222011.1 protein_id gnl|my_center|LOCUS_04820 78081 77044 gene locus_tag LOCUS_04830 78081 77044 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805214.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04830 79546 78185 gene locus_tag LOCUS_04840 gene pafA 79546 78185 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 protein_id gnl|my_center|LOCUS_04840 79620 81149 gene locus_tag LOCUS_04850 79620 81149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 81146 82240 gene locus_tag LOCUS_04860 81146 82240 CDS product cellulose-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973600.1 protein_id gnl|my_center|LOCUS_04860 83225 82335 gene locus_tag LOCUS_04870 gene prcA 83225 82335 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226723.1 protein_id gnl|my_center|LOCUS_04870 84058 83228 gene locus_tag LOCUS_04880 gene prcB 84058 83228 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_04880 84252 84055 gene locus_tag LOCUS_04890 84252 84055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 85823 84306 gene locus_tag LOCUS_04900 gene dop 85823 84306 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_04900 85835 86875 gene locus_tag LOCUS_04910 85835 86875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 87001 88005 gene locus_tag LOCUS_04920 87001 88005 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222033.1 protein_id gnl|my_center|LOCUS_04920 88056 88418 gene locus_tag LOCUS_04930 88056 88418 CDS product DUF3054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891587.1 protein_id gnl|my_center|LOCUS_04930 88415 88996 gene locus_tag LOCUS_04940 88415 88996 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975614.1 protein_id gnl|my_center|LOCUS_04940 89146 90792 gene locus_tag LOCUS_04950 89146 90792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 92577 90838 gene locus_tag LOCUS_04960 gene arc 92577 90838 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_04960 93772 92648 gene locus_tag LOCUS_04970 93772 92648 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027901.1 protein_id gnl|my_center|LOCUS_04970 94122 93784 gene locus_tag LOCUS_04980 94122 93784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 95473 94340 gene locus_tag LOCUS_04990 95473 94340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 95570 99352 gene locus_tag LOCUS_05000 gene metH 95570 99352 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729624.1 protein_id gnl|my_center|LOCUS_05000 99477 100322 gene locus_tag LOCUS_05010 99477 100322 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485830.1 protein_id gnl|my_center|LOCUS_05010 101021 100326 gene locus_tag LOCUS_05020 101021 100326 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467175.1 protein_id gnl|my_center|LOCUS_05020 101110 101955 gene locus_tag LOCUS_05030 gene parJ 101110 101955 CDS product filament polymerization regulator ParJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_05030 103232 101985 gene locus_tag LOCUS_05040 gene mshC 103232 101985 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977162.1 protein_id gnl|my_center|LOCUS_05040 104108 103251 gene locus_tag LOCUS_05050 104108 103251 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226501.1 protein_id gnl|my_center|LOCUS_05050 104694 104119 gene locus_tag LOCUS_05060 104694 104119 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977160.1 protein_id gnl|my_center|LOCUS_05060 105441 104704 gene locus_tag LOCUS_05070 105441 104704 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226474.1 protein_id gnl|my_center|LOCUS_05070 105434 106504 gene locus_tag LOCUS_05080 gene corA 105434 106504 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027906.1 protein_id gnl|my_center|LOCUS_05080 107409 106555 gene locus_tag LOCUS_05090 107409 106555 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972097.1 protein_id gnl|my_center|LOCUS_05090 108480 107416 gene locus_tag LOCUS_05100 108480 107416 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226472.1 protein_id gnl|my_center|LOCUS_05100 108553 109491 gene locus_tag LOCUS_05110 108553 109491 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285031.1 protein_id gnl|my_center|LOCUS_05110 109903 109511 gene locus_tag LOCUS_05120 109903 109511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 111370 110012 gene locus_tag LOCUS_05130 111370 110012 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804006.1 protein_id gnl|my_center|LOCUS_05130 112294 111407 gene locus_tag LOCUS_05140 112294 111407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 112386 112469 gene locus_tag LOCUS_t00100 112386 112469 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 114116 112563 gene locus_tag LOCUS_05150 114116 112563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 115158 114217 gene locus_tag LOCUS_05160 gene rocF 115158 114217 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808362.1 protein_id gnl|my_center|LOCUS_05160 116062 115205 gene locus_tag LOCUS_05170 116062 115205 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812896.1 protein_id gnl|my_center|LOCUS_05170 116835 116050 gene locus_tag LOCUS_05180 116835 116050 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729298.1 protein_id gnl|my_center|LOCUS_05180 117934 116918 gene locus_tag LOCUS_05190 117934 116918 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027982.1 protein_id gnl|my_center|LOCUS_05190 118465 117998 gene locus_tag LOCUS_05200 118465 117998 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977025.1 protein_id gnl|my_center|LOCUS_05200 119339 118521 gene locus_tag LOCUS_05210 119339 118521 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284427.1 protein_id gnl|my_center|LOCUS_05210 119414 120181 gene locus_tag LOCUS_05220 119414 120181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 121395 120205 gene locus_tag LOCUS_05230 gene glgA 121395 120205 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805185.1 protein_id gnl|my_center|LOCUS_05230 121457 122710 gene locus_tag LOCUS_05240 gene glgC 121457 122710 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805186.1 protein_id gnl|my_center|LOCUS_05240 122707 123582 gene locus_tag LOCUS_05250 122707 123582 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224195.1 protein_id gnl|my_center|LOCUS_05250 123579 124802 gene locus_tag LOCUS_05260 gene serB 123579 124802 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977014.1 protein_id gnl|my_center|LOCUS_05260 125594 124833 gene locus_tag LOCUS_05270 gene fabI 125594 124833 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226770.1 protein_id gnl|my_center|LOCUS_05270 126361 125633 gene locus_tag LOCUS_05280 gene fabG 126361 125633 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_05280 126513 126827 gene locus_tag LOCUS_05290 126513 126827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 127869 126838 gene locus_tag LOCUS_05300 gene moaA 127869 126838 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230243.1 protein_id gnl|my_center|LOCUS_05300 127902 128693 gene locus_tag LOCUS_05310 127902 128693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05310 130586 128712 gene locus_tag LOCUS_05320 130586 128712 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031376.1 protein_id gnl|my_center|LOCUS_05320 131497 130712 gene locus_tag LOCUS_05330 131497 130712 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028003.1 protein_id gnl|my_center|LOCUS_05330 132394 131507 gene locus_tag LOCUS_05340 132394 131507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 133443 132391 gene locus_tag LOCUS_05350 133443 132391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 134338 133613 gene locus_tag LOCUS_05360 134338 133613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 135600 134335 gene locus_tag LOCUS_05370 gene cobA 135600 134335 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977272.1 protein_id gnl|my_center|LOCUS_05370 136562 135603 gene locus_tag LOCUS_05380 136562 135603 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223442.1 protein_id gnl|my_center|LOCUS_05380 137382 136552 gene locus_tag LOCUS_05390 137382 136552 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972825.1 protein_id gnl|my_center|LOCUS_05390 138335 137385 gene locus_tag LOCUS_05400 138335 137385 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030652.1 protein_id gnl|my_center|LOCUS_05400 139771 138467 gene locus_tag LOCUS_05410 139771 138467 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972823.1 protein_id gnl|my_center|LOCUS_05410 140739 139771 gene locus_tag LOCUS_05420 gene cysD 140739 139771 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972822.1 protein_id gnl|my_center|LOCUS_05420 141482 140736 gene locus_tag LOCUS_05430 141482 140736 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972820.1 protein_id gnl|my_center|LOCUS_05430 143349 141670 gene locus_tag LOCUS_05440 gene sirA 143349 141670 CDS product sulfite reductase SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972818.1 protein_id gnl|my_center|LOCUS_05440 143823 145208 gene locus_tag LOCUS_05450 143823 145208 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228765.1 protein_id gnl|my_center|LOCUS_05450 146008 145202 gene locus_tag LOCUS_05460 146008 145202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 147632 146034 gene locus_tag LOCUS_05470 147632 146034 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976982.1 protein_id gnl|my_center|LOCUS_05470 147739 148872 gene locus_tag LOCUS_05480 147739 148872 CDS product peptidoglycan bridge formation peptidyltransferase VanK-Sc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029108.1 protein_id gnl|my_center|LOCUS_05480 148869 149921 gene locus_tag LOCUS_05490 148869 149921 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975028.1 protein_id gnl|my_center|LOCUS_05490 150035 151000 gene locus_tag LOCUS_05500 150035 151000 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068889.1 protein_id gnl|my_center|LOCUS_05500 151496 151086 gene locus_tag LOCUS_05510 151496 151086 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082943.1 protein_id gnl|my_center|LOCUS_05510 152133 151555 gene locus_tag LOCUS_05520 152133 151555 CDS product acVLRF1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224727.1 protein_id gnl|my_center|LOCUS_05520 152532 152191 gene locus_tag LOCUS_05530 152532 152191 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224702.1 protein_id gnl|my_center|LOCUS_05530 153044 152529 gene locus_tag LOCUS_05540 153044 152529 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082271.1 protein_id gnl|my_center|LOCUS_05540 153925 153044 gene locus_tag LOCUS_05550 153925 153044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05550 154338 153823 gene locus_tag LOCUS_05560 154338 153823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05560 155363 154350 gene locus_tag LOCUS_05570 155363 154350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 155244 155465 gene locus_tag LOCUS_05580 155244 155465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 155864 155487 gene locus_tag LOCUS_05590 155864 155487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05590 155930 156601 gene locus_tag LOCUS_05600 155930 156601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 157118 156711 gene locus_tag LOCUS_05610 157118 156711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05610 158001 157291 gene locus_tag LOCUS_05620 158001 157291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05620 159137 158769 gene locus_tag LOCUS_05630 159137 158769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05630 >Feature sequence04 599 2026 gene locus_tag LOCUS_05640 599 2026 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227294.1 protein_id gnl|my_center|LOCUS_05640 2094 3167 gene locus_tag LOCUS_05650 gene cydB 2094 3167 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227295.1 protein_id gnl|my_center|LOCUS_05650 3394 3248 gene locus_tag LOCUS_05660 3394 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 3350 7033 gene locus_tag LOCUS_05670 gene cydD 3350 7033 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029332.1 protein_id gnl|my_center|LOCUS_05670 7113 8165 gene locus_tag LOCUS_05680 gene bioB 7113 8165 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057907.1 protein_id gnl|my_center|LOCUS_05680 8178 8411 gene locus_tag LOCUS_05690 8178 8411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 8577 8762 gene locus_tag LOCUS_05700 8577 8762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 9109 8864 gene locus_tag LOCUS_05710 9109 8864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 10597 9512 gene locus_tag LOCUS_05720 10597 9512 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029178.1 protein_id gnl|my_center|LOCUS_05720 11397 10594 gene locus_tag LOCUS_05730 11397 10594 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029177.1 protein_id gnl|my_center|LOCUS_05730 12155 11394 gene locus_tag LOCUS_05740 12155 11394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 12547 12152 gene locus_tag LOCUS_05750 12547 12152 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775840.1 protein_id gnl|my_center|LOCUS_05750 12606 13976 gene locus_tag LOCUS_05760 12606 13976 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224093.1 protein_id gnl|my_center|LOCUS_05760 14359 14006 gene locus_tag LOCUS_05770 14359 14006 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776996.1 protein_id gnl|my_center|LOCUS_05770 14796 14356 gene locus_tag LOCUS_05780 14796 14356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 14925 16043 gene locus_tag LOCUS_05790 14925 16043 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728881.1 protein_id gnl|my_center|LOCUS_05790 16036 16758 gene locus_tag LOCUS_05800 gene bioD 16036 16758 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742103.1 protein_id gnl|my_center|LOCUS_05800 16958 16734 gene locus_tag LOCUS_05810 16958 16734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 16996 18090 gene locus_tag LOCUS_05820 16996 18090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 18132 18647 gene locus_tag LOCUS_05830 18132 18647 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975011.1 protein_id gnl|my_center|LOCUS_05830 18736 20145 gene locus_tag LOCUS_05840 gene purB 18736 20145 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776538.1 protein_id gnl|my_center|LOCUS_05840 20857 20462 gene locus_tag LOCUS_05850 20857 20462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 20769 21404 gene locus_tag LOCUS_05860 gene nodB 20769 21404 CDS product chitooligosaccharide deacetylase NodB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875356.1 protein_id gnl|my_center|LOCUS_05860 22145 21510 gene locus_tag LOCUS_05870 22145 21510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 23063 22215 gene locus_tag LOCUS_05880 23063 22215 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887660.1 protein_id gnl|my_center|LOCUS_05880 23939 23121 gene locus_tag LOCUS_05890 23939 23121 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804321.1 protein_id gnl|my_center|LOCUS_05890 25220 23940 gene locus_tag LOCUS_05900 gene serS 25220 23940 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574367.1 protein_id gnl|my_center|LOCUS_05900 25817 25281 gene locus_tag LOCUS_05910 25817 25281 CDS product maleylpyruvate isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728747.1 protein_id gnl|my_center|LOCUS_05910 26194 27123 gene locus_tag LOCUS_05920 26194 27123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 27887 27192 gene locus_tag LOCUS_05930 27887 27192 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030451.1 protein_id gnl|my_center|LOCUS_05930 28867 27884 gene locus_tag LOCUS_05940 28867 27884 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973239.1 protein_id gnl|my_center|LOCUS_05940 29143 29880 gene locus_tag LOCUS_05950 29143 29880 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478515.1 protein_id gnl|my_center|LOCUS_05950 29877 30698 gene locus_tag LOCUS_05960 29877 30698 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454529.1 protein_id gnl|my_center|LOCUS_05960 30698 31048 gene locus_tag LOCUS_05970 30698 31048 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382084.1 protein_id gnl|my_center|LOCUS_05970 31045 31461 gene locus_tag LOCUS_05980 31045 31461 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454537.1 protein_id gnl|my_center|LOCUS_05980 31564 32655 gene locus_tag LOCUS_05990 31564 32655 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804319.1 protein_id gnl|my_center|LOCUS_05990 33742 32858 gene locus_tag LOCUS_06000 33742 32858 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229933.1 protein_id gnl|my_center|LOCUS_06000 36450 34033 gene locus_tag LOCUS_06010 36450 34033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 36614 37249 gene locus_tag LOCUS_06020 36614 37249 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028297.1 protein_id gnl|my_center|LOCUS_06020 37341 38231 gene locus_tag LOCUS_06030 37341 38231 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222172.1 protein_id gnl|my_center|LOCUS_06030 39197 38313 gene locus_tag LOCUS_06040 39197 38313 CDS product DUF5926 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974969.1 protein_id gnl|my_center|LOCUS_06040 39810 39367 gene locus_tag LOCUS_06050 39810 39367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 39972 40565 gene locus_tag LOCUS_06060 39972 40565 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729728.1 protein_id gnl|my_center|LOCUS_06060 40562 41179 gene locus_tag LOCUS_06070 40562 41179 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226078.1 protein_id gnl|my_center|LOCUS_06070 42422 41367 gene locus_tag LOCUS_06080 42422 41367 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225281.1 protein_id gnl|my_center|LOCUS_06080 42584 43720 gene locus_tag LOCUS_06090 42584 43720 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898087.1 protein_id gnl|my_center|LOCUS_06090 44378 43896 gene locus_tag LOCUS_06100 44378 43896 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031562.1 protein_id gnl|my_center|LOCUS_06100 45338 44508 gene locus_tag LOCUS_06110 45338 44508 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222836.1 protein_id gnl|my_center|LOCUS_06110 45382 46107 gene locus_tag LOCUS_06120 45382 46107 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224341.1 protein_id gnl|my_center|LOCUS_06120 47991 46252 gene locus_tag LOCUS_06130 47991 46252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 49290 48088 gene locus_tag LOCUS_06140 49290 48088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 49789 49352 gene locus_tag LOCUS_06150 49789 49352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 50906 49992 gene locus_tag LOCUS_06160 50906 49992 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867471.1 protein_id gnl|my_center|LOCUS_06160 51888 50893 gene locus_tag LOCUS_06170 51888 50893 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974362.1 protein_id gnl|my_center|LOCUS_06170 53159 51885 gene locus_tag LOCUS_06180 53159 51885 CDS product sigma-E factor regulatory protein RseB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229771.1 protein_id gnl|my_center|LOCUS_06180 53248 53544 gene locus_tag LOCUS_06190 53248 53544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 53541 54140 gene locus_tag LOCUS_06200 53541 54140 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400645.1 protein_id gnl|my_center|LOCUS_06200 54152 54616 gene locus_tag LOCUS_06210 54152 54616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 54693 55346 gene locus_tag LOCUS_06220 54693 55346 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230358.1 protein_id gnl|my_center|LOCUS_06220 55343 56818 gene locus_tag LOCUS_06230 55343 56818 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973593.1 protein_id gnl|my_center|LOCUS_06230 56948 57262 gene locus_tag LOCUS_06240 56948 57262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 57791 57390 gene locus_tag LOCUS_06250 57791 57390 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070936545.1 protein_id gnl|my_center|LOCUS_06250 59337 57814 gene locus_tag LOCUS_06260 59337 57814 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035359.1 protein_id gnl|my_center|LOCUS_06260 59495 59938 gene locus_tag LOCUS_06270 59495 59938 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224900.1 protein_id gnl|my_center|LOCUS_06270 59963 60346 gene locus_tag LOCUS_06280 59963 60346 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227906.1 protein_id gnl|my_center|LOCUS_06280 60484 60765 gene locus_tag LOCUS_06290 60484 60765 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406322.1 protein_id gnl|my_center|LOCUS_06290 60858 61145 gene locus_tag LOCUS_06300 60858 61145 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414602.1 protein_id gnl|my_center|LOCUS_06300 62350 61169 gene locus_tag LOCUS_06310 62350 61169 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027627.1 protein_id gnl|my_center|LOCUS_06310 64641 62605 gene locus_tag LOCUS_06320 64641 62605 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031412.1 protein_id gnl|my_center|LOCUS_06320 64828 65481 gene locus_tag LOCUS_06330 64828 65481 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976332.1 protein_id gnl|my_center|LOCUS_06330 65755 65462 gene locus_tag LOCUS_06340 65755 65462 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259052.1 protein_id gnl|my_center|LOCUS_06340 65795 67156 gene locus_tag LOCUS_06350 65795 67156 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976239.1 protein_id gnl|my_center|LOCUS_06350 67173 67718 gene locus_tag LOCUS_06360 67173 67718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 67845 69608 gene locus_tag LOCUS_06370 67845 69608 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029582.1 protein_id gnl|my_center|LOCUS_06370 70821 69784 gene locus_tag LOCUS_06380 70821 69784 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480227.1 protein_id gnl|my_center|LOCUS_06380 71334 70882 gene locus_tag LOCUS_06390 71334 70882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 71908 71480 gene locus_tag LOCUS_06400 71908 71480 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410811.1 protein_id gnl|my_center|LOCUS_06400 72135 71905 gene locus_tag LOCUS_06410 72135 71905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 72243 72461 gene locus_tag LOCUS_06420 72243 72461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 72458 72847 gene locus_tag LOCUS_06430 72458 72847 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404903.1 protein_id gnl|my_center|LOCUS_06430 74021 72912 gene locus_tag LOCUS_06440 74021 72912 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229015.1 protein_id gnl|my_center|LOCUS_06440 75423 74044 gene locus_tag LOCUS_06450 75423 74044 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895076.1 protein_id gnl|my_center|LOCUS_06450 77157 75541 gene locus_tag LOCUS_06460 77157 75541 CDS product exporter of polyketide antibiotics inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222247.1 protein_id gnl|my_center|LOCUS_06460 78062 77157 gene locus_tag LOCUS_06470 78062 77157 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222248.1 protein_id gnl|my_center|LOCUS_06470 78763 78059 gene locus_tag LOCUS_06480 78763 78059 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895207.1 protein_id gnl|my_center|LOCUS_06480 78906 79403 gene locus_tag LOCUS_06490 78906 79403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 79591 80082 gene locus_tag LOCUS_06500 79591 80082 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037753.1 protein_id gnl|my_center|LOCUS_06500 80695 80300 gene locus_tag LOCUS_06510 80695 80300 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729021.1 protein_id gnl|my_center|LOCUS_06510 81722 80676 gene locus_tag LOCUS_06520 81722 80676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 82678 81818 gene locus_tag LOCUS_06530 82678 81818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111012.1 protein_id gnl|my_center|LOCUS_06530 82819 83571 gene locus_tag LOCUS_06540 82819 83571 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072477587.1 protein_id gnl|my_center|LOCUS_06540 85757 83703 gene locus_tag LOCUS_06550 85757 83703 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804338.1 protein_id gnl|my_center|LOCUS_06550 85946 86992 gene locus_tag LOCUS_06560 85946 86992 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_06560 86989 87819 gene locus_tag LOCUS_06570 86989 87819 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975619.1 protein_id gnl|my_center|LOCUS_06570 88240 87884 gene locus_tag LOCUS_06580 88240 87884 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360043.1 protein_id gnl|my_center|LOCUS_06580 90007 88391 gene locus_tag LOCUS_06590 90007 88391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 91587 90199 gene locus_tag LOCUS_06600 91587 90199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 91801 93021 gene locus_tag LOCUS_06610 91801 93021 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730071.1 protein_id gnl|my_center|LOCUS_06610 94285 93065 gene locus_tag LOCUS_06620 94285 93065 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_06620 94442 95743 gene locus_tag LOCUS_06630 94442 95743 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224417.1 protein_id gnl|my_center|LOCUS_06630 95740 97191 gene locus_tag LOCUS_06640 95740 97191 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029264.1 protein_id gnl|my_center|LOCUS_06640 98401 97229 gene locus_tag LOCUS_06650 98401 97229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06650 98915 100732 gene locus_tag LOCUS_06660 98915 100732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 100624 101652 gene locus_tag LOCUS_06670 100624 101652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 101649 105860 gene locus_tag LOCUS_06680 101649 105860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 106049 106972 gene locus_tag LOCUS_06690 106049 106972 CDS product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971834.1 protein_id gnl|my_center|LOCUS_06690 107843 106905 gene locus_tag LOCUS_06700 107843 106905 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110811.1 protein_id gnl|my_center|LOCUS_06700 109871 108090 gene locus_tag LOCUS_06710 109871 108090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06710 111170 109908 gene locus_tag LOCUS_06720 111170 109908 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197085735.1 protein_id gnl|my_center|LOCUS_06720 112378 111338 gene locus_tag LOCUS_06730 112378 111338 CDS product intradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013494.1 protein_id gnl|my_center|LOCUS_06730 113464 112523 gene locus_tag LOCUS_06740 113464 112523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06740 114480 113758 gene locus_tag LOCUS_06750 114480 113758 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227982.1 protein_id gnl|my_center|LOCUS_06750 115634 114477 gene locus_tag LOCUS_06760 115634 114477 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227983.1 protein_id gnl|my_center|LOCUS_06760 116053 115631 gene locus_tag LOCUS_06770 116053 115631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 116275 116787 gene locus_tag LOCUS_06780 116275 116787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 117432 116896 gene locus_tag LOCUS_06790 117432 116896 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803747.1 protein_id gnl|my_center|LOCUS_06790 117697 118290 gene locus_tag LOCUS_06800 117697 118290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06800 118316 118507 gene locus_tag LOCUS_06810 118316 118507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 120084 118633 gene locus_tag LOCUS_06820 120084 118633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 120250 122220 gene locus_tag LOCUS_06830 120250 122220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 122220 123860 gene locus_tag LOCUS_06840 122220 123860 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414057.1 protein_id gnl|my_center|LOCUS_06840 123857 124996 gene locus_tag LOCUS_06850 123857 124996 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403856.1 protein_id gnl|my_center|LOCUS_06850 124996 125973 gene locus_tag LOCUS_06860 124996 125973 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463764.1 protein_id gnl|my_center|LOCUS_06860 125966 129160 gene locus_tag LOCUS_06870 125966 129160 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_06870 129251 130333 gene locus_tag LOCUS_06880 129251 130333 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035469.1 protein_id gnl|my_center|LOCUS_06880 130620 130877 gene locus_tag LOCUS_06890 130620 130877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 130865 131263 gene locus_tag LOCUS_06900 130865 131263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 131880 131308 gene locus_tag LOCUS_06910 131880 131308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 135181 131828 gene locus_tag LOCUS_06920 135181 131828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06920 135703 135975 gene locus_tag LOCUS_06930 135703 135975 CDS product DUF2277 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967020.1 protein_id gnl|my_center|LOCUS_06930 136539 135994 gene locus_tag LOCUS_06940 136539 135994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 136567 137346 gene locus_tag LOCUS_06950 136567 137346 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227842.1 protein_id gnl|my_center|LOCUS_06950 137348 138730 gene locus_tag LOCUS_06960 137348 138730 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485269.1 protein_id gnl|my_center|LOCUS_06960 140120 138897 gene locus_tag LOCUS_06970 140120 138897 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804560.1 protein_id gnl|my_center|LOCUS_06970 140644 140117 gene locus_tag LOCUS_06980 140644 140117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 140976 140641 gene locus_tag LOCUS_06990 140976 140641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 142013 140973 gene locus_tag LOCUS_07000 142013 140973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 142291 142010 gene locus_tag LOCUS_07010 142291 142010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 143070 142288 gene locus_tag LOCUS_07020 143070 142288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 144766 143078 gene locus_tag LOCUS_07030 144766 143078 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013584.1 protein_id gnl|my_center|LOCUS_07030 144969 145946 gene locus_tag LOCUS_07040 gene gmd 144969 145946 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284917.1 protein_id gnl|my_center|LOCUS_07040 145951 146973 gene locus_tag LOCUS_07050 gene gmd 145951 146973 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056481.1 protein_id gnl|my_center|LOCUS_07050 148415 146982 gene locus_tag LOCUS_07060 148415 146982 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803920.1 protein_id gnl|my_center|LOCUS_07060 149909 148716 gene locus_tag LOCUS_07070 149909 148716 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966352.1 protein_id gnl|my_center|LOCUS_07070 151044 150082 gene locus_tag LOCUS_07080 151044 150082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 152144 151041 gene locus_tag LOCUS_07090 152144 151041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 153442 152141 gene locus_tag LOCUS_07100 153442 152141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 154500 153439 gene locus_tag LOCUS_07110 154500 153439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 155624 154497 gene locus_tag LOCUS_07120 155624 154497 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531646.1 protein_id gnl|my_center|LOCUS_07120 >Feature sequence05 145 3250 gene locus_tag LOCUS_r00010 145 3250 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3325 3433 gene locus_tag LOCUS_r00020 3325 3433 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3799 4551 gene locus_tag LOCUS_07130 3799 4551 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977032.1 protein_id gnl|my_center|LOCUS_07130 4548 5615 gene locus_tag LOCUS_07140 4548 5615 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804972.1 protein_id gnl|my_center|LOCUS_07140 5596 6570 gene locus_tag LOCUS_07150 5596 6570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 6567 6809 gene locus_tag LOCUS_07160 6567 6809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 6806 7609 gene locus_tag LOCUS_07170 6806 7609 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027974.1 protein_id gnl|my_center|LOCUS_07170 7606 8520 gene locus_tag LOCUS_07180 7606 8520 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027973.1 protein_id gnl|my_center|LOCUS_07180 8599 10350 gene locus_tag LOCUS_07190 gene recN 8599 10350 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_07190 10362 12029 gene locus_tag LOCUS_07200 10362 12029 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063606961.1 protein_id gnl|my_center|LOCUS_07200 12046 12708 gene locus_tag LOCUS_07210 12046 12708 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977050.1 protein_id gnl|my_center|LOCUS_07210 12786 13109 gene locus_tag LOCUS_07220 12786 13109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 13106 13261 gene locus_tag LOCUS_07230 13106 13261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 13405 14769 gene locus_tag LOCUS_07240 13405 14769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 14766 15134 gene locus_tag LOCUS_07250 14766 15134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 15261 17072 gene locus_tag LOCUS_07260 gene aspS 15261 17072 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224570.1 protein_id gnl|my_center|LOCUS_07260 19358 17154 gene locus_tag LOCUS_07270 19358 17154 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031089.1 protein_id gnl|my_center|LOCUS_07270 19411 20865 gene locus_tag LOCUS_07280 19411 20865 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775673.1 protein_id gnl|my_center|LOCUS_07280 20925 21341 gene locus_tag LOCUS_07290 20925 21341 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224580.1 protein_id gnl|my_center|LOCUS_07290 21331 21630 gene locus_tag LOCUS_07300 21331 21630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 21759 24455 gene locus_tag LOCUS_07310 gene alaS 21759 24455 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977325.1 protein_id gnl|my_center|LOCUS_07310 24459 24956 gene locus_tag LOCUS_07320 gene ruvX 24459 24956 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775670.1 protein_id gnl|my_center|LOCUS_07320 24953 26266 gene locus_tag LOCUS_07330 gene mltG 24953 26266 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053383.1 protein_id gnl|my_center|LOCUS_07330 26254 27078 gene locus_tag LOCUS_07340 26254 27078 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027816.1 protein_id gnl|my_center|LOCUS_07340 27083 27751 gene locus_tag LOCUS_07350 27083 27751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 27824 29047 gene locus_tag LOCUS_07360 gene aroC 27824 29047 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977330.1 protein_id gnl|my_center|LOCUS_07360 29041 29565 gene locus_tag LOCUS_07370 29041 29565 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027814.1 protein_id gnl|my_center|LOCUS_07370 29562 30677 gene locus_tag LOCUS_07380 gene aroB 29562 30677 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027813.1 protein_id gnl|my_center|LOCUS_07380 30765 31370 gene locus_tag LOCUS_07390 gene efp 30765 31370 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224610.1 protein_id gnl|my_center|LOCUS_07390 31435 31845 gene locus_tag LOCUS_07400 31435 31845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 31868 32320 gene locus_tag LOCUS_07410 31868 32320 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222358.1 protein_id gnl|my_center|LOCUS_07410 33101 32364 gene locus_tag LOCUS_07420 33101 32364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 33290 33787 gene locus_tag LOCUS_07430 33290 33787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 35162 33813 gene locus_tag LOCUS_07440 35162 33813 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886129.1 protein_id gnl|my_center|LOCUS_07440 36699 35290 gene locus_tag LOCUS_07450 36699 35290 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093260.1 protein_id gnl|my_center|LOCUS_07450 36883 37449 gene locus_tag LOCUS_07460 gene pyrR 36883 37449 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977338.1 protein_id gnl|my_center|LOCUS_07460 37446 38405 gene locus_tag LOCUS_07470 37446 38405 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407200.1 protein_id gnl|my_center|LOCUS_07470 38432 39757 gene locus_tag LOCUS_07480 38432 39757 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977340.1 protein_id gnl|my_center|LOCUS_07480 39754 40944 gene locus_tag LOCUS_07490 gene carA 39754 40944 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027810.1 protein_id gnl|my_center|LOCUS_07490 40944 44285 gene locus_tag LOCUS_07500 gene carB 40944 44285 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977343.1 protein_id gnl|my_center|LOCUS_07500 44282 45352 gene locus_tag LOCUS_07510 44282 45352 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930218.1 protein_id gnl|my_center|LOCUS_07510 45345 46235 gene locus_tag LOCUS_07520 gene pyrF 45345 46235 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485777.1 protein_id gnl|my_center|LOCUS_07520 47087 46242 gene locus_tag LOCUS_07530 gene panC 47087 46242 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258070.1 protein_id gnl|my_center|LOCUS_07530 47974 47084 gene locus_tag LOCUS_07540 gene panB 47974 47084 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258071.1 protein_id gnl|my_center|LOCUS_07540 48959 47994 gene locus_tag LOCUS_07550 48959 47994 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230459.1 protein_id gnl|my_center|LOCUS_07550 49085 49402 gene locus_tag LOCUS_07560 49085 49402 CDS product integration host factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977346.1 protein_id gnl|my_center|LOCUS_07560 49399 49995 gene locus_tag LOCUS_07570 gene gmk 49399 49995 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805082.1 protein_id gnl|my_center|LOCUS_07570 50028 50291 gene locus_tag LOCUS_07580 gene rpoZ 50028 50291 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977348.1 protein_id gnl|my_center|LOCUS_07580 50299 51597 gene locus_tag LOCUS_07590 gene coaBC 50299 51597 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057695.1 protein_id gnl|my_center|LOCUS_07590 51623 52906 gene locus_tag LOCUS_07600 gene metK 51623 52906 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977350.1 protein_id gnl|my_center|LOCUS_07600 54406 52958 gene locus_tag LOCUS_07610 gene xylB 54406 52958 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141897420.1 protein_id gnl|my_center|LOCUS_07610 55620 54433 gene locus_tag LOCUS_07620 gene xylA 55620 54433 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803826.1 protein_id gnl|my_center|LOCUS_07620 55783 56967 gene locus_tag LOCUS_07630 55783 56967 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027551.1 protein_id gnl|my_center|LOCUS_07630 57164 58282 gene locus_tag LOCUS_07640 gene chvE 57164 58282 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226248.1 protein_id gnl|my_center|LOCUS_07640 58403 59962 gene locus_tag LOCUS_07650 gene gguA 58403 59962 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226249.1 protein_id gnl|my_center|LOCUS_07650 59959 61212 gene locus_tag LOCUS_07660 gene gguB 59959 61212 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068800.1 protein_id gnl|my_center|LOCUS_07660 61253 63298 gene locus_tag LOCUS_07670 61253 63298 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224627.1 protein_id gnl|my_center|LOCUS_07670 63388 63933 gene locus_tag LOCUS_07680 gene def 63388 63933 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224209.1 protein_id gnl|my_center|LOCUS_07680 63937 64890 gene locus_tag LOCUS_07690 gene fmt 63937 64890 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027805.1 protein_id gnl|my_center|LOCUS_07690 65012 66391 gene locus_tag LOCUS_07700 65012 66391 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805210.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07700 66460 67116 gene locus_tag LOCUS_07710 gene rpe 66460 67116 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977361.1 protein_id gnl|my_center|LOCUS_07710 67428 68156 gene locus_tag LOCUS_07720 gene pnuC 67428 68156 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013360.1 protein_id gnl|my_center|LOCUS_07720 68270 68533 gene locus_tag LOCUS_07730 68270 68533 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226745.1 protein_id gnl|my_center|LOCUS_07730 68561 69406 gene locus_tag LOCUS_07740 gene hisG 68561 69406 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977387.1 protein_id gnl|my_center|LOCUS_07740 69438 69905 gene locus_tag LOCUS_07750 69438 69905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 70324 69914 gene locus_tag LOCUS_07760 70324 69914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 70728 70321 gene locus_tag LOCUS_07770 gene crcB 70728 70321 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416046.1 protein_id gnl|my_center|LOCUS_07770 71310 70732 gene locus_tag LOCUS_07780 71310 70732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 71974 71321 gene locus_tag LOCUS_07790 71974 71321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 71952 72725 gene locus_tag LOCUS_07800 gene hisF 71952 72725 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466799.1 protein_id gnl|my_center|LOCUS_07800 72722 73348 gene locus_tag LOCUS_07810 72722 73348 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079489.1 protein_id gnl|my_center|LOCUS_07810 73373 74530 gene locus_tag LOCUS_07820 gene ispG 73373 74530 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284254.1 protein_id gnl|my_center|LOCUS_07820 74630 75475 gene locus_tag LOCUS_07830 74630 75475 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873433.1 protein_id gnl|my_center|LOCUS_07830 75648 77327 gene locus_tag LOCUS_07840 75648 77327 CDS product aspartate:alanine exchanger family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941681.1 protein_id gnl|my_center|LOCUS_07840 77372 78328 gene locus_tag LOCUS_07850 77372 78328 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015483.1 protein_id gnl|my_center|LOCUS_07850 78428 80197 gene locus_tag LOCUS_07860 78428 80197 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223963.1 protein_id gnl|my_center|LOCUS_07860 80194 80925 gene locus_tag LOCUS_07870 80194 80925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 80918 81697 gene locus_tag LOCUS_07880 80918 81697 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805161.1 protein_id gnl|my_center|LOCUS_07880 81850 83214 gene locus_tag LOCUS_07890 81850 83214 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225544.1 protein_id gnl|my_center|LOCUS_07890 83245 83796 gene locus_tag LOCUS_07900 83245 83796 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225543.1 protein_id gnl|my_center|LOCUS_07900 83793 84533 gene locus_tag LOCUS_07910 83793 84533 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225542.1 protein_id gnl|my_center|LOCUS_07910 84941 84546 gene locus_tag LOCUS_07920 84941 84546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 87112 85094 gene locus_tag LOCUS_07930 87112 85094 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119948893.1 protein_id gnl|my_center|LOCUS_07930 88133 87129 gene locus_tag LOCUS_07940 88133 87129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 88381 88932 gene locus_tag LOCUS_07950 88381 88932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 88932 90002 gene locus_tag LOCUS_07960 gene nusA 88932 90002 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030401.1 protein_id gnl|my_center|LOCUS_07960 90062 90424 gene locus_tag LOCUS_07970 90062 90424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 90485 93412 gene locus_tag LOCUS_07980 90485 93412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 93405 93920 gene locus_tag LOCUS_07990 gene rbfA 93405 93920 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804655.1 protein_id gnl|my_center|LOCUS_07990 93946 94884 gene locus_tag LOCUS_08000 gene truB 93946 94884 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728501.1 protein_id gnl|my_center|LOCUS_08000 94886 95887 gene locus_tag LOCUS_08010 94886 95887 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804658.1 protein_id gnl|my_center|LOCUS_08010 96101 97963 gene locus_tag LOCUS_08020 96101 97963 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156206934.1 protein_id gnl|my_center|LOCUS_08020 98705 98151 gene locus_tag LOCUS_08030 98705 98151 CDS product fibrillarin-like rRNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776334.1 protein_id gnl|my_center|LOCUS_08030 98736 100712 gene locus_tag LOCUS_08040 98736 100712 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976193.1 protein_id gnl|my_center|LOCUS_08040 100739 101263 gene locus_tag LOCUS_08050 100739 101263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 101824 101291 gene locus_tag LOCUS_08060 101824 101291 CDS product NUDIX hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870383.1 protein_id gnl|my_center|LOCUS_08060 103199 101847 gene locus_tag LOCUS_08070 103199 101847 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975885.1 protein_id gnl|my_center|LOCUS_08070 103333 104568 gene locus_tag LOCUS_08080 103333 104568 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 protein_id gnl|my_center|LOCUS_08080 104565 104930 gene locus_tag LOCUS_08090 104565 104930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 105070 105273 gene locus_tag LOCUS_08100 105070 105273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 105210 105860 gene locus_tag LOCUS_08110 105210 105860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 106183 109497 gene locus_tag LOCUS_08120 gene ileS 106183 109497 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224829.1 protein_id gnl|my_center|LOCUS_08120 109494 110006 gene locus_tag LOCUS_08130 109494 110006 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445544.1 protein_id gnl|my_center|LOCUS_08130 110003 111364 gene locus_tag LOCUS_08140 110003 111364 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485025.1 protein_id gnl|my_center|LOCUS_08140 111361 111759 gene locus_tag LOCUS_08150 111361 111759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 111825 112190 gene locus_tag LOCUS_08160 gene ndk 111825 112190 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804615.1 protein_id gnl|my_center|LOCUS_08160 112655 112176 gene locus_tag LOCUS_08170 112655 112176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 112712 113836 gene locus_tag LOCUS_08180 112712 113836 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853634.1 protein_id gnl|my_center|LOCUS_08180 114951 113956 gene locus_tag LOCUS_08190 gene rfbB 114951 113956 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080535.1 protein_id gnl|my_center|LOCUS_08190 115751 114987 gene locus_tag LOCUS_08200 115751 114987 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225174.1 protein_id gnl|my_center|LOCUS_08200 115814 116542 gene locus_tag LOCUS_08210 115814 116542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 116651 117853 gene locus_tag LOCUS_08220 gene odc2 116651 117853 CDS product ornithine/lysine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529754.1 protein_id gnl|my_center|LOCUS_08220 117850 119061 gene locus_tag LOCUS_08230 117850 119061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 119824 119006 gene locus_tag LOCUS_08240 119824 119006 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226371.1 protein_id gnl|my_center|LOCUS_08240 122381 120108 gene locus_tag LOCUS_08250 122381 120108 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084321.1 protein_id gnl|my_center|LOCUS_08250 122496 123014 gene locus_tag LOCUS_08260 122496 123014 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730372.1 protein_id gnl|my_center|LOCUS_08260 123058 124455 gene locus_tag LOCUS_08270 gene lpdA 123058 124455 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283919.1 protein_id gnl|my_center|LOCUS_08270 124825 124553 gene locus_tag LOCUS_08280 124825 124553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 125054 124902 gene locus_tag LOCUS_08290 125054 124902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08290 >Feature sequence06 973 1131 gene locus_tag LOCUS_08300 973 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 2355 1888 gene locus_tag LOCUS_08310 2355 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08310 2585 2827 gene locus_tag LOCUS_08320 2585 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 3082 2747 gene locus_tag LOCUS_08330 3082 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 3097 4056 gene locus_tag LOCUS_08340 3097 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08340 4053 4358 gene locus_tag LOCUS_08350 4053 4358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08350 4551 5087 gene locus_tag LOCUS_08360 4551 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 5030 5284 gene locus_tag LOCUS_08370 5030 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 5506 5667 gene locus_tag LOCUS_08380 5506 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 5768 6058 gene locus_tag LOCUS_08390 5768 6058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 6290 8401 gene locus_tag LOCUS_08400 6290 8401 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244418.1 protein_id gnl|my_center|LOCUS_08400 8648 8484 gene locus_tag LOCUS_08410 8648 8484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 8761 9186 gene locus_tag LOCUS_08420 8761 9186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 9265 12162 gene locus_tag LOCUS_08430 9265 12162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 12334 13089 gene locus_tag LOCUS_08440 12334 13089 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066563356.1 protein_id gnl|my_center|LOCUS_08440 13139 14680 gene locus_tag LOCUS_08450 13139 14680 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223916.1 protein_id gnl|my_center|LOCUS_08450 14727 16115 gene locus_tag LOCUS_08460 14727 16115 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110217.1 protein_id gnl|my_center|LOCUS_08460 16849 16100 gene locus_tag LOCUS_08470 16849 16100 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947313.1 protein_id gnl|my_center|LOCUS_08470 16951 19335 gene locus_tag LOCUS_08480 16951 19335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 20183 19350 gene locus_tag LOCUS_08490 20183 19350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 21460 20180 gene locus_tag LOCUS_08500 21460 20180 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484988.1 protein_id gnl|my_center|LOCUS_08500 22811 21441 gene locus_tag LOCUS_08510 22811 21441 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028498.1 protein_id gnl|my_center|LOCUS_08510 24778 22796 gene locus_tag LOCUS_08520 24778 22796 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014868643.