>Feature sequence01 272 883 gene locus_tag LOCUS_00010 272 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 886 1455 gene locus_tag LOCUS_00020 886 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1617 2513 gene locus_tag LOCUS_00030 1617 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2836 2624 gene locus_tag LOCUS_00040 2836 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3069 3383 gene locus_tag LOCUS_00050 3069 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 3383 4363 gene locus_tag LOCUS_00060 3383 4363 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861516.1 protein_id gnl|my_center|LOCUS_00060 5072 6295 gene locus_tag LOCUS_00070 gene ltrA 5072 6295 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084848.1 protein_id gnl|my_center|LOCUS_00070 6470 6916 gene locus_tag LOCUS_00080 6470 6916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 7182 7517 gene locus_tag LOCUS_00090 7182 7517 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704671.1 protein_id gnl|my_center|LOCUS_00090 7523 7966 gene locus_tag LOCUS_00100 7523 7966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 9490 9852 gene locus_tag LOCUS_00110 9490 9852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 10206 10433 gene locus_tag LOCUS_00120 10206 10433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 10530 11069 gene locus_tag LOCUS_00130 10530 11069 CDS product CIA30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933738.1 protein_id gnl|my_center|LOCUS_00130 11126 11500 gene locus_tag LOCUS_00140 11126 11500 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462150.1 protein_id gnl|my_center|LOCUS_00140 11673 12629 gene locus_tag LOCUS_00150 11673 12629 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_00150 12833 13300 gene locus_tag LOCUS_00160 12833 13300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 14303 13647 gene locus_tag LOCUS_00170 14303 13647 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208174.1 protein_id gnl|my_center|LOCUS_00170 16105 14300 gene locus_tag LOCUS_00180 16105 14300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 16608 18650 gene locus_tag LOCUS_00190 16608 18650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 18578 19168 gene locus_tag LOCUS_00200 18578 19168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 19620 19973 gene locus_tag LOCUS_00210 19620 19973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 20802 20062 gene locus_tag LOCUS_00220 20802 20062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 22067 20958 gene locus_tag LOCUS_00230 22067 20958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 24214 22784 gene locus_tag LOCUS_00240 24214 22784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 24758 24198 gene locus_tag LOCUS_00250 24758 24198 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_00250 25948 24770 gene locus_tag LOCUS_00260 25948 24770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 27153 26884 gene locus_tag LOCUS_00270 27153 26884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 27966 29456 gene locus_tag LOCUS_00280 27966 29456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 29743 30960 gene locus_tag LOCUS_00290 29743 30960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 30997 31989 gene locus_tag LOCUS_00300 30997 31989 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694271.1 protein_id gnl|my_center|LOCUS_00300 31973 32572 gene locus_tag LOCUS_00310 31973 32572 CDS product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794135.1 protein_id gnl|my_center|LOCUS_00310 32761 34311 gene locus_tag LOCUS_00320 32761 34311 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483074.1 protein_id gnl|my_center|LOCUS_00320 34881 34384 gene locus_tag LOCUS_00330 34881 34384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 35373 35017 gene locus_tag LOCUS_00340 35373 35017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 35785 35351 gene locus_tag LOCUS_00350 35785 35351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 36506 35769 gene locus_tag LOCUS_00360 36506 35769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 37149 38513 gene locus_tag LOCUS_00370 gene hisS 37149 38513 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767712.1 protein_id gnl|my_center|LOCUS_00370 40030 38801 gene locus_tag LOCUS_00380 40030 38801 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838343.1 protein_id gnl|my_center|LOCUS_00380 43145 40092 gene locus_tag LOCUS_00390 43145 40092 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838342.1 protein_id gnl|my_center|LOCUS_00390 44086 43154 gene locus_tag LOCUS_00400 44086 43154 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764016.1 protein_id gnl|my_center|LOCUS_00400 44774 45076 gene locus_tag LOCUS_00410 44774 45076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 45913 45080 gene locus_tag LOCUS_00420 45913 45080 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405176.1 protein_id gnl|my_center|LOCUS_00420 46275 45949 gene locus_tag LOCUS_00430 46275 45949 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_00430 46843 46520 gene locus_tag LOCUS_00440 46843 46520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 49125 46726 gene locus_tag LOCUS_00450 49125 46726 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035498.1 protein_id gnl|my_center|LOCUS_00450 49687 49472 gene locus_tag LOCUS_00460 49687 49472 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791339.1 protein_id gnl|my_center|LOCUS_00460 50227 49691 gene locus_tag LOCUS_00470 50227 49691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 50784 51407 gene locus_tag LOCUS_00480 50784 51407 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_00480 51613 