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08520 24723 24965 gene locus_tag LOCUS_08530 24723 24965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 26453 25248 gene locus_tag LOCUS_08540 26453 25248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 27426 26458 gene locus_tag LOCUS_08550 27426 26458 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222295.1 protein_id gnl|my_center|LOCUS_08550 28115 27423 gene locus_tag LOCUS_08560 28115 27423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08560 28815 28135 gene locus_tag LOCUS_08570 28815 28135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 30371 28812 gene locus_tag LOCUS_08580 30371 28812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 30993 30379 gene locus_tag LOCUS_08590 30993 30379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 32251 30998 gene locus_tag LOCUS_08600 32251 30998 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479620.1 protein_id gnl|my_center|LOCUS_08600 33118 32348 gene locus_tag LOCUS_08610 33118 32348 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027251.1 protein_id gnl|my_center|LOCUS_08610 33267 33340 gene locus_tag LOCUS_t00110 33267 33340 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 33387 33463 gene locus_tag LOCUS_t00120 33387 33463 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 33608 33778 gene locus_tag LOCUS_08620 gene rpmG 33608 33778 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114322.1 protein_id gnl|my_center|LOCUS_08620 34315 34761 gene locus_tag LOCUS_08630 34315 34761 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285884.1 protein_id gnl|my_center|LOCUS_08630 34758 35186 gene locus_tag LOCUS_08640 34758 35186 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029785.1 protein_id gnl|my_center|LOCUS_08640 35193 36284 gene locus_tag LOCUS_08650 35193 36284 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270166.1 protein_id gnl|my_center|LOCUS_08650 36777 36319 gene locus_tag LOCUS_08660 36777 36319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 36734 37081 gene locus_tag LOCUS_08670 36734 37081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 38408 37041 gene locus_tag LOCUS_08680 38408 37041 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896540.1 protein_id gnl|my_center|LOCUS_08680 39381 38419 gene locus_tag LOCUS_08690 39381 38419 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974319.1 protein_id gnl|my_center|LOCUS_08690 39992 39468 gene locus_tag LOCUS_08700 39992 39468 CDS product DUF5709 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027314.1 protein_id gnl|my_center|LOCUS_08700 42673 40136 gene locus_tag LOCUS_08710 42673 40136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 42860 43630 gene locus_tag LOCUS_08720 42860 43630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 44635 43676 gene locus_tag LOCUS_08730 gene coaA 44635 43676 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776319.1 protein_id gnl|my_center|LOCUS_08730 44733 46592 gene locus_tag LOCUS_08740 gene glmS 44733 46592 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974233.1 protein_id gnl|my_center|LOCUS_08740 46598 46954 gene locus_tag LOCUS_08750 46598 46954 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974229.1 protein_id gnl|my_center|LOCUS_08750 46951 48423 gene locus_tag LOCUS_08760 46951 48423 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029833.1 protein_id gnl|my_center|LOCUS_08760 48454 49647 gene locus_tag LOCUS_08770 gene alr 48454 49647 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029835.1 protein_id gnl|my_center|LOCUS_08770 49644 50840 gene locus_tag LOCUS_08780 49644 50840 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327056.1 protein_id gnl|my_center|LOCUS_08780 50830 51324 gene locus_tag LOCUS_08790 gene tsaE 50830 51324 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029837.1 protein_id gnl|my_center|LOCUS_08790 51324 52049 gene locus_tag LOCUS_08800 gene tsaB 51324 52049 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029839.1 protein_id gnl|my_center|LOCUS_08800 52046 52540 gene locus_tag LOCUS_08810 gene rimI 52046 52540 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029840.1 protein_id gnl|my_center|LOCUS_08810 52555 53586 gene locus_tag LOCUS_08820 gene tsaD 52555 53586 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029841.1 protein_id gnl|my_center|LOCUS_08820 54981 53599 gene locus_tag LOCUS_08830 54981 53599 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068259.1 protein_id gnl|my_center|LOCUS_08830 54980 55798 gene locus_tag LOCUS_08840 54980 55798 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231023.1 protein_id gnl|my_center|LOCUS_08840 56042 56509 gene locus_tag LOCUS_08850 56042 56509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 56464 57723 gene locus_tag LOCUS_08860 56464 57723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 58977 57733 gene locus_tag LOCUS_08870 58977 57733 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804479.1 protein_id gnl|my_center|LOCUS_08870 59248 59541 gene locus_tag LOCUS_08880 gene groES 59248 59541 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559922.1 protein_id gnl|my_center|LOCUS_08880 59553 61169 gene locus_tag LOCUS_08890 gene groL 59553 61169 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974210.1 protein_id gnl|my_center|LOCUS_08890 61543 61253 gene locus_tag LOCUS_08900 61543 61253 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222678.1 protein_id gnl|my_center|LOCUS_08900 61769 62437 gene locus_tag LOCUS_08910 61769 62437 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974204.1 protein_id gnl|my_center|LOCUS_08910 62434 63588 gene locus_tag LOCUS_08920 62434 63588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 63598 65121 gene locus_tag LOCUS_08930 gene guaB 63598 65121 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804497.1 protein_id gnl|my_center|LOCUS_08930 65161 66282 gene locus_tag LOCUS_08940 65161 66282 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804502.1 protein_id gnl|my_center|LOCUS_08940 66290 67930 gene locus_tag LOCUS_08950 66290 67930 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029859.1 protein_id gnl|my_center|LOCUS_08950 67927 69693 gene locus_tag LOCUS_08960 67927 69693 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893009.1 protein_id gnl|my_center|LOCUS_08960 70478 69690 gene locus_tag LOCUS_08970 70478 69690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 70680 71411 gene locus_tag LOCUS_08980 70680 71411 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259229.1 protein_id gnl|my_center|LOCUS_08980 71408 72499 gene locus_tag LOCUS_08990 71408 72499 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259230.1 protein_id gnl|my_center|LOCUS_08990 72507 72926 gene locus_tag LOCUS_09000 gene trxA 72507 72926 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093515.1 protein_id gnl|my_center|LOCUS_09000 72926 73432 gene locus_tag LOCUS_09010 72926 73432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 73776 73429 gene locus_tag LOCUS_09020 73776 73429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 74663 73773 gene locus_tag LOCUS_09030 74663 73773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 76200 74821 gene locus_tag LOCUS_09040 76200 74821 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896784.1 protein_id gnl|my_center|LOCUS_09040 76322 76636 gene locus_tag LOCUS_09050 76322 76636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 77418 76654 gene locus_tag LOCUS_09060 77418 76654 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804816.1 protein_id gnl|my_center|LOCUS_09060 77672 79417 gene locus_tag LOCUS_09070 77672 79417 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731564.1 protein_id gnl|my_center|LOCUS_09070 79414 80163 gene locus_tag LOCUS_09080 79414 80163 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892015.1 protein_id gnl|my_center|LOCUS_09080 80160 81653 gene locus_tag LOCUS_09090 80160 81653 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027372.1 protein_id gnl|my_center|LOCUS_09090 81650 82297 gene locus_tag LOCUS_09100 81650 82297 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978042.1 protein_id gnl|my_center|LOCUS_09100 83482 82313 gene locus_tag LOCUS_09110 83482 82313 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731461.1 protein_id gnl|my_center|LOCUS_09110 84711 83560 gene locus_tag LOCUS_09120 84711 83560 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027926.1 protein_id gnl|my_center|LOCUS_09120 85472 84726 gene locus_tag LOCUS_09130 85472 84726 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804112.1 protein_id gnl|my_center|LOCUS_09130 86670 85507 gene locus_tag LOCUS_09140 86670 85507 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804113.1 protein_id gnl|my_center|LOCUS_09140 87486 86683 gene locus_tag LOCUS_09150 gene menB 87486 86683 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459123.1 protein_id gnl|my_center|LOCUS_09150 87584 88192 gene locus_tag LOCUS_09160 87584 88192 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804114.1 protein_id gnl|my_center|LOCUS_09160 89904 88189 gene locus_tag LOCUS_09170 89904 88189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 90089 91123 gene locus_tag LOCUS_09180 90089 91123 CDS product DUF4037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775736.1 protein_id gnl|my_center|LOCUS_09180 92924 91128 gene locus_tag LOCUS_09190 92924 91128 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030252.1 protein_id gnl|my_center|LOCUS_09190 94720 92924 gene locus_tag LOCUS_09200 94720 92924 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030253.1 protein_id gnl|my_center|LOCUS_09200 94710 95549 gene locus_tag LOCUS_09210 94710 95549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 95546 95896 gene locus_tag LOCUS_09220 95546 95896 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857996.1 protein_id gnl|my_center|LOCUS_09220 95907 97484 gene locus_tag LOCUS_09230 gene guaA 95907 97484 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974187.1 protein_id gnl|my_center|LOCUS_09230 97916 97509 gene locus_tag LOCUS_09240 97916 97509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 97998 99299 gene locus_tag LOCUS_09250 97998 99299 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068484.1 protein_id gnl|my_center|LOCUS_09250 99296 100030 gene locus_tag LOCUS_09260 99296 100030 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051560.1 protein_id gnl|my_center|LOCUS_09260 100063 101295 gene locus_tag LOCUS_09270 100063 101295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 102136 101273 gene locus_tag LOCUS_09280 102136 101273 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467152.1 protein_id gnl|my_center|LOCUS_09280 102123 103271 gene locus_tag LOCUS_09290 102123 103271 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250274.1 protein_id gnl|my_center|LOCUS_09290 103273 104034 gene locus_tag LOCUS_09300 103273 104034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 104272 104012 gene locus_tag LOCUS_09310 104272 104012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 105726 104269 gene locus_tag LOCUS_09320 105726 104269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 105911 106903 gene locus_tag LOCUS_09330 105911 106903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 106900 107598 gene locus_tag LOCUS_09340 106900 107598 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029866.1 protein_id gnl|my_center|LOCUS_09340 108790 107615 gene locus_tag LOCUS_09350 108790 107615 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337440.1 protein_id gnl|my_center|LOCUS_09350 108845 109249 gene locus_tag LOCUS_09360 108845 109249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 110251 109268 gene locus_tag LOCUS_09370 110251 109268 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227740.1 protein_id gnl|my_center|LOCUS_09370 110296 112905 gene locus_tag LOCUS_09380 gene pcrA 110296 112905 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_09380 113794 112946 gene locus_tag LOCUS_09390 113794 112946 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029440.1 protein_id gnl|my_center|LOCUS_09390 113965 114366 gene locus_tag LOCUS_09400 113965 114366 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974171.1 protein_id gnl|my_center|LOCUS_09400 114650 115759 gene locus_tag LOCUS_09410 114650 115759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 115945 117147 gene locus_tag LOCUS_09420 gene sucC 115945 117147 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804537.1 protein_id gnl|my_center|LOCUS_09420 117183 118076 gene locus_tag LOCUS_09430 gene sucD 117183 118076 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804538.1 protein_id gnl|my_center|LOCUS_09430 118162 119349 gene locus_tag LOCUS_09440 118162 119349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 120049 119633 gene locus_tag LOCUS_09450 120049 119633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 >Feature sequence07 386 1456 gene locus_tag LOCUS_09460 386 1456 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975324.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09460 1453 2541 gene locus_tag LOCUS_09470 1453 2541 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230597.1 protein_id gnl|my_center|LOCUS_09470 2685 3404 gene locus_tag LOCUS_09480 2685 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 3501 5213 gene locus_tag LOCUS_09490 3501 5213 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730685.1 protein_id gnl|my_center|LOCUS_09490 7026 5356 gene locus_tag LOCUS_09500 7026 5356 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230133.1 protein_id gnl|my_center|LOCUS_09500 8099 7167 gene locus_tag LOCUS_09510 8099 7167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 8420 9970 gene locus_tag LOCUS_09520 8420 9970 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223445.1 protein_id gnl|my_center|LOCUS_09520 10190 13450 gene locus_tag LOCUS_09530 10190 13450 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152945460.1 protein_id gnl|my_center|LOCUS_09530 14316 13498 gene locus_tag LOCUS_09540 14316 13498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 14473 14886 gene locus_tag LOCUS_09550 14473 14886 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410645.1 protein_id gnl|my_center|LOCUS_09550 14891 15538 gene locus_tag LOCUS_09560 14891 15538 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888647.1 protein_id gnl|my_center|LOCUS_09560 15658 16728 gene locus_tag LOCUS_09570 15658 16728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 16725 17240 gene locus_tag LOCUS_09580 16725 17240 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036864.1 protein_id gnl|my_center|LOCUS_09580 17221 18033 gene locus_tag LOCUS_09590 17221 18033 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405938.1 protein_id gnl|my_center|LOCUS_09590 18245 19333 gene locus_tag LOCUS_09600 18245 19333 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_09600 19330 20760 gene locus_tag LOCUS_09610 19330 20760 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903975.1 protein_id gnl|my_center|LOCUS_09610 21053 22348 gene locus_tag LOCUS_09620 21053 22348 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230815.1 protein_id gnl|my_center|LOCUS_09620 24634 22418 gene locus_tag LOCUS_09630 24634 22418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 25348 24695 gene locus_tag LOCUS_09640 25348 24695 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803691.1 protein_id gnl|my_center|LOCUS_09640 26740 25436 gene locus_tag LOCUS_09650 gene hemL 26740 25436 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029675.1 protein_id gnl|my_center|LOCUS_09650 27753 26737 gene locus_tag LOCUS_09660 gene hemB 27753 26737 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831526.1 protein_id gnl|my_center|LOCUS_09660 28871 27750 gene locus_tag LOCUS_09670 28871 27750 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776654.1 protein_id gnl|my_center|LOCUS_09670 29560 28871 gene locus_tag LOCUS_09680 29560 28871 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972879.1 protein_id gnl|my_center|LOCUS_09680 31068 29557 gene locus_tag LOCUS_09690 gene hemY 31068 29557 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245394.1 protein_id gnl|my_center|LOCUS_09690 32180 31065 gene locus_tag LOCUS_09700 gene hemE 32180 31065 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224512.1 protein_id gnl|my_center|LOCUS_09700 33082 32177 gene locus_tag LOCUS_09710 gene hemC 33082 32177 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975518.1 protein_id gnl|my_center|LOCUS_09710 34335 33082 gene locus_tag LOCUS_09720 34335 33082 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776650.1 protein_id gnl|my_center|LOCUS_09720 34487 35014 gene locus_tag LOCUS_09730 34487 35014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 35049 35519 gene locus_tag LOCUS_09740 35049 35519 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079454.1 protein_id gnl|my_center|LOCUS_09740 35563 36828 gene locus_tag LOCUS_09750 35563 36828 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229610.1 protein_id gnl|my_center|LOCUS_09750 36839 38170 gene locus_tag LOCUS_09760 36839 38170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 38176 38916 gene locus_tag LOCUS_09770 38176 38916 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529927.1 protein_id gnl|my_center|LOCUS_09770 39022 40011 gene locus_tag LOCUS_09780 39022 40011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 40031 40651 gene locus_tag LOCUS_09790 40031 40651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 40657 41373 gene locus_tag LOCUS_09800 40657 41373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 41584 42846 gene locus_tag LOCUS_09810 41584 42846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 42913 43161 gene locus_tag LOCUS_09820 42913 43161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 43158 43571 gene locus_tag LOCUS_09830 43158 43571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 43672 44178 gene locus_tag LOCUS_09840 43672 44178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 45832 44153 gene locus_tag LOCUS_09850 45832 44153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 46129 46812 gene locus_tag LOCUS_09860 46129 46812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 46809 49784 gene locus_tag LOCUS_09870 46809 49784 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227899.1 protein_id gnl|my_center|LOCUS_09870 49781 50713 gene locus_tag LOCUS_09880 49781 50713 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028540.1 protein_id gnl|my_center|LOCUS_09880 51996 50677 gene locus_tag LOCUS_09890 51996 50677 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229362.1 protein_id gnl|my_center|LOCUS_09890 52090 53184 gene locus_tag LOCUS_09900 52090 53184 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080950.1 protein_id gnl|my_center|LOCUS_09900 53327 54634 gene locus_tag LOCUS_09910 53327 54634 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191279629.1 protein_id gnl|my_center|LOCUS_09910 54852 55712 gene locus_tag LOCUS_09920 54852 55712 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804094.1 protein_id gnl|my_center|LOCUS_09920 55717 56781 gene locus_tag LOCUS_09930 55717 56781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 56916 57131 gene locus_tag LOCUS_09940 56916 57131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 57415 58392 gene locus_tag LOCUS_09950 gene ligD 57415 58392 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226451.1 protein_id gnl|my_center|LOCUS_09950 58403 58960 gene locus_tag LOCUS_09960 58403 58960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 59037 59855 gene locus_tag LOCUS_09970 59037 59855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 59881 60213 gene locus_tag LOCUS_09980 59881 60213 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225986.1 protein_id gnl|my_center|LOCUS_09980 62271 60220 gene locus_tag LOCUS_09990 62271 60220 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729965.1 protein_id gnl|my_center|LOCUS_09990 62411 63364 gene locus_tag LOCUS_10000 62411 63364 CDS product SLAC1 anion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788774.1 protein_id gnl|my_center|LOCUS_10000 63497 64954 gene locus_tag LOCUS_10010 63497 64954 CDS product sulfide:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931811.1 protein_id gnl|my_center|LOCUS_10010 65607 66344 gene locus_tag LOCUS_10020 65607 66344 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201007.1 protein_id gnl|my_center|LOCUS_10020 66345 67787 gene locus_tag LOCUS_10030 66345 67787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 68820 67819 gene locus_tag LOCUS_10040 68820 67819 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080445.1 protein_id gnl|my_center|LOCUS_10040 68992 70524 gene locus_tag LOCUS_10050 68992 70524 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479549.1 protein_id gnl|my_center|LOCUS_10050 71939 70668 gene locus_tag LOCUS_10060 71939 70668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 71854 72591 gene locus_tag LOCUS_10070 71854 72591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 73139 72588 gene locus_tag LOCUS_10080 73139 72588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 73147 73752 gene locus_tag LOCUS_10090 73147 73752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 73749 75458 gene locus_tag LOCUS_10100 gene malL 73749 75458 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 protein_id gnl|my_center|LOCUS_10100 76834 75506 gene locus_tag LOCUS_10110 76834 75506 CDS product trans-acting enoyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412609.1 protein_id gnl|my_center|LOCUS_10110 76903 77703 gene locus_tag LOCUS_10120 76903 77703 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236296.1 protein_id gnl|my_center|LOCUS_10120 78694 78005 gene locus_tag LOCUS_10130 78694 78005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 80584 78893 gene locus_tag LOCUS_10140 80584 78893 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908096.1 protein_id gnl|my_center|LOCUS_10140 81285 80683 gene locus_tag LOCUS_10150 gene thpR 81285 80683 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029587.1 protein_id gnl|my_center|LOCUS_10150 83193 81325 gene locus_tag LOCUS_10160 83193 81325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 83346 83948 gene locus_tag LOCUS_10170 83346 83948 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056202.1 protein_id gnl|my_center|LOCUS_10170 84415 83987 gene locus_tag LOCUS_10180 84415 83987 CDS product DUF2177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767545.1 protein_id gnl|my_center|LOCUS_10180 84590 85852 gene locus_tag LOCUS_10190 84590 85852 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113200.1 protein_id gnl|my_center|LOCUS_10190 85913 87469 gene locus_tag LOCUS_10200 85913 87469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 88147 87470 gene locus_tag LOCUS_10210 88147 87470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 88287 89966 gene locus_tag LOCUS_10220 88287 89966 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528300.1 protein_id gnl|my_center|LOCUS_10220 90137 90661 gene locus_tag LOCUS_10230 90137 90661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 90658 91038 gene locus_tag LOCUS_10240 90658 91038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 92102 91206 gene locus_tag LOCUS_10250 92102 91206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228743.1 protein_id gnl|my_center|LOCUS_10250 93002 92112 gene locus_tag LOCUS_10260 93002 92112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228743.1 protein_id gnl|my_center|LOCUS_10260 93882 93280 gene locus_tag LOCUS_10270 93882 93280 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975113.1 protein_id gnl|my_center|LOCUS_10270 96056 93924 gene locus_tag LOCUS_10280 96056 93924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 97048 95981 gene locus_tag LOCUS_10290 97048 95981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 97734 97045 gene locus_tag LOCUS_10300 97734 97045 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265944.1 protein_id gnl|my_center|LOCUS_10300 98462 97773 gene locus_tag LOCUS_10310 98462 97773 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804263.1 protein_id gnl|my_center|LOCUS_10310 99260 98565 gene locus_tag LOCUS_10320 99260 98565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 100252 99275 gene locus_tag LOCUS_10330 100252 99275 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_10330 100309 101610 gene locus_tag LOCUS_10340 100309 101610 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198965.1 protein_id gnl|my_center|LOCUS_10340 102802 101867 gene locus_tag LOCUS_10350 102802 101867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 103137 103349 gene locus_tag LOCUS_10360 103137 103349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 103346 103759 gene locus_tag LOCUS_10370 103346 103759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 104117 104485 gene locus_tag LOCUS_10380 104117 104485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 104482 104922 gene locus_tag LOCUS_10390 104482 104922 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226135.1 protein_id gnl|my_center|LOCUS_10390 105506 105018 gene locus_tag LOCUS_10400 105506 105018 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803676.1 protein_id gnl|my_center|LOCUS_10400 105669 107027 gene locus_tag LOCUS_10410 105669 107027 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223170.1 protein_id gnl|my_center|LOCUS_10410 107331 107047 gene locus_tag LOCUS_10420 107331 107047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 107599 108822 gene locus_tag LOCUS_10430 107599 108822 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878186.1 protein_id gnl|my_center|LOCUS_10430 108927 110621 gene locus_tag LOCUS_10440 108927 110621 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125313541.1 protein_id gnl|my_center|LOCUS_10440 110623 111702 gene locus_tag LOCUS_10450 110623 111702 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030362.1 protein_id gnl|my_center|LOCUS_10450 111699 114203 gene locus_tag LOCUS_10460 111699 114203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 116014 114254 gene locus_tag LOCUS_10470 116014 114254 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925143.1 protein_id gnl|my_center|LOCUS_10470 116563 116069 gene locus_tag LOCUS_10480 116563 116069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 116623 117213 gene locus_tag LOCUS_10490 116623 117213 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971514.1 protein_id gnl|my_center|LOCUS_10490 117424 118638 gene locus_tag LOCUS_10500 117424 118638 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090913.1 protein_id gnl|my_center|LOCUS_10500 119376 118672 gene locus_tag LOCUS_10510 119376 118672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 119375 119851 gene locus_tag LOCUS_10520 119375 119851 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229473.1 protein_id gnl|my_center|LOCUS_10520 120739 119909 gene locus_tag LOCUS_10530 120739 119909 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027387.1 protein_id gnl|my_center|LOCUS_10530 <121544 120822 gene locus_tag LOCUS_10540 <121544 120822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027038.1:fumarylacetoacetate hydrolase family protein >Feature sequence08 2321 1956 gene locus_tag LOCUS_10550 2321 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 4826 2589 gene locus_tag LOCUS_10560 4826 2589 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223681.1 protein_id gnl|my_center|LOCUS_10560 6085 5015 gene locus_tag LOCUS_10570 6085 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 6464 7783 gene locus_tag LOCUS_10580 gene purD 6464 7783 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029417.1 protein_id gnl|my_center|LOCUS_10580 7794 8708 gene locus_tag LOCUS_10590 7794 8708 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974901.1 protein_id gnl|my_center|LOCUS_10590 10646 8745 gene locus_tag LOCUS_10600 gene iolD 10646 8745 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 protein_id gnl|my_center|LOCUS_10600 11736 10666 gene locus_tag LOCUS_10610 11736 10666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 12598 11900 gene locus_tag LOCUS_10620 gene iolR 12598 11900 CDS product GntR family transcriptional regulator IolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857140.1 protein_id gnl|my_center|LOCUS_10620 12732 13694 gene locus_tag LOCUS_10630 gene iolC 12732 13694 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857138.1 protein_id gnl|my_center|LOCUS_10630 13691 14581 gene locus_tag LOCUS_10640 13691 14581 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896035.1 protein_id gnl|my_center|LOCUS_10640 14578 15480 gene locus_tag LOCUS_10650 gene iolB 14578 15480 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031348.1 protein_id gnl|my_center|LOCUS_10650 15622 17121 gene locus_tag LOCUS_10660 15622 17121 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893815.1 protein_id gnl|my_center|LOCUS_10660 17308 18240 gene locus_tag LOCUS_10670 17308 18240 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013435.1 protein_id gnl|my_center|LOCUS_10670 18401 19405 gene locus_tag LOCUS_10680 18401 19405 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223780.1 protein_id gnl|my_center|LOCUS_10680 19534 20577 gene locus_tag LOCUS_10690 19534 20577 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223779.1 protein_id gnl|my_center|LOCUS_10690 20574 21422 gene locus_tag LOCUS_10700 20574 21422 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223778.1 protein_id gnl|my_center|LOCUS_10700 21419 22600 gene locus_tag LOCUS_10710 21419 22600 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031359.1 protein_id gnl|my_center|LOCUS_10710 22597 23649 gene locus_tag LOCUS_10720 gene iolG 22597 23649 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973498.1 protein_id gnl|my_center|LOCUS_10720 23653 24612 gene locus_tag LOCUS_10730 gene rfbD 23653 24612 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893216.1 protein_id gnl|my_center|LOCUS_10730 24618 25418 gene locus_tag LOCUS_10740 24618 25418 CDS product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014887.1 protein_id gnl|my_center|LOCUS_10740 25489 26118 gene locus_tag LOCUS_10750 25489 26118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 26195 30283 gene locus_tag LOCUS_10760 gene purL 26195 30283 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527208.1 protein_id gnl|my_center|LOCUS_10760 30536 30964 gene locus_tag LOCUS_10770 30536 30964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10770 31100 31567 gene locus_tag LOCUS_10780 31100 31567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228771.1 protein_id gnl|my_center|LOCUS_10780 32459 31698 gene locus_tag LOCUS_10790 32459 31698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143283.1 protein_id gnl|my_center|LOCUS_10790 33823 32870 gene locus_tag LOCUS_10800 33823 32870 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028594.1 protein_id gnl|my_center|LOCUS_10800 34319 33900 gene locus_tag LOCUS_10810 34319 33900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 35362 34316 gene locus_tag LOCUS_10820 35362 34316 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225577.1 protein_id gnl|my_center|LOCUS_10820 35361 35780 gene locus_tag LOCUS_10830 35361 35780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 35777 35998 gene locus_tag LOCUS_10840 35777 35998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 36094 37680 gene locus_tag LOCUS_10850 gene purF 36094 37680 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804524.1 protein_id gnl|my_center|LOCUS_10850 38211 37708 gene locus_tag LOCUS_10860 38211 37708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 38247 39374 gene locus_tag LOCUS_10870 gene purM 38247 39374 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804525.1 protein_id gnl|my_center|LOCUS_10870 39747 39502 gene locus_tag LOCUS_10880 39747 39502 CDS product DUF3073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863131.1 protein_id gnl|my_center|LOCUS_10880 40054 40305 gene locus_tag LOCUS_10890 40054 40305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 40659 41873 gene locus_tag LOCUS_10900 40659 41873 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030441.1 protein_id gnl|my_center|LOCUS_10900 41979 42797 gene locus_tag LOCUS_10910 41979 42797 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257237.1 protein_id gnl|my_center|LOCUS_10910 42816 44447 gene locus_tag LOCUS_10920 42816 44447 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977987.1 protein_id gnl|my_center|LOCUS_10920 45633 44461 gene locus_tag LOCUS_10930 45633 44461 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416933.1 protein_id gnl|my_center|LOCUS_10930 46160 45636 gene locus_tag LOCUS_10940 46160 45636 CDS product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729245.1 protein_id gnl|my_center|LOCUS_10940 47806 46238 gene locus_tag LOCUS_10950 47806 46238 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972907.1 protein_id gnl|my_center|LOCUS_10950 47929 48810 gene locus_tag LOCUS_10960 47929 48810 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114171.1 protein_id gnl|my_center|LOCUS_10960 51104 48891 gene locus_tag LOCUS_10970 51104 48891 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256758.1 protein_id gnl|my_center|LOCUS_10970 51766 51299 gene locus_tag LOCUS_10980 51766 51299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 52046 51970 gene locus_tag LOCUS_t00130 52046 51970 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 52148 52072 gene locus_tag LOCUS_t00140 52148 52072 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 52245 52172 gene locus_tag LOCUS_t00150 52245 52172 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 52442 53677 gene locus_tag LOCUS_10990 52442 53677 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223998.1 protein_id gnl|my_center|LOCUS_10990 54752 53703 gene locus_tag LOCUS_11000 54752 53703 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869314.1 protein_id gnl|my_center|LOCUS_11000 55456 54803 gene locus_tag LOCUS_11010 55456 54803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 55835 55575 gene locus_tag LOCUS_11020 55835 55575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 55729 56172 gene locus_tag LOCUS_11030 55729 56172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 56264 56830 gene locus_tag LOCUS_11040 56264 56830 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975987.1 protein_id gnl|my_center|LOCUS_11040 56936 56863 gene locus_tag LOCUS_t00160 56936 56863 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 61041 57043 gene locus_tag LOCUS_11050 61041 57043 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030426.1 protein_id gnl|my_center|LOCUS_11050 61267 62946 gene locus_tag LOCUS_11060 61267 62946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 63198 63521 gene locus_tag LOCUS_11070 63198 63521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 63537 63839 gene locus_tag LOCUS_11080 63537 63839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 63977 64441 gene locus_tag LOCUS_11090 63977 64441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 64438 66114 gene locus_tag LOCUS_11100 64438 66114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 66160 67518 gene locus_tag LOCUS_11110 66160 67518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 67521 68891 gene locus_tag LOCUS_11120 gene eccB 67521 68891 CDS product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030413.1 protein_id gnl|my_center|LOCUS_11120 69005 70243 gene locus_tag LOCUS_11130 69005 70243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 70248 70985 gene locus_tag LOCUS_11140 70248 70985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804371.1 protein_id gnl|my_center|LOCUS_11140 71965 71189 gene locus_tag LOCUS_11150 gene pstB 71965 71189 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730783.1 protein_id gnl|my_center|LOCUS_11150 72927 71965 gene locus_tag LOCUS_11160 gene pstA 72927 71965 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230713.1 protein_id gnl|my_center|LOCUS_11160 73898 72924 gene locus_tag LOCUS_11170 gene pstC 73898 72924 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230714.1 protein_id gnl|my_center|LOCUS_11170 74989 73901 gene locus_tag LOCUS_11180 gene pstS 74989 73901 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113225.1 protein_id gnl|my_center|LOCUS_11180 76188 75235 gene locus_tag LOCUS_11190 76188 75235 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776549.1 protein_id gnl|my_center|LOCUS_11190 79427 76200 gene locus_tag LOCUS_11200 79427 76200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 80180 79467 gene locus_tag LOCUS_11210 gene glnR 80180 79467 CDS product two-component system response regulator GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029474.1 protein_id gnl|my_center|LOCUS_11210 80273 80530 gene locus_tag LOCUS_11220 80273 80530 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974810.1 protein_id gnl|my_center|LOCUS_11220 80538 81362 gene locus_tag LOCUS_11230 80538 81362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 81384 82136 gene locus_tag LOCUS_11240 81384 82136 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978056.1 protein_id gnl|my_center|LOCUS_11240 82520 82149 gene locus_tag LOCUS_11250 82520 82149 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974797.1 protein_id gnl|my_center|LOCUS_11250 82519 83043 gene locus_tag LOCUS_11260 82519 83043 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230723.1 protein_id gnl|my_center|LOCUS_11260 83076 83489 gene locus_tag LOCUS_11270 83076 83489 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_11270 83543 84595 gene locus_tag LOCUS_11280 83543 84595 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974789.1 protein_id gnl|my_center|LOCUS_11280 84592 85431 gene locus_tag LOCUS_11290 84592 85431 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_11290 85521 86051 gene locus_tag LOCUS_11300 85521 86051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 86077 86880 gene locus_tag LOCUS_11310 86077 86880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 87398 87012 gene locus_tag LOCUS_11320 87398 87012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 87543 88460 gene locus_tag LOCUS_11330 87543 88460 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224034.1 protein_id gnl|my_center|LOCUS_11330 88462 88962 gene locus_tag LOCUS_11340 gene dtd 88462 88962 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409533.1 protein_id gnl|my_center|LOCUS_11340 88967 89287 gene locus_tag LOCUS_11350 88967 89287 CDS product DUF2516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868443.1 protein_id gnl|my_center|LOCUS_11350 90226 89414 gene locus_tag LOCUS_11360 90226 89414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222384.1 protein_id gnl|my_center|LOCUS_11360 90385 91749 gene locus_tag LOCUS_11370 gene mshA 90385 91749 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742053.1 protein_id gnl|my_center|LOCUS_11370 91759 92406 gene locus_tag LOCUS_11380 91759 92406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 92445 93185 gene locus_tag LOCUS_11390 92445 93185 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222392.1 protein_id gnl|my_center|LOCUS_11390 94544 93255 gene locus_tag LOCUS_11400 94544 93255 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226021.1 protein_id gnl|my_center|LOCUS_11400 95380 94667 gene locus_tag LOCUS_11410 gene phoU 95380 94667 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974747.1 protein_id gnl|my_center|LOCUS_11410 95523 96881 gene locus_tag LOCUS_11420 95523 96881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 96878 97558 gene locus_tag LOCUS_11430 96878 97558 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974745.1 protein_id gnl|my_center|LOCUS_11430 98148 97693 gene locus_tag LOCUS_11440 98148 97693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 98462 98944 gene locus_tag LOCUS_11450 98462 98944 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003953493.1 protein_id gnl|my_center|LOCUS_11450 99014 99739 gene locus_tag LOCUS_11460 gene ispD 99014 99739 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731019.1 protein_id gnl|my_center|LOCUS_11460 99809 100609 gene locus_tag LOCUS_11470 99809 100609 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031214.1 protein_id gnl|my_center|LOCUS_11470 100602 101135 gene locus_tag LOCUS_11480 gene ispF 100602 101135 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804549.1 protein_id gnl|my_center|LOCUS_11480 101610 101146 gene locus_tag LOCUS_11490 101610 101146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11490 102002 101556 gene locus_tag LOCUS_11500 102002 101556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 102415 102044 gene locus_tag LOCUS_11510 102415 102044 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776996.1 protein_id gnl|my_center|LOCUS_11510 102596 103696 gene locus_tag LOCUS_11520 102596 103696 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027326.1 protein_id gnl|my_center|LOCUS_11520 103693 104439 gene locus_tag LOCUS_11530 103693 104439 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895736.1 protein_id gnl|my_center|LOCUS_11530 104774 104580 gene locus_tag LOCUS_11540 104774 104580 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226939.1 protein_id gnl|my_center|LOCUS_11540 104886 106328 gene locus_tag LOCUS_11550 gene cysS 104886 106328 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868385.1 protein_id gnl|my_center|LOCUS_11550 106354 107430 gene locus_tag LOCUS_11560 gene rlmB 106354 107430 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230407.1 protein_id gnl|my_center|LOCUS_11560 107502 108389 gene locus_tag LOCUS_11570 107502 108389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 108399 108938 gene locus_tag LOCUS_11580 108399 108938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 109871 108966 gene locus_tag LOCUS_11590 109871 108966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 111179 109932 gene locus_tag LOCUS_11600 111179 109932 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804886.1 protein_id gnl|my_center|LOCUS_11600 112452 111343 gene locus_tag LOCUS_11610 gene ugpC 112452 111343 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804887.1 protein_id gnl|my_center|LOCUS_11610 112762 114069 gene locus_tag LOCUS_11620 112762 114069 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804843.1 protein_id gnl|my_center|LOCUS_11620 114297 115835 gene locus_tag LOCUS_11630 114297 115835 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804842.1 protein_id gnl|my_center|LOCUS_11630 115835 116752 gene locus_tag LOCUS_11640 115835 116752 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804841.1 protein_id gnl|my_center|LOCUS_11640 116749 118662 gene locus_tag LOCUS_11650 gene malZ 116749 118662 CDS product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257409.1 protein_id gnl|my_center|LOCUS_11650 118684 119766 gene locus_tag LOCUS_11660 118684 119766 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976582.1 protein_id gnl|my_center|LOCUS_11660 119866 120279 gene locus_tag LOCUS_11670 119866 120279 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224278.1 protein_id gnl|my_center|LOCUS_11670 >Feature sequence09 <1 1125 gene locus_tag LOCUS_11680 <1 1125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011014867.1:DUF4921 family protein 1401 2903 gene locus_tag LOCUS_11690 1401 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 3519 3001 gene locus_tag LOCUS_11700 3519 3001 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975424.1 protein_id gnl|my_center|LOCUS_11700 3615 5165 gene locus_tag LOCUS_11710 3615 5165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 5162 6226 gene locus_tag LOCUS_11720 5162 6226 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_11720 6717 6325 gene locus_tag LOCUS_11730 6717 6325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 6604 7305 gene locus_tag LOCUS_11740 6604 7305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11740 7391 7942 gene locus_tag LOCUS_11750 gene hpt 7391 7942 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007452004.1 protein_id gnl|my_center|LOCUS_11750 8103 10208 gene locus_tag LOCUS_11760 gene ftsH 8103 10208 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867756.1 protein_id gnl|my_center|LOCUS_11760 10214 10786 gene locus_tag LOCUS_11770 gene folE 10214 10786 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975430.1 protein_id gnl|my_center|LOCUS_11770 10783 11712 gene locus_tag LOCUS_11780 gene folP 10783 11712 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975435.1 protein_id gnl|my_center|LOCUS_11780 11709 12656 gene locus_tag LOCUS_11790 11709 12656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 12650 13153 gene locus_tag LOCUS_11800 12650 13153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 13919 13155 gene locus_tag LOCUS_11810 13919 13155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 15058 13916 gene locus_tag LOCUS_11820 15058 13916 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975441.1 protein_id gnl|my_center|LOCUS_11820 15107 16459 gene locus_tag LOCUS_11830 15107 16459 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969138.1 protein_id gnl|my_center|LOCUS_11830 16470 17237 gene locus_tag LOCUS_11840 16470 17237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 17234 18928 gene locus_tag LOCUS_11850 17234 18928 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028946.1 protein_id gnl|my_center|LOCUS_11850 18925 19800 gene locus_tag LOCUS_11860 gene nadC 18925 19800 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082204.1 protein_id gnl|my_center|LOCUS_11860 20016 20975 gene locus_tag LOCUS_11870 20016 20975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 21852 21046 gene locus_tag LOCUS_11880 21852 21046 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091945.1 protein_id gnl|my_center|LOCUS_11880 22007 23533 gene locus_tag LOCUS_11890 gene lysS 22007 23533 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230454.1 protein_id gnl|my_center|LOCUS_11890 23537 23722 gene locus_tag LOCUS_11900 23537 23722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 23964 24308 gene locus_tag LOCUS_11910 23964 24308 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804905.1 protein_id gnl|my_center|LOCUS_11910 25285 24392 gene locus_tag LOCUS_11920 25285 24392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11920 26258 25278 gene locus_tag LOCUS_11930 26258 25278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 26753 26268 gene locus_tag LOCUS_11940 26753 26268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 26854 27759 gene locus_tag LOCUS_11950 26854 27759 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878394.1 protein_id gnl|my_center|LOCUS_11950 27764 28669 gene locus_tag LOCUS_11960 27764 28669 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730006.1 protein_id gnl|my_center|LOCUS_11960 28889 31453 gene locus_tag LOCUS_11970 28889 31453 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_11970 31538 31960 gene locus_tag LOCUS_11980 31538 31960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 32180 31971 gene locus_tag LOCUS_11990 32180 31971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 32209 32427 gene locus_tag LOCUS_12000 32209 32427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 32643 33224 gene locus_tag LOCUS_12010 32643 33224 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804919.1 protein_id gnl|my_center|LOCUS_12010 33682 33233 gene locus_tag LOCUS_12020 33682 33233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 33681 34535 gene locus_tag LOCUS_12030 33681 34535 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015511.1 protein_id gnl|my_center|LOCUS_12030 35609 34644 gene locus_tag LOCUS_12040 35609 34644 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975480.1 protein_id gnl|my_center|LOCUS_12040 36738 35662 gene locus_tag LOCUS_12050 gene disA 36738 35662 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_12050 38198 36786 gene locus_tag LOCUS_12060 gene radA 38198 36786 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028928.1 protein_id gnl|my_center|LOCUS_12060 39061 38306 gene locus_tag LOCUS_12070 39061 38306 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223868.1 protein_id gnl|my_center|LOCUS_12070 40194 39058 gene locus_tag LOCUS_12080 40194 39058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 40255 41082 gene locus_tag LOCUS_12090 40255 41082 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975487.1 protein_id gnl|my_center|LOCUS_12090 41119 42066 gene locus_tag LOCUS_12100 41119 42066 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224531.1 protein_id gnl|my_center|LOCUS_12100 42074 42901 gene locus_tag LOCUS_12110 gene proC 42074 42901 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975496.1 protein_id gnl|my_center|LOCUS_12110 42894 43436 gene locus_tag LOCUS_12120 42894 43436 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929931.1 protein_id gnl|my_center|LOCUS_12120 43498 44058 gene locus_tag LOCUS_12130 43498 44058 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082252685.1 protein_id gnl|my_center|LOCUS_12130 44149 45342 gene locus_tag LOCUS_12140 44149 45342 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326515.1 protein_id gnl|my_center|LOCUS_12140 45744 51794 gene locus_tag LOCUS_12150 45744 51794 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193495474.1 protein_id gnl|my_center|LOCUS_12150 51819 52793 gene locus_tag LOCUS_12160 51819 52793 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929980.1 protein_id gnl|my_center|LOCUS_12160 53102 54247 gene locus_tag LOCUS_12170 53102 54247 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776170.1 protein_id gnl|my_center|LOCUS_12170 54247 56637 gene locus_tag LOCUS_12180 54247 56637 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776169.1 protein_id gnl|my_center|LOCUS_12180 56634 58022 gene locus_tag LOCUS_12190 56634 58022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 58019 58891 gene locus_tag LOCUS_12200 58019 58891 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776167.1 protein_id gnl|my_center|LOCUS_12200 58888 60456 gene locus_tag LOCUS_12210 58888 60456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 60453 62108 gene locus_tag LOCUS_12220 60453 62108 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776165.1 protein_id gnl|my_center|LOCUS_12220 62105 62905 gene locus_tag LOCUS_12230 62105 62905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776164.1 protein_id gnl|my_center|LOCUS_12230 62902 67323 gene locus_tag LOCUS_12240 62902 67323 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776163.1 protein_id gnl|my_center|LOCUS_12240 67399 68877 gene locus_tag LOCUS_12250 67399 68877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 68874 70292 gene locus_tag LOCUS_12260 68874 70292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 70289 70942 gene locus_tag LOCUS_12270 70289 70942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 70939 71574 gene locus_tag LOCUS_12280 70939 71574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 71696 71992 gene locus_tag LOCUS_12290 71696 71992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 72190 72390 gene locus_tag LOCUS_12300 72190 72390 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004984898.1 protein_id gnl|my_center|LOCUS_12300 73193 72507 gene locus_tag LOCUS_12310 73193 72507 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308861.1 protein_id gnl|my_center|LOCUS_12310 73728 74789 gene locus_tag LOCUS_12320 73728 74789 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975510.1 protein_id gnl|my_center|LOCUS_12320 74789 76348 gene locus_tag LOCUS_12330 74789 76348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 76503 76649 gene locus_tag LOCUS_12340 76503 76649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 76764 77462 gene locus_tag LOCUS_12350 76764 77462 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141850309.1 protein_id gnl|my_center|LOCUS_12350 77521 79149 gene locus_tag LOCUS_12360 77521 79149 CDS product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975519.1 protein_id gnl|my_center|LOCUS_12360 79905 79372 gene locus_tag LOCUS_12370 79905 79372 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776424.1 protein_id gnl|my_center|LOCUS_12370 80091 80549 gene locus_tag LOCUS_12380 80091 80549 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028826.1 protein_id gnl|my_center|LOCUS_12380 80622 81263 gene locus_tag LOCUS_12390 80622 81263 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222430.1 protein_id gnl|my_center|LOCUS_12390 81263 81880 gene locus_tag LOCUS_12400 81263 81880 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029677.1 protein_id gnl|my_center|LOCUS_12400 81880 82656 gene locus_tag LOCUS_12410 81880 82656 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974477.1 protein_id gnl|my_center|LOCUS_12410 82653 84272 gene locus_tag LOCUS_12420 82653 84272 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776419.1 protein_id gnl|my_center|LOCUS_12420 84275 85396 gene locus_tag LOCUS_12430 gene ccsB 84275 85396 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029680.1 protein_id gnl|my_center|LOCUS_12430 85463 85780 gene locus_tag LOCUS_12440 85463 85780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 86681 85809 gene locus_tag LOCUS_12450 86681 85809 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094666.1 protein_id gnl|my_center|LOCUS_12450 87033 86761 gene locus_tag LOCUS_12460 87033 86761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 88300 87113 gene locus_tag LOCUS_12470 gene menE 88300 87113 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098433.1 protein_id gnl|my_center|LOCUS_12470 89256 88546 gene locus_tag LOCUS_12480 89256 88546 CDS product PaeR7I family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176598.1 protein_id gnl|my_center|LOCUS_12480 90866 89253 gene locus_tag LOCUS_12490 90866 89253 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089418476.1 protein_id gnl|my_center|LOCUS_12490 91984 91013 gene locus_tag LOCUS_12500 91984 91013 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860502.1 protein_id gnl|my_center|LOCUS_12500 92474 92088 gene locus_tag LOCUS_12510 92474 92088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 93235 92684 gene locus_tag LOCUS_12520 93235 92684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 93219 93413 gene locus_tag LOCUS_12530 93219 93413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 93421 94230 gene locus_tag LOCUS_12540 93421 94230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 94227 94946 gene locus_tag LOCUS_12550 gene cseB 94227 94946 CDS product two-component system response regulator CseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975477.1 protein_id gnl|my_center|LOCUS_12550 94960 96231 gene locus_tag LOCUS_12560 94960 96231 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028932.1 protein_id gnl|my_center|LOCUS_12560 96228 97256 gene locus_tag LOCUS_12570 96228 97256 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230276.1 protein_id gnl|my_center|LOCUS_12570 97323 98660 gene locus_tag LOCUS_12580 97323 98660 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901990.1 protein_id gnl|my_center|LOCUS_12580 99001 98657 gene locus_tag LOCUS_12590 gene mazF3 99001 98657 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405820.1 protein_id gnl|my_center|LOCUS_12590 99238 99005 gene locus_tag LOCUS_12600 99238 99005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 101038 99293 gene locus_tag LOCUS_12610 101038 99293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 102742 101057 gene locus_tag LOCUS_12620 gene menD 102742 101057 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466562.1 protein_id gnl|my_center|LOCUS_12620 104072 102747 gene locus_tag LOCUS_12630 104072 102747 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929999.1 protein_id gnl|my_center|LOCUS_12630 104833 104144 gene locus_tag LOCUS_12640 104833 104144 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974389.1 protein_id gnl|my_center|LOCUS_12640 105085 107490 gene locus_tag LOCUS_12650 105085 107490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 107643 108563 gene locus_tag LOCUS_12660 107643 108563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 108704 110005 gene locus_tag LOCUS_12670 108704 110005 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_12670 110181 110543 gene locus_tag LOCUS_12680 110181 110543 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974383.1 protein_id gnl|my_center|LOCUS_12680 110554 111108 gene locus_tag LOCUS_12690 110554 111108 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061196.1 protein_id gnl|my_center|LOCUS_12690 111105 111812 gene locus_tag LOCUS_12700 111105 111812 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029733.1 protein_id gnl|my_center|LOCUS_12700 111812 113155 gene locus_tag LOCUS_12710 111812 113155 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029734.1 protein_id gnl|my_center|LOCUS_12710 >Feature sequence10 954 592 gene locus_tag LOCUS_12720 954 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12720 1150 992 gene locus_tag LOCUS_12730 1150 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12730 2352 1468 gene locus_tag LOCUS_12740 2352 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12740 2801 2277 gene locus_tag LOCUS_12750 2801 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12750 4335 2689 gene locus_tag LOCUS_12760 4335 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12760 4594 4283 gene locus_tag LOCUS_12770 4594 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12770 5681 4740 gene locus_tag LOCUS_12780 5681 4740 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976742.1 protein_id gnl|my_center|LOCUS_12780 6303 5668 gene locus_tag LOCUS_12790 gene lspA 6303 5668 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495573.1 protein_id gnl|my_center|LOCUS_12790 6890 6267 gene locus_tag LOCUS_12800 6890 6267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 8544 7087 gene locus_tag LOCUS_12810 8544 7087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 8906 8628 gene locus_tag LOCUS_12820 8906 8628 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900476.1 protein_id gnl|my_center|LOCUS_12820 9511 9026 gene locus_tag LOCUS_12830 gene sepF 9511 9026 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976736.1 protein_id gnl|my_center|LOCUS_12830 10303 9584 gene locus_tag LOCUS_12840 10303 9584 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028129.1 protein_id gnl|my_center|LOCUS_12840 11156 10356 gene locus_tag LOCUS_12850 gene pgeF 11156 10356 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028130.1 protein_id gnl|my_center|LOCUS_12850 12416 11205 gene locus_tag LOCUS_12860 gene ftsZ 12416 11205 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_12860 13516 12758 gene locus_tag LOCUS_12870 13516 12758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 14982 13516 gene locus_tag LOCUS_12880 gene murC 14982 13516 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228036.1 protein_id gnl|my_center|LOCUS_12880 16130 14979 gene locus_tag LOCUS_12890 gene murG 16130 14979 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976731.1 protein_id gnl|my_center|LOCUS_12890 17455 16151 gene locus_tag LOCUS_12900 gene ftsW 17455 16151 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804701.1 protein_id gnl|my_center|LOCUS_12900 18996 17452 gene locus_tag LOCUS_12910 gene murD 18996 17452 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804700.1 protein_id gnl|my_center|LOCUS_12910 20075 18993 gene locus_tag LOCUS_12920 gene mraY 20075 18993 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976728.1 protein_id gnl|my_center|LOCUS_12920 21532 20072 gene locus_tag LOCUS_12930 21532 20072 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_12930 23109 21529 gene locus_tag LOCUS_12940 23109 21529 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028131.1 protein_id gnl|my_center|LOCUS_12940 24997 23120 gene locus_tag LOCUS_12950 gene ftsI 24997 23120 CDS product cell division protein FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028132.1 protein_id gnl|my_center|LOCUS_12950 25537 25001 gene locus_tag LOCUS_12960 25537 25001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 26511 25534 gene locus_tag LOCUS_12970 gene rsmH 26511 25534 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976723.1 protein_id gnl|my_center|LOCUS_12970 27183 26752 gene locus_tag LOCUS_12980 gene mraZ 27183 26752 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804693.1 protein_id gnl|my_center|LOCUS_12980 27547 28557 gene locus_tag LOCUS_12990 27547 28557 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976721.1 protein_id gnl|my_center|LOCUS_12990 28567 29823 gene locus_tag LOCUS_13000 28567 29823 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486197.1 protein_id gnl|my_center|LOCUS_13000 29820 32177 gene locus_tag LOCUS_13010 29820 32177 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486200.1 protein_id gnl|my_center|LOCUS_13010 34209 32287 gene locus_tag LOCUS_13020 34209 32287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 34810 34403 gene locus_tag LOCUS_13030 34810 34403 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729640.1 protein_id gnl|my_center|LOCUS_13030 36026 34884 gene locus_tag LOCUS_13040 36026 34884 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229667.1 protein_id gnl|my_center|LOCUS_13040 37266 36193 gene locus_tag LOCUS_13050 37266 36193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 37710 37405 gene locus_tag LOCUS_13060 37710 37405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 38739 37945 gene locus_tag LOCUS_13070 38739 37945 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775745.1 protein_id gnl|my_center|LOCUS_13070 38819 40531 gene locus_tag LOCUS_13080 38819 40531 CDS product bifunctional 3'-5' exonuclease/DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228747.1 protein_id gnl|my_center|LOCUS_13080 41469 40528 gene locus_tag LOCUS_13090 41469 40528 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229588.1 protein_id gnl|my_center|LOCUS_13090 45357 41599 gene locus_tag LOCUS_13100 gene hrpA 45357 41599 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228749.1 protein_id gnl|my_center|LOCUS_13100 46152 45544 gene locus_tag LOCUS_13110 46152 45544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 46073 46585 gene locus_tag LOCUS_13120 46073 46585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 47871 46555 gene locus_tag LOCUS_13130 47871 46555 CDS product bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893059.1 protein_id gnl|my_center|LOCUS_13130 48183 49256 gene locus_tag LOCUS_13140 gene mgrA 48183 49256 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224864.1 protein_id gnl|my_center|LOCUS_13140 49298 49957 gene locus_tag LOCUS_13150 49298 49957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 49959 50558 gene locus_tag LOCUS_13160 49959 50558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 50555 51205 gene locus_tag LOCUS_13170 50555 51205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 52459 51197 gene locus_tag LOCUS_13180 52459 51197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 53483 52467 gene locus_tag LOCUS_13190 gene ppk2 53483 52467 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082944.1 protein_id gnl|my_center|LOCUS_13190 53569 54000 gene locus_tag LOCUS_13200 53569 54000 CDS product F420H(2)-dependent quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407780.1 protein_id gnl|my_center|LOCUS_13200 54090 55088 gene locus_tag LOCUS_13210 54090 55088 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015422.1 protein_id gnl|my_center|LOCUS_13210 55168 55362 gene locus_tag LOCUS_13220 55168 55362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 56048 55458 gene locus_tag LOCUS_13230 56048 55458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 56254 58734 gene locus_tag LOCUS_13240 56254 58734 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533043.1 protein_id gnl|my_center|LOCUS_13240 59742 58783 gene locus_tag LOCUS_13250 59742 58783 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227077.1 protein_id gnl|my_center|LOCUS_13250 60561 59770 gene locus_tag LOCUS_13260 60561 59770 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028095.1 protein_id gnl|my_center|LOCUS_13260 62462 60558 gene locus_tag LOCUS_13270 62462 60558 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350675.1 protein_id gnl|my_center|LOCUS_13270 63328 62459 gene locus_tag LOCUS_13280 63328 62459 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810750.1 protein_id gnl|my_center|LOCUS_13280 64519 63335 gene locus_tag LOCUS_13290 64519 63335 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942379.1 protein_id gnl|my_center|LOCUS_13290 64841 65401 gene locus_tag LOCUS_13300 64841 65401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 66333 65443 gene locus_tag LOCUS_13310 66333 65443 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457759.1 protein_id gnl|my_center|LOCUS_13310 66636 66358 gene locus_tag LOCUS_13320 66636 66358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 70251 66676 gene locus_tag LOCUS_13330 gene smc 70251 66676 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030315.1 protein_id gnl|my_center|LOCUS_13330 70654 70319 gene locus_tag LOCUS_13340 70654 70319 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976797.1 protein_id gnl|my_center|LOCUS_13340 70985 70692 gene locus_tag LOCUS_13350 70985 70692 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856367.1 protein_id gnl|my_center|LOCUS_13350 72926 70989 gene locus_tag LOCUS_13360 72926 70989 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206614.1 protein_id gnl|my_center|LOCUS_13360 73163 72933 gene locus_tag LOCUS_13370 73163 72933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 73781 73170 gene locus_tag LOCUS_13380 73781 73170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 75038 74364 gene locus_tag LOCUS_13390 75038 74364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681638.1 protein_id gnl|my_center|LOCUS_13390 75372 75608 gene locus_tag LOCUS_13400 75372 75608 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389965.1 protein_id gnl|my_center|LOCUS_13400 75605 76033 gene locus_tag LOCUS_13410 75605 76033 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081160608.1 protein_id gnl|my_center|LOCUS_13410 76234 76716 gene locus_tag LOCUS_13420 76234 76716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 77673 76783 gene locus_tag LOCUS_13430 gene mutM 77673 76783 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223692.1 protein_id gnl|my_center|LOCUS_13430 78466 77675 gene locus_tag LOCUS_13440 gene rnc 78466 77675 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973423.1 protein_id gnl|my_center|LOCUS_13440 78675 78481 gene locus_tag LOCUS_13450 gene rpmF 78675 78481 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811892.1 protein_id gnl|my_center|LOCUS_13450 79264 78677 gene locus_tag LOCUS_13460 79264 78677 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973424.1 protein_id gnl|my_center|LOCUS_13460 79882 79397 gene locus_tag LOCUS_13470 gene coaD 79882 79397 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973426.1 protein_id gnl|my_center|LOCUS_13470 80508 79930 gene locus_tag LOCUS_13480 gene rsmD 80508 79930 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466716.1 protein_id gnl|my_center|LOCUS_13480 82764 80509 gene locus_tag LOCUS_13490 gene recG 82764 80509 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973428.1 protein_id gnl|my_center|LOCUS_13490 84502 82766 gene locus_tag LOCUS_13500 84502 82766 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030309.1 protein_id gnl|my_center|LOCUS_13500 84828 85016 gene locus_tag LOCUS_13510 gene rpmB 84828 85016 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_13510 86601 85111 gene locus_tag LOCUS_13520 86601 85111 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258343.1 protein_id gnl|my_center|LOCUS_13520 87595 86672 gene locus_tag LOCUS_13530 87595 86672 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415034.1 protein_id gnl|my_center|LOCUS_13530 87791 88024 gene locus_tag LOCUS_13540 87791 88024 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973433.1 protein_id gnl|my_center|LOCUS_13540 88003 88545 gene locus_tag LOCUS_13550 88003 88545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 89602 88550 gene locus_tag LOCUS_13560 89602 88550 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973434.1 protein_id gnl|my_center|LOCUS_13560 89747 90865 gene locus_tag LOCUS_13570 89747 90865 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222013.1 protein_id gnl|my_center|LOCUS_13570 91929 90931 gene locus_tag LOCUS_13580 91929 90931 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030308.1 protein_id gnl|my_center|LOCUS_13580 92669 91926 gene locus_tag LOCUS_13590 92669 91926 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973436.1 protein_id gnl|my_center|LOCUS_13590 93387 92788 gene locus_tag LOCUS_13600 93387 92788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 94184 93597 gene locus_tag LOCUS_13610 gene leuD 94184 93597 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893754.1 protein_id gnl|my_center|LOCUS_13610 95586 94195 gene locus_tag LOCUS_13620 gene leuC 95586 94195 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223619.1 protein_id gnl|my_center|LOCUS_13620 95695 96426 gene locus_tag LOCUS_13630 95695 96426 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775885.1 protein_id gnl|my_center|LOCUS_13630 96591 97709 gene locus_tag LOCUS_13640 96591 97709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 97929 97856 gene locus_tag LOCUS_t00170 97929 97856 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 98110 98038 gene locus_tag LOCUS_t00180 98110 98038 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 99763 98237 gene locus_tag LOCUS_13650 gene gltX 99763 98237 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394117.1 protein_id gnl|my_center|LOCUS_13650 100609 99827 gene locus_tag LOCUS_13660 100609 99827 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775888.1 protein_id gnl|my_center|LOCUS_13660 101482 100619 gene locus_tag LOCUS_13670 101482 100619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 101606 102496 gene locus_tag LOCUS_13680 101606 102496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226805.1 protein_id gnl|my_center|LOCUS_13680 103041 102484 gene locus_tag LOCUS_13690 103041 102484 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257182.1 protein_id gnl|my_center|LOCUS_13690 104651 103053 gene locus_tag LOCUS_13700 gene cimA 104651 103053 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030295.1 protein_id gnl|my_center|LOCUS_13700 105800 104970 gene locus_tag LOCUS_13710 105800 104970 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974993.1 protein_id gnl|my_center|LOCUS_13710 106900 105779 gene locus_tag LOCUS_13720 106900 105779 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036086.1 protein_id gnl|my_center|LOCUS_13720 >Feature sequence11 2 172 gene locus_tag LOCUS_13730 2 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 298 597 gene locus_tag LOCUS_13740 298 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 594 2201 gene locus_tag LOCUS_13750 594 2201 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227390.1 protein_id gnl|my_center|LOCUS_13750 2293 3390 gene locus_tag LOCUS_13760 gene dapE 2293 3390 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030079.1 protein_id gnl|my_center|LOCUS_13760 3458 4183 gene locus_tag LOCUS_13770 3458 4183 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973837.1 protein_id gnl|my_center|LOCUS_13770 4180 4500 gene locus_tag LOCUS_13780 4180 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 4511 4963 gene locus_tag LOCUS_13790 4511 4963 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030713.1 protein_id gnl|my_center|LOCUS_13790 4960 5547 gene locus_tag LOCUS_13800 4960 5547 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015424.1 protein_id gnl|my_center|LOCUS_13800 5558 6796 gene locus_tag LOCUS_13810 5558 6796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 7655 6822 gene locus_tag LOCUS_13820 7655 6822 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222968.1 protein_id gnl|my_center|LOCUS_13820 7794 7967 gene locus_tag LOCUS_13830 7794 7967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 8690 8058 gene locus_tag LOCUS_13840 8690 8058 CDS product SAM-dependent O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911448.1 protein_id gnl|my_center|LOCUS_13840 8971 9639 gene locus_tag LOCUS_13850 gene sigE 8971 9639 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973830.1 protein_id gnl|my_center|LOCUS_13850 9636 10277 gene locus_tag LOCUS_13860 9636 10277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 10274 11629 gene locus_tag LOCUS_13870 10274 11629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13870 11776 11869 gene locus_tag LOCUS_t00190 11776 11869 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13407 12274 gene locus_tag LOCUS_13880 13407 12274 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973825.1 protein_id gnl|my_center|LOCUS_13880 14013 13435 gene locus_tag LOCUS_13890 14013 13435 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469672.1 protein_id gnl|my_center|LOCUS_13890 15353 14010 gene locus_tag LOCUS_13900 15353 14010 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030088.1 protein_id gnl|my_center|LOCUS_13900 15483 16559 gene locus_tag LOCUS_13910 15483 16559 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222030.1 protein_id gnl|my_center|LOCUS_13910 16559 17473 gene locus_tag LOCUS_13920 16559 17473 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222029.1 protein_id gnl|my_center|LOCUS_13920 18284 17493 gene locus_tag LOCUS_13930 18284 17493 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730845.1 protein_id gnl|my_center|LOCUS_13930 18410 19615 gene locus_tag LOCUS_13940 18410 19615 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030944.1 protein_id gnl|my_center|LOCUS_13940 19742 20584 gene locus_tag LOCUS_13950 19742 20584 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327253.1 protein_id gnl|my_center|LOCUS_13950 20581 21108 gene locus_tag LOCUS_13960 20581 21108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13960 21155 22897 gene locus_tag LOCUS_13970 21155 22897 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029468.1 protein_id gnl|my_center|LOCUS_13970 23050 23568 gene locus_tag LOCUS_13980 23050 23568 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089004579.1 protein_id gnl|my_center|LOCUS_13980 23561 24517 gene locus_tag LOCUS_13990 23561 24517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 25867 24536 gene locus_tag LOCUS_14000 25867 24536 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930178.1 protein_id gnl|my_center|LOCUS_14000 27125 26076 gene locus_tag LOCUS_14010 27125 26076 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256083.1 protein_id gnl|my_center|LOCUS_14010 27109 28335 gene locus_tag LOCUS_14020 27109 28335 CDS product DUF2332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403477.1 protein_id gnl|my_center|LOCUS_14020 28557 28781 gene locus_tag LOCUS_14030 28557 28781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 28862 29041 gene locus_tag LOCUS_14040 28862 29041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 29050 30027 gene locus_tag LOCUS_14050 29050 30027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 30024 30743 gene locus_tag LOCUS_14060 30024 30743 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173716.1 protein_id gnl|my_center|LOCUS_14060 30736 32223 gene locus_tag LOCUS_14070 30736 32223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 32220 32969 gene locus_tag LOCUS_14080 32220 32969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 34685 32979 gene locus_tag LOCUS_14090 34685 32979 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 protein_id gnl|my_center|LOCUS_14090 36629 35097 gene locus_tag LOCUS_14100 gene glpK 36629 35097 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731139.1 protein_id gnl|my_center|LOCUS_14100 37874 36687 gene locus_tag LOCUS_14110 37874 36687 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083253.1 protein_id gnl|my_center|LOCUS_14110 39572 37941 gene locus_tag LOCUS_14120 39572 37941 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083178.1 protein_id gnl|my_center|LOCUS_14120 40629 39685 gene locus_tag LOCUS_14130 40629 39685 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727817.1 protein_id gnl|my_center|LOCUS_14130 40792 42234 gene locus_tag LOCUS_14140 40792 42234 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877707.1 protein_id gnl|my_center|LOCUS_14140 43049 42222 gene locus_tag LOCUS_14150 43049 42222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 43855 43046 gene locus_tag LOCUS_14160 43855 43046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 45253 43865 gene locus_tag LOCUS_14170 45253 43865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 45542 45243 gene locus_tag LOCUS_14180 45542 45243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 45767 46615 gene locus_tag LOCUS_14190 45767 46615 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804749.1 protein_id gnl|my_center|LOCUS_14190 46612 47505 gene locus_tag LOCUS_14200 46612 47505 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286316.1 protein_id gnl|my_center|LOCUS_14200 47502 48350 gene locus_tag LOCUS_14210 47502 48350 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728017.1 protein_id gnl|my_center|LOCUS_14210 50177 48423 gene locus_tag LOCUS_14220 50177 48423 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804750.1 protein_id gnl|my_center|LOCUS_14220 50387 51061 gene locus_tag LOCUS_14230 50387 51061 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973811.1 protein_id gnl|my_center|LOCUS_14230 51411 51145 gene locus_tag LOCUS_14240 51411 51145 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894403.1 protein_id gnl|my_center|LOCUS_14240 51776 51537 gene locus_tag LOCUS_14250 51776 51537 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821409.1 protein_id gnl|my_center|LOCUS_14250 52488 51811 gene locus_tag LOCUS_14260 52488 51811 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973808.1 protein_id gnl|my_center|LOCUS_14260 52582 53754 gene locus_tag LOCUS_14270 gene moeZ 52582 53754 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973798.1 protein_id gnl|my_center|LOCUS_14270 53822 56998 gene locus_tag LOCUS_14280 53822 56998 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223038.1 protein_id gnl|my_center|LOCUS_14280 56995 60486 gene locus_tag LOCUS_14290 56995 60486 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111858.1 protein_id gnl|my_center|LOCUS_14290 61646 60426 gene locus_tag LOCUS_14300 61646 60426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 61680 62666 gene locus_tag LOCUS_14310 gene nudC 61680 62666 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327228.1 protein_id gnl|my_center|LOCUS_14310 62913 62689 gene locus_tag LOCUS_14320 62913 62689 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973789.1 protein_id gnl|my_center|LOCUS_14320 62903 63118 gene locus_tag LOCUS_14330 62903 63118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 63195 64301 gene locus_tag LOCUS_14340 63195 64301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 64371 66650 gene locus_tag LOCUS_14350 64371 66650 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668762.1 protein_id gnl|my_center|LOCUS_14350 66811 67080 gene locus_tag LOCUS_14360 66811 67080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 67334 67627 gene locus_tag LOCUS_14370 67334 67627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 68856 68146 gene locus_tag LOCUS_14380 68856 68146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14380 69595 68807 gene locus_tag LOCUS_14390 69595 68807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14390 70874 69915 gene locus_tag LOCUS_14400 70874 69915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 71116 71700 gene locus_tag LOCUS_14410 71116 71700 CDS product HhH-GPD-type base excision DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222739.1 protein_id gnl|my_center|LOCUS_14410 71693 73168 gene locus_tag LOCUS_14420 71693 73168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206056.1 protein_id gnl|my_center|LOCUS_14420 73262 74137 gene locus_tag LOCUS_14430 73262 74137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 74206 74652 gene locus_tag LOCUS_14440 74206 74652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 75149 74766 gene locus_tag LOCUS_14450 75149 74766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 75034 75330 gene locus_tag LOCUS_14460 75034 75330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 75346 75555 gene locus_tag LOCUS_14470 75346 75555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 76920 75589 gene locus_tag LOCUS_14480 76920 75589 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030108.1 protein_id gnl|my_center|LOCUS_14480 77804 76917 gene locus_tag LOCUS_14490 77804 76917 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223145.1 protein_id gnl|my_center|LOCUS_14490 78145 77990 gene locus_tag LOCUS_14500 78145 77990 CDS product DUF5679 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010551122.1 protein_id gnl|my_center|LOCUS_14500 78268 79104 gene locus_tag LOCUS_14510 78268 79104 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_14510 79162 79731 gene locus_tag LOCUS_14520 79162 79731 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867997.1 protein_id gnl|my_center|LOCUS_14520 79779 80453 gene locus_tag LOCUS_14530 79779 80453 CDS product YwiC-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779966.1 protein_id gnl|my_center|LOCUS_14530 81074 80457 gene locus_tag LOCUS_14540 81074 80457 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727936.1 protein_id gnl|my_center|LOCUS_14540 82519 81089 gene locus_tag LOCUS_14550 82519 81089 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973777.1 protein_id gnl|my_center|LOCUS_14550 82628 83788 gene locus_tag LOCUS_14560 82628 83788 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973776.1 protein_id gnl|my_center|LOCUS_14560 83919 84350 gene locus_tag LOCUS_14570 83919 84350 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973775.1 protein_id gnl|my_center|LOCUS_14570 84624 84313 gene locus_tag LOCUS_14580 84624 84313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 84506 85537 gene locus_tag LOCUS_14590 84506 85537 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804763.1 protein_id gnl|my_center|LOCUS_14590 85548 86096 gene locus_tag LOCUS_14600 85548 86096 CDS product PPA1309 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167526720.1 protein_id gnl|my_center|LOCUS_14600 86175 89240 gene locus_tag LOCUS_14610 86175 89240 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973771.1 protein_id gnl|my_center|LOCUS_14610 89359 89433 gene locus_tag LOCUS_t00200 89359 89433 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 90665 89487 gene locus_tag LOCUS_14620 90665 89487 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209912946.1 protein_id gnl|my_center|LOCUS_14620 90664 90957 gene locus_tag LOCUS_14630 90664 90957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 90975 91379 gene locus_tag LOCUS_14640 90975 91379 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 protein_id gnl|my_center|LOCUS_14640 92693 91413 gene locus_tag LOCUS_14650 92693 91413 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057983.1 protein_id gnl|my_center|LOCUS_14650 92821 93369 gene locus_tag LOCUS_14660 92821 93369 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893663.1 protein_id gnl|my_center|LOCUS_14660 94785 93391 gene locus_tag LOCUS_14670 94785 93391 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222025.1 protein_id gnl|my_center|LOCUS_14670 94972 96522 gene locus_tag LOCUS_14680 94972 96522 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742127.1 protein_id gnl|my_center|LOCUS_14680 96626 97576 gene locus_tag LOCUS_14690 96626 97576 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284829.1 protein_id gnl|my_center|LOCUS_14690 97573 98499 gene locus_tag LOCUS_14700 97573 98499 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466499.1 protein_id gnl|my_center|LOCUS_14700 98496 99308 gene locus_tag LOCUS_14710 98496 99308 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222021.1 protein_id gnl|my_center|LOCUS_14710 99245 99541 gene locus_tag LOCUS_14720 99245 99541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14720 99538 100410 gene locus_tag LOCUS_14730 99538 100410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 100435 100785 gene locus_tag LOCUS_14740 100435 100785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14740 102032 102349 gene locus_tag LOCUS_14750 102032 102349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14750 >Feature sequence12 <1 559 gene locus_tag LOCUS_14760 <1 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728280.1:DUF5914 domain-containing protein 552 920 gene locus_tag LOCUS_14770 552 920 CDS product lycopene cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225922.1 protein_id gnl|my_center|LOCUS_14770 917 1225 gene locus_tag LOCUS_14780 917 1225 CDS product lycopene cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742202.1 protein_id gnl|my_center|LOCUS_14780 1245 2939 gene locus_tag LOCUS_14790 1245 2939 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225919.1 protein_id gnl|my_center|LOCUS_14790 2941 3657 gene locus_tag LOCUS_14800 2941 3657 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225920.1 protein_id gnl|my_center|LOCUS_14800 3654 4187 gene locus_tag LOCUS_14810 3654 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 4288 8349 gene locus_tag LOCUS_14820 4288 8349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 8788 8423 gene locus_tag LOCUS_14830 gene mscL 8788 8423 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230043.1 protein_id gnl|my_center|LOCUS_14830 9092 8835 gene locus_tag LOCUS_14840 9092 8835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 9808 9113 gene locus_tag LOCUS_14850 9808 9113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 10725 9805 gene locus_tag LOCUS_14860 10725 9805 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975629.1 protein_id gnl|my_center|LOCUS_14860 10712 11068 gene locus_tag LOCUS_14870 10712 11068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 12934 11318 gene locus_tag LOCUS_14880 12934 11318 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975632.1 protein_id gnl|my_center|LOCUS_14880 13018 15549 gene locus_tag LOCUS_14890 13018 15549 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141986.1 protein_id gnl|my_center|LOCUS_14890 16216 15578 gene locus_tag LOCUS_14900 16216 15578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 16315 17721 gene locus_tag LOCUS_14910 16315 17721 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775783.1 protein_id gnl|my_center|LOCUS_14910 17718 18989 gene locus_tag LOCUS_14920 17718 18989 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113181.1 protein_id gnl|my_center|LOCUS_14920 18986 19471 gene locus_tag LOCUS_14930 gene moaC 18986 19471 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028813.1 protein_id gnl|my_center|LOCUS_14930 19513 20025 gene locus_tag LOCUS_14940 19513 20025 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804487.1 protein_id gnl|my_center|LOCUS_14940 20022 20645 gene locus_tag LOCUS_14950 20022 20645 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804925.1 protein_id gnl|my_center|LOCUS_14950 20772 21848 gene locus_tag LOCUS_14960 20772 21848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 23069 21867 gene locus_tag LOCUS_14970 23069 21867 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030013.1 protein_id gnl|my_center|LOCUS_14970 24501 23113 gene locus_tag LOCUS_14980 24501 23113 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038535091.1 protein_id gnl|my_center|LOCUS_14980 24500 25783 gene locus_tag LOCUS_14990 24500 25783 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087572.1 protein_id gnl|my_center|LOCUS_14990 26747 25680 gene locus_tag LOCUS_15000 26747 25680 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027421.1 protein_id gnl|my_center|LOCUS_15000 26632 27009 gene locus_tag LOCUS_15010 26632 27009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 27027 27101 gene locus_tag LOCUS_t00210 27027 27101 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 27270 27506 gene locus_tag LOCUS_15020 27270 27506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413717.1 protein_id gnl|my_center|LOCUS_15020 27518 27769 gene locus_tag LOCUS_15030 27518 