51843 gene locus_tag LOCUS_00490 51613 51843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 51904 52470 gene locus_tag LOCUS_00500 51904 52470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 52479 53798 gene locus_tag LOCUS_00510 52479 53798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 53898 55652 gene locus_tag LOCUS_00520 53898 55652 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942850.1 protein_id gnl|my_center|LOCUS_00520 57717 56107 gene locus_tag LOCUS_00530 57717 56107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 58555 57791 gene locus_tag LOCUS_00540 58555 57791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 59365 58646 gene locus_tag LOCUS_00550 59365 58646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 59960 59367 gene locus_tag LOCUS_00560 59960 59367 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932189.1 protein_id gnl|my_center|LOCUS_00560 60234 60827 gene locus_tag LOCUS_00570 60234 60827 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948381.1 protein_id gnl|my_center|LOCUS_00570 60828 62042 gene locus_tag LOCUS_00580 60828 62042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 62266 62021 gene locus_tag LOCUS_00590 62266 62021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 62148 62663 gene locus_tag LOCUS_00600 62148 62663 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083338.1 protein_id gnl|my_center|LOCUS_00600 63078 62773 gene locus_tag LOCUS_00610 63078 62773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 63484 63182 gene locus_tag LOCUS_00620 63484 63182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 64248 63481 gene locus_tag LOCUS_00630 64248 63481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 64958 64245 gene locus_tag LOCUS_00640 64958 64245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 66082 64955 gene locus_tag LOCUS_00650 66082 64955 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808197.1 protein_id gnl|my_center|LOCUS_00650 67192 66209 gene locus_tag LOCUS_00660 67192 66209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 69349 67361 gene locus_tag LOCUS_00670 gene nosZ 69349 67361 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838072.1 protein_id gnl|my_center|LOCUS_00670 69850 69365 gene locus_tag LOCUS_00680 69850 69365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 71316 70126 gene locus_tag LOCUS_00690 gene mqnF 71316 70126 CDS product aminofutalosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155847.1 protein_id gnl|my_center|LOCUS_00690 72433 71318 gene locus_tag LOCUS_00700 72433 71318 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462038.1 protein_id gnl|my_center|LOCUS_00700 72641 73207 gene locus_tag LOCUS_00710 72641 73207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 73477 73881 gene locus_tag LOCUS_00720 73477 73881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00720 73923 74990 gene locus_tag LOCUS_00730 73923 74990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00730 75022 75273 gene locus_tag LOCUS_00740 gene atpC 75022 75273 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787478.1 protein_id gnl|my_center|LOCUS_00740 75891 78671 gene locus_tag LOCUS_00750 75891 78671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 79471 85560 gene locus_tag LOCUS_00760 79471 85560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 85679 93871 gene locus_tag LOCUS_00770 85679 93871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 94164 105398 gene locus_tag LOCUS_00780 94164 105398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 105440 111430 gene locus_tag LOCUS_00790 105440 111430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 111673 111744 gene locus_tag LOCUS_t00010 111673 111744 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 111797 114175 gene locus_tag LOCUS_00800 111797 114175 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 protein_id gnl|my_center|LOCUS_00800 114312 115130 gene locus_tag LOCUS_00810 114312 115130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 115202 117334 gene locus_tag LOCUS_00820 gene scpA 115202 117334 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828556.1 protein_id gnl|my_center|LOCUS_00820 118080 117358 gene locus_tag LOCUS_00830 118080 117358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 118583 118077 gene locus_tag LOCUS_00840 118583 118077 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704518.1 protein_id gnl|my_center|LOCUS_00840 118761 119813 gene locus_tag LOCUS_00850 118761 119813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 120050 120757 gene locus_tag LOCUS_00860 120050 120757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 120792 121718 gene locus_tag LOCUS_00870 120792 121718 CDS product protochlorophyllide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900117.1 protein_id gnl|my_center|LOCUS_00870 121881 122102 gene locus_tag LOCUS_00880 121881 122102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 122295 122765 gene locus_tag LOCUS_00890 122295 122765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 122762 123178 gene locus_tag LOCUS_00900 122762 123178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 125576 126538 gene locus_tag LOCUS_00910 125576 126538 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528460.1 protein_id gnl|my_center|LOCUS_00910 126566 129247 gene locus_tag LOCUS_00920 126566 129247 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942321.1 protein_id gnl|my_center|LOCUS_00920 129331 131736 gene locus_tag LOCUS_00930 gene ppsA 129331 131736 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056610.1 protein_id gnl|my_center|LOCUS_00930 131748 132146 gene locus_tag LOCUS_00940 131748 