27769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413719.1 protein_id gnl|my_center|LOCUS_15030 28638 27808 gene locus_tag LOCUS_15040 28638 27808 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227110.1 protein_id gnl|my_center|LOCUS_15040 29099 28746 gene locus_tag LOCUS_15050 29099 28746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 28987 29748 gene locus_tag LOCUS_15060 28987 29748 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204674735.1 protein_id gnl|my_center|LOCUS_15060 29878 30429 gene locus_tag LOCUS_15070 29878 30429 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112393.1 protein_id gnl|my_center|LOCUS_15070 31071 30535 gene locus_tag LOCUS_15080 31071 30535 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531326.1 protein_id gnl|my_center|LOCUS_15080 32325 31111 gene locus_tag LOCUS_15090 32325 31111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 34024 32375 gene locus_tag LOCUS_15100 34024 32375 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486701.1 protein_id gnl|my_center|LOCUS_15100 34132 35079 gene locus_tag LOCUS_15110 34132 35079 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804404.1 protein_id gnl|my_center|LOCUS_15110 35872 35102 gene locus_tag LOCUS_15120 35872 35102 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027753.1 protein_id gnl|my_center|LOCUS_15120 35905 36573 gene locus_tag LOCUS_15130 35905 36573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 36570 37187 gene locus_tag LOCUS_15140 36570 37187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 37251 37502 gene locus_tag LOCUS_15150 37251 37502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 37499 37912 gene locus_tag LOCUS_15160 37499 37912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 37955 38812 gene locus_tag LOCUS_15170 gene rsmI 37955 38812 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975663.1 protein_id gnl|my_center|LOCUS_15170 39301 38834 gene locus_tag LOCUS_15180 39301 38834 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859290.1 protein_id gnl|my_center|LOCUS_15180 39464 39871 gene locus_tag LOCUS_15190 39464 39871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 39923 41500 gene locus_tag LOCUS_15200 39923 41500 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229590.1 protein_id gnl|my_center|LOCUS_15200 41534 43153 gene locus_tag LOCUS_15210 41534 43153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 44365 43169 gene locus_tag LOCUS_15220 44365 43169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 44645 46447 gene locus_tag LOCUS_15230 gene metG 44645 46447 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775786.1 protein_id gnl|my_center|LOCUS_15230 46460 47335 gene locus_tag LOCUS_15240 46460 47335 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028796.1 protein_id gnl|my_center|LOCUS_15240 47617 48702 gene locus_tag LOCUS_15250 47617 48702 CDS product resuscitation-promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896836.1 protein_id gnl|my_center|LOCUS_15250 48816 49679 gene locus_tag LOCUS_15260 gene rsmA 48816 49679 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975667.1 protein_id gnl|my_center|LOCUS_15260 49741 50676 gene locus_tag LOCUS_15270 49741 50676 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045756603.1 protein_id gnl|my_center|LOCUS_15270 50691 52535 gene locus_tag LOCUS_15280 50691 52535 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975669.1 protein_id gnl|my_center|LOCUS_15280 52627 52926 gene locus_tag LOCUS_15290 52627 52926 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975682.1 protein_id gnl|my_center|LOCUS_15290 53481 52966 gene locus_tag LOCUS_15300 gene tamR 53481 52966 CDS product MarR family transcriptional regulator TamR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975680.1 protein_id gnl|my_center|LOCUS_15300 53706 55703 gene locus_tag LOCUS_15310 53706 55703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 56401 55754 gene locus_tag LOCUS_15320 56401 55754 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975684.1 protein_id gnl|my_center|LOCUS_15320 56551 56630 gene locus_tag LOCUS_t00220 56551 56630 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 56694 57869 gene locus_tag LOCUS_15330 56694 57869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 57866 58846 gene locus_tag LOCUS_15340 57866 58846 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229964.1 protein_id gnl|my_center|LOCUS_15340 58872 59759 gene locus_tag LOCUS_15350 58872 59759 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665624.1 protein_id gnl|my_center|LOCUS_15350 59756 60748 gene locus_tag LOCUS_15360 59756 60748 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892918.1 protein_id gnl|my_center|LOCUS_15360 60888 61496 gene locus_tag LOCUS_15370 60888 61496 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975690.1 protein_id gnl|my_center|LOCUS_15370 61509 62150 gene locus_tag LOCUS_15380 gene pth 61509 62150 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229969.1 protein_id gnl|my_center|LOCUS_15380 62466 63974 gene locus_tag LOCUS_15390 62466 63974 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803920.1 protein_id gnl|my_center|LOCUS_15390 64076 65494 gene locus_tag LOCUS_15400 64076 65494 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929836.1 protein_id gnl|my_center|LOCUS_15400 65491 66228 gene locus_tag LOCUS_15410 65491 66228 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803937.1 protein_id gnl|my_center|LOCUS_15410 66235 67461 gene locus_tag LOCUS_15420 66235 67461 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803945.1 protein_id gnl|my_center|LOCUS_15420 67458 68111 gene locus_tag LOCUS_15430 67458 68111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 68287 74253 gene locus_tag LOCUS_15440 68287 74253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 74384 74902 gene locus_tag LOCUS_15450 74384 74902 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930108.1 protein_id gnl|my_center|LOCUS_15450 74917 75945 gene locus_tag LOCUS_15460 74917 75945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 75961 77481 gene locus_tag LOCUS_15470 75961 77481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 77508 78920 gene locus_tag LOCUS_15480 77508 78920 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628934.1 protein_id gnl|my_center|LOCUS_15480 79047 80483 gene locus_tag LOCUS_15490 79047 80483 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730947.1 protein_id gnl|my_center|LOCUS_15490 80480 81259 gene locus_tag LOCUS_15500 80480 81259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 81252 82232 gene locus_tag LOCUS_15510 81252 82232 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158657585.1 protein_id gnl|my_center|LOCUS_15510 82457 85027 gene locus_tag LOCUS_15520 82457 85027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 86481 85054 gene locus_tag LOCUS_15530 86481 85054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 86565 90395 gene locus_tag LOCUS_15540 gene mfd 86565 90395 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028772.1 protein_id gnl|my_center|LOCUS_15540 90392 90922 gene locus_tag LOCUS_15550 90392 90922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 90919 91563 gene locus_tag LOCUS_15560 90919 91563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 91649 92410 gene locus_tag LOCUS_15570 91649 92410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15570 92442 93098 gene locus_tag LOCUS_15580 92442 93098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15580 93174 93548 gene locus_tag LOCUS_15590 93174 93548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 93987 94484 gene locus_tag LOCUS_15600 93987 94484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15600 94442 94621 gene locus_tag LOCUS_15610 94442 94621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15610 94994 95113 gene locus_tag LOCUS_15620 94994 95113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 95608 95757 gene locus_tag LOCUS_15630 95608 95757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence13 508 284 gene locus_tag LOCUS_15640 508 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 2205 1072 gene locus_tag LOCUS_15650 2205 1072 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462207.1 protein_id gnl|my_center|LOCUS_15650 4544 2241 gene locus_tag LOCUS_15660 4544 2241 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582619.1 protein_id gnl|my_center|LOCUS_15660 5281 4541 gene locus_tag LOCUS_15670 5281 4541 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088713.1 protein_id gnl|my_center|LOCUS_15670 6458 5295 gene locus_tag LOCUS_15680 6458 5295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803906.1 protein_id gnl|my_center|LOCUS_15680 7474 6449 gene locus_tag LOCUS_15690 7474 6449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 8087 7491 gene locus_tag LOCUS_15700 8087 7491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 9076 8084 gene locus_tag LOCUS_15710 9076 8084 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094336.1 protein_id gnl|my_center|LOCUS_15710 9270 10136 gene locus_tag LOCUS_15720 9270 10136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 10220 10879 gene locus_tag LOCUS_15730 10220 10879 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087865.1 protein_id gnl|my_center|LOCUS_15730 11695 10904 gene locus_tag LOCUS_15740 11695 10904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 12882 11869 gene locus_tag LOCUS_15750 12882 11869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 12963 13796 gene locus_tag LOCUS_15760 12963 13796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 14787 13804 gene locus_tag LOCUS_15770 14787 13804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 16625 14784 gene locus_tag LOCUS_15780 16625 14784 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_15780 17940 16696 gene locus_tag LOCUS_15790 17940 16696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 18500 18054 gene locus_tag LOCUS_15800 gene rplI 18500 18054 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975023.1 protein_id gnl|my_center|LOCUS_15800 18772 18536 gene locus_tag LOCUS_15810 gene rpsR 18772 18536 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777137.1 protein_id gnl|my_center|LOCUS_15810 19455 18844 gene locus_tag LOCUS_15820 19455 18844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 19818 19531 gene locus_tag LOCUS_15830 gene rpsF 19818 19531 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898321.1 protein_id gnl|my_center|LOCUS_15830 20481 20062 gene locus_tag LOCUS_15840 20481 20062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 20602 20859 gene locus_tag LOCUS_15850 20602 20859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 21495 20851 gene locus_tag LOCUS_15860 21495 20851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 22483 21479 gene locus_tag LOCUS_15870 22483 21479 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114555269.1 protein_id gnl|my_center|LOCUS_15870 23641 22676 gene locus_tag LOCUS_15880 23641 22676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 23750 24589 gene locus_tag LOCUS_15890 23750 24589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 25568 26395 gene locus_tag LOCUS_15900 25568 26395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 27925 26546 gene locus_tag LOCUS_15910 27925 26546 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029301.1 protein_id gnl|my_center|LOCUS_15910 30266 27981 gene locus_tag LOCUS_15920 30266 27981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 30522 31088 gene locus_tag LOCUS_15930 30522 31088 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975031.1 protein_id gnl|my_center|LOCUS_15930 31253 32344 gene locus_tag LOCUS_15940 31253 32344 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731620.1 protein_id gnl|my_center|LOCUS_15940 38975 32409 gene locus_tag LOCUS_15950 38975 32409 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193495474.1 protein_id gnl|my_center|LOCUS_15950 41464 38972 gene locus_tag LOCUS_15960 41464 38972 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776169.1 protein_id gnl|my_center|LOCUS_15960 42861 41461 gene locus_tag LOCUS_15970 42861 41461 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776170.1 protein_id gnl|my_center|LOCUS_15970 43907 42936 gene locus_tag LOCUS_15980 43907 42936 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929980.1 protein_id gnl|my_center|LOCUS_15980 44377 43982 gene locus_tag LOCUS_15990 44377 43982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 45046 44687 gene locus_tag LOCUS_16000 45046 44687 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193213.1 protein_id gnl|my_center|LOCUS_16000 45648 45361 gene locus_tag LOCUS_16010 45648 45361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 47251 46253 gene locus_tag LOCUS_16020 47251 46253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 47517 47200 gene locus_tag LOCUS_16030 47517 47200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 47719 48669 gene locus_tag LOCUS_16040 47719 48669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 48741 50234 gene locus_tag LOCUS_16050 48741 50234 CDS product IS1634-like element IS1549 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726646.1 protein_id gnl|my_center|LOCUS_16050 52426 50615 gene locus_tag LOCUS_16060 52426 50615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 54603 52426 gene locus_tag LOCUS_16070 54603 52426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 55379 54600 gene locus_tag LOCUS_16080 55379 54600 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776167.1 protein_id gnl|my_center|LOCUS_16080 57183 55609 gene locus_tag LOCUS_16090 57183 55609 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_16090 57298 57780 gene locus_tag LOCUS_16100 57298 57780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16100 57891 60158 gene locus_tag LOCUS_16110 57891 60158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 60233 62029 gene locus_tag LOCUS_16120 60233 62029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 62058 62849 gene locus_tag LOCUS_16130 62058 62849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 63034 64029 gene locus_tag LOCUS_16140 gene trxB 63034 64029 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975041.1 protein_id gnl|my_center|LOCUS_16140 64180 64506 gene locus_tag LOCUS_16150 gene trxA 64180 64506 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975042.1 protein_id gnl|my_center|LOCUS_16150 65601 64534 gene locus_tag LOCUS_16160 65601 64534 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863476.1 protein_id gnl|my_center|LOCUS_16160 66611 65598 gene locus_tag LOCUS_16170 66611 65598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 68293 67535 gene locus_tag LOCUS_16180 gene rsmG 68293 67535 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029291.1 protein_id gnl|my_center|LOCUS_16180 69407 68637 gene locus_tag LOCUS_16190 69407 68637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 70561 69470 gene locus_tag LOCUS_16200 70561 69470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 71054 70647 gene locus_tag LOCUS_16210 71054 70647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 71452 71054 gene locus_tag LOCUS_16220 gene rnpA 71452 71054 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296830.1 protein_id gnl|my_center|LOCUS_16220 71599 71462 gene locus_tag LOCUS_16230 gene rpmH 71599 71462 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975051.1 protein_id gnl|my_center|LOCUS_16230 72181 72657 gene locus_tag LOCUS_16240 72181 72657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 72962 73792 gene locus_tag LOCUS_16250 72962 73792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16250 73832 74146 gene locus_tag LOCUS_16260 73832 74146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 74265 75401 gene locus_tag LOCUS_16270 gene dnaN 74265 75401 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975054.1 protein_id gnl|my_center|LOCUS_16270 75541 76479 gene locus_tag LOCUS_16280 gene gnd 75541 76479 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221957.1 protein_id gnl|my_center|LOCUS_16280 76624 77922 gene locus_tag LOCUS_16290 gene recF 76624 77922 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975056.1 protein_id gnl|my_center|LOCUS_16290 77991 78593 gene locus_tag LOCUS_16300 77991 78593 CDS product DUF721 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087667.1 protein_id gnl|my_center|LOCUS_16300 78648 79529 gene locus_tag LOCUS_16310 78648 79529 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224290.1 protein_id gnl|my_center|LOCUS_16310 79895 79587 gene locus_tag LOCUS_16320 79895 79587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 79789 79989 gene locus_tag LOCUS_16330 79789 79989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 80334 80140 gene locus_tag LOCUS_16340 80334 80140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 80682 82850 gene locus_tag LOCUS_16350 gene gyrB 80682 82850 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803673.1 protein_id gnl|my_center|LOCUS_16350 82902 85613 gene locus_tag LOCUS_16360 gene gyrA 82902 85613 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326690.1 protein_id gnl|my_center|LOCUS_16360 86041 86394 gene locus_tag LOCUS_16370 86041 86394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 86516 86592 gene locus_tag LOCUS_t00230 86516 86592 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 86620 86757 gene locus_tag LOCUS_16380 86620 86757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 87001 87076 gene locus_tag LOCUS_t00240 87001 87076 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 87842 88447 gene locus_tag LOCUS_16390 87842 88447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16390 88342 88545 gene locus_tag LOCUS_16400 88342 88545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 88545 88952 gene locus_tag LOCUS_16410 88545 88952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 89969 90211 gene locus_tag LOCUS_16420 89969 90211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 90208 90630 gene locus_tag LOCUS_16430 90208 90630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 90955 91302 gene locus_tag LOCUS_16440 90955 91302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 91271 91723 gene locus_tag LOCUS_16450 91271 91723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 92020 92313 gene locus_tag LOCUS_16460 92020 92313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 >Feature sequence14 1152 646 gene locus_tag LOCUS_16470 1152 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 1823 1179 gene locus_tag LOCUS_16480 1823 1179 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082850.1 protein_id gnl|my_center|LOCUS_16480 2996 1830 gene locus_tag LOCUS_16490 gene dusB 2996 1830 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010147544.1 protein_id gnl|my_center|LOCUS_16490 3527 3084 gene locus_tag LOCUS_16500 3527 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 4280 3582 gene locus_tag LOCUS_16510 4280 3582 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804932.1 protein_id gnl|my_center|LOCUS_16510 4602 5606 gene locus_tag LOCUS_16520 4602 5606 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158657585.1 protein_id gnl|my_center|LOCUS_16520 5603 6343 gene locus_tag LOCUS_16530 5603 6343 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257978.1 protein_id gnl|my_center|LOCUS_16530 7761 6364 gene locus_tag LOCUS_16540 7761 6364 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228379.1 protein_id gnl|my_center|LOCUS_16540 7836 8141 gene locus_tag LOCUS_16550 7836 8141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 9036 8119 gene locus_tag LOCUS_16560 9036 8119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 9220 10137 gene locus_tag LOCUS_16570 9220 10137 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976297.1 protein_id gnl|my_center|LOCUS_16570 10128 10970 gene locus_tag LOCUS_16580 10128 10970 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028392.1 protein_id gnl|my_center|LOCUS_16580 10963 11973 gene locus_tag LOCUS_16590 10963 11973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 11970 12359 gene locus_tag LOCUS_16600 11970 12359 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007449657.1 protein_id gnl|my_center|LOCUS_16600 14246 12588 gene locus_tag LOCUS_16610 14246 12588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 15202 14336 gene locus_tag LOCUS_16620 15202 14336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 15409 15227 gene locus_tag LOCUS_16630 15409 15227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 15660 15971 gene locus_tag LOCUS_16640 15660 15971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 16968 15964 gene locus_tag LOCUS_16650 16968 15964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 17613 18347 gene locus_tag LOCUS_16660 17613 18347 CDS product ZIP family zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487390.1 protein_id gnl|my_center|LOCUS_16660 18980 18333 gene locus_tag LOCUS_16670 18980 18333 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027777.1 protein_id gnl|my_center|LOCUS_16670 19057 20505 gene locus_tag LOCUS_16680 19057 20505 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878083.1 protein_id gnl|my_center|LOCUS_16680 21308 20475 gene locus_tag LOCUS_16690 21308 20475 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775743.1 protein_id gnl|my_center|LOCUS_16690 22189 21374 gene locus_tag LOCUS_16700 gene recO 22189 21374 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863758.1 protein_id gnl|my_center|LOCUS_16700 22268 22900 gene locus_tag LOCUS_16710 22268 22900 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971839.1 protein_id gnl|my_center|LOCUS_16710 24673 22919 gene locus_tag LOCUS_16720 gene leuA 24673 22919 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930223.1 protein_id gnl|my_center|LOCUS_16720 24975 26123 gene locus_tag LOCUS_16730 24975 26123 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777031.1 protein_id gnl|my_center|LOCUS_16730 26946 26146 gene locus_tag LOCUS_16740 26946 26146 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228778.1 protein_id gnl|my_center|LOCUS_16740 26984 27580 gene locus_tag LOCUS_16750 26984 27580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 28551 27622 gene locus_tag LOCUS_16760 gene era 28551 27622 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326176.1 protein_id gnl|my_center|LOCUS_16760 29942 28551 gene locus_tag LOCUS_16770 29942 28551 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228398.1 protein_id gnl|my_center|LOCUS_16770 30414 29950 gene locus_tag LOCUS_16780 gene ybeY 30414 29950 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775754.1 protein_id gnl|my_center|LOCUS_16780 31571 30411 gene locus_tag LOCUS_16790 31571 30411 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_16790 31996 31652 gene locus_tag LOCUS_16800 31996 31652 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976256.1 protein_id gnl|my_center|LOCUS_16800 32788 32045 gene locus_tag LOCUS_16810 32788 32045 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110198.1 protein_id gnl|my_center|LOCUS_16810 33956 32826 gene locus_tag LOCUS_16820 gene dnaJ 33956 32826 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976250.1 protein_id gnl|my_center|LOCUS_16820 35048 34008 gene locus_tag LOCUS_16830 gene hrcA 35048 34008 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 protein_id gnl|my_center|LOCUS_16830 35204 36058 gene locus_tag LOCUS_16840 35204 36058 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728763.1 protein_id gnl|my_center|LOCUS_16840 37298 36075 gene locus_tag LOCUS_16850 gene hemW 37298 36075 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326185.1 protein_id gnl|my_center|LOCUS_16850 37853 38671 gene locus_tag LOCUS_16860 37853 38671 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079758.1 protein_id gnl|my_center|LOCUS_16860 40603 38747 gene locus_tag LOCUS_16870 gene lepA 40603 38747 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083190386.1 protein_id gnl|my_center|LOCUS_16870 40754 41323 gene locus_tag LOCUS_16880 40754 41323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 41395 41721 gene locus_tag LOCUS_16890 41395 41721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 42061 41801 gene locus_tag LOCUS_16900 gene rpsT 42061 41801 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775769.1 protein_id gnl|my_center|LOCUS_16900 42254 43087 gene locus_tag LOCUS_16910 42254 43087 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223699.1 protein_id gnl|my_center|LOCUS_16910 44148 43177 gene locus_tag LOCUS_16920 gene holA 44148 43177 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485035.1 protein_id gnl|my_center|LOCUS_16920 44182 45549 gene locus_tag LOCUS_16930 44182 45549 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205737.1 protein_id gnl|my_center|LOCUS_16930 47911 45587 gene locus_tag LOCUS_16940 47911 45587 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229470.1 protein_id gnl|my_center|LOCUS_16940 47938 49191 gene locus_tag LOCUS_16950 47938 49191 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222135.1 protein_id gnl|my_center|LOCUS_16950 50579 49239 gene locus_tag LOCUS_16960 50579 49239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 53407 50699 gene locus_tag LOCUS_16970 53407 50699 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_16970 54573 53467 gene locus_tag LOCUS_16980 54573 53467 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110218.1 protein_id gnl|my_center|LOCUS_16980 55048 54539 gene locus_tag LOCUS_16990 55048 54539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 56519 55062 gene locus_tag LOCUS_17000 gene hflX 56519 55062 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030461.1 protein_id gnl|my_center|LOCUS_17000 57274 56573 gene locus_tag LOCUS_17010 57274 56573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 57273 57944 gene locus_tag LOCUS_17020 57273 57944 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389654.1 protein_id gnl|my_center|LOCUS_17020 58812 57934 gene locus_tag LOCUS_17030 gene dapF 58812 57934 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804680.1 protein_id gnl|my_center|LOCUS_17030 59764 58817 gene locus_tag LOCUS_17040 gene miaA 59764 58817 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030456.1 protein_id gnl|my_center|LOCUS_17040 60402 59761 gene locus_tag LOCUS_17050 60402 59761 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230292.1 protein_id gnl|my_center|LOCUS_17050 62086 60422 gene locus_tag LOCUS_17060 gene miaB 62086 60422 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930170.1 protein_id gnl|my_center|LOCUS_17060 63096 62401 gene locus_tag LOCUS_17070 63096 62401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 64151 63111 gene locus_tag LOCUS_17080 gene recA 64151 63111 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224217.1 protein_id gnl|my_center|LOCUS_17080 64546 65826 gene locus_tag LOCUS_17090 64546 65826 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852462.1 protein_id gnl|my_center|LOCUS_17090 66094 65873 gene locus_tag LOCUS_17100 66094 65873 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728536.1 protein_id gnl|my_center|LOCUS_17100 66281 71038 gene locus_tag LOCUS_17110 66281 71038 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109508967.1 protein_id gnl|my_center|LOCUS_17110 71045 71971 gene locus_tag LOCUS_17120 71045 71971 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030437.1 protein_id gnl|my_center|LOCUS_17120 73140 71956 gene locus_tag LOCUS_17130 73140 71956 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038888.1 protein_id gnl|my_center|LOCUS_17130 73576 73169 gene locus_tag LOCUS_17140 73576 73169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 74125 73592 gene locus_tag LOCUS_17150 74125 73592 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228067.1 protein_id gnl|my_center|LOCUS_17150 74853 74125 gene locus_tag LOCUS_17160 gene pgsA 74853 74125 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894077.1 protein_id gnl|my_center|LOCUS_17160 76286 74850 gene locus_tag LOCUS_17170 gene rimO 76286 74850 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973272.1 protein_id gnl|my_center|LOCUS_17170 78881 76434 gene locus_tag LOCUS_17180 78881 76434 CDS product immune inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028663.1 protein_id gnl|my_center|LOCUS_17180 81677 79128 gene locus_tag LOCUS_17190 81677 79128 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929902.1 protein_id gnl|my_center|LOCUS_17190 81730 81966 gene locus_tag LOCUS_17200 81730 81966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 82155 83558 gene locus_tag LOCUS_17210 82155 83558 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224833.1 protein_id gnl|my_center|LOCUS_17210 83958 83566 gene locus_tag LOCUS_17220 83958 83566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 84502 84104 gene locus_tag LOCUS_17230 84502 84104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 85487 84624 gene locus_tag LOCUS_17240 85487 84624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 87257 85572 gene locus_tag LOCUS_17250 87257 85572 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973282.1 protein_id gnl|my_center|LOCUS_17250 88141 87254 gene locus_tag LOCUS_17260 gene dapA 88141 87254 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804668.1 protein_id gnl|my_center|LOCUS_17260 88316 89125 gene locus_tag LOCUS_17270 88316 89125 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969714.1 protein_id gnl|my_center|LOCUS_17270 89122 89613 gene locus_tag LOCUS_17280 89122 89613 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189313.1 protein_id gnl|my_center|LOCUS_17280 90716 89601 gene locus_tag LOCUS_17290 gene paaK 90716 89601 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083203.1 protein_id gnl|my_center|LOCUS_17290 91262 90717 gene locus_tag LOCUS_17300 gene paaJ 91262 90717 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551025.1 protein_id gnl|my_center|LOCUS_17300 92041 91274 gene locus_tag LOCUS_17310 gene paaC 92041 91274 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329397.1 protein_id gnl|my_center|LOCUS_17310 >Feature sequence15 198 1886 gene locus_tag LOCUS_17320 198 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17320 2032 2928 gene locus_tag LOCUS_17330 2032 2928 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707194.1 protein_id gnl|my_center|LOCUS_17330 2925 3827 gene locus_tag LOCUS_17340 2925 3827 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222022.1 protein_id gnl|my_center|LOCUS_17340 3824 4861 gene locus_tag LOCUS_17350 3824 4861 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028819.1 protein_id gnl|my_center|LOCUS_17350 4923 5732 gene locus_tag LOCUS_17360 4923 5732 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222024.1 protein_id gnl|my_center|LOCUS_17360 5836 7980 gene locus_tag LOCUS_17370 gene malQ 5836 7980 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804935.1 protein_id gnl|my_center|LOCUS_17370 8289 8008 gene locus_tag LOCUS_17380 8289 8008 CDS product YciI-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330126.1 protein_id gnl|my_center|LOCUS_17380 9238 8360 gene locus_tag LOCUS_17390 9238 8360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 11145 9439 gene locus_tag LOCUS_17400 11145 9439 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350815.1 protein_id gnl|my_center|LOCUS_17400 12837 11197 gene locus_tag LOCUS_17410 12837 11197 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777012.1 protein_id gnl|my_center|LOCUS_17410 12946 13539 gene locus_tag LOCUS_17420 12946 13539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 13564 14040 gene locus_tag LOCUS_17430 13564 14040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 14140 15474 gene locus_tag LOCUS_17440 14140 15474 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973184.1 protein_id gnl|my_center|LOCUS_17440 15471 16898 gene locus_tag LOCUS_17450 15471 16898 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030488.1 protein_id gnl|my_center|LOCUS_17450 16909 17469 gene locus_tag LOCUS_17460 16909 17469 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037783.1 protein_id gnl|my_center|LOCUS_17460 18315 17506 gene locus_tag LOCUS_17470 gene hisN 18315 17506 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973764.1 protein_id gnl|my_center|LOCUS_17470 18786 18358 gene locus_tag LOCUS_17480 18786 18358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 19897 18848 gene locus_tag LOCUS_17490 gene rsgA 19897 18848 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973761.1 protein_id gnl|my_center|LOCUS_17490 21165 19894 gene locus_tag LOCUS_17500 gene aroA 21165 19894 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973760.1 protein_id gnl|my_center|LOCUS_17500 21626 21162 gene locus_tag LOCUS_17510 21626 21162 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230942.1 protein_id gnl|my_center|LOCUS_17510 21661 22563 gene locus_tag LOCUS_17520 21661 22563 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030116.1 protein_id gnl|my_center|LOCUS_17520 22560 23243 gene locus_tag LOCUS_17530 22560 23243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 23354 24175 gene locus_tag LOCUS_17540 23354 24175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 24172 24450 gene locus_tag LOCUS_17550 24172 24450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 25094 25240 gene locus_tag LOCUS_17560 25094 25240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 25322 25492 gene locus_tag LOCUS_17570 25322 25492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 25545 26957 gene locus_tag LOCUS_17580 25545 26957 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030117.1 protein_id gnl|my_center|LOCUS_17580 26990 28291 gene locus_tag LOCUS_17590 26990 28291 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495247.1 protein_id gnl|my_center|LOCUS_17590 28777 28376 gene locus_tag LOCUS_17600 gene sodN 28777 28376 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 protein_id gnl|my_center|LOCUS_17600 29239 28886 gene locus_tag LOCUS_17610 29239 28886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 29848 29258 gene locus_tag LOCUS_17620 29848 29258 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229701.1 protein_id gnl|my_center|LOCUS_17620 30726 29848 gene locus_tag LOCUS_17630 gene rfbA 30726 29848 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103413.1 protein_id gnl|my_center|LOCUS_17630 30783 31628 gene locus_tag LOCUS_17640 gene rfbD 30783 31628 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_17640 31772 32500 gene locus_tag LOCUS_17650 31772 32500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 34428 32809 gene locus_tag LOCUS_17660 34428 32809 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029952.1 protein_id gnl|my_center|LOCUS_17660 34519 35307 gene locus_tag LOCUS_17670 34519 35307 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029953.1 protein_id gnl|my_center|LOCUS_17670 35365 36654 gene locus_tag LOCUS_17680 35365 36654 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223470.1 protein_id gnl|my_center|LOCUS_17680 36651 37445 gene locus_tag LOCUS_17690 36651 37445 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029956.1 protein_id gnl|my_center|LOCUS_17690 37474 38154 gene locus_tag LOCUS_17700 37474 38154 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975748.1 protein_id gnl|my_center|LOCUS_17700 38176 39228 gene locus_tag LOCUS_17710 38176 39228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 39737 39243 gene locus_tag LOCUS_17720 39737 39243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 39831 41006 gene locus_tag LOCUS_17730 39831 41006 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975751.1 protein_id gnl|my_center|LOCUS_17730 41056 41577 gene locus_tag LOCUS_17740 gene purE 41056 41577 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776122.1 protein_id gnl|my_center|LOCUS_17740 42074 41625 gene locus_tag LOCUS_17750 42074 41625 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027708.1 protein_id gnl|my_center|LOCUS_17750 42155 43174 gene locus_tag LOCUS_17760 42155 43174 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897127.1 protein_id gnl|my_center|LOCUS_17760 43197 44090 gene locus_tag LOCUS_17770 43197 44090 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727261.1 protein_id gnl|my_center|LOCUS_17770 44187 45353 gene locus_tag LOCUS_17780 44187 45353 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132624759.1 protein_id gnl|my_center|LOCUS_17780 45439 47265 gene locus_tag LOCUS_17790 45439 47265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 48232 47282 gene locus_tag LOCUS_17800 48232 47282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17800 48804 50003 gene locus_tag LOCUS_17810 gene glf 48804 50003 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776101.1 protein_id gnl|my_center|LOCUS_17810 50000 52090 gene locus_tag LOCUS_17820 50000 52090 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776100.1 protein_id gnl|my_center|LOCUS_17820 52087 52974 gene locus_tag LOCUS_17830 52087 52974 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112141.1 protein_id gnl|my_center|LOCUS_17830 52974 53708 gene locus_tag LOCUS_17840 52974 53708 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776098.1 protein_id gnl|my_center|LOCUS_17840 53705 54229 gene locus_tag LOCUS_17850 53705 54229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 54226 55068 gene locus_tag LOCUS_17860 54226 55068 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932599.1 protein_id gnl|my_center|LOCUS_17860 55173 55946 gene locus_tag LOCUS_17870 55173 55946 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031119.1 protein_id gnl|my_center|LOCUS_17870 55950 56588 gene locus_tag LOCUS_17880 55950 56588 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031118.1 protein_id gnl|my_center|LOCUS_17880 57326 56598 gene locus_tag LOCUS_17890 57326 56598 CDS product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975771.1 protein_id gnl|my_center|LOCUS_17890 57350 58288 gene locus_tag LOCUS_17900 57350 58288 CDS product DNA-3-methyladenine glycosylase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139979125.1 protein_id gnl|my_center|LOCUS_17900 59473 58355 gene locus_tag LOCUS_17910 gene cofE 59473 58355 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776096.1 protein_id gnl|my_center|LOCUS_17910 60447 59470 gene locus_tag LOCUS_17920 gene cofD 60447 59470 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975775.1 protein_id gnl|my_center|LOCUS_17920 60856 61119 gene locus_tag LOCUS_17930 60856 61119 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091761302.1 protein_id gnl|my_center|LOCUS_17930 61183 64482 gene locus_tag LOCUS_17940 61183 64482 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028725.1 protein_id gnl|my_center|LOCUS_17940 64479 65948 gene locus_tag LOCUS_17950 64479 65948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 66327 65986 gene locus_tag LOCUS_17960 66327 65986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 66521 66904 gene locus_tag LOCUS_17970 66521 66904 CDS product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975781.1 protein_id gnl|my_center|LOCUS_17970 66961 68256 gene locus_tag LOCUS_17980 66961 68256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 68259 69482 gene locus_tag LOCUS_17990 68259 69482 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975785.1 protein_id gnl|my_center|LOCUS_17990 71189 69567 gene locus_tag LOCUS_18000 71189 69567 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_18000 72367 71189 gene locus_tag LOCUS_18010 72367 71189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 73637 72384 gene locus_tag LOCUS_18020 gene porA 73637 72384 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020091.1 protein_id gnl|my_center|LOCUS_18020 74229 73621 gene locus_tag LOCUS_18030 74229 73621 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_18030 74310 75269 gene locus_tag LOCUS_18040 74310 75269 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891984.1 protein_id gnl|my_center|LOCUS_18040 75232 76260 gene locus_tag LOCUS_18050 75232 76260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 76419 77882 gene locus_tag LOCUS_18060 gene ahcY 76419 77882 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229742.1 protein_id gnl|my_center|LOCUS_18060 78231 78908 gene locus_tag LOCUS_18070 gene mtrA 78231 78908 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975799.1 protein_id gnl|my_center|LOCUS_18070 78912 80627 gene locus_tag LOCUS_18080 gene mtrB 78912 80627 CDS product two-component system sensor histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028715.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18080 80723 82507 gene locus_tag LOCUS_18090 80723 82507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 82631 83401 gene locus_tag LOCUS_18100 82631 83401 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028713.1 protein_id gnl|my_center|LOCUS_18100 83515 84129 gene locus_tag LOCUS_18110 gene raiA 83515 84129 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776077.1 protein_id gnl|my_center|LOCUS_18110 84134 84877 gene locus_tag LOCUS_18120 84134 84877 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_18120 84881 86134 gene locus_tag LOCUS_18130 84881 86134 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921155.1 protein_id gnl|my_center|LOCUS_18130 86139 87479 gene locus_tag LOCUS_18140 86139 87479 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223123.1 protein_id gnl|my_center|LOCUS_18140 87546 88547 gene locus_tag LOCUS_18150 87546 88547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 89686 88544 gene locus_tag LOCUS_18160 89686 88544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 >Feature sequence16 2312 636 gene locus_tag LOCUS_18170 2312 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 3253 2309 gene locus_tag LOCUS_18180 3253 2309 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225923.1 protein_id gnl|my_center|LOCUS_18180 4725 3250 gene locus_tag LOCUS_18190 gene crtI 4725 3250 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026910.1 protein_id gnl|my_center|LOCUS_18190 5885 4722 gene locus_tag LOCUS_18200 gene idsA 5885 4722 CDS product geranylgeranyl pyrophosphate synthase IdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856555.1 protein_id gnl|my_center|LOCUS_18200 6553 5882 gene locus_tag LOCUS_18210 gene idi 6553 5882 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804097.1 protein_id gnl|my_center|LOCUS_18210 6666 7259 gene locus_tag LOCUS_18220 6666 7259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 7222 7296 gene locus_tag LOCUS_t00250 7222 7296 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8174 7584 gene locus_tag LOCUS_18230 8174 7584 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229780.1 protein_id gnl|my_center|LOCUS_18230 8590 8865 gene locus_tag LOCUS_18240 8590 8865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 9569 8874 gene locus_tag LOCUS_18250 9569 8874 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385544.1 protein_id gnl|my_center|LOCUS_18250 10362 9589 gene locus_tag LOCUS_18260 10362 9589 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226368.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18260 10614 10877 gene locus_tag LOCUS_18270 10614 10877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 11798 11010 gene locus_tag LOCUS_18280 11798 11010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 12850 12098 gene locus_tag LOCUS_18290 12850 12098 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029385.1 protein_id gnl|my_center|LOCUS_18290 12871 14235 gene locus_tag LOCUS_18300 12871 14235 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230152.1 protein_id gnl|my_center|LOCUS_18300 14374 14940 gene locus_tag LOCUS_18310 14374 14940 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088503.1 protein_id gnl|my_center|LOCUS_18310 16387 15125 gene locus_tag LOCUS_18320 16387 15125 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064985.1 protein_id gnl|my_center|LOCUS_18320 17409 16726 gene locus_tag LOCUS_18330 gene pdxH 17409 16726 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814302.1 protein_id gnl|my_center|LOCUS_18330 17461 17868 gene locus_tag LOCUS_18340 17461 17868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 17971 19116 gene locus_tag LOCUS_18350 17971 19116 CDS product citrate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029624.1 protein_id gnl|my_center|LOCUS_18350 19971 19210 gene locus_tag LOCUS_18360 19971 19210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 20156 21277 gene locus_tag LOCUS_18370 gene serC 20156 21277 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174401615.1 protein_id gnl|my_center|LOCUS_18370 23114 21591 gene locus_tag LOCUS_18380 23114 21591 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804962.1 protein_id gnl|my_center|LOCUS_18380 23446 23694 gene locus_tag LOCUS_18390 23446 23694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 24573 23635 gene locus_tag LOCUS_18400 24573 23635 CDS product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776598.1 protein_id gnl|my_center|LOCUS_18400 24968 24573 gene locus_tag LOCUS_18410 24968 24573 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776599.1 protein_id gnl|my_center|LOCUS_18410 25079 27430 gene locus_tag LOCUS_18420 25079 27430 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230251.1 protein_id gnl|my_center|LOCUS_18420 28445 27471 gene locus_tag LOCUS_18430 28445 27471 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028581.1 protein_id gnl|my_center|LOCUS_18430 28547 29575 gene locus_tag LOCUS_18440 28547 29575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 29579 31213 gene locus_tag LOCUS_18450 29579 31213 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063651.1 protein_id gnl|my_center|LOCUS_18450 31256 31543 gene locus_tag LOCUS_18460 31256 31543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 31540 31965 gene locus_tag LOCUS_18470 31540 31965 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898500.1 protein_id gnl|my_center|LOCUS_18470 32712 31975 gene locus_tag LOCUS_18480 32712 31975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 33095 34513 gene locus_tag LOCUS_18490 33095 34513 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727104.1 protein_id gnl|my_center|LOCUS_18490 35536 34601 gene locus_tag LOCUS_18500 35536 34601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 35673 36989 gene locus_tag LOCUS_18510 35673 36989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 37661 39796 gene locus_tag LOCUS_18520 37661 39796 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029575.1 protein_id gnl|my_center|LOCUS_18520 39860 40531 gene locus_tag LOCUS_18530 39860 40531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974662.1 protein_id gnl|my_center|LOCUS_18530 41315 40554 gene locus_tag LOCUS_18540 41315 40554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 41782 41372 gene locus_tag LOCUS_18550 41782 41372 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037733.1 protein_id gnl|my_center|LOCUS_18550 42033 42320 gene locus_tag LOCUS_18560 42033 42320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 44453 42762 gene locus_tag LOCUS_18570 gene groL 44453 42762 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974678.1 protein_id gnl|my_center|LOCUS_18570 45821 44619 gene locus_tag LOCUS_18580 45821 44619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18580 47023 45818 gene locus_tag LOCUS_18590 47023 45818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 48402 47080 gene locus_tag LOCUS_18600 48402 47080 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036327.1 protein_id gnl|my_center|LOCUS_18600 49357 48545 gene locus_tag LOCUS_18610 49357 48545 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776999.1 protein_id gnl|my_center|LOCUS_18610 49356 50240 gene locus_tag LOCUS_18620 gene fdhD 49356 50240 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876561.1 protein_id gnl|my_center|LOCUS_18620 50645 50199 gene locus_tag LOCUS_18630 50645 50199 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979519.1 protein_id gnl|my_center|LOCUS_18630 50837 52108 gene locus_tag LOCUS_18640 50837 52108 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098430.1 protein_id gnl|my_center|LOCUS_18640 52130 52432 gene locus_tag LOCUS_18650 52130 52432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 52729 53055 gene locus_tag LOCUS_18660 52729 53055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 53292 54548 gene locus_tag LOCUS_18670 53292 54548 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265565.1 protein_id gnl|my_center|LOCUS_18670 54564 54851 gene locus_tag LOCUS_18680 54564 54851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 54863 55189 gene locus_tag LOCUS_18690 54863 55189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 55599 55312 gene locus_tag LOCUS_18700 55599 55312 CDS product DUF3263 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230291.1 protein_id gnl|my_center|LOCUS_18700 55857 57512 gene locus_tag LOCUS_18710 55857 57512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 58339 57671 gene locus_tag LOCUS_18720 58339 57671 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393503.1 protein_id gnl|my_center|LOCUS_18720 58901 58422 gene locus_tag LOCUS_18730 58901 58422 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779558.1 protein_id gnl|my_center|LOCUS_18730 59073 60095 gene locus_tag LOCUS_18740 59073 60095 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229676.1 protein_id gnl|my_center|LOCUS_18740 60199 60876 gene locus_tag LOCUS_18750 60199 60876 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223644.1 protein_id gnl|my_center|LOCUS_18750 60873 61727 gene locus_tag LOCUS_18760 60873 61727 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230311.1 protein_id gnl|my_center|LOCUS_18760 63821 61749 gene locus_tag LOCUS_18770 63821 61749 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876865.1 protein_id gnl|my_center|LOCUS_18770 63953 64516 gene locus_tag LOCUS_18780 63953 64516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 64609 65760 gene locus_tag LOCUS_18790 64609 65760 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891441.1 protein_id gnl|my_center|LOCUS_18790 65765 66529 gene locus_tag LOCUS_18800 65765 66529 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225704.1 protein_id gnl|my_center|LOCUS_18800 66989 67555 gene locus_tag LOCUS_18810 66989 67555 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225162.1 protein_id gnl|my_center|LOCUS_18810 67552 68826 gene locus_tag LOCUS_18820 67552 68826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 68949 69665 gene locus_tag LOCUS_18830 68949 69665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 70765 69698 gene locus_tag LOCUS_18840 70765 69698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 70793 71446 gene locus_tag LOCUS_18850 70793 71446 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228809.1 protein_id gnl|my_center|LOCUS_18850 71443 72207 gene locus_tag LOCUS_18860 71443 72207 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228811.1 protein_id gnl|my_center|LOCUS_18860 72319 72999 gene locus_tag LOCUS_18870 72319 72999 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727024.1 protein_id gnl|my_center|LOCUS_18870 74655 73027 gene locus_tag LOCUS_18880 74655 73027 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229798.1 protein_id gnl|my_center|LOCUS_18880 75884 74652 gene locus_tag LOCUS_18890 75884 74652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18890 76458 75784 gene locus_tag LOCUS_18900 76458 75784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18900 77580 76504 gene locus_tag LOCUS_18910 77580 76504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 77644 78441 gene locus_tag LOCUS_18920 77644 78441 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402248.1 protein_id gnl|my_center|LOCUS_18920 78525 79448 gene locus_tag LOCUS_18930 78525 79448 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102581.1 protein_id gnl|my_center|LOCUS_18930 79606 80871 gene locus_tag LOCUS_18940 79606 80871 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728185.1 protein_id gnl|my_center|LOCUS_18940 81035 80962 gene locus_tag LOCUS_t00260 81035 80962 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 81009 81743 gene locus_tag LOCUS_18950 81009 81743 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080357.1 protein_id gnl|my_center|LOCUS_18950 81886 83424 gene locus_tag LOCUS_18960 81886 83424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 85345 83747 gene locus_tag LOCUS_18970 85345 83747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 85250 85492 gene locus_tag LOCUS_18980 85250 85492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 85909 85784 gene locus_tag LOCUS_18990 85909 85784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 86725 86420 gene locus_tag LOCUS_19000 86725 86420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19000 >Feature sequence17 805 461 gene locus_tag LOCUS_19010 805 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 2792 2655 gene locus_tag LOCUS_19020 2792 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 4358 4786 gene locus_tag LOCUS_19030 4358 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19030 5963 6136 gene locus_tag LOCUS_19040 5963 6136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 6270 7091 gene locus_tag LOCUS_19050 6270 7091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19050 7031 7354 gene locus_tag LOCUS_19060 7031 7354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19060 7408 8268 gene locus_tag LOCUS_19070 7408 8268 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085410.1 protein_id gnl|my_center|LOCUS_19070 8286 8744 gene locus_tag LOCUS_19080 8286 8744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 9783 8791 gene locus_tag LOCUS_19090 9783 8791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 10208 9786 gene locus_tag LOCUS_19100 10208 9786 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222521.1 protein_id gnl|my_center|LOCUS_19100 10313 10843 gene locus_tag LOCUS_19110 10313 10843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 10850 11662 gene locus_tag LOCUS_19120 10850 11662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 11702 12913 gene locus_tag LOCUS_19130 gene coaE 11702 12913 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088698.1 protein_id gnl|my_center|LOCUS_19130 12906 13658 gene locus_tag LOCUS_19140 12906 13658 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970319.1 protein_id gnl|my_center|LOCUS_19140 14473 13685 gene locus_tag LOCUS_19150 14473 13685 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401627.1 protein_id gnl|my_center|LOCUS_19150 14478 16700 gene locus_tag LOCUS_19160 gene uvrB 14478 16700 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028069.1 protein_id gnl|my_center|LOCUS_19160 16762 17856 gene locus_tag LOCUS_19170 16762 17856 CDS product calcium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106297146.1 protein_id gnl|my_center|LOCUS_19170 17950 18219 gene locus_tag LOCUS_19180 17950 18219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 18216 20168 gene locus_tag LOCUS_19190 gene feoB 18216 20168 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948746.1 protein_id gnl|my_center|LOCUS_19190 20165 20473 gene locus_tag LOCUS_19200 20165 20473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 20490 21365 gene locus_tag LOCUS_19210 20490 21365 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974609.1 protein_id gnl|my_center|LOCUS_19210 22436 21393 gene locus_tag LOCUS_19220 22436 21393 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113122.1 protein_id gnl|my_center|LOCUS_19220 22856 22506 gene locus_tag LOCUS_19230 22856 22506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 22931 23707 gene locus_tag LOCUS_19240 22931 23707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 25351 23729 gene locus_tag LOCUS_19250 25351 23729 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029859.1 protein_id gnl|my_center|LOCUS_19250 25537 27093 gene locus_tag LOCUS_19260 25537 27093 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405217.1 protein_id gnl|my_center|LOCUS_19260 27099 29162 gene locus_tag LOCUS_19270 27099 29162 CDS product serine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259150.1 protein_id gnl|my_center|LOCUS_19270 29242 30090 gene locus_tag LOCUS_19280 29242 30090 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079986.1 protein_id gnl|my_center|LOCUS_19280 30114 30974 gene locus_tag LOCUS_19290 30114 30974 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250368.1 protein_id gnl|my_center|LOCUS_19290 31220 31056 gene locus_tag LOCUS_19300 31220 31056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 31655 31497 gene locus_tag LOCUS_19310 31655 31497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 31982 31737 gene locus_tag LOCUS_19320 31982 31737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 32727 32062 gene locus_tag LOCUS_19330 32727 32062 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805114.1 protein_id gnl|my_center|LOCUS_19330 33636 32731 gene locus_tag LOCUS_19340 33636 32731 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222689.1 protein_id gnl|my_center|LOCUS_19340 33518 36610 gene locus_tag LOCUS_19350 gene uvrA 33518 36610 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028066.1 protein_id gnl|my_center|LOCUS_19350 36607 37506 gene locus_tag LOCUS_19360 36607 37506 CDS product streptomycin 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729101.1 protein_id gnl|my_center|LOCUS_19360 37663 39066 gene locus_tag LOCUS_19370 37663 39066 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226873.1 protein_id gnl|my_center|LOCUS_19370 39819 39109 gene locus_tag LOCUS_19380 39819 39109 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028095.1 protein_id gnl|my_center|LOCUS_19380 40733 39816 gene locus_tag LOCUS_19390 40733 39816 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976806.1 protein_id gnl|my_center|LOCUS_19390 42460 40730 gene locus_tag LOCUS_19400 42460 40730 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028094.1 protein_id gnl|my_center|LOCUS_19400 43380 42457 gene locus_tag LOCUS_19410 43380 42457 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028093.1 protein_id gnl|my_center|LOCUS_19410 44732 43521 gene locus_tag LOCUS_19420 44732 43521 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976809.1 protein_id gnl|my_center|LOCUS_19420 45001 45423 gene locus_tag LOCUS_19430 45001 45423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 45568 47583 gene locus_tag LOCUS_19440 gene uvrC 45568 47583 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831611.1 protein_id gnl|my_center|LOCUS_19440 47629 48594 gene locus_tag LOCUS_19450 gene rapZ 47629 48594 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_19450 48601 49542 gene locus_tag LOCUS_19460 gene yvcK 48601 49542 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028061.1 protein_id gnl|my_center|LOCUS_19460 49657 50637 gene locus_tag LOCUS_19470 gene whiA 49657 50637 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976869.1 protein_id gnl|my_center|LOCUS_19470 50957 51961 gene locus_tag LOCUS_19480 gene gap 50957 51961 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_19480 52006 53220 gene locus_tag LOCUS_19490 52006 53220 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224667.1 protein_id gnl|my_center|LOCUS_19490 53217 54014 gene locus_tag LOCUS_19500 gene tpiA 53217 54014 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 protein_id gnl|my_center|LOCUS_19500 54070 54960 gene locus_tag LOCUS_19510 54070 54960 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728951.1 protein_id gnl|my_center|LOCUS_19510 55102 55350 gene locus_tag LOCUS_19520 gene secG 55102 55350 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115170.1 protein_id gnl|my_center|LOCUS_19520 55367 55717 gene locus_tag LOCUS_19530 55367 55717 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976875.1 protein_id gnl|my_center|LOCUS_19530 56510 55749 gene locus_tag LOCUS_19540 gene pgl 56510 55749 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976879.1 protein_id gnl|my_center|LOCUS_19540 57547 56507 gene locus_tag LOCUS_19550 gene opcA 57547 56507 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224673.1 protein_id gnl|my_center|LOCUS_19550 58995 57544 gene locus_tag LOCUS_19560 gene zwf 58995 57544 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728813.1 protein_id gnl|my_center|LOCUS_19560 60197 59082 gene locus_tag LOCUS_19570 gene tal 60197 59082 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407447.1 protein_id gnl|my_center|LOCUS_19570 62398 60194 gene locus_tag LOCUS_19580 gene tkt 62398 60194 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167022841.1 protein_id gnl|my_center|LOCUS_19580 62540 63532 gene locus_tag LOCUS_19590 62540 63532 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976885.1 protein_id gnl|my_center|LOCUS_19590 64134 63559 gene locus_tag LOCUS_19600 64134 63559 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480348.1 protein_id gnl|my_center|LOCUS_19600 65110 64208 gene locus_tag LOCUS_19610 65110 64208 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897656.1 protein_id gnl|my_center|LOCUS_19610 65933 65187 gene locus_tag LOCUS_19620 65933 65187 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805060.1 protein_id gnl|my_center|LOCUS_19620 66628 65930 gene locus_tag LOCUS_19630 66628 65930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 66717 67445 gene locus_tag LOCUS_19640 66717 67445 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742174.1 protein_id gnl|my_center|LOCUS_19640 67442 69988 gene locus_tag LOCUS_19650 67442 69988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 69988 71358 gene locus_tag LOCUS_19660 69988 71358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 71345 71596 gene locus_tag LOCUS_19670 71345 71596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 71593 71799 gene locus_tag LOCUS_19680 71593 71799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19680 71717 71992 gene locus_tag LOCUS_19690 71717 71992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19690 71980 72348 gene locus_tag LOCUS_19700 71980 72348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19700 72360 73181 gene locus_tag LOCUS_19710 72360 73181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19710 73094 73729 gene locus_tag LOCUS_19720 73094 73729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19720 73874 74170 gene locus_tag LOCUS_19730 73874 74170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19730 74167 74967 gene locus_tag LOCUS_19740 74167 74967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 75459 75671 gene locus_tag LOCUS_19750 75459 75671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 77087 76761 gene locus_tag LOCUS_19760 77087 76761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 78185 77826 gene locus_tag LOCUS_19770 78185 77826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19770 78737 78306 gene locus_tag LOCUS_19780 78737 78306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19780 78876 79130 gene locus_tag LOCUS_19790 78876 79130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 >Feature sequence18 2981 336 gene locus_tag LOCUS_19800 2981 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 4748 3060 gene locus_tag LOCUS_19810 4748 3060 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230221.1 protein_id gnl|my_center|LOCUS_19810 8517 4894 gene locus_tag LOCUS_19820 8517 4894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 8987 8517 gene locus_tag LOCUS_19830 8987 8517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 10036 8984 gene locus_tag LOCUS_19840 10036 8984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 12113 10218 gene locus_tag LOCUS_19850 12113 10218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 12400 12819 gene locus_tag LOCUS_19860 12400 12819 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777009.1 protein_id gnl|my_center|LOCUS_19860 14427 12931 gene locus_tag LOCUS_19870 14427 12931 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969731.1 protein_id gnl|my_center|LOCUS_19870 15069 14431 gene locus_tag LOCUS_19880 15069 14431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 16102 15071 gene locus_tag LOCUS_19890 16102 15071 CDS product tripartite tricarboxylate transporter substrate binding protein BugD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969733.1 protein_id gnl|my_center|LOCUS_19890 17838 16249 gene locus_tag LOCUS_19900 17838 16249 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804270.1 protein_id gnl|my_center|LOCUS_19900 18518 17835 gene locus_tag LOCUS_19910 18518 17835 CDS product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079604.1 protein_id gnl|my_center|LOCUS_19910 19282 18710 gene locus_tag LOCUS_19920 19282 18710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 20091 19285 gene locus_tag LOCUS_19930 20091 19285 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223917.1 protein_id gnl|my_center|LOCUS_19930 20142 20918 gene locus_tag LOCUS_19940 20142 20918 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940907.1 protein_id gnl|my_center|LOCUS_19940 21148 23445 gene locus_tag LOCUS_19950 21148 23445 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189742800.1 protein_id gnl|my_center|LOCUS_19950 23598 24737 gene locus_tag LOCUS_19960 23598 24737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 24734 25450 gene locus_tag LOCUS_19970 24734 25450 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973149.1 protein_id gnl|my_center|LOCUS_19970 25563 25895 gene locus_tag LOCUS_19980 25563 25895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 25931 27184 gene locus_tag LOCUS_19990 25931 27184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 27171 27581 gene locus_tag LOCUS_20000 27171 27581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 29106 27637 gene locus_tag LOCUS_20010 29106 27637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 29469 29287 gene locus_tag LOCUS_20020 29469 29287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20020 29959 29462 gene locus_tag LOCUS_20030 29959 29462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20030 30066 31082 gene locus_tag LOCUS_20040 30066 31082 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226432.1 protein_id gnl|my_center|LOCUS_20040 31123 32013 gene locus_tag LOCUS_20050 31123 32013 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226431.1 protein_id gnl|my_center|LOCUS_20050 32906 32316 gene locus_tag LOCUS_20060 32906 32316 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229780.1 protein_id gnl|my_center|LOCUS_20060 33070 32997 gene locus_tag LOCUS_t00270 33070 32997 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 33427 35223 gene locus_tag LOCUS_20070 33427 35223 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230959.1 protein_id gnl|my_center|LOCUS_20070 36062 36817 gene locus_tag LOCUS_20080 36062 36817 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863629.1 protein_id gnl|my_center|LOCUS_20080 36843 38426 gene locus_tag LOCUS_20090 36843 38426 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876236.1 protein_id gnl|my_center|LOCUS_20090 38617 40725 gene locus_tag LOCUS_20100 38617 40725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 41363 41275 gene locus_tag LOCUS_t00280 41363 41275 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 41587 43128 gene locus_tag LOCUS_20110 41587 43128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 43492 43289 gene locus_tag LOCUS_20120 43492 43289 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 protein_id gnl|my_center|LOCUS_20120 44725 43715 gene locus_tag LOCUS_20130 gene folP 44725 43715 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296421.1 protein_id gnl|my_center|LOCUS_20130 45907 45029 gene locus_tag LOCUS_20140 45907 45029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 46553 45930 gene locus_tag LOCUS_20150 46553 45930 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969736.1 protein_id gnl|my_center|LOCUS_20150 46886 46799 gene locus_tag LOCUS_t00290 46886 46799 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 47056 48801 gene locus_tag LOCUS_20160 47056 48801 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230378.1 protein_id gnl|my_center|LOCUS_20160 48798 49436 gene locus_tag LOCUS_20170 48798 49436 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086837759.1 protein_id gnl|my_center|LOCUS_20170 49433 49945 gene locus_tag LOCUS_20180 49433 49945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 49959 52688 gene locus_tag LOCUS_20190 49959 52688 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230375.1 protein_id gnl|my_center|LOCUS_20190 53347 52685 gene locus_tag LOCUS_20200 gene cysE 53347 52685 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929921.1 protein_id gnl|my_center|LOCUS_20200 54442 53510 gene locus_tag LOCUS_20210 gene cysK 54442 53510 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804846.1 protein_id gnl|my_center|LOCUS_20210 54825 54526 gene locus_tag LOCUS_20220 54825 54526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 54733 55080 gene locus_tag LOCUS_20230 54733 55080 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326153.1 protein_id gnl|my_center|LOCUS_20230 55220 57016 gene locus_tag LOCUS_20240 55220 57016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 57785 57255 gene locus_tag LOCUS_20250 57785 57255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 58200 57886 gene locus_tag LOCUS_20260 58200 57886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 59510 58458 gene locus_tag LOCUS_20270 59510 58458 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992272.1 protein_id gnl|my_center|LOCUS_20270 60162 59839 gene locus_tag LOCUS_20280 60162 59839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20280 61432 61016 gene locus_tag LOCUS_20290 61432 61016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 61752 62381 gene locus_tag LOCUS_20300 61752 62381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 62652 62936 gene locus_tag LOCUS_20310 62652 62936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 62968 63237 gene locus_tag LOCUS_20320 62968 63237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 63452 63135 gene locus_tag LOCUS_20330 63452 63135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 64297 64067 gene locus_tag LOCUS_20340 64297 64067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 64817 64230 gene locus_tag LOCUS_20350 64817 64230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 64862 65092 gene locus_tag LOCUS_20360 64862 65092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20360 66619 66855 gene locus_tag LOCUS_20370 66619 66855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 67114 67293 gene locus_tag LOCUS_20380 67114 67293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 68197 67871 gene locus_tag LOCUS_20390 68197 67871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 >Feature sequence19 346 921 gene locus_tag LOCUS_20400 346 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20400 1414 2427 gene locus_tag LOCUS_20410 1414 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20410 2533 4599 gene locus_tag LOCUS_20420 gene glgB 2533 4599 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224470.1 protein_id gnl|my_center|LOCUS_20420 4606 6270 gene locus_tag LOCUS_20430 gene pgm 4606 6270 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728182.1 protein_id gnl|my_center|LOCUS_20430 6367 7227 gene locus_tag LOCUS_20440 6367 7227 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230181.1 protein_id gnl|my_center|LOCUS_20440 7224 8033 gene locus_tag LOCUS_20450 7224 8033 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227225.1 protein_id gnl|my_center|LOCUS_20450 8062 9276 gene locus_tag LOCUS_20460 8062 9276 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227224.1 protein_id gnl|my_center|LOCUS_20460 9273 9929 gene locus_tag LOCUS_20470 9273 9929 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227223.1 protein_id gnl|my_center|LOCUS_20470 9957 10436 gene locus_tag LOCUS_20480 9957 10436 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_20480 10470 12920 gene locus_tag LOCUS_20490 10470 12920 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113370.1 protein_id gnl|my_center|LOCUS_20490 13893 12928 gene locus_tag LOCUS_20500 13893 12928 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973580.1 protein_id gnl|my_center|LOCUS_20500 15032 13911 gene locus_tag LOCUS_20510 15032 13911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 16891 15149 gene locus_tag LOCUS_20520 16891 15149 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030230.1 protein_id gnl|my_center|LOCUS_20520 17482 16964 gene locus_tag LOCUS_20530 17482 16964 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973586.1 protein_id gnl|my_center|LOCUS_20530 18202 17492 gene locus_tag LOCUS_20540 18202 17492 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887118.1 protein_id gnl|my_center|LOCUS_20540 19076 18195 gene locus_tag LOCUS_20550 19076 18195 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028504.1 protein_id gnl|my_center|LOCUS_20550 21730 19073 gene locus_tag LOCUS_20560 21730 19073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 24056 21771 gene locus_tag LOCUS_20570 gene glgX 24056 21771 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030640.1 protein_id gnl|my_center|LOCUS_20570 25154 24192 gene locus_tag LOCUS_20580 gene meaB 25154 24192 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030222.1 protein_id gnl|my_center|LOCUS_20580 26452 25256 gene locus_tag LOCUS_20590 26452 25256 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084654.1 protein_id gnl|my_center|LOCUS_20590 26650 27117 gene locus_tag LOCUS_20600 gene mce 26650 27117 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223476.1 protein_id gnl|my_center|LOCUS_20600 27289 28644 gene locus_tag LOCUS_20610 gene ccrA 27289 28644 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078168.1 protein_id gnl|my_center|LOCUS_20610 28720 29967 gene locus_tag LOCUS_20620 28720 29967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 30014 30601 gene locus_tag LOCUS_20630 30014 30601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 30680 32548 gene locus_tag LOCUS_20640 30680 32548 CDS product cyclic nucleotide-binding/CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014260.1 protein_id gnl|my_center|LOCUS_20640 32580 33266 gene locus_tag LOCUS_20650 32580 33266 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014261.1 protein_id gnl|my_center|LOCUS_20650 33597 33298 gene locus_tag LOCUS_20660 33597 33298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229480.1 protein_id gnl|my_center|LOCUS_20660 35396 33621 gene locus_tag LOCUS_20670 35396 33621 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229492.1 protein_id gnl|my_center|LOCUS_20670 36252 35554 gene locus_tag LOCUS_20680 36252 35554 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_20680 37365 36322 gene locus_tag LOCUS_20690 37365 36322 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941057.1 protein_id gnl|my_center|LOCUS_20690 38366 37362 gene locus_tag LOCUS_20700 38366 37362 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114555269.1 protein_id gnl|my_center|LOCUS_20700 38703 39398 gene locus_tag LOCUS_20710 gene nucS 38703 39398 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775934.1 protein_id gnl|my_center|LOCUS_20710 39770 39384 gene locus_tag LOCUS_20720 39770 39384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 41883 39808 gene locus_tag LOCUS_20730 41883 39808 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030947.1 protein_id gnl|my_center|LOCUS_20730 41985 42650 gene locus_tag LOCUS_20740 41985 42650 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973616.1 protein_id gnl|my_center|LOCUS_20740 43091 42654 gene locus_tag LOCUS_20750 43091 42654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 43376 43104 gene locus_tag LOCUS_20760 43376 43104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 44057 43413 gene locus_tag LOCUS_20770 44057 43413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 45636 44182 gene locus_tag LOCUS_20780 gene atpD 45636 44182 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004120484.1 protein_id gnl|my_center|LOCUS_20780 46557 45664 gene locus_tag LOCUS_20790 46557 45664 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973625.1 protein_id gnl|my_center|LOCUS_20790 48342 46699 gene locus_tag LOCUS_20800 gene atpA 48342 46699 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775940.1 protein_id gnl|my_center|LOCUS_20800 49268 48447 gene locus_tag LOCUS_20810 49268 48447 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327277.1 protein_id gnl|my_center|LOCUS_20810 49858 49268 gene locus_tag LOCUS_20820 49858 49268 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229526.1 protein_id gnl|my_center|LOCUS_20820 50123 49914 gene locus_tag LOCUS_20830 50123 49914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 51061 50270 gene locus_tag LOCUS_20840 gene atpB 51061 50270 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229528.1 protein_id gnl|my_center|LOCUS_20840 51455 51180 gene locus_tag LOCUS_20850 51455 51180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 52022 51531 gene locus_tag LOCUS_20860 52022 51531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 53240 52134 gene locus_tag LOCUS_20870 53240 52134 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052448.1 protein_id gnl|my_center|LOCUS_20870 54557 53274 gene locus_tag LOCUS_20880 54557 53274 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880274.1 protein_id gnl|my_center|LOCUS_20880 55340 54621 gene locus_tag LOCUS_20890 55340 54621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 56152 55337 gene locus_tag LOCUS_20900 56152 55337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 57110 56199 gene locus_tag LOCUS_20910 gene prmC 57110 56199 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973636.1 protein_id gnl|my_center|LOCUS_20910 58210 57107 gene locus_tag LOCUS_20920 gene prfA 58210 57107 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973637.1 protein_id gnl|my_center|LOCUS_20920 58548 58333 gene locus_tag LOCUS_20930 gene rpmE 58548 58333 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973638.1 protein_id gnl|my_center|LOCUS_20930 58737 59363 gene locus_tag LOCUS_20940 58737 59363 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973517.1 protein_id gnl|my_center|LOCUS_20940 59432 60274 gene locus_tag LOCUS_20950 59432 60274 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098166.1 protein_id gnl|my_center|LOCUS_20950 62296 60368 gene locus_tag LOCUS_20960 62296 60368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 63982 62576 gene locus_tag LOCUS_20970 63982 62576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 64834 64661 gene locus_tag LOCUS_20980 64834 64661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 >Feature sequence20 41 727 gene locus_tag LOCUS_20990 41 727 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223459.1 protein_id gnl|my_center|LOCUS_20990 1703 738 gene locus_tag LOCUS_21000 1703 738 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731587.1 protein_id gnl|my_center|LOCUS_21000 2804 1884 gene locus_tag LOCUS_21010 2804 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 2961 3917 gene locus_tag LOCUS_21020 gene dapD 2961 3917 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898768.1 protein_id gnl|my_center|LOCUS_21020 3922 4863 gene locus_tag LOCUS_21030 3922 4863 CDS product heavy metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486364.1 protein_id gnl|my_center|LOCUS_21030 6149 4899 gene locus_tag LOCUS_21040 6149 4899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 7633 6338 gene locus_tag LOCUS_21050 7633 6338 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897085.1 protein_id gnl|my_center|LOCUS_21050 8723 7713 gene locus_tag LOCUS_21060 gene dapC 8723 7713 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730331.1 protein_id gnl|my_center|LOCUS_21060 9194 8868 gene locus_tag LOCUS_21070 9194 8868 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973842.1 protein_id gnl|my_center|LOCUS_21070 9235 10131 gene locus_tag LOCUS_21080 9235 10131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 11064 10150 gene locus_tag LOCUS_21090 gene mshB 11064 10150 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229758.1 protein_id gnl|my_center|LOCUS_21090 12186 11065 gene locus_tag LOCUS_21100 12186 11065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 13329 12202 gene locus_tag LOCUS_21110 13329 12202 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973519.1 protein_id gnl|my_center|LOCUS_21110 14383 13340 gene locus_tag LOCUS_21120 14383 13340 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973520.1 protein_id gnl|my_center|LOCUS_21120 16329 14605 gene locus_tag LOCUS_21130 16329 14605 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803733.1 protein_id gnl|my_center|LOCUS_21130 17479 16460 gene locus_tag LOCUS_21140 17479 16460 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973522.1 protein_id gnl|my_center|LOCUS_21140 19498 17663 gene locus_tag LOCUS_21150 19498 17663 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994617.1 protein_id gnl|my_center|LOCUS_21150 21493 19538 gene locus_tag LOCUS_21160 gene typA 21493 19538 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804730.1 protein_id gnl|my_center|LOCUS_21160 22078 21581 gene locus_tag LOCUS_21170 22078 21581 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973876.1 protein_id gnl|my_center|LOCUS_21170 22062 22319 gene locus_tag LOCUS_21180 22062 22319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 22312 23034 gene locus_tag LOCUS_21190 22312 23034 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893323.1 protein_id gnl|my_center|LOCUS_21190 24090 23080 gene locus_tag LOCUS_21200 gene argF 24090 23080 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030578.1 protein_id gnl|my_center|LOCUS_21200 24573 24115 gene locus_tag LOCUS_21210 24573 24115 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027865.1 protein_id gnl|my_center|LOCUS_21210 25936 24608 gene locus_tag LOCUS_21220 25936 24608 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_21220 27522 25990 gene locus_tag LOCUS_21230 27522 25990 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_21230 28257 27562 gene locus_tag LOCUS_21240 28257 27562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 28893 28360 gene locus_tag LOCUS_21250 28893 28360 CDS product glycine cleavage system regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775899.1 protein_id gnl|my_center|LOCUS_21250 29298 30446 gene locus_tag LOCUS_21260 29298 30446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029086.1 protein_id gnl|my_center|LOCUS_21260 31846 30479 gene locus_tag LOCUS_21270 31846 30479 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679578.1 protein_id gnl|my_center|LOCUS_21270 32227 32559 gene locus_tag LOCUS_21280 32227 32559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 32936 32598 gene locus_tag LOCUS_21290 gene mazF9 32936 32598 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414166.1 protein_id gnl|my_center|LOCUS_21290 33117 32920 gene locus_tag LOCUS_21300 33117 32920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 34134 33364 gene locus_tag LOCUS_21310 34134 33364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21310 34635 34309 gene locus_tag LOCUS_21320 34635 34309 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899493.1 protein_id gnl|my_center|LOCUS_21320 34982 34596 gene locus_tag LOCUS_21330 34982 34596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 36244 34979 gene locus_tag LOCUS_21340 36244 34979 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172649301.1 protein_id gnl|my_center|LOCUS_21340 36700 36272 gene locus_tag LOCUS_21350 36700 36272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 37925 36840 gene locus_tag LOCUS_21360 gene ychF 37925 36840 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730394.1 protein_id gnl|my_center|LOCUS_21360 38795 37938 gene locus_tag LOCUS_21370 38795 37938 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222400.1 protein_id gnl|my_center|LOCUS_21370 39456 38812 gene locus_tag LOCUS_21380 39456 38812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 41966 39474 gene locus_tag LOCUS_21390 41966 39474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 42053 43336 gene locus_tag LOCUS_21400 42053 43336 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776294.1 protein_id gnl|my_center|LOCUS_21400 44364 43312 gene locus_tag LOCUS_21410 44364 43312 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296404.1 protein_id gnl|my_center|LOCUS_21410 44507 45883 gene locus_tag LOCUS_21420 gene xseA 44507 45883 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776296.1 protein_id gnl|my_center|LOCUS_21420 45880 46116 gene locus_tag LOCUS_21430 45880 46116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 46749 46186 gene locus_tag LOCUS_21440 46749 46186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 46956 47894 gene locus_tag LOCUS_21450 46956 47894 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776299.1 protein_id gnl|my_center|LOCUS_21450 48367 47960 gene locus_tag LOCUS_21460 48367 47960 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230086.1 protein_id gnl|my_center|LOCUS_21460 48584 50308 gene locus_tag LOCUS_21470 48584 50308 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 protein_id gnl|my_center|LOCUS_21470 50352 51023 gene locus_tag LOCUS_21480 50352 51023 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908614.1 protein_id gnl|my_center|LOCUS_21480 52395 51058 gene locus_tag LOCUS_21490 gene glmM 52395 51058 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974237.1 protein_id gnl|my_center|LOCUS_21490 53103 52594 gene locus_tag LOCUS_21500 gene rpsI 53103 52594 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776323.1 protein_id gnl|my_center|LOCUS_21500 53594 53151 gene locus_tag LOCUS_21510 gene rplM 53594 53151 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974239.1 protein_id gnl|my_center|LOCUS_21510 53875 54468 gene locus_tag LOCUS_21520 53875 54468 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230395.1 protein_id gnl|my_center|LOCUS_21520 55285 54596 gene locus_tag LOCUS_21530 55285 54596 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179944199.1 protein_id gnl|my_center|LOCUS_21530 56376 55282 gene locus_tag LOCUS_21540 56376 55282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 57352 56354 gene locus_tag LOCUS_21550 57352 56354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 57697 57362 gene locus_tag LOCUS_21560 57697 57362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 58007 58261 gene locus_tag LOCUS_21570 58007 58261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 60018 58300 gene locus_tag LOCUS_21580 60018 58300 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114333.1 protein_id gnl|my_center|LOCUS_21580 60945 60025 gene locus_tag LOCUS_21590 gene truA 60945 60025 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776325.1 protein_id gnl|my_center|LOCUS_21590 61571 60996 gene locus_tag LOCUS_21600 61571 60996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 62675 61644 gene locus_tag LOCUS_21610 62675 61644 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966937.1 protein_id gnl|my_center|LOCUS_21610 63475 62867 gene locus_tag LOCUS_21620 gene rpsD 63475 62867 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892911.1 protein_id gnl|my_center|LOCUS_21620 63914 63504 gene locus_tag LOCUS_21630 gene rpsK 63914 63504 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 protein_id gnl|my_center|LOCUS_21630 64746 64621 gene locus_tag LOCUS_21640 64746 64621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21640 >Feature sequence21 <1 939 gene locus_tag LOCUS_21650 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015777076.1:lactate racemase domain-containing protein 1916 840 gene locus_tag LOCUS_21660 1916 840 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168512796.1 protein_id gnl|my_center|LOCUS_21660 3341 2106 gene locus_tag LOCUS_21670 3341 2106 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613399.1 protein_id gnl|my_center|LOCUS_21670 3603 3361 gene locus_tag LOCUS_21680 3603 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 3853 5664 gene locus_tag LOCUS_21690 gene uidA 3853 5664 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945897.1 protein_id gnl|my_center|LOCUS_21690 5661 6608 gene locus_tag LOCUS_21700 gene larE 5661 6608 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777075.1 protein_id gnl|my_center|LOCUS_21700 6598 7443 gene locus_tag LOCUS_21710 gene larB 6598 7443 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777074.1 protein_id gnl|my_center|LOCUS_21710 7592 9256 gene locus_tag LOCUS_21720 7592 9256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 10815 9370 gene locus_tag LOCUS_21730 10815 9370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 11994 10819 gene locus_tag LOCUS_21740 11994 10819 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035366.1 protein_id gnl|my_center|LOCUS_21740 12768 12070 gene locus_tag LOCUS_21750 12768 12070 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036328.1 protein_id gnl|my_center|LOCUS_21750 13921 13487 gene locus_tag LOCUS_21760 13921 13487 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804833.1 protein_id gnl|my_center|LOCUS_21760 15086 14025 gene locus_tag LOCUS_21770 15086 14025 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051638.1 protein_id gnl|my_center|LOCUS_21770 15824 15114 gene locus_tag LOCUS_21780 15824 15114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 17710 15821 gene locus_tag LOCUS_21790 gene dnaK 17710 15821 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814044.1 protein_id gnl|my_center|LOCUS_21790 17964 17779 gene locus_tag LOCUS_21800 17964 17779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 18128 19006 gene locus_tag LOCUS_21810 18128 19006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 19127 19372 gene locus_tag LOCUS_21820 19127 19372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 19362 19781 gene locus_tag LOCUS_21830 19362 19781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 19833 20075 gene locus_tag LOCUS_21840 19833 20075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 20062 20481 gene locus_tag LOCUS_21850 20062 20481 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403137.1 protein_id gnl|my_center|LOCUS_21850 20525 21085 gene locus_tag LOCUS_21860 20525 21085 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028002136.1 protein_id gnl|my_center|LOCUS_21860 21558 21803 gene locus_tag LOCUS_21870 21558 21803 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227972.1 protein_id gnl|my_center|LOCUS_21870 21800 22189 gene locus_tag LOCUS_21880 21800 22189 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227971.1 protein_id gnl|my_center|LOCUS_21880 22323 23375 gene locus_tag LOCUS_21890 22323 23375 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021942.1 protein_id gnl|my_center|LOCUS_21890 24459 23530 gene locus_tag LOCUS_21900 24459 23530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 24676 25065 gene locus_tag LOCUS_21910 24676 25065 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730014.1 protein_id gnl|my_center|LOCUS_21910 25383 25075 gene locus_tag LOCUS_21920 25383 25075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 26104 25472 gene locus_tag LOCUS_21930 26104 25472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 26798 26157 gene locus_tag LOCUS_21940 26798 26157 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729239.1 protein_id gnl|my_center|LOCUS_21940 26938 27894 gene locus_tag LOCUS_21950 26938 27894 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225136.1 protein_id gnl|my_center|LOCUS_21950 28018 28377 gene locus_tag LOCUS_21960 28018 28377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 30651 28525 gene locus_tag LOCUS_21970 30651 28525 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730364.1 protein_id gnl|my_center|LOCUS_21970 30853 31452 gene locus_tag LOCUS_21980 30853 31452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 31477 31767 gene locus_tag LOCUS_21990 31477 31767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 31764 32165 gene locus_tag LOCUS_22000 31764 32165 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417998.1 protein_id gnl|my_center|LOCUS_22000 32427 33026 gene locus_tag LOCUS_22010 32427 33026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 33127 33753 gene locus_tag LOCUS_22020 33127 33753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 33750 35033 gene locus_tag LOCUS_22030 33750 35033 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777064.1 protein_id gnl|my_center|LOCUS_22030 35984 35136 gene locus_tag LOCUS_22040 35984 35136 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028504.1 protein_id gnl|my_center|LOCUS_22040 39118 35981 gene locus_tag LOCUS_22050 39118 35981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 