132146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 132929 132441 gene locus_tag LOCUS_00950 132929 132441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00950 133701 132919 gene locus_tag LOCUS_00960 133701 132919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00960 134740 133721 gene locus_tag LOCUS_00970 134740 133721 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970212.1 protein_id gnl|my_center|LOCUS_00970 135275 134808 gene locus_tag LOCUS_00980 135275 134808 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972895.1 protein_id gnl|my_center|LOCUS_00980 135599 136006 gene locus_tag LOCUS_00990 135599 136006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 136066 137646 gene locus_tag LOCUS_01000 136066 137646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01000 137786 138376 gene locus_tag LOCUS_01010 137786 138376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01010 138576 139460 gene locus_tag LOCUS_01020 138576 139460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 140740 140126 gene locus_tag LOCUS_01030 140740 140126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 141605 140916 gene locus_tag LOCUS_01040 141605 140916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 142445 141981 gene locus_tag LOCUS_01050 142445 141981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 142824 144287 gene locus_tag LOCUS_01060 142824 144287 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861436.1 protein_id gnl|my_center|LOCUS_01060 145654 144473 gene locus_tag LOCUS_01070 145654 144473 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986828.1 protein_id gnl|my_center|LOCUS_01070 146030 145839 gene locus_tag LOCUS_01080 146030 145839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 147041 146787 gene locus_tag LOCUS_01090 147041 146787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 147555 146989 gene locus_tag LOCUS_01100 147555 146989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 151071 147820 gene locus_tag LOCUS_01110 151071 147820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 151878 151702 gene locus_tag LOCUS_01120 151878 151702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 153195 151969 gene locus_tag LOCUS_01130 153195 151969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 154181 153192 gene locus_tag LOCUS_01140 154181 153192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 154888 154187 gene locus_tag LOCUS_01150 154888 154187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 155204 155689 gene locus_tag LOCUS_01160 155204 155689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 156453 157076 gene locus_tag LOCUS_01170 156453 157076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 157175 157816 gene locus_tag LOCUS_01180 157175 157816 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198408415.1 protein_id gnl|my_center|LOCUS_01180 157984 158997 gene locus_tag LOCUS_01190 157984 158997 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_01190 159176 159985 gene locus_tag LOCUS_01200 gene focA 159176 159985 CDS product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816739.1 protein_id gnl|my_center|LOCUS_01200 160128 161087 gene locus_tag LOCUS_01210 160128 161087 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405131.1 protein_id gnl|my_center|LOCUS_01210 161271 161354 gene locus_tag LOCUS_t00020 161271 161354 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 161638 161468 gene locus_tag LOCUS_01220 161638 161468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 162005 163645 gene locus_tag LOCUS_01230 162005 163645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 165366 163729 gene locus_tag LOCUS_01240 165366 163729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 166844 165372 gene locus_tag LOCUS_01250 166844 165372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 167509 167051 gene locus_tag LOCUS_01260 167509 167051 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027268.1 protein_id gnl|my_center|LOCUS_01260 168435 167554 gene locus_tag LOCUS_01270 168435 167554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 168715 168569 gene locus_tag LOCUS_01280 168715 168569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01280 169531 168764 gene locus_tag LOCUS_01290 169531 168764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01290 169795 169586 gene locus_tag LOCUS_01300 169795 169586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01300 169988 169755 gene locus_tag LOCUS_01310 169988 169755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01310 172355 170079 gene locus_tag LOCUS_01320 172355 170079 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_01320 174217 173363 gene locus_tag LOCUS_01330 174217 173363 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015839.1 protein_id gnl|my_center|LOCUS_01330 175545 174418 gene locus_tag LOCUS_01340 175545 174418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 176226 176519 gene locus_tag LOCUS_01350 176226 176519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 176593 177000 gene locus_tag LOCUS_01360 176593 177000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 177005 177370 gene locus_tag LOCUS_01370 177005 177370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 177381 178067 gene locus_tag LOCUS_01380 177381 178067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 178150 179250 gene locus_tag LOCUS_01390 178150 179250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 179773 179441 gene locus_tag LOCUS_01400 179773 179441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 180037 180630 gene locus_tag LOCUS_01410 180037 180630 CDS product 2OG-Fe(II) oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962260.1 protein_id