39268 39942 gene locus_tag LOCUS_22060 39268 39942 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888822.1 protein_id gnl|my_center|LOCUS_22060 39970 40125 gene locus_tag LOCUS_22070 39970 40125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 40928 40236 gene locus_tag LOCUS_22080 40928 40236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 41165 42658 gene locus_tag LOCUS_22090 41165 42658 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225544.1 protein_id gnl|my_center|LOCUS_22090 42734 43168 gene locus_tag LOCUS_22100 42734 43168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 43168 43914 gene locus_tag LOCUS_22110 43168 43914 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223631.1 protein_id gnl|my_center|LOCUS_22110 44697 44023 gene locus_tag LOCUS_22120 44697 44023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 45705 44977 gene locus_tag LOCUS_22130 45705 44977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 47565 45901 gene locus_tag LOCUS_22140 47565 45901 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484466.1 protein_id gnl|my_center|LOCUS_22140 47617 48396 gene locus_tag LOCUS_22150 47617 48396 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978194.1 protein_id gnl|my_center|LOCUS_22150 48401 49954 gene locus_tag LOCUS_22160 48401 49954 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230146.1 protein_id gnl|my_center|LOCUS_22160 50230 50514 gene locus_tag LOCUS_22170 50230 50514 CDS product DUF1272 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113606.1 protein_id gnl|my_center|LOCUS_22170 50948 50634 gene locus_tag LOCUS_22180 50948 50634 CDS product DUF2853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531020.1 protein_id gnl|my_center|LOCUS_22180 51446 51006 gene locus_tag LOCUS_22190 51446 51006 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 protein_id gnl|my_center|LOCUS_22190 53393 51504 gene locus_tag LOCUS_22200 gene arsA 53393 51504 CDS product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705614.1 protein_id gnl|my_center|LOCUS_22200 53974 53363 gene locus_tag LOCUS_22210 53974 53363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 54065 54478 gene locus_tag LOCUS_22220 54065 54478 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777081.1 protein_id gnl|my_center|LOCUS_22220 54469 55572 gene locus_tag LOCUS_22230 gene arsB 54469 55572 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265970.1 protein_id gnl|my_center|LOCUS_22230 56022 60257 gene locus_tag LOCUS_22240 56022 60257 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113120.1 protein_id gnl|my_center|LOCUS_22240 60254 61570 gene locus_tag LOCUS_22250 60254 61570 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086878.1 protein_id gnl|my_center|LOCUS_22250 62463 61744 gene locus_tag LOCUS_22260 62463 61744 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776448.1 protein_id gnl|my_center|LOCUS_22260 >Feature sequence22 492 677 gene locus_tag LOCUS_22270 492 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 652 1578 gene locus_tag LOCUS_22280 652 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22280 1949 1677 gene locus_tag LOCUS_22290 1949 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 4839 2026 gene locus_tag LOCUS_22300 gene fdhF 4839 2026 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726709.1 protein_id gnl|my_center|LOCUS_22300 6371 4836 gene locus_tag LOCUS_22310 6371 4836 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726708.1 protein_id gnl|my_center|LOCUS_22310 6832 6368 gene locus_tag LOCUS_22320 6832 6368 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726707.1 protein_id gnl|my_center|LOCUS_22320 8489 6987 gene locus_tag LOCUS_22330 8489 6987 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224377.1 protein_id gnl|my_center|LOCUS_22330 8715 9038 gene locus_tag LOCUS_22340 gene rpsO 8715 9038 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804659.1 protein_id gnl|my_center|LOCUS_22340 9231 11471 gene locus_tag LOCUS_22350 9231 11471 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973290.1 protein_id gnl|my_center|LOCUS_22350 11702 12436 gene locus_tag LOCUS_22360 11702 12436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22360 12433 12669 gene locus_tag LOCUS_22370 12433 12669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22370 12713 12982 gene locus_tag LOCUS_22380 12713 12982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22380 13557 13006 gene locus_tag LOCUS_22390 13557 13006 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977487.1 protein_id gnl|my_center|LOCUS_22390 13804 13622 gene locus_tag LOCUS_22400 13804 13622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 13818 14753 gene locus_tag LOCUS_22410 13818 14753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 14851 16191 gene locus_tag LOCUS_22420 14851 16191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 16209 16418 gene locus_tag LOCUS_22430 16209 16418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 16493 18340 gene locus_tag LOCUS_22440 16493 18340 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776700.1 protein_id gnl|my_center|LOCUS_22440 18337 20148 gene locus_tag LOCUS_22450 18337 20148 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776699.1 protein_id gnl|my_center|LOCUS_22450 21974 20175 gene locus_tag LOCUS_22460 gene pabB 21974 20175 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722110.1 protein_id gnl|my_center|LOCUS_22460 22021 22458 gene locus_tag LOCUS_22470 gene hisI 22021 22458 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052762.1 protein_id gnl|my_center|LOCUS_22470 22455 24014 gene locus_tag LOCUS_22480 22455 24014 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976773.1 protein_id gnl|my_center|LOCUS_22480 24011 24649 gene locus_tag LOCUS_22490 24011 24649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 24663 24884 gene locus_tag LOCUS_22500 24663 24884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 25094 25762 gene locus_tag LOCUS_22510 25094 25762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 25767 26219 gene locus_tag LOCUS_22520 25767 26219 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028111.1 protein_id gnl|my_center|LOCUS_22520 26243 27112 gene locus_tag LOCUS_22530 gene trpC 26243 27112 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894608.1 protein_id gnl|my_center|LOCUS_22530 27109 28317 gene locus_tag LOCUS_22540 gene trpB 27109 28317 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930205.1 protein_id gnl|my_center|LOCUS_22540 28314 29126 gene locus_tag LOCUS_22550 gene trpA 28314 29126 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407999.1 protein_id gnl|my_center|LOCUS_22550 29123 29581 gene locus_tag LOCUS_22560 29123 29581 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223188.1 protein_id gnl|my_center|LOCUS_22560 29603 30373 gene locus_tag LOCUS_22570 29603 30373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 30370 31275 gene locus_tag LOCUS_22580 gene lgt 30370 31275 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466801.1 protein_id gnl|my_center|LOCUS_22580 31396 35949 gene locus_tag LOCUS_22590 gene gltB 31396 35949 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028104.1 protein_id gnl|my_center|LOCUS_22590 35942 37399 gene locus_tag LOCUS_22600 35942 37399 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228800.1 protein_id gnl|my_center|LOCUS_22600 37461 38909 gene locus_tag LOCUS_22610 gene pyk 37461 38909 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028096.1 protein_id gnl|my_center|LOCUS_22610 38995 39078 gene locus_tag LOCUS_t00300 38995 39078 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 39153 39761 gene locus_tag LOCUS_22620 39153 39761 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805096.1 protein_id gnl|my_center|LOCUS_22620 40565 39792 gene locus_tag LOCUS_22630 40565 39792 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583890.1 protein_id gnl|my_center|LOCUS_22630 40721 41305 gene locus_tag LOCUS_22640 40721 41305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 42610 41369 gene locus_tag LOCUS_22650 42610 41369 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729712.1 protein_id gnl|my_center|LOCUS_22650 43381 42890 gene locus_tag LOCUS_22660 43381 42890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 43368 46070 gene locus_tag LOCUS_22670 gene polA 43368 46070 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467407.1 protein_id gnl|my_center|LOCUS_22670 46895 46092 gene locus_tag LOCUS_22680 46895 46092 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227917.1 protein_id gnl|my_center|LOCUS_22680 47101 47679 gene locus_tag LOCUS_22690 47101 47679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 47676 50009 gene locus_tag LOCUS_22700 47676 50009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 50287 51750 gene locus_tag LOCUS_22710 gene rpsA 50287 51750 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976820.1 protein_id gnl|my_center|LOCUS_22710 51802 52491 gene locus_tag LOCUS_22720 51802 52491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 53989 52439 gene locus_tag LOCUS_22730 53989 52439 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205720.1 protein_id gnl|my_center|LOCUS_22730 55395 53986 gene locus_tag LOCUS_22740 55395 53986 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539284.1 protein_id gnl|my_center|LOCUS_22740 55574 56479 gene locus_tag LOCUS_22750 55574 56479 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414505.1 protein_id gnl|my_center|LOCUS_22750 56526 57449 gene locus_tag LOCUS_22760 56526 57449 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014325.1 protein_id gnl|my_center|LOCUS_22760 57550 57837 gene locus_tag LOCUS_22770 57550 57837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22770 57771 58115 gene locus_tag LOCUS_22780 57771 58115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22780 58102 58419 gene locus_tag LOCUS_22790 58102 58419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 58794 58561 gene locus_tag LOCUS_22800 58794 58561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 59146 58922 gene locus_tag LOCUS_22810 59146 58922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 59852 59998 gene locus_tag LOCUS_22820 59852 59998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 >Feature sequence23 1526 609 gene locus_tag LOCUS_22830 1526 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 1880 1743 gene locus_tag LOCUS_22840 1880 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 3039 2092 gene locus_tag LOCUS_22850 3039 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 3710 3039 gene locus_tag LOCUS_22860 3710 3039 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257359.1 protein_id gnl|my_center|LOCUS_22860 5436 4294 gene locus_tag LOCUS_22870 5436 4294 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093786317.1 protein_id gnl|my_center|LOCUS_22870 5609 5812 gene locus_tag LOCUS_22880 5609 5812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22880 5853 6554 gene locus_tag LOCUS_22890 5853 6554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22890 6771 7892 gene locus_tag LOCUS_22900 6771 7892 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393453.1 protein_id gnl|my_center|LOCUS_22900 7894 8862 gene locus_tag LOCUS_22910 7894 8862 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223743.1 protein_id gnl|my_center|LOCUS_22910 9830 8928 gene locus_tag LOCUS_22920 9830 8928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 10867 9944 gene locus_tag LOCUS_22930 10867 9944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 10979 12229 gene locus_tag LOCUS_22940 10979 12229 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230594.1 protein_id gnl|my_center|LOCUS_22940 12919 12317 gene locus_tag LOCUS_22950 12919 12317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 14844 12961 gene locus_tag LOCUS_22960 14844 12961 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950653.1 protein_id gnl|my_center|LOCUS_22960 15149 14844 gene locus_tag LOCUS_22970 15149 14844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 15367 17235 gene locus_tag LOCUS_22980 15367 17235 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230903.1 protein_id gnl|my_center|LOCUS_22980 17625 17344 gene locus_tag LOCUS_22990 17625 17344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 17779 17630 gene locus_tag LOCUS_23000 17779 17630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 18022 19002 gene locus_tag LOCUS_23010 18022 19002 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030691.1 protein_id gnl|my_center|LOCUS_23010 19250 19798 gene locus_tag LOCUS_23020 19250 19798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 19885 20211 gene locus_tag LOCUS_23030 19885 20211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 20221 21207 gene locus_tag LOCUS_23040 20221 21207 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776493.1 protein_id gnl|my_center|LOCUS_23040 21342 22037 gene locus_tag LOCUS_23050 21342 22037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 22356 22619 gene locus_tag LOCUS_23060 22356 22619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 24162 22780 gene locus_tag LOCUS_23070 24162 22780 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803753.1 protein_id gnl|my_center|LOCUS_23070 25119 24268 gene locus_tag LOCUS_23080 25119 24268 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975129.1 protein_id gnl|my_center|LOCUS_23080 26503 25130 gene locus_tag LOCUS_23090 26503 25130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 28545 26500 gene locus_tag LOCUS_23100 28545 26500 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878112.1 protein_id gnl|my_center|LOCUS_23100 28610 29560 gene locus_tag LOCUS_23110 28610 29560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 31405 29678 gene locus_tag LOCUS_23120 31405 29678 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230478.1 protein_id gnl|my_center|LOCUS_23120 32031 31522 gene locus_tag LOCUS_23130 32031 31522 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230835.1 protein_id gnl|my_center|LOCUS_23130 34579 32141 gene locus_tag LOCUS_23140 34579 32141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 34705 35970 gene locus_tag LOCUS_23150 34705 35970 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_23150 36628 36053 gene locus_tag LOCUS_23160 36628 36053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 38480 36795 gene locus_tag LOCUS_23170 38480 36795 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029246.1 protein_id gnl|my_center|LOCUS_23170 39542 38493 gene locus_tag LOCUS_23180 39542 38493 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326663.1 protein_id gnl|my_center|LOCUS_23180 40711 39539 gene locus_tag LOCUS_23190 gene pdhA 40711 39539 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230923.1 protein_id gnl|my_center|LOCUS_23190 40671 40904 gene locus_tag LOCUS_23200 40671 40904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 41988 41086 gene locus_tag LOCUS_23210 41988 41086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411581.1 protein_id gnl|my_center|LOCUS_23210 43130 42093 gene locus_tag LOCUS_23220 gene hisC 43130 42093 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029330.1 protein_id gnl|my_center|LOCUS_23220 43322 43738 gene locus_tag LOCUS_23230 43322 43738 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409542.1 protein_id gnl|my_center|LOCUS_23230 45605 43914 gene locus_tag LOCUS_23240 gene paaN 45605 43914 CDS product phenylacetic acid degradation protein PaaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029260.1 protein_id gnl|my_center|LOCUS_23240 45912 47081 gene locus_tag LOCUS_23250 45912 47081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 47406 48335 gene locus_tag LOCUS_23260 47406 48335 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025221252.1 protein_id gnl|my_center|LOCUS_23260 48335 49312 gene locus_tag LOCUS_23270 48335 49312 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894625.1 protein_id gnl|my_center|LOCUS_23270 49312 50097 gene locus_tag LOCUS_23280 49312 50097 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230914.1 protein_id gnl|my_center|LOCUS_23280 50272 51567 gene locus_tag LOCUS_23290 gene paaF 50272 51567 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083202.1 protein_id gnl|my_center|LOCUS_23290 51663 52685 gene locus_tag LOCUS_23300 gene galE 51663 52685 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210750.1 protein_id gnl|my_center|LOCUS_23300 52991 54424 gene locus_tag LOCUS_23310 52991 54424 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227294.1 protein_id gnl|my_center|LOCUS_23310 54720 54935 gene locus_tag LOCUS_23320 54720 54935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23320 55388 55585 gene locus_tag LOCUS_23330 55388 55585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23330 55810 55664 gene locus_tag LOCUS_23340 55810 55664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 >Feature sequence24 448 1242 gene locus_tag LOCUS_23350 448 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23350 1134 1439 gene locus_tag LOCUS_23360 1134 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 1436 1963 gene locus_tag LOCUS_23370 1436 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 2210 2626 gene locus_tag LOCUS_23380 2210 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23380 2973 3974 gene locus_tag LOCUS_23390 gene eno 2973 3974 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975715.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23390 4218 4643 gene locus_tag LOCUS_23400 4218 4643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 4662 5195 gene locus_tag LOCUS_23410 4662 5195 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028762.1 protein_id gnl|my_center|LOCUS_23410 5192 6163 gene locus_tag LOCUS_23420 5192 6163 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_23420 6194 7015 gene locus_tag LOCUS_23430 6194 7015 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730268.1 protein_id gnl|my_center|LOCUS_23430 7101 7631 gene locus_tag LOCUS_23440 7101 7631 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944067.1 protein_id gnl|my_center|LOCUS_23440 7643 8164 gene locus_tag LOCUS_23450 gene def 7643 8164 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944066.1 protein_id gnl|my_center|LOCUS_23450 8224 8298 gene locus_tag LOCUS_t00310 8224 8298 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8385 9257 gene locus_tag LOCUS_23460 8385 9257 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896676.1 protein_id gnl|my_center|LOCUS_23460 9274 9582 gene locus_tag LOCUS_23470 9274 9582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 10809 9586 gene locus_tag LOCUS_23480 10809 9586 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229842.1 protein_id gnl|my_center|LOCUS_23480 11030 11752 gene locus_tag LOCUS_23490 11030 11752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 12681 11767 gene locus_tag LOCUS_23500 12681 11767 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524829.1 protein_id gnl|my_center|LOCUS_23500 13571 12678 gene locus_tag LOCUS_23510 13571 12678 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226352.1 protein_id gnl|my_center|LOCUS_23510 14992 13640 gene locus_tag LOCUS_23520 14992 13640 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552177.1 protein_id gnl|my_center|LOCUS_23520 15241 17313 gene locus_tag LOCUS_23530 15241 17313 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031640.1 protein_id gnl|my_center|LOCUS_23530 17316 18098 gene locus_tag LOCUS_23540 17316 18098 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230059.1 protein_id gnl|my_center|LOCUS_23540 18235 18978 gene locus_tag LOCUS_23550 18235 18978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 20280 19072 gene locus_tag LOCUS_23560 20280 19072 CDS product pyrophosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775974.1 protein_id gnl|my_center|LOCUS_23560 23139 20533 gene locus_tag LOCUS_23570 23139 20533 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272585.1 protein_id gnl|my_center|LOCUS_23570 24578 23241 gene locus_tag LOCUS_23580 24578 23241 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868206.1 protein_id gnl|my_center|LOCUS_23580 25250 24690 gene locus_tag LOCUS_23590 25250 24690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 25973 25467 gene locus_tag LOCUS_23600 25973 25467 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027466.1 protein_id gnl|my_center|LOCUS_23600 26709 26002 gene locus_tag LOCUS_23610 gene msrA 26709 26002 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918878.1 protein_id gnl|my_center|LOCUS_23610 27109 26789 gene locus_tag LOCUS_23620 27109 26789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 27804 27454 gene locus_tag LOCUS_23630 27804 27454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 29375 27801 gene locus_tag LOCUS_23640 29375 27801 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730516.1 protein_id gnl|my_center|LOCUS_23640 30205 29405 gene locus_tag LOCUS_23650 30205 29405 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730515.1 protein_id gnl|my_center|LOCUS_23650 30494 30985 gene locus_tag LOCUS_23660 gene greA 30494 30985 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776308.1 protein_id gnl|my_center|LOCUS_23660 32243 31029 gene locus_tag LOCUS_23670 gene ilvA 32243 31029 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029975.1 protein_id gnl|my_center|LOCUS_23670 33703 32264 gene locus_tag LOCUS_23680 gene glmL 33703 32264 CDS product methylaspartate mutase accessory protein GlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945203.1 protein_id gnl|my_center|LOCUS_23680 34176 33700 gene locus_tag LOCUS_23690 34176 33700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 34215 35189 gene locus_tag LOCUS_23700 gene mca 34215 35189 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007444314.1 protein_id gnl|my_center|LOCUS_23700 35196 35393 gene locus_tag LOCUS_23710 35196 35393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 36127 35462 gene locus_tag LOCUS_23720 36127 35462 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029984.1 protein_id gnl|my_center|LOCUS_23720 36270 37031 gene locus_tag LOCUS_23730 36270 37031 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441465.1 protein_id gnl|my_center|LOCUS_23730 38380 37151 gene locus_tag LOCUS_23740 38380 37151 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_23740 38606 38679 gene locus_tag LOCUS_t00320 38606 38679 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 38789 39058 gene locus_tag LOCUS_23750 38789 39058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 39122 39904 gene locus_tag LOCUS_23760 39122 39904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 40015 40452 gene locus_tag LOCUS_23770 gene rplK 40015 40452 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974315.1 protein_id gnl|my_center|LOCUS_23770 40567 41280 gene locus_tag LOCUS_23780 gene rplA 40567 41280 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974314.1 protein_id gnl|my_center|LOCUS_23780 41432 42223 gene locus_tag LOCUS_23790 41432 42223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 42264 43391 gene locus_tag LOCUS_23800 42264 43391 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226719.1 protein_id gnl|my_center|LOCUS_23800 43567 44142 gene locus_tag LOCUS_23810 gene ahpC 43567 44142 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395542.1 protein_id gnl|my_center|LOCUS_23810 44323 45978 gene locus_tag LOCUS_23820 gene ahpF 44323 45978 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036069.1 protein_id gnl|my_center|LOCUS_23820 45975 46892 gene locus_tag LOCUS_23830 45975 46892 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036068.1 protein_id gnl|my_center|LOCUS_23830 46982 48817 gene locus_tag LOCUS_23840 gene ggt 46982 48817 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224631.1 protein_id gnl|my_center|LOCUS_23840 49106 49762 gene locus_tag LOCUS_23850 gene rplJ 49106 49762 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776392.1 protein_id gnl|my_center|LOCUS_23850 49827 50216 gene locus_tag LOCUS_23860 gene rplL 49827 50216 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053002.1 protein_id gnl|my_center|LOCUS_23860 51315 50350 gene locus_tag LOCUS_23870 51315 50350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 52468 51356 gene locus_tag LOCUS_23880 gene glcF 52468 51356 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194653.1 protein_id gnl|my_center|LOCUS_23880 53940 52465 gene locus_tag LOCUS_23890 gene glcD 53940 52465 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890729.1 protein_id gnl|my_center|LOCUS_23890 54550 54050 gene locus_tag LOCUS_23900 54550 54050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 >Feature sequence25 133 897 gene locus_tag LOCUS_23910 133 897 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029738.1 protein_id gnl|my_center|LOCUS_23910 894 1193 gene locus_tag LOCUS_23920 gene nuoK 894 1193 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893422.1 protein_id gnl|my_center|LOCUS_23920 1207 3150 gene locus_tag LOCUS_23930 gene nuoL 1207 3150 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893421.1 protein_id gnl|my_center|LOCUS_23930 3150 4685 gene locus_tag LOCUS_23940 3150 4685 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974372.1 protein_id gnl|my_center|LOCUS_23940 4682 6283 gene locus_tag LOCUS_23950 gene nuoN 4682 6283 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974371.1 protein_id gnl|my_center|LOCUS_23950 6318 7319 gene locus_tag LOCUS_23960 6318 7319 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974364.1 protein_id gnl|my_center|LOCUS_23960 7623 7348 gene locus_tag LOCUS_23970 7623 7348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 7862 7620 gene locus_tag LOCUS_23980 7862 7620 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587616.1 protein_id gnl|my_center|LOCUS_23980 8907 7903 gene locus_tag LOCUS_23990 gene rarD 8907 7903 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029749.1 protein_id gnl|my_center|LOCUS_23990 10025 8904 gene locus_tag LOCUS_24000 10025 8904 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222471.1 protein_id gnl|my_center|LOCUS_24000 11911 10022 gene locus_tag LOCUS_24010 11911 10022 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030783.1 protein_id gnl|my_center|LOCUS_24010 13243 12005 gene locus_tag LOCUS_24020 13243 12005 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031139.1 protein_id gnl|my_center|LOCUS_24020 13462 21552 gene locus_tag LOCUS_24030 13462 21552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 22035 21625 gene locus_tag LOCUS_24040 gene vapc11 22035 21625 CDS product type II toxin-antitoxin system toxin ribonuclease VapC11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407786.1 protein_id gnl|my_center|LOCUS_24040 22244 22032 gene locus_tag LOCUS_24050 22244 22032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 22358 22750 gene locus_tag LOCUS_24060 22358 22750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 22756 23352 gene locus_tag LOCUS_24070 22756 23352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 24401 23334 gene locus_tag LOCUS_24080 24401 23334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363811.1 protein_id gnl|my_center|LOCUS_24080 25017 24412 gene locus_tag LOCUS_24090 25017 24412 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814716.1 protein_id gnl|my_center|LOCUS_24090 26048 25008 gene locus_tag LOCUS_24100 26048 25008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 26717 26052 gene locus_tag LOCUS_24110 26717 26052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 29065 27380 gene locus_tag LOCUS_24120 gene ptsP 29065 27380 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977434.1 protein_id gnl|my_center|LOCUS_24120 29465 29196 gene locus_tag LOCUS_24130 29465 29196 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804336.1 protein_id gnl|my_center|LOCUS_24130 31627 29552 gene locus_tag LOCUS_24140 31627 29552 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028822.1 protein_id gnl|my_center|LOCUS_24140 32716 31766 gene locus_tag LOCUS_24150 gene pfkB 32716 31766 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226343.1 protein_id gnl|my_center|LOCUS_24150 33474 32713 gene locus_tag LOCUS_24160 33474 32713 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975619.1 protein_id gnl|my_center|LOCUS_24160 33727 34119 gene locus_tag LOCUS_24170 33727 34119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 34112 34549 gene locus_tag LOCUS_24180 34112 34549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 34546 34926 gene locus_tag LOCUS_24190 34546 34926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 34976 35860 gene locus_tag LOCUS_24200 gene htpX 34976 35860 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094627.1 protein_id gnl|my_center|LOCUS_24200 35926 38496 gene locus_tag LOCUS_24210 gene pepN 35926 38496 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283751.1 protein_id gnl|my_center|LOCUS_24210 38646 39155 gene locus_tag LOCUS_24220 38646 39155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 39678 39184 gene locus_tag LOCUS_24230 39678 39184 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974333.1 protein_id gnl|my_center|LOCUS_24230 39799 39881 gene locus_tag LOCUS_t00330 39799 39881 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 40435 39965 gene locus_tag LOCUS_24240 40435 39965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 41475 40699 gene locus_tag LOCUS_24250 41475 40699 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974928.1 protein_id gnl|my_center|LOCUS_24250 41667 42452 gene locus_tag LOCUS_24260 41667 42452 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228306.1 protein_id gnl|my_center|LOCUS_24260 44271 42502 gene locus_tag LOCUS_24270 44271 42502 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775581.1 protein_id gnl|my_center|LOCUS_24270 45038 44412 gene locus_tag LOCUS_24280 45038 44412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405892.1 protein_id gnl|my_center|LOCUS_24280 45186 46811 gene locus_tag LOCUS_24290 45186 46811 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929823.1 protein_id gnl|my_center|LOCUS_24290 46823 47872 gene locus_tag LOCUS_24300 46823 47872 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027122.1 protein_id gnl|my_center|LOCUS_24300 48154 47876 gene locus_tag LOCUS_24310 48154 47876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24310 48828 48139 gene locus_tag LOCUS_24320 48828 48139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 48769 48948 gene locus_tag LOCUS_24330 48769 48948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 49714 48974 gene locus_tag LOCUS_24340 gene narI 49714 48974 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730339.1 protein_id gnl|my_center|LOCUS_24340 50412 49711 gene locus_tag LOCUS_24350 50412 49711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 <51614 50415 gene locus_tag LOCUS_24360 <51614 50415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730341.1:nitrate reductase subunit beta >Feature sequence26 981 1517 gene locus_tag LOCUS_24370 981 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 2996 1527 gene locus_tag LOCUS_24380 2996 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 3025 3801 gene locus_tag LOCUS_24390 3025 3801 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977745.1 protein_id gnl|my_center|LOCUS_24390 3804 4583 gene locus_tag LOCUS_24400 3804 4583 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976201.1 protein_id gnl|my_center|LOCUS_24400 4746 8054 gene locus_tag LOCUS_24410 4746 8054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24410 8122 8556 gene locus_tag LOCUS_24420 8122 8556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 8588 8857 gene locus_tag LOCUS_24430 gene rpmA 8588 8857 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976205.1 protein_id gnl|my_center|LOCUS_24430 8979 10499 gene locus_tag LOCUS_24440 gene obgE 8979 10499 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775853.1 protein_id gnl|my_center|LOCUS_24440 11167 10541 gene locus_tag LOCUS_24450 11167 10541 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087536.1 protein_id gnl|my_center|LOCUS_24450 11229 12320 gene locus_tag LOCUS_24460 gene proB 11229 12320 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028438.1 protein_id gnl|my_center|LOCUS_24460 12369 13652 gene locus_tag LOCUS_24470 12369 13652 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976218.1 protein_id gnl|my_center|LOCUS_24470 14567 13593 gene locus_tag LOCUS_24480 14567 13593 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029794.1 protein_id gnl|my_center|LOCUS_24480 14690 14917 gene locus_tag LOCUS_24490 14690 14917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 14935 15564 gene locus_tag LOCUS_24500 gene nadD 14935 15564 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775849.1 protein_id gnl|my_center|LOCUS_24500 15561 15968 gene locus_tag LOCUS_24510 gene rsfS 15561 15968 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074555.1 protein_id gnl|my_center|LOCUS_24510 15968 16672 gene locus_tag LOCUS_24520 15968 16672 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976227.1 protein_id gnl|my_center|LOCUS_24520 16704 16779 gene locus_tag LOCUS_t00340 16704 16779 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 17567 16812 gene locus_tag LOCUS_24530 17567 16812 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111854.1 protein_id gnl|my_center|LOCUS_24530 18630 17674 gene locus_tag LOCUS_24540 18630 17674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 19075 18872 gene locus_tag LOCUS_24550 19075 18872 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558414.1 protein_id gnl|my_center|LOCUS_24550 20793 19291 gene locus_tag LOCUS_24560 20793 19291 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728196.1 protein_id gnl|my_center|LOCUS_24560 21171 20809 gene locus_tag LOCUS_24570 21171 20809 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357588.1 protein_id gnl|my_center|LOCUS_24570 21297 21935 gene locus_tag LOCUS_24580 21297 21935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 22121 25081 gene locus_tag LOCUS_24590 gene leuS 22121 25081 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976232.1 protein_id gnl|my_center|LOCUS_24590 25165 26049 gene locus_tag LOCUS_24600 25165 26049 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976234.1 protein_id gnl|my_center|LOCUS_24600 26046 26684 gene locus_tag LOCUS_24610 gene plsY 26046 26684 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085061.1 protein_id gnl|my_center|LOCUS_24610 27184 26939 gene locus_tag LOCUS_24620 27184 26939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 27245 27964 gene locus_tag LOCUS_24630 27245 27964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 27964 30462 gene locus_tag LOCUS_24640 27964 30462 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775771.1 protein_id gnl|my_center|LOCUS_24640 31027 30539 gene locus_tag LOCUS_24650 31027 30539 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614581.1 protein_id gnl|my_center|LOCUS_24650 32042 31110 gene locus_tag LOCUS_24660 32042 31110 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029852.1 protein_id gnl|my_center|LOCUS_24660 32128 33027 gene locus_tag LOCUS_24670 32128 33027 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226056.1 protein_id gnl|my_center|LOCUS_24670 33829 33080 gene locus_tag LOCUS_24680 gene lexA 33829 33080 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894124.1 protein_id gnl|my_center|LOCUS_24680 34154 33888 gene locus_tag LOCUS_24690 34154 33888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 34144 34575 gene locus_tag LOCUS_24700 34144 34575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 34888 35178 gene locus_tag LOCUS_24710 34888 35178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 35471 35214 gene locus_tag LOCUS_24720 35471 35214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 35376 36872 gene locus_tag LOCUS_24730 35376 36872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 37173 37664 gene locus_tag LOCUS_24740 gene nrdR 37173 37664 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804686.1 protein_id gnl|my_center|LOCUS_24740 37821 40709 gene locus_tag LOCUS_24750 37821 40709 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030467.1 protein_id gnl|my_center|LOCUS_24750 40861 41232 gene locus_tag LOCUS_24760 40861 41232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 41236 42216 gene locus_tag LOCUS_24770 41236 42216 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104632.1 protein_id gnl|my_center|LOCUS_24770 42216 42515 gene locus_tag LOCUS_24780 42216 42515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 42591 43697 gene locus_tag LOCUS_24790 42591 43697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 43675 43998 gene locus_tag LOCUS_24800 43675 43998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 44632 44168 gene locus_tag LOCUS_24810 44632 44168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 45109 46236 gene locus_tag LOCUS_24820 45109 46236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 46792 46998 gene locus_tag LOCUS_24830 46792 46998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 48328 47291 gene locus_tag LOCUS_24840 48328 47291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24840 48967 48356 gene locus_tag LOCUS_24850 48967 48356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24850 49256 49732 gene locus_tag LOCUS_24860 49256 49732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24860 50060 49734 gene locus_tag LOCUS_24870 50060 49734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 >Feature sequence27 <1 686 gene locus_tag LOCUS_24880 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029449.1:MFS transporter 1176 1367 gene locus_tag LOCUS_24890 1176 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 1524 1880 gene locus_tag LOCUS_24900 1524 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 1877 3061 gene locus_tag LOCUS_24910 1877 3061 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_24910 3904 3083 gene locus_tag LOCUS_24920 3904 3083 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419780.1 protein_id gnl|my_center|LOCUS_24920 3961 4968 gene locus_tag LOCUS_24930 3961 4968 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975791.1 protein_id gnl|my_center|LOCUS_24930 6271 4976 gene locus_tag LOCUS_24940 6271 4976 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223048.1 protein_id gnl|my_center|LOCUS_24940 7358 6336 gene locus_tag LOCUS_24950 7358 6336 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223047.1 protein_id gnl|my_center|LOCUS_24950 8563 7355 gene locus_tag LOCUS_24960 8563 7355 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223046.1 protein_id gnl|my_center|LOCUS_24960 9207 8560 gene locus_tag LOCUS_24970 9207 8560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 10298 9204 gene locus_tag LOCUS_24980 10298 9204 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419768.1 protein_id gnl|my_center|LOCUS_24980 10945 10325 gene locus_tag LOCUS_24990 10945 10325 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189397579.1 protein_id gnl|my_center|LOCUS_24990 11905 10949 gene locus_tag LOCUS_25000 11905 10949 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715428.1 protein_id gnl|my_center|LOCUS_25000 13359 11902 gene locus_tag LOCUS_25010 13359 11902 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222793.1 protein_id gnl|my_center|LOCUS_25010 14365 13367 gene locus_tag LOCUS_25020 gene deoC 14365 13367 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 protein_id gnl|my_center|LOCUS_25020 14429 15100 gene locus_tag LOCUS_25030 14429 15100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 16039 15104 gene locus_tag LOCUS_25040 16039 15104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727795.1 protein_id gnl|my_center|LOCUS_25040 17775 16057 gene locus_tag LOCUS_25050 17775 16057 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495362.1 protein_id gnl|my_center|LOCUS_25050 18646 17786 gene locus_tag LOCUS_25060 18646 17786 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776134.1 protein_id gnl|my_center|LOCUS_25060 18682 20088 gene locus_tag LOCUS_25070 18682 20088 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872192.1 protein_id gnl|my_center|LOCUS_25070 21904 20114 gene locus_tag LOCUS_25080 21904 20114 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029950.1 protein_id gnl|my_center|LOCUS_25080 21995 22870 gene locus_tag LOCUS_25090 21995 22870 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031003.1 protein_id gnl|my_center|LOCUS_25090 23283 22891 gene locus_tag LOCUS_25100 23283 22891 CDS product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929528.1 protein_id gnl|my_center|LOCUS_25100 23395 24579 gene locus_tag LOCUS_25110 23395 24579 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229659.1 protein_id gnl|my_center|LOCUS_25110 24590 26215 gene locus_tag LOCUS_25120 24590 26215 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231527.1 protein_id gnl|my_center|LOCUS_25120 26258 27520 gene locus_tag LOCUS_25130 26258 27520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 28508 27495 gene locus_tag LOCUS_25140 28508 27495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803908.1 protein_id gnl|my_center|LOCUS_25140 29238 28549 gene locus_tag LOCUS_25150 29238 28549 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974050.1 protein_id gnl|my_center|LOCUS_25150 30965 29259 gene locus_tag LOCUS_25160 30965 29259 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728748.1 protein_id gnl|my_center|LOCUS_25160 31083 32423 gene locus_tag LOCUS_25170 31083 32423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 32441 33412 gene locus_tag LOCUS_25180 32441 33412 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973708.1 protein_id gnl|my_center|LOCUS_25180 37457 33399 gene locus_tag LOCUS_25190 37457 33399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 37615 38847 gene locus_tag LOCUS_25200 37615 38847 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776058.1 protein_id gnl|my_center|LOCUS_25200 38844 39710 gene locus_tag LOCUS_25210 38844 39710 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776057.1 protein_id gnl|my_center|LOCUS_25210 39707 40642 gene locus_tag LOCUS_25220 39707 40642 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776056.1 protein_id gnl|my_center|LOCUS_25220 40673 40894 gene locus_tag LOCUS_25230 40673 40894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 40903 41337 gene locus_tag LOCUS_25240 40903 41337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 41334 41804 gene locus_tag LOCUS_25250 41334 41804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 41810 42292 gene locus_tag LOCUS_25260 41810 42292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 42364 43476 gene locus_tag LOCUS_25270 gene prfB 42364 43476 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776050.1 protein_id gnl|my_center|LOCUS_25270 44036 43473 gene locus_tag LOCUS_25280 44036 43473 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092983.1 protein_id gnl|my_center|LOCUS_25280 44199 45053 gene locus_tag LOCUS_25290 gene ftsE 44199 45053 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_25290 45050 45958 gene locus_tag LOCUS_25300 gene ftsX 45050 45958 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975844.1 protein_id gnl|my_center|LOCUS_25300 46017 47348 gene locus_tag LOCUS_25310 46017 47348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 47391 47915 gene locus_tag LOCUS_25320 gene smpB 47391 47915 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975846.1 protein_id gnl|my_center|LOCUS_25320 47996 49849 gene locus_tag LOCUS_25330 47996 49849 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223053.1 protein_id gnl|my_center|LOCUS_25330 >Feature sequence28 601 77 gene locus_tag LOCUS_25340 601 77 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229904.1 protein_id gnl|my_center|LOCUS_25340 1866 682 gene locus_tag LOCUS_25350 gene rlmN 1866 682 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973380.1 protein_id gnl|my_center|LOCUS_25350 2741 1863 gene locus_tag LOCUS_25360 2741 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 3359 2802 gene locus_tag LOCUS_25370 gene frr 3359 2802 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973383.1 protein_id gnl|my_center|LOCUS_25370 4136 3399 gene locus_tag LOCUS_25380 gene pyrH 4136 3399 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804636.1 protein_id gnl|my_center|LOCUS_25380 5097 4267 gene locus_tag LOCUS_25390 gene tsf 5097 4267 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804635.1 protein_id gnl|my_center|LOCUS_25390 6159 5518 gene locus_tag LOCUS_25400 6159 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25400 7723 6455 gene locus_tag LOCUS_25410 7723 6455 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030377.1 protein_id gnl|my_center|LOCUS_25410 7993 9171 gene locus_tag LOCUS_25420 7993 9171 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029150.1 protein_id gnl|my_center|LOCUS_25420 9340 9885 gene locus_tag LOCUS_25430 9340 9885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 10485 9892 gene locus_tag LOCUS_25440 10485 9892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 10514 10747 gene locus_tag LOCUS_25450 10514 10747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 11984 11025 gene locus_tag LOCUS_25460 11984 11025 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088347.1 protein_id gnl|my_center|LOCUS_25460 13330 12173 gene locus_tag LOCUS_25470 gene dprA 13330 12173 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804631.1 protein_id gnl|my_center|LOCUS_25470 14175 13327 gene locus_tag LOCUS_25480 14175 13327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 14864 14082 gene locus_tag LOCUS_25490 14864 14082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25490 15228 14866 gene locus_tag LOCUS_25500 15228 14866 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872622.1 protein_id gnl|my_center|LOCUS_25500 15667 15365 gene locus_tag LOCUS_25510 15667 15365 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096226.1 protein_id gnl|my_center|LOCUS_25510 16568 15678 gene locus_tag LOCUS_25520 16568 15678 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804627.1 protein_id gnl|my_center|LOCUS_25520 17484 16573 gene locus_tag LOCUS_25530 17484 16573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25530 18321 17497 gene locus_tag LOCUS_25540 18321 17497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 18709 18344 gene locus_tag LOCUS_25550 gene rplS 18709 18344 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973398.1 protein_id gnl|my_center|LOCUS_25550 19871 18918 gene locus_tag LOCUS_25560 19871 18918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 20727 20035 gene locus_tag LOCUS_25570 gene trmD 20727 20035 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804623.1 protein_id gnl|my_center|LOCUS_25570 21265 20729 gene locus_tag LOCUS_25580 gene rimM 21265 20729 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223850.1 protein_id gnl|my_center|LOCUS_25580 21644 21405 gene locus_tag LOCUS_25590 21644 21405 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973401.1 protein_id gnl|my_center|LOCUS_25590 22318 21647 gene locus_tag LOCUS_25600 22318 21647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 23500 22496 gene locus_tag LOCUS_25610 23500 22496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 26855 23625 gene locus_tag LOCUS_25620 26855 23625 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228544.1 protein_id gnl|my_center|LOCUS_25620 28189 27104 gene locus_tag LOCUS_25630 28189 27104 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976959.1 protein_id gnl|my_center|LOCUS_25630 28286 29167 gene locus_tag LOCUS_25640 28286 29167 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200823401.1 protein_id gnl|my_center|LOCUS_25640 30115 29189 gene locus_tag LOCUS_25650 30115 29189 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 protein_id gnl|my_center|LOCUS_25650 30268 30891 gene locus_tag LOCUS_25660 30268 30891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 30999 31187 gene locus_tag LOCUS_25670 30999 31187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 32847 31222 gene locus_tag LOCUS_25680 gene ffh 32847 31222 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804617.1 protein_id gnl|my_center|LOCUS_25680 32890 33297 gene locus_tag LOCUS_25690 32890 33297 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029511.1 protein_id gnl|my_center|LOCUS_25690 35767 33362 gene locus_tag LOCUS_25700 35767 33362 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487177.1 protein_id gnl|my_center|LOCUS_25700 36129 35791 gene locus_tag LOCUS_25710 36129 35791 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051565.1 protein_id gnl|my_center|LOCUS_25710 37511 36126 gene locus_tag LOCUS_25720 37511 36126 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063182.1 protein_id gnl|my_center|LOCUS_25720 38898 37516 gene locus_tag LOCUS_25730 38898 37516 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087724.1 protein_id gnl|my_center|LOCUS_25730 40214 39003 gene locus_tag LOCUS_25740 gene ftsY 40214 39003 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164278219.1 protein_id gnl|my_center|LOCUS_25740 42271 40292 gene locus_tag LOCUS_25750 42271 40292 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089548.1 protein_id gnl|my_center|LOCUS_25750 42652 42978 gene locus_tag LOCUS_25760 42652 42978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 43607 42927 gene locus_tag LOCUS_25770 43607 42927 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918344.1 protein_id gnl|my_center|LOCUS_25770 43747 44976 gene locus_tag LOCUS_25780 43747 44976 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816310.1 protein_id gnl|my_center|LOCUS_25780 45689 45114 gene locus_tag LOCUS_25790 45689 45114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25790 >Feature sequence29 1054 677 gene locus_tag LOCUS_25800 1054 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 2683 3093 gene locus_tag LOCUS_25810 2683 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 3156 3614 gene locus_tag LOCUS_25820 3156 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25820 3888 4757 gene locus_tag LOCUS_25830 3888 4757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25830 5198 6328 gene locus_tag LOCUS_25840 5198 6328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 7283 6552 gene locus_tag LOCUS_25850 7283 6552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 7546 7355 gene locus_tag LOCUS_25860 7546 7355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 7660 8436 gene locus_tag LOCUS_25870 7660 8436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 9477 8437 gene locus_tag LOCUS_25880 9477 8437 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804166.1 protein_id gnl|my_center|LOCUS_25880 14306 9474 gene locus_tag LOCUS_25890 14306 9474 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950644.1 protein_id gnl|my_center|LOCUS_25890 14653 14321 gene locus_tag LOCUS_25900 14653 14321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 14834 15277 gene locus_tag LOCUS_25910 14834 15277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 15380 15589 gene locus_tag LOCUS_25920 15380 15589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 15597 16316 gene locus_tag LOCUS_25930 15597 16316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 16926 16850 gene locus_tag LOCUS_t00350 16926 16850 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 18025 17090 gene locus_tag LOCUS_25940 18025 17090 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899637.1 protein_id gnl|my_center|LOCUS_25940 18164 18616 gene locus_tag LOCUS_25950 18164 18616 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419765.1 protein_id gnl|my_center|LOCUS_25950 21012 18625 gene locus_tag LOCUS_25960 21012 18625 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930028.1 protein_id gnl|my_center|LOCUS_25960 21297 21605 gene locus_tag LOCUS_25970 21297 21605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 22928 21795 gene locus_tag LOCUS_25980 22928 21795 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_25980 23971 22925 gene locus_tag LOCUS_25990 23971 22925 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897588.1 protein_id gnl|my_center|LOCUS_25990 24020 24193 gene locus_tag LOCUS_26000 24020 24193 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897587.1 protein_id gnl|my_center|LOCUS_26000 24193 24681 gene locus_tag LOCUS_26010 24193 24681 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975361.1 protein_id gnl|my_center|LOCUS_26010 24696 25556 gene locus_tag LOCUS_26020 24696 25556 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230560.1 protein_id gnl|my_center|LOCUS_26020 25577 26404 gene locus_tag LOCUS_26030 25577 26404 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975364.1 protein_id gnl|my_center|LOCUS_26030 27093 26482 gene locus_tag LOCUS_26040 27093 26482 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175285932.1 protein_id gnl|my_center|LOCUS_26040 27275 28015 gene locus_tag LOCUS_26050 gene nth 27275 28015 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230550.1 protein_id gnl|my_center|LOCUS_26050 28012 28731 gene locus_tag LOCUS_26060 28012 28731 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029090.1 protein_id gnl|my_center|LOCUS_26060 28728 29936 gene locus_tag LOCUS_26070 28728 29936 CDS product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136209493.1 protein_id gnl|my_center|LOCUS_26070 30876 29926 gene locus_tag LOCUS_26080 30876 29926 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029089.1 protein_id gnl|my_center|LOCUS_26080 31339 30893 gene locus_tag LOCUS_26090 31339 30893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 31588 33192 gene locus_tag LOCUS_26100 31588 33192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 34603 33296 gene locus_tag LOCUS_26110 gene nhaA 34603 33296 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728574.1 protein_id gnl|my_center|LOCUS_26110 34777 35625 gene locus_tag LOCUS_26120 34777 35625 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460080.1 protein_id gnl|my_center|LOCUS_26120 35893 35693 gene locus_tag LOCUS_26130 35893 35693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 37874 35904 gene locus_tag LOCUS_26140 gene acs 37874 35904 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975373.1 protein_id gnl|my_center|LOCUS_26140 39406 38060 gene locus_tag LOCUS_26150 gene gdhA 39406 38060 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896839.1 protein_id gnl|my_center|LOCUS_26150 39967 39602 gene locus_tag LOCUS_26160 39967 39602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 40285 41322 gene locus_tag LOCUS_26170 gene trpS 40285 41322 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222753.1 protein_id gnl|my_center|LOCUS_26170 43170 41575 gene locus_tag LOCUS_26180 43170 41575 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223483.1 protein_id gnl|my_center|LOCUS_26180 43511 43167 gene locus_tag LOCUS_26190 43511 43167 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223484.1 protein_id gnl|my_center|LOCUS_26190 44819 43746 gene locus_tag LOCUS_26200 44819 43746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26200 >Feature sequence30 662 498 gene locus_tag LOCUS_26210 662 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 2560 611 gene locus_tag LOCUS_26220 gene ettA 2560 611 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804765.1 protein_id gnl|my_center|LOCUS_26220 3274 2696 gene locus_tag LOCUS_26230 3274 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 5100 3436 gene locus_tag LOCUS_26240 5100 3436 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776426.1 protein_id gnl|my_center|LOCUS_26240 6815 5097 gene locus_tag LOCUS_26250 6815 5097 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073255020.1 protein_id gnl|my_center|LOCUS_26250 7116 7042 gene locus_tag LOCUS_t00360 7116 7042 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8296 7142 gene locus_tag LOCUS_26260 8296 7142 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230460.1 protein_id gnl|my_center|LOCUS_26260 8308 8478 gene locus_tag LOCUS_26270 8308 8478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 8488 9270 gene locus_tag LOCUS_26280 gene orn 8488 9270 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976007.1 protein_id gnl|my_center|LOCUS_26280 9301 9376 gene locus_tag LOCUS_t00370 9301 9376 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 9445 10131 gene locus_tag LOCUS_26290 9445 10131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 10186 10258 gene locus_tag LOCUS_t00380 10186 10258 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 10659 10312 gene locus_tag LOCUS_26300 10659 10312 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975911.1 protein_id gnl|my_center|LOCUS_26300 10950 10678 gene locus_tag LOCUS_26310 10950 10678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 11466 10999 gene locus_tag LOCUS_26320 gene bcp 11466 10999 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730061.1 protein_id gnl|my_center|LOCUS_26320 11594 12295 gene locus_tag LOCUS_26330 11594 12295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26330 12292 12576 gene locus_tag LOCUS_26340 12292 12576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26340 12566 13237 gene locus_tag LOCUS_26350 gene cbiQ 12566 13237 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975656.1 protein_id gnl|my_center|LOCUS_26350 13237 14019 gene locus_tag LOCUS_26360 13237 14019 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028802.1 protein_id gnl|my_center|LOCUS_26360 14866 13985 gene locus_tag LOCUS_26370 14866 13985 CDS product 5-oxoprolinase/urea amidolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079952.1 protein_id gnl|my_center|LOCUS_26370 15537 14863 gene locus_tag LOCUS_26380 15537 14863 CDS product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079953.1 protein_id gnl|my_center|LOCUS_26380 16436 15528 gene locus_tag LOCUS_26390 16436 15528 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105454.1 protein_id gnl|my_center|LOCUS_26390 16442 16360 gene locus_tag LOCUS_t00390 16442 16360 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 18072 16480 gene locus_tag LOCUS_26400 18072 16480 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027201.1 protein_id gnl|my_center|LOCUS_26400 18683 18069 gene locus_tag LOCUS_26410 gene rdgB 18683 18069 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028655.1 protein_id gnl|my_center|LOCUS_26410 19384 18680 gene locus_tag LOCUS_26420 gene rph 19384 18680 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975906.1 protein_id gnl|my_center|LOCUS_26420 20271 19507 gene locus_tag LOCUS_26430 20271 19507 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776023.1 protein_id gnl|my_center|LOCUS_26430 21134 20268 gene locus_tag LOCUS_26440 gene murI 21134 20268 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567685.1 protein_id gnl|my_center|LOCUS_26440 21812 21186 gene locus_tag LOCUS_26450 21812 21186 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776025.1 protein_id gnl|my_center|LOCUS_26450 22106 21816 gene locus_tag LOCUS_26460 gene clpS 22106 21816 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030180153.1 protein_id gnl|my_center|LOCUS_26460 22129 23460 gene locus_tag LOCUS_26470 22129 23460 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028662.1 protein_id gnl|my_center|LOCUS_26470 23497 24087 gene locus_tag LOCUS_26480 23497 24087 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975893.1 protein_id gnl|my_center|LOCUS_26480 24096 25316 gene locus_tag LOCUS_26490 24096 25316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 25398 26234 gene locus_tag LOCUS_26500 25398 26234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113317.1 protein_id gnl|my_center|LOCUS_26500 26234 27457 gene locus_tag LOCUS_26510 gene fahA 26234 27457 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224839.1 protein_id gnl|my_center|LOCUS_26510 28692 27502 gene locus_tag LOCUS_26520 28692 27502 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229485.1 protein_id gnl|my_center|LOCUS_26520 28772 29311 gene locus_tag LOCUS_26530 28772 29311 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704464.1 protein_id gnl|my_center|LOCUS_26530 30157 29321 gene locus_tag LOCUS_26540 30157 29321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 30269 31651 gene locus_tag LOCUS_26550 30269 31651 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404453.1 protein_id gnl|my_center|LOCUS_26550 31666 32196 gene locus_tag LOCUS_26560 31666 32196 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227463.1 protein_id gnl|my_center|LOCUS_26560 32270 32818 gene locus_tag LOCUS_26570 32270 32818 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227463.1 protein_id gnl|my_center|LOCUS_26570 33146 32829 gene locus_tag LOCUS_26580 33146 32829 CDS product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030402030.1 protein_id gnl|my_center|LOCUS_26580 34363 33191 gene locus_tag LOCUS_26590 34363 33191 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085756.1 protein_id gnl|my_center|LOCUS_26590 34773 34360 gene locus_tag LOCUS_26600 34773 34360 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892192.1 protein_id gnl|my_center|LOCUS_26600 35323 34796 gene locus_tag LOCUS_26610 35323 34796 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865482.1 protein_id gnl|my_center|LOCUS_26610 37727 35409 gene locus_tag LOCUS_26620 37727 35409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 38230 37832 gene locus_tag LOCUS_26630 38230 37832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 38916 38227 gene locus_tag LOCUS_26640 38916 38227 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222316.1 protein_id gnl|my_center|LOCUS_26640 38934 39593 gene locus_tag LOCUS_26650 38934 39593 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113129.1 protein_id gnl|my_center|LOCUS_26650 39622 40050 gene locus_tag LOCUS_26660 gene trxA 39622 40050 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027416.1 protein_id gnl|my_center|LOCUS_26660 40097 40489 gene locus_tag LOCUS_26670 40097 40489 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230234.1 protein_id gnl|my_center|LOCUS_26670 40962 40597 gene locus_tag LOCUS_tm00010 40962 40597 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 41177 44605 gene locus_tag LOCUS_26680 41177 44605 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223655.1 protein_id gnl|my_center|LOCUS_26680 <45345 44622 gene locus_tag LOCUS_26690 <45345 44622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005111288.1:polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB >Feature sequence31 722 1264 gene locus_tag LOCUS_26700 722 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403957.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26700 2620 1271 gene locus_tag LOCUS_26710 gene hisS 2620 1271 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805006.1 protein_id gnl|my_center|LOCUS_26710 8125 2684 gene locus_tag LOCUS_26720 8125 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 9059 8274 gene locus_tag LOCUS_26730 9059 8274 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977317.1 protein_id gnl|my_center|LOCUS_26730 9504 9061 gene locus_tag LOCUS_26740 9504 9061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 9422 9958 gene locus_tag LOCUS_26750 9422 9958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 9963 11498 gene locus_tag LOCUS_26760 9963 11498 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805005.1 protein_id gnl|my_center|LOCUS_26760 13867 11573 gene locus_tag LOCUS_26770 gene relA 13867 11573 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 protein_id gnl|my_center|LOCUS_26770 14436 13891 gene locus_tag LOCUS_26780 14436 13891 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256182.1 protein_id gnl|my_center|LOCUS_26780 15656 14433 gene locus_tag LOCUS_26790 gene secF 15656 14433 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805001.1 protein_id gnl|my_center|LOCUS_26790 17487 15658 gene locus_tag LOCUS_26800 gene secD 17487 15658 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027823.1 protein_id gnl|my_center|LOCUS_26800 17802 17497 gene locus_tag LOCUS_26810 gene yajC 17802 17497 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068913.1 protein_id gnl|my_center|LOCUS_26810 19091 17946 gene locus_tag LOCUS_26820 gene ruvB 19091 17946 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977309.1 protein_id gnl|my_center|LOCUS_26820 19690 19094 gene locus_tag LOCUS_26830 gene ruvA 19690 19094 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027825.1 protein_id gnl|my_center|LOCUS_26830 20232 19687 gene locus_tag LOCUS_26840 gene ruvC 20232 19687 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977307.1 protein_id gnl|my_center|LOCUS_26840 21109 20342 gene locus_tag LOCUS_26850 21109 20342 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413464.1 protein_id gnl|my_center|LOCUS_26850 21275 22084 gene locus_tag LOCUS_26860 21275 22084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 22700 22095 gene locus_tag LOCUS_26870 gene pdxT 22700 22095 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111403.1 protein_id gnl|my_center|LOCUS_26870 23593 22697 gene locus_tag LOCUS_26880 gene pdxS 23593 22697 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070939476.1 protein_id gnl|my_center|LOCUS_26880 24085 23723 gene locus_tag LOCUS_26890 24085 23723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 24549 24082 gene locus_tag LOCUS_26900 24549 24082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921215.1 protein_id gnl|my_center|LOCUS_26900 25181 24603 gene locus_tag LOCUS_26910 25181 24603 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027827.1 protein_id gnl|my_center|LOCUS_26910 26377 25178 gene locus_tag LOCUS_26920 26377 25178 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027828.1 protein_id gnl|my_center|LOCUS_26920 27339 26374 gene locus_tag LOCUS_26930 27339 26374 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 protein_id gnl|my_center|LOCUS_26930 27944 27336 gene locus_tag LOCUS_26940 27944 27336 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027830.1 protein_id gnl|my_center|LOCUS_26940 28641 28084 gene locus_tag LOCUS_26950 28641 28084 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804993.1 protein_id gnl|my_center|LOCUS_26950 30646 28667 gene locus_tag LOCUS_26960 gene thrS 30646 28667 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804992.1 protein_id gnl|my_center|LOCUS_26960 31648 30797 gene locus_tag LOCUS_26970 31648 30797 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230939.1 protein_id gnl|my_center|LOCUS_26970 33003 31645 gene locus_tag LOCUS_26980 33003 31645 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230940.1 protein_id gnl|my_center|LOCUS_26980 34243 33005 gene locus_tag LOCUS_26990 34243 33005 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230941.1 protein_id gnl|my_center|LOCUS_26990 34493 34419 gene locus_tag LOCUS_t00400 34493 34419 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 35406 34561 gene locus_tag LOCUS_27000 35406 34561 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977279.1 protein_id gnl|my_center|LOCUS_27000 35685 36815 gene locus_tag LOCUS_27010 35685 36815 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899420.1 protein_id gnl|my_center|LOCUS_27010 36812 37297 gene locus_tag LOCUS_27020 36812 37297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 37450 37683 gene locus_tag LOCUS_27030 37450 37683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 37882 38199 gene locus_tag LOCUS_27040 37882 38199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 38196 40655 gene locus_tag LOCUS_27050 38196 40655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 40798 41184 gene locus_tag LOCUS_27060 40798 41184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 41181 41465 gene locus_tag LOCUS_27070 41181 41465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 41498 41881 gene locus_tag LOCUS_27080 41498 41881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 41993 42694 gene locus_tag LOCUS_27090 41993 42694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 42691 42960 gene locus_tag LOCUS_27100 42691 42960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 43707 43510 gene locus_tag LOCUS_27110 43707 43510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 43976 43704 gene locus_tag LOCUS_27120 43976 43704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 44347 43973 gene locus_tag LOCUS_27130 44347 43973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 44807 44505 gene locus_tag LOCUS_27140 44807 44505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 44974 44807 gene locus_tag LOCUS_27150 44974 44807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 >Feature sequence32 77 562 gene locus_tag LOCUS_27160 77 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 846 1016 gene locus_tag LOCUS_27170 846 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 1779 1240 gene locus_tag LOCUS_27180 1779 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 2056 1892 gene locus_tag LOCUS_27190 2056 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 2736 2065 gene locus_tag LOCUS_27200 2736 2065 CDS product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776677.1 protein_id gnl|my_center|LOCUS_27200 3170 2889 gene locus_tag LOCUS_27210 3170 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27210 3655 3347 gene locus_tag LOCUS_27220 3655 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 3768 4082 gene locus_tag LOCUS_27230 3768 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 4852 4187 gene locus_tag LOCUS_27240 4852 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 4842 5021 gene locus_tag LOCUS_27250 4842 5021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 5622 5104 gene locus_tag LOCUS_27260 5622 5104 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878080.1 protein_id gnl|my_center|LOCUS_27260 5934 7067 gene locus_tag LOCUS_27270 5934 7067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 7698 7279 gene locus_tag LOCUS_27280 7698 7279 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896644.1 protein_id gnl|my_center|LOCUS_27280 8596 7892 gene locus_tag LOCUS_27290 8596 7892 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 protein_id gnl|my_center|LOCUS_27290 9923 8589 gene locus_tag LOCUS_27300 9923 8589 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776429.1 protein_id gnl|my_center|LOCUS_27300 11497 10076 gene locus_tag LOCUS_27310 11497 10076 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977375.1 protein_id gnl|my_center|LOCUS_27310 11853 11539 gene locus_tag LOCUS_27320 11853 11539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 12001 12444 gene locus_tag LOCUS_27330 12001 12444 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723418.1 protein_id gnl|my_center|LOCUS_27330 13322 12423 gene locus_tag LOCUS_27340 13322 12423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228743.1 protein_id gnl|my_center|LOCUS_27340 14153 13365 gene locus_tag LOCUS_27350 14153 13365 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081153.1 protein_id gnl|my_center|LOCUS_27350 15288 14284 gene locus_tag LOCUS_27360 15288 14284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 15722 16453 gene locus_tag LOCUS_27370 15722 16453 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308861.1 protein_id gnl|my_center|LOCUS_27370 18630 16450 gene locus_tag LOCUS_27380 18630 16450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 19074 19835 gene locus_tag LOCUS_27390 19074 19835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 29059 20027 gene locus_tag LOCUS_27400 29059 20027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 28971 29288 gene locus_tag LOCUS_27410 28971 29288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 30717 29398 gene locus_tag LOCUS_27420 30717 29398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 31191 31904 gene locus_tag LOCUS_27430 31191 31904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 32416 32168 gene locus_tag LOCUS_27440 32416 32168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 32676 35330 gene locus_tag LOCUS_27450 32676 35330 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123738087.1 protein_id gnl|my_center|LOCUS_27450 35335 35970 gene locus_tag LOCUS_27460 35335 35970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 36367 36143 gene locus_tag LOCUS_27470 36367 36143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 37016 36501 gene locus_tag LOCUS_27480 37016 36501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 38407 37013 gene locus_tag LOCUS_27490 38407 37013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 38709 38404 gene locus_tag LOCUS_27500 38709 38404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 39388 39065 gene locus_tag LOCUS_27510 39388 39065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 39852 39385 gene locus_tag LOCUS_27520 39852 39385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 39876 40172 gene locus_tag LOCUS_27530 39876 40172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 41604 40192 gene locus_tag LOCUS_27540 41604 40192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210308580.1 protein_id gnl|my_center|LOCUS_27540 43424 41601 gene locus_tag LOCUS_27550 43424 41601 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942011.1 protein_id gnl|my_center|LOCUS_27550 44846 43545 gene locus_tag LOCUS_27560 44846 43545 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804177.1 protein_id gnl|my_center|LOCUS_27560 >Feature sequence33 1797 1423 gene locus_tag LOCUS_27570 1797 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 3668 3087 gene locus_tag LOCUS_27580 3668 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27580 4024 3662 gene locus_tag LOCUS_27590 4024 3662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27590 4467 4261 gene locus_tag LOCUS_27600 4467 4261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 4676 4464 gene locus_tag LOCUS_27610 4676 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 4971 4702 gene locus_tag LOCUS_27620 4971 4702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 5434 5144 gene locus_tag LOCUS_27630 5434 5144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 6547 6125 gene locus_tag LOCUS_27640 6547 6125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27640 6521 6742 gene locus_tag LOCUS_27650 6521 6742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 7353 8105 gene locus_tag LOCUS_27660 7353 8105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 8157 8447 gene locus_tag LOCUS_27670 8157 8447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 9343 8465 gene locus_tag LOCUS_27680 9343 8465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 9567 10190 gene locus_tag LOCUS_27690 9567 10190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 11070 10204 gene locus_tag LOCUS_27700 11070 10204 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229456.1 protein_id gnl|my_center|LOCUS_27700 11101 11838 gene locus_tag LOCUS_27710 11101 11838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 11841 13163 gene locus_tag LOCUS_27720 11841 13163 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111120.1 protein_id gnl|my_center|LOCUS_27720 14792 13149 gene locus_tag LOCUS_27730 14792 13149 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730039.1 protein_id gnl|my_center|LOCUS_27730 14798 15154 gene locus_tag LOCUS_27740 14798 15154 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003999914.1 protein_id gnl|my_center|LOCUS_27740 15209 15715 gene locus_tag LOCUS_27750 15209 15715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 16451 15822 gene locus_tag LOCUS_27760 16451 15822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 16575 19643 gene locus_tag LOCUS_27770 16575 19643 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805171.1 protein_id gnl|my_center|LOCUS_27770 19643 22087 gene locus_tag LOCUS_27780 19643 22087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 22610 22386 gene locus_tag LOCUS_27790 22610 22386 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974621.1 protein_id gnl|my_center|LOCUS_27790 23225 22611 gene locus_tag LOCUS_27800 23225 22611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 23480 23391 gene locus_tag LOCUS_t00410 23480 23391 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 24160 23549 gene locus_tag LOCUS_27810 24160 23549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 24781 24221 gene locus_tag LOCUS_27820 24781 24221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 24768 25406 gene locus_tag LOCUS_27830 gene upp 24768 25406 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974921.1 protein_id gnl|my_center|LOCUS_27830 25666 25836 gene locus_tag LOCUS_27840 25666 25836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 25870 26790 gene locus_tag LOCUS_27850 25870 26790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 28367 26976 gene locus_tag LOCUS_27860 gene pntB 28367 26976 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014036.1 protein_id gnl|my_center|LOCUS_27860 29917 28364 gene locus_tag LOCUS_27870 29917 28364 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726673.1 protein_id gnl|my_center|LOCUS_27870 31151 30168 gene locus_tag LOCUS_27880 31151 30168 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975143.1 protein_id gnl|my_center|LOCUS_27880 33680 31188 gene locus_tag LOCUS_27890 33680 31188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 34525 33677 gene locus_tag LOCUS_27900 34525 33677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 35209 34784 gene locus_tag LOCUS_27910 35209 34784 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255194.1 protein_id gnl|my_center|LOCUS_27910 35758 35285 gene locus_tag LOCUS_27920 35758 35285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27920 36423 35722 gene locus_tag LOCUS_27930 36423 35722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27930 36785 36453 gene locus_tag LOCUS_27940 36785 36453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 37161 36841 gene locus_tag LOCUS_27950 37161 36841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 38698 37163 gene locus_tag LOCUS_27960 38698 37163 CDS product aromatic/alkene/methane monooxygenase hydroxylase/oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206217.1 protein_id gnl|my_center|LOCUS_27960 39009 38716 gene locus_tag LOCUS_27970 39009 38716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 40052 39006 gene locus_tag LOCUS_27980 40052 39006 CDS product aromatic/alkene monooxygenase hydroxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206218.1 protein_id gnl|my_center|LOCUS_27980 40573 40148 gene locus_tag LOCUS_27990 40573 40148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 41415 42026 gene locus_tag LOCUS_28000 41415 42026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 <42688 42109 gene locus_tag LOCUS_28010 <42688 42109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001075831.1:glucuronide transporter >Feature sequence34 1443 877 gene locus_tag LOCUS_28020 1443 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28020 2111 1440 gene locus_tag LOCUS_28030 2111 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28030 3848 2475 gene locus_tag LOCUS_28040 3848 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550161.1 protein_id gnl|my_center|LOCUS_28040 4042 3818 gene locus_tag LOCUS_28050 4042 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 4180 5166 gene locus_tag LOCUS_28060 4180 5166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 6136 5450 gene locus_tag LOCUS_28070 6136 5450 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079790.1 protein_id gnl|my_center|LOCUS_28070 6720 6166 gene locus_tag LOCUS_28080 gene pyrE 6720 6166 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029143.1 protein_id gnl|my_center|LOCUS_28080 7774 6794 gene locus_tag LOCUS_28090 7774 6794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 8560 7784 gene locus_tag LOCUS_28100 8560 7784 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029850.1 protein_id gnl|my_center|LOCUS_28100 8675 9466 gene locus_tag LOCUS_28110 8675 9466 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402176.1 protein_id gnl|my_center|LOCUS_28110 9646 10443 gene locus_tag LOCUS_28120 9646 10443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28120 10427 11755 gene locus_tag LOCUS_28130 10427 11755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28130 11940 12857 gene locus_tag LOCUS_28140 gene hpaD 11940 12857 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228330.1 protein_id gnl|my_center|LOCUS_28140 13462 13004 gene locus_tag LOCUS_28150 13462 13004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 14115 13540 gene locus_tag LOCUS_28160 14115 13540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 15232 14162 gene locus_tag LOCUS_28170 15232 14162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 16591 15242 gene locus_tag LOCUS_28180 16591 15242 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083617.1 protein_id gnl|my_center|LOCUS_28180 17685 16621 gene locus_tag LOCUS_28190 17685 16621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 20362 17741 gene locus_tag LOCUS_28200 gene clpB 20362 17741 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975278.1 protein_id gnl|my_center|LOCUS_28200 20758 20591 gene locus_tag LOCUS_28210 20758 20591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 20835 22874 gene locus_tag LOCUS_28220 20835 22874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 25316 22995 gene locus_tag LOCUS_28230 25316 22995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 25437 25979 gene locus_tag LOCUS_28240 25437 25979 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030929.1 protein_id gnl|my_center|LOCUS_28240 26333 26055 gene locus_tag LOCUS_28250 26333 26055 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978241.1 protein_id gnl|my_center|LOCUS_28250 26508 27740 gene locus_tag LOCUS_28260 26508 27740 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461847.1 protein_id gnl|my_center|LOCUS_28260 27801 28115 gene locus_tag LOCUS_28270 27801 28115 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808391.1 protein_id gnl|my_center|LOCUS_28270 28191 28712 gene locus_tag LOCUS_28280 28191 28712 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943062.1 protein_id gnl|my_center|LOCUS_28280 29794 28955 gene locus_tag LOCUS_28290 29794 28955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 31500 29791 gene locus_tag LOCUS_28300 31500 29791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 33036 31588 gene locus_tag LOCUS_28310 33036 31588 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_28310 33368 33033 gene locus_tag LOCUS_28320 33368 33033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 34216 33365 gene locus_tag LOCUS_28330 34216 33365 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742177.1 protein_id gnl|my_center|LOCUS_28330 <34720 34216 gene locus_tag LOCUS_28340 <34720 34216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226067.1:4-hydroxy-2-oxovalerate aldolase >Feature sequence35 <1 2962 gene locus_tag LOCUS_28350 <1 2962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975807.1:preprotein translocase subunit SecA 3463 2966 gene locus_tag LOCUS_28360 3463 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 4281 3460 gene locus_tag LOCUS_28370 4281 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 4423 4974 gene locus_tag LOCUS_28380 4423 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776073.1 protein_id gnl|my_center|LOCUS_28380 5278 5036 gene locus_tag LOCUS_28390 5278 5036 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776072.1 protein_id gnl|my_center|LOCUS_28390 5370 6065 gene locus_tag LOCUS_28400 5370 6065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 6062 7552 gene locus_tag LOCUS_28410 6062 7552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 7655 9073 gene locus_tag LOCUS_28420 7655 9073 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229720.1 protein_id gnl|my_center|LOCUS_28420 9070 9498 gene locus_tag LOCUS_28430 9070 9498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 11842 9488 gene locus_tag LOCUS_28440 11842 9488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 12135 11839 gene locus_tag LOCUS_28450 12135 11839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 13859 12192 gene locus_tag LOCUS_28460 13859 12192 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028213.1 protein_id gnl|my_center|LOCUS_28460 14242 13856 gene locus_tag LOCUS_28470 14242 13856 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028501.1 protein_id gnl|my_center|LOCUS_28470 15137 14247 gene locus_tag LOCUS_28480 15137 14247 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228591.1 protein_id gnl|my_center|LOCUS_28480 17827 15254 gene locus_tag LOCUS_28490 gene pepN 17827 15254 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804773.1 protein_id gnl|my_center|LOCUS_28490 18178 18762 gene locus_tag LOCUS_28500 18178 18762 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110163.1 protein_id gnl|my_center|LOCUS_28500 18817 19284 gene locus_tag LOCUS_28510 18817 19284 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666673.1 protein_id gnl|my_center|LOCUS_28510 19575 19363 gene locus_tag LOCUS_28520 19575 19363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 19658 20350 gene locus_tag LOCUS_28530 gene trmB 19658 20350 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209991.1 protein_id gnl|my_center|LOCUS_28530 20392 20319 gene locus_tag LOCUS_t00420 20392 20319 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 20566 20642 gene locus_tag LOCUS_t00430 20566 20642 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 20755 22116 gene locus_tag LOCUS_28540 gene tig 20755 22116 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976179.1 protein_id gnl|my_center|LOCUS_28540 22131 23387 gene locus_tag LOCUS_28550 22131 23387 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029671.1 protein_id gnl|my_center|LOCUS_28550 23500 24129 gene locus_tag LOCUS_28560 23500 24129 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115412275.1 protein_id gnl|my_center|LOCUS_28560 24156 24839 gene locus_tag LOCUS_28570 24156 24839 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930165.1 protein_id gnl|my_center|LOCUS_28570 25015 26298 gene locus_tag LOCUS_28580 gene clpX 25015 26298 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028457.1 protein_id gnl|my_center|LOCUS_28580 26315 27022 gene locus_tag LOCUS_28590 26315 27022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 27330 26986 gene locus_tag LOCUS_28600 27330 26986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 27509 28153 gene locus_tag LOCUS_28610 27509 28153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 30724 28304 gene locus_tag LOCUS_28620 gene valS 30724 28304 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054756.1 protein_id gnl|my_center|LOCUS_28620 31156 31443 gene locus_tag LOCUS_28630 31156 31443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 32650 32273 gene locus_tag LOCUS_28640 32650 32273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28640 33380 33132 gene locus_tag LOCUS_28650 33380 33132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28650 33619 33377 gene locus_tag LOCUS_28660 33619 33377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 >Feature sequence36 897 91 gene locus_tag LOCUS_28670 897 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 955 2151 gene locus_tag LOCUS_28680 955 2151 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728292.1 protein_id gnl|my_center|LOCUS_28680 2151 3248 gene locus_tag LOCUS_28690 gene mnmA 2151 3248 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973510.1 protein_id gnl|my_center|LOCUS_28690 3258 4265 gene locus_tag LOCUS_28700 3258 4265 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030277.1 protein_id gnl|my_center|LOCUS_28700 5707 4382 gene locus_tag LOCUS_28710 5707 4382 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630264.1 protein_id gnl|my_center|LOCUS_28710 5849 8038 gene locus_tag LOCUS_28720 gene ligA 5849 8038 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728295.1 protein_id gnl|my_center|LOCUS_28720 8294 8061 gene locus_tag LOCUS_28730 8294 8061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 9147 8311 gene locus_tag LOCUS_28740 9147 8311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 9603 9205 gene locus_tag LOCUS_28750 9603 9205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 11114 9600 gene locus_tag LOCUS_28760 11114 9600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 11443 11111 gene locus_tag LOCUS_28770 11443 11111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 11856 11440 gene locus_tag LOCUS_28780 11856 11440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 12088 12384 gene locus_tag LOCUS_28790 gene gatC 12088 12384 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973500.1 protein_id gnl|my_center|LOCUS_28790 12471 13988 gene locus_tag LOCUS_28800 gene gatA 12471 13988 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223570.1 protein_id gnl|my_center|LOCUS_28800 13990 15537 gene locus_tag LOCUS_28810 gene gatB 13990 15537 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030281.1 protein_id gnl|my_center|LOCUS_28810 16418 15624 gene locus_tag LOCUS_28820 16418 15624 CDS product DUF937 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060195.1 protein_id gnl|my_center|LOCUS_28820 16482 17429 gene locus_tag LOCUS_28830 16482 17429 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030286.1 protein_id gnl|my_center|LOCUS_28830 19334 17571 gene locus_tag LOCUS_28840 19334 17571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 19494 20012 gene locus_tag LOCUS_28850 19494 20012 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805188.1 protein_id gnl|my_center|LOCUS_28850 21198 20086 gene locus_tag LOCUS_28860 21198 20086 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015323.1 protein_id gnl|my_center|LOCUS_28860 21868 21236 gene locus_tag LOCUS_28870 gene folE 21868 21236 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072479192.1 protein_id gnl|my_center|LOCUS_28870 22138 21884 gene locus_tag LOCUS_28880 22138 21884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 22788 22135 gene locus_tag LOCUS_28890 22788 22135 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731458.1 protein_id gnl|my_center|LOCUS_28890 23013 24881 gene locus_tag LOCUS_28900 gene ilvD 23013 24881 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223580.1 protein_id gnl|my_center|LOCUS_28900 24984 25754 gene locus_tag LOCUS_28910 24984 25754 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776310.1 protein_id gnl|my_center|LOCUS_28910 25724 27325 gene locus_tag LOCUS_28920 25724 27325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776311.1 protein_id gnl|my_center|LOCUS_28920 28775 27351 gene locus_tag LOCUS_28930 28775 27351 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226839.1 protein_id gnl|my_center|LOCUS_28930 30229 28772 gene locus_tag LOCUS_28940 30229 28772 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226840.1 protein_id gnl|my_center|LOCUS_28940 30370 32271 gene locus_tag LOCUS_28950 30370 32271 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284399.1 protein_id gnl|my_center|LOCUS_28950 32286 32798 gene locus_tag LOCUS_28960 gene ilvN 32286 32798 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973483.1 protein_id gnl|my_center|LOCUS_28960 >Feature sequence37 <1 566 gene locus_tag LOCUS_28970 <1 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007052519.1:imidazoleglycerol-phosphate dehydratase HisB 563 1174 gene locus_tag LOCUS_28980 563 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 1171 1812 gene locus_tag LOCUS_28990 gene hisH 1171 1812 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057924.1 protein_id gnl|my_center|LOCUS_28990 1989 2189 gene locus_tag LOCUS_29000 1989 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 2186 2914 gene locus_tag LOCUS_29010 gene priA 2186 2914 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776203.1 protein_id gnl|my_center|LOCUS_29010 2911 3297 gene locus_tag LOCUS_29020 2911 3297 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976767.1 protein_id gnl|my_center|LOCUS_29020 3390 4097 gene locus_tag LOCUS_29030 3390 4097 CDS product SseB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027875.1 protein_id gnl|my_center|LOCUS_29030 4266 5090 gene locus_tag LOCUS_29040 4266 5090 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228103.1 protein_id gnl|my_center|LOCUS_29040 5274 6548 gene locus_tag LOCUS_29050 5274 6548 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222356.1 protein_id gnl|my_center|LOCUS_29050 8169 6625 gene locus_tag LOCUS_29060 8169 6625 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776487.1 protein_id gnl|my_center|LOCUS_29060 8309 9571 gene locus_tag LOCUS_29070 8309 9571 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230592.1 protein_id gnl|my_center|LOCUS_29070 9684 11621 gene locus_tag LOCUS_29080 9684 