gnl|my_center|LOCUS_01410 180956 182509 gene locus_tag LOCUS_01420 180956 182509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 182655 183665 gene locus_tag LOCUS_01430 182655 183665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01430 183694 184263 gene locus_tag LOCUS_01440 183694 184263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 185936 184380 gene locus_tag LOCUS_01450 185936 184380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01450 186568 185873 gene locus_tag LOCUS_01460 186568 185873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01460 186818 187039 gene locus_tag LOCUS_01470 186818 187039 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015000940.1 protein_id gnl|my_center|LOCUS_01470 187116 187190 gene locus_tag LOCUS_t00030 187116 187190 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 188078 187560 gene locus_tag LOCUS_01480 188078 187560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 188506 188333 gene locus_tag LOCUS_01490 188506 188333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 189938 189267 gene locus_tag LOCUS_01500 189938 189267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 190483 190040 gene locus_tag LOCUS_01510 190483 190040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 190847 190575 gene locus_tag LOCUS_01520 190847 190575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 191332 192114 gene locus_tag LOCUS_01530 191332 192114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01530 192163 192531 gene locus_tag LOCUS_01540 192163 192531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 192705 192881 gene locus_tag LOCUS_01550 192705 192881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 192900 193385 gene locus_tag LOCUS_01560 192900 193385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 193700 194740 gene locus_tag LOCUS_01570 193700 194740 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085648.1 protein_id gnl|my_center|LOCUS_01570 194822 195547 gene locus_tag LOCUS_01580 194822 195547 CDS product DUF1361 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680079.1 protein_id gnl|my_center|LOCUS_01580 195568 195867 gene locus_tag LOCUS_01590 195568 195867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 195822 196757 gene locus_tag LOCUS_01600 195822 196757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 196823 198829 gene locus_tag LOCUS_01610 196823 198829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 198848 199225 gene locus_tag LOCUS_01620 198848 199225 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085647.1 protein_id gnl|my_center|LOCUS_01620 199293 199655 gene locus_tag LOCUS_01630 199293 199655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 199652 201625 gene locus_tag LOCUS_01640 199652 201625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 201788 204481 gene locus_tag LOCUS_01650 201788 204481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 204486 206783 gene locus_tag LOCUS_01660 204486 206783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 206847 209150 gene locus_tag LOCUS_01670 206847 209150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 209424 211409 gene locus_tag LOCUS_01680 209424 211409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 211428 211805 gene locus_tag LOCUS_01690 211428 211805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 212450 211887 gene locus_tag LOCUS_01700 212450 211887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 215508 212455 gene locus_tag LOCUS_01710 215508 212455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 215689 217224 gene locus_tag LOCUS_01720 215689 217224 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948035.1 protein_id gnl|my_center|LOCUS_01720 217314 219347 gene locus_tag LOCUS_01730 217314 219347 CDS product 7TM diverse intracellular signaling domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090388836.1 protein_id gnl|my_center|LOCUS_01730 219418 219801 gene locus_tag LOCUS_01740 219418 219801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 219846 220739 gene locus_tag LOCUS_01750 219846 220739 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963796.1 protein_id gnl|my_center|LOCUS_01750 220824 222758 gene locus_tag LOCUS_01760 220824 222758 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962262.1 protein_id gnl|my_center|LOCUS_01760 223731 223108 gene locus_tag LOCUS_01770 223731 223108 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947903.1 protein_id gnl|my_center|LOCUS_01770 225358 223760 gene locus_tag LOCUS_01780 225358 223760 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362015.1 protein_id gnl|my_center|LOCUS_01780 225819 225520 gene locus_tag LOCUS_01790 225819 225520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 227733 225931 gene locus_tag LOCUS_01800 227733 225931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 228584 229000 gene locus_tag LOCUS_01810 228584 229000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068355.1 protein_id gnl|my_center|LOCUS_01810 232711 229115 gene locus_tag LOCUS_01820 232711 229115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 232846 234207 gene locus_tag LOCUS_01830 232846 234207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 234295 235911 gene locus_tag LOCUS_01840 234295 235911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 236976 237572 gene locus_tag LOCUS_01850 236976 237572 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_01850 238795 238403 gene locus_tag LOCUS_01860 238795 238403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01860 239689 238901 gene locus_tag LOCUS_01870 239689 238901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 240236 240649 gene locus_tag LOCUS_01880 240236 240649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 240646 241038 gene locus_tag LOCUS_01890 240646 241038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 241035 241322 gene locus_tag LOCUS_01900 241035 241322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 243077 242706 gene locus_tag LOCUS_01910 243077 242706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01910 243493 243074 gene locus_tag LOCUS_01920 243493 243074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01920 244408 245631 gene locus_tag LOCUS_01930 gene ltrA 244408 245631 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024495.1 protein_id gnl|my_center|LOCUS_01930 249496 246659 gene locus_tag LOCUS_01940 249496 246659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 250059 249559 gene locus_tag LOCUS_01950 250059 249559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01950 250630 251484 gene locus_tag LOCUS_01960 250630 251484 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479611.1 protein_id gnl|my_center|LOCUS_01960 252374 253564 gene locus_tag LOCUS_01970 252374 253564 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261604.1 protein_id gnl|my_center|LOCUS_01970 253967 255253 gene locus_tag LOCUS_01980 253967 255253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 255313 262359 gene locus_tag LOCUS_01990 255313 262359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 262528 264567 gene locus_tag LOCUS_02000 262528 264567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 265130 267760 gene locus_tag LOCUS_02010 265130 267760 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933304.1 protein_id gnl|my_center|LOCUS_02010 268890 268183 gene locus_tag LOCUS_02020 268890 268183 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948381.1 protein_id gnl|my_center|LOCUS_02020 271195 268970 gene locus_tag LOCUS_02030 271195 268970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 271491 271934 gene locus_tag LOCUS_02040 gene rplM 271491 271934 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081738.1 protein_id gnl|my_center|LOCUS_02040 271941 272327 gene locus_tag LOCUS_02050 gene rpsI 271941 272327 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791749.1 protein_id gnl|my_center|LOCUS_02050 272463 272924 gene locus_tag LOCUS_02060 272463 272924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02060 272918 273076 gene locus_tag LOCUS_02070 272918 273076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02070 273114 273950 gene locus_tag LOCUS_02080 gene tsf 273114 273950 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962622.1 protein_id gnl|my_center|LOCUS_02080 274028 274741 gene locus_tag LOCUS_02090 gene pyrH 274028 274741 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962604.1 protein_id gnl|my_center|LOCUS_02090 274840 275394 gene locus_tag LOCUS_02100 274840 275394 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176066.1 protein_id gnl|my_center|LOCUS_02100 276716 275451 gene locus_tag LOCUS_02110 276716 275451 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 protein_id gnl|my_center|LOCUS_02110 278801 276732 gene locus_tag LOCUS_02120 278801 276732 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_02120 279027 280139 gene locus_tag LOCUS_02130 gene ald 279027 280139 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795308.1 protein_id gnl|my_center|LOCUS_02130 280280 281950 gene locus_tag LOCUS_02140 280280 281950 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_02140 282148 284049 gene locus_tag LOCUS_02150 282148 284049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 284253 285515 gene locus_tag LOCUS_02160 284253 285515 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_02160 287353 285686 gene locus_tag LOCUS_02170 287353 285686 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968056.1 protein_id gnl|my_center|LOCUS_02170 289558 287543 gene locus_tag LOCUS_02180 289558 287543 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962262.1 protein_id gnl|my_center|LOCUS_02180 290101 289655 gene locus_tag LOCUS_02190 290101 289655 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416059.1 protein_id gnl|my_center|LOCUS_02190 292057 290249 gene locus_tag LOCUS_02200 292057 290249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 292135 292320 gene locus_tag LOCUS_02210 292135 292320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 292317 292613 gene locus_tag LOCUS_02220 292317 292613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 293796 292690 gene locus_tag LOCUS_02230 293796 292690 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964801.1 protein_id gnl|my_center|LOCUS_02230 294692 293964 gene locus_tag LOCUS_02240 294692 293964 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_02240 297611 294705 gene locus_tag LOCUS_02250 297611 294705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 298276 297818 gene locus_tag LOCUS_02260 298276 297818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 299122 298277 gene locus_tag LOCUS_02270 299122 298277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 299544 299125 gene locus_tag LOCUS_02280 299544 299125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 300254 299721 gene locus_tag LOCUS_02290 300254 299721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 300623 300288 gene locus_tag LOCUS_02300 300623 300288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 302046 300742 gene locus_tag LOCUS_02310 302046 300742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 302428 303345 gene locus_tag LOCUS_02320 302428 303345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 303796 303398 gene locus_tag LOCUS_02330 303796 303398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 