11621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 11882 12898 gene locus_tag LOCUS_29090 11882 12898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 12996 13190 gene locus_tag LOCUS_29100 gene rpmI 12996 13190 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776198.1 protein_id gnl|my_center|LOCUS_29100 13224 13607 gene locus_tag LOCUS_29110 gene rplT 13224 13607 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559056.1 protein_id gnl|my_center|LOCUS_29110 13660 14451 gene locus_tag LOCUS_29120 13660 14451 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027873.1 protein_id gnl|my_center|LOCUS_29120 14571 15680 gene locus_tag LOCUS_29130 gene pheS 14571 15680 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977229.1 protein_id gnl|my_center|LOCUS_29130 15682 18228 gene locus_tag LOCUS_29140 gene pheT 15682 18228 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027870.1 protein_id gnl|my_center|LOCUS_29140 18243 19436 gene locus_tag LOCUS_29150 18243 19436 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895662.1 protein_id gnl|my_center|LOCUS_29150 19462 20505 gene locus_tag LOCUS_29160 gene argC 19462 20505 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977244.1 protein_id gnl|my_center|LOCUS_29160 20502 21680 gene locus_tag LOCUS_29170 gene argJ 20502 21680 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027859.1 protein_id gnl|my_center|LOCUS_29170 21714 22652 gene locus_tag LOCUS_29180 gene argB 21714 22652 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227836.1 protein_id gnl|my_center|LOCUS_29180 22649 23866 gene locus_tag LOCUS_29190 22649 23866 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776179.1 protein_id gnl|my_center|LOCUS_29190 23863 24342 gene locus_tag LOCUS_29200 23863 24342 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977248.1 protein_id gnl|my_center|LOCUS_29200 24405 25961 gene locus_tag LOCUS_29210 gene argH 24405 25961 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776175.1 protein_id gnl|my_center|LOCUS_29210 26141 27430 gene locus_tag LOCUS_29220 26141 27430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 27540 27391 gene locus_tag LOCUS_29230 27540 27391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 27544 28293 gene locus_tag LOCUS_29240 27544 28293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29240 28221 28835 gene locus_tag LOCUS_29250 28221 28835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29250 29422 30934 gene locus_tag LOCUS_r00030 29422 30934 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence38 470 171 gene locus_tag LOCUS_29260 470 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 889 470 gene locus_tag LOCUS_29270 gene rplP 889 470 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776370.1 protein_id gnl|my_center|LOCUS_29270 1728 892 gene locus_tag LOCUS_29280 gene rpsC 1728 892 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776371.1 protein_id gnl|my_center|LOCUS_29280 2147 1728 gene locus_tag LOCUS_29290 gene rplV 2147 1728 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776372.1 protein_id gnl|my_center|LOCUS_29290 2428 2147 gene locus_tag LOCUS_29300 gene rpsS 2428 2147 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776373.1 protein_id gnl|my_center|LOCUS_29300 3283 2447 gene locus_tag LOCUS_29310 gene rplB 3283 2447 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776374.1 protein_id gnl|my_center|LOCUS_29310 3610 3311 gene locus_tag LOCUS_29320 gene rplW 3610 3311 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776375.1 protein_id gnl|my_center|LOCUS_29320 4581 3607 gene locus_tag LOCUS_29330 4581 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 5252 4587 gene locus_tag LOCUS_29340 gene rplC 5252 4587 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776377.1 protein_id gnl|my_center|LOCUS_29340 5574 5266 gene locus_tag LOCUS_29350 gene rpsJ 5574 5266 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776378.1 protein_id gnl|my_center|LOCUS_29350 6778 5876 gene locus_tag LOCUS_29360 6778 5876 CDS product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526255.1 protein_id gnl|my_center|LOCUS_29360 7214 7041 gene locus_tag LOCUS_29370 7214 7041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 8149 7211 gene locus_tag LOCUS_29380 8149 7211 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027675.1 protein_id gnl|my_center|LOCUS_29380 8706 8146 gene locus_tag LOCUS_29390 8706 8146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 9246 8710 gene locus_tag LOCUS_29400 9246 8710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 9875 9243 gene locus_tag LOCUS_29410 9875 9243 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537558.1 protein_id gnl|my_center|LOCUS_29410 10656 9901 gene locus_tag LOCUS_29420 10656 9901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 11324 10656 gene locus_tag LOCUS_29430 11324 10656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 11690 11370 gene locus_tag LOCUS_29440 11690 11370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 13131 11806 gene locus_tag LOCUS_29450 13131 11806 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975140.1 protein_id gnl|my_center|LOCUS_29450 14404 13166 gene locus_tag LOCUS_29460 14404 13166 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038894.1 protein_id gnl|my_center|LOCUS_29460 15665 14472 gene locus_tag LOCUS_29470 gene tuf 15665 14472 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029795.1 protein_id gnl|my_center|LOCUS_29470 17877 15775 gene locus_tag LOCUS_29480 gene fusA 17877 15775 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222602.1 protein_id gnl|my_center|LOCUS_29480 18457 17987 gene locus_tag LOCUS_29490 gene rpsG 18457 17987 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776385.1 protein_id gnl|my_center|LOCUS_29490 18828 18457 gene locus_tag LOCUS_29500 gene rpsL 18828 18457 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007167812.1 protein_id gnl|my_center|LOCUS_29500 22568 19878 gene locus_tag LOCUS_29510 gene ppdK 22568 19878 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976309.1 protein_id gnl|my_center|LOCUS_29510 26844 22921 gene locus_tag LOCUS_29520 26844 22921 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974308.1 protein_id gnl|my_center|LOCUS_29520 <27740 26946 gene locus_tag LOCUS_29530 <27740 26946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029792.1:DNA-directed RNA polymerase subunit beta >Feature sequence39 395 4143 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttccgctgtccccatctcgcgacagcgaatagaaac 4414 5688 gene locus_tag LOCUS_29540 4414 5688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 6475 5681 gene locus_tag LOCUS_29550 6475 5681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 7574 6726 gene locus_tag LOCUS_29560 7574 6726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 8269 7571 gene locus_tag LOCUS_29570 8269 7571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 8721 8266 gene locus_tag LOCUS_29580 8721 8266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 10218 9355 gene locus_tag LOCUS_29590 10218 9355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 10292 10528 gene locus_tag LOCUS_29600 10292 10528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 10525 11904 gene locus_tag LOCUS_29610 10525 11904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 11901 13247 gene locus_tag LOCUS_29620 11901 13247 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296723.1 protein_id gnl|my_center|LOCUS_29620 13285 13938 gene locus_tag LOCUS_29630 13285 13938 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323891.1 protein_id gnl|my_center|LOCUS_29630 15057 13984 gene locus_tag LOCUS_29640 15057 13984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 15315 16055 gene locus_tag LOCUS_29650 15315 16055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 16211 17242 gene locus_tag LOCUS_29660 gene fbaA 16211 17242 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230818.1 protein_id gnl|my_center|LOCUS_29660 17247 17702 gene locus_tag LOCUS_29670 17247 17702 CDS product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975291.1 protein_id gnl|my_center|LOCUS_29670 18912 17761 gene locus_tag LOCUS_29680 18912 17761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 21153 19006 gene locus_tag LOCUS_29690 21153 19006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 21268 22575 gene locus_tag LOCUS_29700 21268 22575 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_29700 22582 23115 gene locus_tag LOCUS_29710 22582 23115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 <24940 23242 gene locus_tag LOCUS_29720 <24940 23242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:immunoglobulin domain-containing protein >Feature sequence40 <1 815 gene locus_tag LOCUS_29730 <1 815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975390.1:class I SAM-dependent methyltransferase 851 3742 gene locus_tag LOCUS_29740 851 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 4458 3739 gene locus_tag LOCUS_29750 4458 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 4833 4477 gene locus_tag LOCUS_29760 4833 4477 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975942.1 protein_id gnl|my_center|LOCUS_29760 4950 5588 gene locus_tag LOCUS_29770 4950 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 5723 7471 gene locus_tag LOCUS_29780 5723 7471 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227095.1 protein_id gnl|my_center|LOCUS_29780 7468 9624 gene locus_tag LOCUS_29790 7468 9624 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227096.1 protein_id gnl|my_center|LOCUS_29790 10465 9659 gene locus_tag LOCUS_29800 10465 9659 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231012.1 protein_id gnl|my_center|LOCUS_29800 10570 10827 gene locus_tag LOCUS_29810 10570 10827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 10820 11224 gene locus_tag LOCUS_29820 10820 11224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 12472 11264 gene locus_tag LOCUS_29830 12472 11264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 12608 15493 gene locus_tag LOCUS_29840 gene topA 12608 15493 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776591.1 protein_id gnl|my_center|LOCUS_29840 15897 15490 gene locus_tag LOCUS_29850 15897 15490 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893728.1 protein_id gnl|my_center|LOCUS_29850 16008 17582 gene locus_tag LOCUS_29860 16008 17582 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416051.1 protein_id gnl|my_center|LOCUS_29860 17680 18486 gene locus_tag LOCUS_29870 17680 18486 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728215.1 protein_id gnl|my_center|LOCUS_29870 19512 18505 gene locus_tag LOCUS_29880 19512 18505 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031688.1 protein_id gnl|my_center|LOCUS_29880 20562 19516 gene locus_tag LOCUS_29890 20562 19516 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223416.1 protein_id gnl|my_center|LOCUS_29890 20447 20842 gene locus_tag LOCUS_29900 20447 20842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 20882 21547 gene locus_tag LOCUS_29910 gene tmk 20882 21547 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776596.1 protein_id gnl|my_center|LOCUS_29910 21544 22713 gene locus_tag LOCUS_29920 21544 22713 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230507.1 protein_id gnl|my_center|LOCUS_29920 >Feature sequence41 620 820 gene locus_tag LOCUS_29930 620 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 1184 1642 gene locus_tag LOCUS_29940 1184 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29940 1842 2015 gene locus_tag LOCUS_29950 1842 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29950 2238 2744 gene locus_tag LOCUS_29960 2238 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29960 2820 3773 gene locus_tag LOCUS_29970 2820 3773 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228484.1 protein_id gnl|my_center|LOCUS_29970 3773 4645 gene locus_tag LOCUS_29980 3773 4645 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228483.1 protein_id gnl|my_center|LOCUS_29980 4642 5487 gene locus_tag LOCUS_29990 4642 5487 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228482.1 protein_id gnl|my_center|LOCUS_29990 5726 6052 gene locus_tag LOCUS_30000 5726 6052 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899493.1 protein_id gnl|my_center|LOCUS_30000 6055 6996 gene locus_tag LOCUS_30010 6055 6996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30010 7424 7759 gene locus_tag LOCUS_30020 7424 7759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 7756 9381 gene locus_tag LOCUS_30030 7756 9381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 9393 11015 gene locus_tag LOCUS_30040 9393 11015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 11012 12466 gene locus_tag LOCUS_30050 11012 12466 CDS product RAMP superfamily CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388904.1 protein_id gnl|my_center|LOCUS_30050 12463 12918 gene locus_tag LOCUS_30060 12463 12918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 13228 15051 gene locus_tag LOCUS_30070 13228 15051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 15071 15832 gene locus_tag LOCUS_30080 15071 15832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 15829 16674 gene locus_tag LOCUS_30090 15829 16674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 16655 18583 gene locus_tag LOCUS_30100 16655 18583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 18571 18858 gene locus_tag LOCUS_30110 18571 18858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 19066 22810 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttccgctgtccccatctcgcgacagcgaatagaaac >Feature sequence42 2149 1061 gene locus_tag LOCUS_30120 2149 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30120 2668 2228 gene locus_tag LOCUS_30130 2668 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30130 3716 3039 gene locus_tag LOCUS_30140 3716 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30140 3903 3688 gene locus_tag LOCUS_30150 3903 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30150 4958 4272 gene locus_tag LOCUS_30160 4958 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30160 5501 5103 gene locus_tag LOCUS_30170 5501 5103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 6640 6476 gene locus_tag LOCUS_30180 6640 6476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 7580 7374 gene locus_tag LOCUS_30190 7580 7374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 7804 8313 gene locus_tag LOCUS_30200 7804 8313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30200 8372 8629 gene locus_tag LOCUS_30210 8372 8629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 8626 9105 gene locus_tag LOCUS_30220 8626 9105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 9115 9705 gene locus_tag LOCUS_30230 9115 9705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 9976 9716 gene locus_tag LOCUS_30240 9976 9716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30240 11346 10144 gene locus_tag LOCUS_30250 11346 10144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30250 11661 11407 gene locus_tag LOCUS_30260 11661 11407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 11543 12523 gene locus_tag LOCUS_30270 11543 12523 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030308.1 protein_id gnl|my_center|LOCUS_30270 12520 13356 gene locus_tag LOCUS_30280 12520 13356 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_30280 13398 14882 gene locus_tag LOCUS_30290 13398 14882 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054423.1 protein_id gnl|my_center|LOCUS_30290 14899 15756 gene locus_tag LOCUS_30300 14899 15756 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030973.1 protein_id gnl|my_center|LOCUS_30300 15873 17570 gene locus_tag LOCUS_30310 15873 17570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 18465 17665 gene locus_tag LOCUS_30320 18465 17665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 18911 18462 gene locus_tag LOCUS_30330 18911 18462 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028505.1 protein_id gnl|my_center|LOCUS_30330 18938 19888 gene locus_tag LOCUS_30340 18938 19888 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804769.1 protein_id gnl|my_center|LOCUS_30340 20095 20637 gene locus_tag LOCUS_30350 20095 20637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30350 20588 21043 gene locus_tag LOCUS_30360 20588 21043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30360 21347 21649 gene locus_tag LOCUS_30370 21347 21649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30370 21646 21930 gene locus_tag LOCUS_30380 21646 21930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 22339 22025 gene locus_tag LOCUS_30390 22339 22025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30390 >Feature sequence43 1075 2457 gene locus_tag LOCUS_30400 1075 2457 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123927512.1 protein_id gnl|my_center|LOCUS_30400 2454 3860 gene locus_tag LOCUS_30410 2454 3860 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014188.1 protein_id gnl|my_center|LOCUS_30410 5412 3925 gene locus_tag LOCUS_30420 gene mmcO 5412 3925 CDS product multicopper oxidase MmcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404392.1 protein_id gnl|my_center|LOCUS_30420 6373 5435 gene locus_tag LOCUS_30430 6373 5435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 6711 6370 gene locus_tag LOCUS_30440 6711 6370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 6761 6928 gene locus_tag LOCUS_30450 6761 6928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 7036 9216 gene locus_tag LOCUS_30460 7036 9216 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776000.1 protein_id gnl|my_center|LOCUS_30460 9477 9232 gene locus_tag LOCUS_30470 9477 9232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 9455 9739 gene locus_tag LOCUS_30480 9455 9739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 11536 10481 gene locus_tag LOCUS_30490 11536 10481 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015529.1 protein_id gnl|my_center|LOCUS_30490 12254 11430 gene locus_tag LOCUS_30500 12254 11430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 12484 12723 gene locus_tag LOCUS_30510 12484 12723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 12993 13502 gene locus_tag LOCUS_30520 12993 13502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30520 13786 13610 gene locus_tag LOCUS_30530 13786 13610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 13728 14252 gene locus_tag LOCUS_30540 13728 14252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30540 14322 15164 gene locus_tag LOCUS_30550 14322 15164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 15286 15564 gene locus_tag LOCUS_30560 15286 15564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 15900 16130 gene locus_tag LOCUS_30570 15900 16130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30570 16160 16945 gene locus_tag LOCUS_30580 16160 16945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30580 16948 18255 gene locus_tag LOCUS_30590 16948 18255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30590 18502 18338 gene locus_tag LOCUS_30600 18502 18338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 >Feature sequence44 425 721 gene locus_tag LOCUS_30610 425 721 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776328.1 protein_id gnl|my_center|LOCUS_30610 1184 2095 gene locus_tag LOCUS_30620 1184 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30620 2092 4998 gene locus_tag LOCUS_30630 2092 4998 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082793861.1 protein_id gnl|my_center|LOCUS_30630 5926 5096 gene locus_tag LOCUS_30640 5926 5096 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898703.1 protein_id gnl|my_center|LOCUS_30640 6465 5923 gene locus_tag LOCUS_30650 6465 5923 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405517.1 protein_id gnl|my_center|LOCUS_30650 6495 6974 gene locus_tag LOCUS_30660 6495 6974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 7910 7206 gene locus_tag LOCUS_30670 7910 7206 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230830.1 protein_id gnl|my_center|LOCUS_30670 8066 8998 gene locus_tag LOCUS_30680 8066 8998 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116998.1 protein_id gnl|my_center|LOCUS_30680 9087 9959 gene locus_tag LOCUS_30690 9087 9959 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053659.1 protein_id gnl|my_center|LOCUS_30690 9956 10693 gene locus_tag LOCUS_30700 9956 10693 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051227.1 protein_id gnl|my_center|LOCUS_30700 10770 11384 gene locus_tag LOCUS_30710 10770 11384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30710 11350 11724 gene locus_tag LOCUS_30720 11350 11724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30720 11724 12596 gene locus_tag LOCUS_30730 11724 12596 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228483.1 protein_id gnl|my_center|LOCUS_30730 12593 13429 gene locus_tag LOCUS_30740 12593 13429 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228482.1 protein_id gnl|my_center|LOCUS_30740 13595 14989 gene locus_tag LOCUS_30750 13595 14989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 14991 17441 gene locus_tag LOCUS_30760 14991 17441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 17823 18398 gene locus_tag LOCUS_30770 17823 18398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 18395 18895 gene locus_tag LOCUS_30780 18395 18895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 18995 19393 gene locus_tag LOCUS_30790 18995 19393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 19448 20017 gene locus_tag LOCUS_30800 19448 20017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 >Feature sequence45 1536 1084 gene locus_tag LOCUS_30810 1536 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 1646 2311 gene locus_tag LOCUS_30820 1646 2311 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804665.1 protein_id gnl|my_center|LOCUS_30820 2308 2622 gene locus_tag LOCUS_30830 2308 2622 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804664.1 protein_id gnl|my_center|LOCUS_30830 3417 2650 gene locus_tag LOCUS_30840 gene dapB 3417 2650 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030428.1 protein_id gnl|my_center|LOCUS_30840 3416 4306 gene locus_tag LOCUS_30850 3416 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 4351 4971 gene locus_tag LOCUS_30860 4351 4971 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730225.1 protein_id gnl|my_center|LOCUS_30860 5031 5933 gene locus_tag LOCUS_30870 5031 5933 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113238.1 protein_id gnl|my_center|LOCUS_30870 5936 6400 gene locus_tag LOCUS_30880 5936 6400 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142456.1 protein_id gnl|my_center|LOCUS_30880 6467 7885 gene locus_tag LOCUS_30890 gene fumC 6467 7885 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889251.1 protein_id gnl|my_center|LOCUS_30890 7975 9594 gene locus_tag LOCUS_30900 7975 9594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 10484 9618 gene locus_tag LOCUS_30910 10484 9618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 12226 10481 gene locus_tag LOCUS_30920 12226 10481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 13263 12223 gene locus_tag LOCUS_30930 13263 12223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 13335 13976 gene locus_tag LOCUS_30940 13335 13976 CDS product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028115.1 protein_id gnl|my_center|LOCUS_30940 14099 14878 gene locus_tag LOCUS_30950 14099 14878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 16270 14924 gene locus_tag LOCUS_30960 16270 14924 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804643.1 protein_id gnl|my_center|LOCUS_30960 17502 16267 gene locus_tag LOCUS_30970 gene dxr 17502 16267 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973332.1 protein_id gnl|my_center|LOCUS_30970 17923 17579 gene locus_tag LOCUS_30980 17923 17579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 18455 17946 gene locus_tag LOCUS_30990 18455 17946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 <19932 18488 gene locus_tag LOCUS_31000 <19932 18488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229619.1:NAD-dependent succinate-semialdehyde dehydrogenase >Feature sequence46 1584 1186 gene locus_tag LOCUS_31010 1584 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 2755 1688 gene locus_tag LOCUS_31020 2755 1688 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899576.1 protein_id gnl|my_center|LOCUS_31020 4459 2876 gene locus_tag LOCUS_31030 gene serA 4459 2876 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973481.1 protein_id gnl|my_center|LOCUS_31030 5067 4651 gene locus_tag LOCUS_31040 5067 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31040 5894 5241 gene locus_tag LOCUS_31050 5894 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31050 6898 6386 gene locus_tag LOCUS_31060 gene ilvN 6898 6386 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973483.1 protein_id gnl|my_center|LOCUS_31060 7401 6913 gene locus_tag LOCUS_31070 7401 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 8674 7331 gene locus_tag LOCUS_31080 8674 7331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 8991 9320 gene locus_tag LOCUS_31090 8991 9320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 9323 9715 gene locus_tag LOCUS_31100 9323 9715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 10453 10106 gene locus_tag LOCUS_31110 10453 10106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 10887 10450 gene locus_tag LOCUS_31120 10887 10450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 11297 10929 gene locus_tag LOCUS_31130 11297 10929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 12115 12810 gene locus_tag LOCUS_31140 12115 12810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 14020 14676 gene locus_tag LOCUS_31150 14020 14676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31150 15379 16425 gene locus_tag LOCUS_31160 15379 16425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31160 16503 16790 gene locus_tag LOCUS_31170 16503 16790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31170 17014 16826 gene locus_tag LOCUS_31180 17014 16826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 17503 17183 gene locus_tag LOCUS_31190 17503 17183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 17878 17546 gene locus_tag LOCUS_31200 17878 17546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 18509 18045 gene locus_tag LOCUS_31210 18509 18045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31210 >Feature sequence47 862 593 gene locus_tag LOCUS_31220 862 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 2098 2310 gene locus_tag LOCUS_31230 2098 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 6160 6312 gene locus_tag LOCUS_31240 6160 6312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 6546 7415 gene locus_tag LOCUS_31250 6546 7415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 7412 7582 gene locus_tag LOCUS_31260 7412 7582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 7811 7987 gene locus_tag LOCUS_31270 7811 7987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 8383 9492 gene locus_tag LOCUS_31280 8383 9492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31280 9402 9803 gene locus_tag LOCUS_31290 9402 9803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31290 12210 9790 gene locus_tag LOCUS_31300 12210 9790 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224401.1 protein_id gnl|my_center|LOCUS_31300 12773 12207 gene locus_tag LOCUS_31310 12773 12207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 13417 12782 gene locus_tag LOCUS_31320 13417 12782 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977126.1 protein_id gnl|my_center|LOCUS_31320 13380 14684 gene locus_tag LOCUS_31330 13380 14684 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072191.1 protein_id gnl|my_center|LOCUS_31330 14681 15481 gene locus_tag LOCUS_31340 14681 15481 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224989.1 protein_id gnl|my_center|LOCUS_31340 16475 15495 gene locus_tag LOCUS_31350 16475 15495 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224343.1 protein_id gnl|my_center|LOCUS_31350 17745 16534 gene locus_tag LOCUS_31360 17745 16534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 18343 18645 gene locus_tag LOCUS_31370 18343 18645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 >Feature sequence48 522 998 gene locus_tag LOCUS_31380 522 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 2113 1163 gene locus_tag LOCUS_31390 2113 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 2018 2314 gene locus_tag LOCUS_31400 2018 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 3112 2726 gene locus_tag LOCUS_31410 3112 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 3965 3180 gene locus_tag LOCUS_31420 3965 3180 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977611.1 protein_id gnl|my_center|LOCUS_31420 5181 3997 gene locus_tag LOCUS_31430 5181 3997 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037667486.1 protein_id gnl|my_center|LOCUS_31430 5373 6200 gene locus_tag LOCUS_31440 5373 6200 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975377.1 protein_id gnl|my_center|LOCUS_31440 6684 6379 gene locus_tag LOCUS_31450 6684 6379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 6725 7432 gene locus_tag LOCUS_31460 6725 7432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 7446 8756 gene locus_tag LOCUS_31470 7446 8756 CDS product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897599.1 protein_id gnl|my_center|LOCUS_31470 8753 9997 gene locus_tag LOCUS_31480 8753 9997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 11749 10109 gene locus_tag LOCUS_31490 11749 10109 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387331.1 protein_id gnl|my_center|LOCUS_31490 11964 12182 gene locus_tag LOCUS_31500 11964 12182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 12289 12621 gene locus_tag LOCUS_31510 12289 12621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 12618 12989 gene locus_tag LOCUS_31520 12618 12989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 13238 12999 gene locus_tag LOCUS_31530 13238 12999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 13197 13394 gene locus_tag LOCUS_31540 13197 13394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 15927 13456 gene locus_tag LOCUS_31550 15927 13456 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776588.1 protein_id gnl|my_center|LOCUS_31550 16095 16499 gene locus_tag LOCUS_31560 gene bldG 16095 16499 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_31560 >Feature sequence49 37 849 gene locus_tag LOCUS_31570 37 849 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419689.1 protein_id gnl|my_center|LOCUS_31570 1405 851 gene locus_tag LOCUS_31580 1405 851 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235430.1 protein_id gnl|my_center|LOCUS_31580 2511 1552 gene locus_tag LOCUS_31590 2511 1552 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027564.1 protein_id gnl|my_center|LOCUS_31590 3322 2540 gene locus_tag LOCUS_31600 3322 2540 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027565.1 protein_id gnl|my_center|LOCUS_31600 3896 3570 gene locus_tag LOCUS_31610 3896 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 4681 3902 gene locus_tag LOCUS_31620 4681 3902 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223512.1 protein_id gnl|my_center|LOCUS_31620 5150 4674 gene locus_tag LOCUS_31630 5150 4674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 5238 7328 gene locus_tag LOCUS_31640 gene glgX 5238 7328 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486968.1 protein_id gnl|my_center|LOCUS_31640 8560 7433 gene locus_tag LOCUS_31650 8560 7433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 9996 8701 gene locus_tag LOCUS_31660 9996 8701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 10495 9989 gene locus_tag LOCUS_31670 10495 9989 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975229.1 protein_id gnl|my_center|LOCUS_31670 10906 12903 gene locus_tag LOCUS_31680 10906 12903 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031595.1 protein_id gnl|my_center|LOCUS_31680 12965 14698 gene locus_tag LOCUS_31690 gene treS 12965 14698 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224468.1 protein_id gnl|my_center|LOCUS_31690 14712 16754 gene locus_tag LOCUS_31700 14712 16754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 17148 17642 gene locus_tag LOCUS_31710 17148 17642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31710 >Feature sequence50 148 342 gene locus_tag LOCUS_31720 148 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31720 650 1345 gene locus_tag LOCUS_31730 650 1345 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775967.1 protein_id gnl|my_center|LOCUS_31730 1674 1282 gene locus_tag LOCUS_31740 1674 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 1673 1828 gene locus_tag LOCUS_31750 1673 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 2088 2336 gene locus_tag LOCUS_31760 2088 2336 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973730.1 protein_id gnl|my_center|LOCUS_31760 3872 2376 gene locus_tag LOCUS_31770 3872 2376 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_31770 8827 3953 gene locus_tag LOCUS_31780 8827 3953 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 protein_id gnl|my_center|LOCUS_31780 8983 9714 gene locus_tag LOCUS_31790 8983 9714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31790 9725 9898 gene locus_tag LOCUS_31800 9725 9898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 10091 10348 gene locus_tag LOCUS_31810 10091 10348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 10836 11333 gene locus_tag LOCUS_31820 10836 11333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 13066 11438 gene locus_tag LOCUS_31830 gene pruA 13066 11438 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247315.1 protein_id gnl|my_center|LOCUS_31830 13333 13569 gene locus_tag LOCUS_31840 13333 13569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31840 13620 13859 gene locus_tag LOCUS_31850 13620 13859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31850 14425 14628 gene locus_tag LOCUS_31860 14425 14628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31860 15161 15706 gene locus_tag LOCUS_31870 15161 15706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 15880 16155 gene locus_tag LOCUS_31880 15880 16155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 >Feature sequence51 <1 578 gene locus_tag LOCUS_31890 <1 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_183373870.1:hemolysin family protein note possible pseudo, frameshifted 1146 1310 gene locus_tag LOCUS_31900 1146 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 1607 1371 gene locus_tag LOCUS_31910 1607 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 2294 1668 gene locus_tag LOCUS_31920 2294 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 2394 2321 gene locus_tag LOCUS_t00440 2394 2321 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2419 3201 gene locus_tag LOCUS_31930 2419 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 3205 4641 gene locus_tag LOCUS_31940 gene lysA 3205 4641 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775960.1 protein_id gnl|my_center|LOCUS_31940 4661 6040 gene locus_tag LOCUS_31950 4661 6040 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283905.1 protein_id gnl|my_center|LOCUS_31950 6042 7148 gene locus_tag LOCUS_31960 gene thrC 6042 7148 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973642.1 protein_id gnl|my_center|LOCUS_31960 7154 8116 gene locus_tag LOCUS_31970 gene thrB 7154 8116 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030204.1 protein_id gnl|my_center|LOCUS_31970 9161 10855 gene locus_tag LOCUS_31980 9161 10855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31980 11933 11295 gene locus_tag LOCUS_31990 11933 11295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 12122 12334 gene locus_tag LOCUS_32000 12122 12334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 12585 13040 gene locus_tag LOCUS_32010 12585 13040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32010 13830 13693 gene locus_tag LOCUS_32020 13830 13693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 13950 14453 gene locus_tag LOCUS_32030 13950 14453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32030 >Feature sequence52 963 340 gene locus_tag LOCUS_32040 963 340 CDS product DUF5063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975322.1 protein_id gnl|my_center|LOCUS_32040 1530 1030 gene locus_tag LOCUS_32050 1530 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32050 2235 1960 gene locus_tag LOCUS_32060 2235 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32060 3328 2654 gene locus_tag LOCUS_32070 3328 2654 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222957.1 protein_id gnl|my_center|LOCUS_32070 5740 3410 gene locus_tag LOCUS_32080 5740 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32080 6574 5819 gene locus_tag LOCUS_32090 6574 5819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 6745 7434 gene locus_tag LOCUS_32100 6745 7434 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929897.1 protein_id gnl|my_center|LOCUS_32100 7484 8938 gene locus_tag LOCUS_32110 7484 8938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 10348 9215 gene locus_tag LOCUS_32120 10348 9215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 11735 10443 gene locus_tag LOCUS_32130 11735 10443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 11946 12140 gene locus_tag LOCUS_32140 11946 12140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 12177 12341 gene locus_tag LOCUS_32150 12177 12341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 13578 12505 gene locus_tag LOCUS_32160 13578 12505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 13998 13672 gene locus_tag LOCUS_32170 13998 13672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 >Feature sequence53 226 1140 gene locus_tag LOCUS_32180 226 1140 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804410.1 protein_id gnl|my_center|LOCUS_32180 2281 1199 gene locus_tag LOCUS_32190 2281 1199 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183373870.1 protein_id gnl|my_center|LOCUS_32190 3612 2278 gene locus_tag LOCUS_32200 3612 2278 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226803.1 protein_id gnl|my_center|LOCUS_32200 3813 4847 gene locus_tag LOCUS_32210 3813 4847 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229683.1 protein_id gnl|my_center|LOCUS_32210 4844 5635 gene locus_tag LOCUS_32220 4844 5635 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804277.1 protein_id gnl|my_center|LOCUS_32220 5915 9733 gene locus_tag LOCUS_32230 5915 9733 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030150.1 protein_id gnl|my_center|LOCUS_32230 9817 10044 gene locus_tag LOCUS_32240 9817 10044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 10047 10742 gene locus_tag LOCUS_32250 10047 10742 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775967.1 protein_id gnl|my_center|LOCUS_32250 11070 10735 gene locus_tag LOCUS_32260 11070 10735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 11069 11218 gene locus_tag LOCUS_32270 11069 11218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 >Feature sequence54 6470 4764 gene locus_tag LOCUS_32280 6470 4764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 8831 6609 gene locus_tag LOCUS_32290 8831 6609 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226200.1 protein_id gnl|my_center|LOCUS_32290 9606 8911 gene locus_tag LOCUS_32300 9606 8911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32300 10725 9781 gene locus_tag LOCUS_32310 10725 9781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 >Feature sequence55 1096 1383 gene locus_tag LOCUS_32320 1096 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 2042 1854 gene locus_tag LOCUS_32330 2042 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 2700 2095 gene locus_tag LOCUS_32340 2700 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 3835 3050 gene locus_tag LOCUS_32350 3835 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 4051 4278 gene locus_tag LOCUS_32360 4051 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 4280 4597 gene locus_tag LOCUS_32370 4280 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 4594 5019 gene locus_tag LOCUS_32380 4594 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 5462 4962 gene locus_tag LOCUS_32390 5462 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32390 5823 5422 gene locus_tag LOCUS_32400 5823 5422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32400 5997 6947 gene locus_tag LOCUS_32410 5997 6947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 7179 7895 gene locus_tag LOCUS_32420 7179 7895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 8844 7936 gene locus_tag LOCUS_32430 8844 7936 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228482.1 protein_id gnl|my_center|LOCUS_32430 9365 8841 gene locus_tag LOCUS_32440 9365 8841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32440 >Feature sequence56 <1 812 gene locus_tag LOCUS_32450 <1 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228545.1:acetate--CoA ligase 1043 1582 gene locus_tag LOCUS_32460 1043 1582 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222365.1 protein_id gnl|my_center|LOCUS_32460 1607 1831 gene locus_tag LOCUS_32470 1607 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 1910 3667 gene locus_tag LOCUS_32480 gene argS 1910 3667 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804295.1 protein_id gnl|my_center|LOCUS_32480 4065 3700 gene locus_tag LOCUS_32490 4065 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777111.1 protein_id gnl|my_center|LOCUS_32490 5295 4435 gene locus_tag LOCUS_32500 5295 4435 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226844.1 protein_id gnl|my_center|LOCUS_32500 5323 6222 gene locus_tag LOCUS_32510 5323 6222 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087450.1 protein_id gnl|my_center|LOCUS_32510 6237 7028 gene locus_tag LOCUS_32520 6237 7028 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230346.1 protein_id gnl|my_center|LOCUS_32520 7030 8067 gene locus_tag LOCUS_32530 7030 8067 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226066.1 protein_id gnl|my_center|LOCUS_32530 >Feature sequence57 <1 2232 gene locus_tag LOCUS_32540 <1 2232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_075123474.1:DEAD/DEAH box helicase 4233 2335 gene locus_tag LOCUS_32550 4233 2335 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896800.1 protein_id gnl|my_center|LOCUS_32550 4393 5565 gene locus_tag LOCUS_32560 4393 5565 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284839.1 protein_id gnl|my_center|LOCUS_32560 5901 5599 gene locus_tag LOCUS_32570 5901 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 6250 6095 gene locus_tag LOCUS_32580 6250 6095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 7524 6295 gene locus_tag LOCUS_32590 7524 6295 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803931.1 protein_id gnl|my_center|LOCUS_32590 8581 7535 gene locus_tag LOCUS_32600 gene tdh 8581 7535 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031190.1 protein_id gnl|my_center|LOCUS_32600 >Feature sequence58 1586 1143 gene locus_tag LOCUS_32610 1586 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32610 2055 1483 gene locus_tag LOCUS_32620 2055 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32620 2540 2022 gene locus_tag LOCUS_32630 2540 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32630 2720 3676 gene locus_tag LOCUS_32640 2720 3676 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414505.1 protein_id gnl|my_center|LOCUS_32640 3673 4350 gene locus_tag LOCUS_32650 3673 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32650 4238 5890 gene locus_tag LOCUS_32660 4238 5890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 6025 6624 gene locus_tag LOCUS_32670 6025 6624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32670 6627 7109 gene locus_tag LOCUS_32680 6627 7109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32680 7157 7969 gene locus_tag LOCUS_32690 7157 7969 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085410.1 protein_id gnl|my_center|LOCUS_32690 >Feature sequence59 1235 2020 gene locus_tag LOCUS_32700 1235 2020 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227890.1 protein_id gnl|my_center|LOCUS_32700 4160 2046 gene locus_tag LOCUS_32710 4160 2046 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803998.1 protein_id gnl|my_center|LOCUS_32710 5166 4171 gene locus_tag LOCUS_32720 5166 4171 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977201.1 protein_id gnl|my_center|LOCUS_32720 7849 5204 gene locus_tag LOCUS_32730 7849 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32730 >Feature sequence60 316 149 gene locus_tag LOCUS_32740 316 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 648 445 gene locus_tag LOCUS_32750 648 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 1345 785 gene locus_tag LOCUS_32760 1345 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 1720 1646 gene locus_tag LOCUS_t00450 1720 1646 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2125 1871 gene locus_tag LOCUS_32770 2125 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 2235 2423 gene locus_tag LOCUS_32780 2235 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32780 2509 3612 gene locus_tag LOCUS_32790 2509 3612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 3609 4184 gene locus_tag LOCUS_32800 3609 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 6147 4414 gene locus_tag LOCUS_32810 6147 4414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 6699 6286 gene locus_tag LOCUS_32820 6699 6286 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224278.1 protein_id gnl|my_center|LOCUS_32820 7197 6799 gene locus_tag LOCUS_32830 7197 6799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32830 7407 7258 gene locus_tag LOCUS_32840 7407 7258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 >Feature sequence61 1351 1575 gene locus_tag LOCUS_32850 1351 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 2239 1892 gene locus_tag LOCUS_32860 2239 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 3363 2245 gene locus_tag LOCUS_32870 3363 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 3892 3518 gene locus_tag LOCUS_32880 3892 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 5707 6018 gene locus_tag LOCUS_32890 5707 6018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 6869 5988 gene locus_tag LOCUS_32900 6869 5988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900