304077 303793 gene locus_tag LOCUS_02340 304077 303793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 305190 304426 gene locus_tag LOCUS_02350 305190 304426 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256218.1 protein_id gnl|my_center|LOCUS_02350 305294 306220 gene locus_tag LOCUS_02360 gene pycR 305294 306220 CDS product LysR family transcriptional regulator PycR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121355.1 protein_id gnl|my_center|LOCUS_02360 307937 306666 gene locus_tag LOCUS_02370 307937 306666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 308461 307934 gene locus_tag LOCUS_02380 308461 307934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 309204 308545 gene locus_tag LOCUS_02390 309204 308545 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289363.1 protein_id gnl|my_center|LOCUS_02390 310041 309208 gene locus_tag LOCUS_02400 310041 309208 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_02400 310163 311764 gene locus_tag LOCUS_02410 310163 311764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 311761 312162 gene locus_tag LOCUS_02420 311761 312162 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802400.1 protein_id gnl|my_center|LOCUS_02420 312159 313079 gene locus_tag LOCUS_02430 312159 313079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 313096 314046 gene locus_tag LOCUS_02440 313096 314046 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124535.1 protein_id gnl|my_center|LOCUS_02440 314043 315146 gene locus_tag LOCUS_02450 314043 315146 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057184.1 protein_id gnl|my_center|LOCUS_02450 315248 315664 gene locus_tag LOCUS_02460 315248 315664 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966951.1 protein_id gnl|my_center|LOCUS_02460 316421 317131 gene locus_tag LOCUS_02470 316421 317131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 318697 317474 gene locus_tag LOCUS_02480 318697 317474 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001443162.1 protein_id gnl|my_center|LOCUS_02480 319715 318780 gene locus_tag LOCUS_02490 319715 318780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 321370 319814 gene locus_tag LOCUS_02500 321370 319814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 322699 322355 gene locus_tag LOCUS_02510 322699 322355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 323313 324374 gene locus_tag LOCUS_02520 323313 324374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 324451 324678 gene locus_tag LOCUS_02530 324451 324678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 324713 325108 gene locus_tag LOCUS_02540 324713 325108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 325465 325935 gene locus_tag LOCUS_02550 325465 325935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 326042 326659 gene locus_tag LOCUS_02560 326042 326659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 326830 330606 gene locus_tag LOCUS_02570 326830 330606 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766276.1 protein_id gnl|my_center|LOCUS_02570 330618 331487 gene locus_tag LOCUS_02580 330618 331487 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_02580 334894 331529 gene locus_tag LOCUS_02590 gene mfd 334894 331529 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962369.1 protein_id gnl|my_center|LOCUS_02590 340848 334948 gene locus_tag LOCUS_02600 340848 334948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 340967 341137 gene locus_tag LOCUS_02610 340967 341137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 342402 341368 gene locus_tag LOCUS_02620 342402 341368 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_02620 343519 342404 gene locus_tag LOCUS_02630 gene gcvT 343519 342404 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962992.1 protein_id gnl|my_center|LOCUS_02630 345583 343580 gene locus_tag LOCUS_02640 345583 343580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 346387 345659 gene locus_tag LOCUS_02650 346387 345659 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964013.1 protein_id gnl|my_center|LOCUS_02650 347523 346432 gene locus_tag LOCUS_02660 347523 346432 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268774.1 protein_id gnl|my_center|LOCUS_02660 348057 348686 gene locus_tag LOCUS_02670 348057 348686 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964236.1 protein_id gnl|my_center|LOCUS_02670 349086 349655 gene locus_tag LOCUS_02680 349086 349655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 349816 351156 gene locus_tag LOCUS_02690 349816 351156 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964479.1 protein_id gnl|my_center|LOCUS_02690 353191 351197 gene locus_tag LOCUS_02700 353191 351197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 353981 353448 gene locus_tag LOCUS_02710 353981 353448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 354336 354121 gene locus_tag LOCUS_02720 354336 354121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 355185 354463 gene locus_tag LOCUS_02730 355185 354463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 356387 355182 gene locus_tag LOCUS_02740 356387 355182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02740 356830 356402 gene locus_tag LOCUS_02750 356830 356402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 357743 357243 gene locus_tag LOCUS_02760 357743 357243 CDS product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723340.1 protein_id gnl|my_center|LOCUS_02760 358703 357777 gene locus_tag LOCUS_02770 358703 357777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 359749 358874 gene locus_tag LOCUS_02780 359749 358874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 360790 359822 gene locus_tag LOCUS_02790 360790 359822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 361168 361374 gene locus_tag LOCUS_02800 361168 361374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02800 362370 362633 gene locus_tag LOCUS_02810 362370 362633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 363065 362676 gene locus_tag LOCUS_02820 363065 362676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 364350 363058 gene locus_tag LOCUS_02830 364350 363058 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947944.1 protein_id gnl|my_center|LOCUS_02830 365475 364354 gene locus_tag LOCUS_02840 365475 364354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 366027 365566 gene locus_tag LOCUS_02850 366027 365566 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266690.1 protein_id gnl|my_center|LOCUS_02850 366526 366029 gene locus_tag LOCUS_02860 366526 366029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 367702 366605 gene locus_tag LOCUS_02870 gene ddlA 367702 366605 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413693.1 protein_id gnl|my_center|LOCUS_02870 368925 367714 gene locus_tag LOCUS_02880 gene fahA 368925 367714 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962840.1 protein_id gnl|my_center|LOCUS_02880 370685 369138 gene locus_tag LOCUS_02890 370685 369138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 370872 371786 gene locus_tag LOCUS_02900 370872 371786 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_02900 372022 371828 gene locus_tag LOCUS_02910 372022 371828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 372021 372287 gene locus_tag LOCUS_02920 372021 372287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 372297 374189 gene locus_tag LOCUS_02930 372297 374189 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788675.1 protein_id gnl|my_center|LOCUS_02930 374191 375054 gene locus_tag LOCUS_02940 374191 375054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02940 375075 375386 gene locus_tag LOCUS_02950 375075 375386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02950 375480 376178 gene locus_tag LOCUS_02960 375480 376178 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964515.1 protein_id gnl|my_center|LOCUS_02960 377968 376229 gene locus_tag LOCUS_02970 377968 376229 CDS product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_02970 378114 379505 gene locus_tag LOCUS_02980 378114 379505 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228233.1 protein_id gnl|my_center|LOCUS_02980 379546 380760 gene locus_tag LOCUS_02990 379546 380760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 380766 381323 gene locus_tag LOCUS_03000 380766 381323 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963794.1 protein_id gnl|my_center|LOCUS_03000 381336 381749 gene locus_tag LOCUS_03010 381336 381749 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_03010 382003 383064 gene locus_tag LOCUS_03020 382003 383064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 383102 384784 gene locus_tag LOCUS_03030 383102 384784 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877102.1 protein_id gnl|my_center|LOCUS_03030 384862 386322 gene locus_tag LOCUS_03040 384862 386322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 386486 387388 gene locus_tag LOCUS_03050 gene xerC 386486 387388 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804122.1 protein_id gnl|my_center|LOCUS_03050 387489 387794 gene locus_tag LOCUS_03060 387489 387794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 388033 388107 gene locus_tag LOCUS_t00040 388033 388107 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 388123 388207 gene locus_tag LOCUS_t00050 388123 388207 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 388229 388304 gene locus_tag LOCUS_t00060 388229 388304 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 388335 388407 gene locus_tag LOCUS_t00070 388335 388407 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 388453 389649 gene locus_tag LOCUS_03070 gene tuf 388453 389649 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963319.1 protein_id gnl|my_center|LOCUS_03070 389717 389790 gene locus_tag LOCUS_t00080 389717 389790 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 389823 390011 gene locus_tag LOCUS_03080 389823 390011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 390022 390570 gene locus_tag LOCUS_03090 gene nusG 390022 390570 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782159.1 protein_id gnl|my_center|LOCUS_03090 390637 391092 gene locus_tag LOCUS_03100 gene rplK 390637 391092 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791514.1 protein_id gnl|my_center|LOCUS_03100 391150 391842 gene locus_tag LOCUS_03110 gene rplA 391150 391842 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310894.1 protein_id gnl|my_center|LOCUS_03110 391860 392387 gene locus_tag LOCUS_03120 gene rplJ 391860 392387 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762028.1 protein_id gnl|my_center|LOCUS_03120 392443 392829 gene locus_tag LOCUS_03130 gene rplL 392443 392829 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558082.1 protein_id gnl|my_center|LOCUS_03130 393100 396924 gene locus_tag LOCUS_03140 gene rpoB 393100 396924 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963312.1 protein_id gnl|my_center|LOCUS_03140 396958 397431 gene locus_tag LOCUS_03150 396958 397431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03150 397377 401210 gene locus_tag LOCUS_03160 gene rpoC 397377 401210 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963311.1 protein_id gnl|my_center|LOCUS_03160 401323 401922 gene locus_tag LOCUS_03170 401323 401922 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785759.1 protein_id gnl|my_center|LOCUS_03170 402712 402155 gene locus_tag LOCUS_03180 402712 402155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 403809 403078 gene locus_tag LOCUS_03190 403809 403078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 405444 403984 gene locus_tag LOCUS_03200 405444 403984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 406854 405712 gene locus_tag LOCUS_03210 406854 405712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 407601 406987 gene locus_tag LOCUS_03220 407601 406987 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602007.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03220 408583 407873 gene locus_tag LOCUS_03230 408583 407873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 410083 410841 gene locus_tag LOCUS_03240 410083 410841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 412424 411282 gene locus_tag LOCUS_03250 412424 411282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 413273 412557 gene locus_tag LOCUS_03260 413273 412557 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602007.1 protein_id gnl|my_center|LOCUS_03260 413683 413369 gene locus_tag LOCUS_03270 413683 413369 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851388.1 protein_id gnl|my_center|LOCUS_03270 414703 413858 gene locus_tag LOCUS_03280 414703 413858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 415196 418552 gene locus_tag LOCUS_03290 415196 418552 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964044.1 protein_id gnl|my_center|LOCUS_03290 421295 418683 gene locus_tag LOCUS_03300 421295 418683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 422694 421399 gene locus_tag LOCUS_03310 422694 421399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 423233 422706 gene locus_tag LOCUS_03320 423233 422706 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962711.1 protein_id gnl|my_center|LOCUS_03320 424901 423237 gene locus_tag LOCUS_03330 424901 423237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 426124 425342 gene locus_tag LOCUS_03340 426124 425342 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962250.1 protein_id gnl|my_center|LOCUS_03340 426508 428178 gene locus_tag LOCUS_03350 gene ettA 426508 428178 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_03350 428284 429117 gene locus_tag LOCUS_03360 428284 429117 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925938.1 protein_id gnl|my_center|LOCUS_03360 429142 429756 gene locus_tag LOCUS_03370 429142 429756 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872152.1 protein_id gnl|my_center|LOCUS_03370 430633 429782 gene locus_tag LOCUS_03380 430633 429782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 433306 430643 gene locus_tag LOCUS_03390 433306 430643 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203461.1 protein_id gnl|my_center|LOCUS_03390 434035 433415 gene locus_tag LOCUS_03400 434035 433415 CDS product DUF937 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120998.1 protein_id gnl|my_center|LOCUS_03400 434372 435415 gene locus_tag LOCUS_03410 434372 435415 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107847.1 protein_id gnl|my_center|LOCUS_03410 436495 435491 gene locus_tag LOCUS_03420 436495 435491 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698132.1 protein_id gnl|my_center|LOCUS_03420 437243 436488 gene locus_tag LOCUS_03430 437243 436488 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002909097.1 protein_id gnl|my_center|LOCUS_03430 438873 437314 gene locus_tag LOCUS_03440 gene dnaB 438873 437314 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962775.1 protein_id gnl|my_center|LOCUS_03440 439958 439212 gene locus_tag LOCUS_03450 439958 439212 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_03450 440079 441038 gene locus_tag LOCUS_03460 440079 441038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764168.1 protein_id gnl|my_center|LOCUS_03460 441119 441706 gene locus_tag LOCUS_03470 441119 441706 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 protein_id gnl|my_center|LOCUS_03470 442915 441716 gene locus_tag LOCUS_03480 442915 441716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_03480 443125 445215 gene locus_tag LOCUS_03490 443125 445215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963111.1 protein_id gnl|my_center|LOCUS_03490 446765 445512 gene locus_tag LOCUS_03500 gene porV 446765 445512 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_03500 450651 446854 gene locus_tag LOCUS_03510 gene porU 450651 446854 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_03510 450905 451942 gene locus_tag LOCUS_03520 450905 451942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 452122 453621 gene locus_tag LOCUS_03530 gene gldJ 452122 453621 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_03530 453733 454710 gene locus_tag LOCUS_03540 453733 454710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03540 454665 455024 gene locus_tag LOCUS_03550 454665 455024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03550 455829 455245 gene locus_tag LOCUS_03560 455829 455245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 456931 455840 gene locus_tag LOCUS_03570 456931 455840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03570 457920 456829 gene locus_tag LOCUS_03580 457920 456829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03580 458460 458107 gene locus_tag LOCUS_03590 458460 458107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 458459 458644 gene locus_tag LOCUS_03600 458459 458644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 460590 458956 gene locus_tag LOCUS_03610 460590 458956 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403056.1 protein_id gnl|my_center|LOCUS_03610 460774 461382 gene locus_tag LOCUS_03620 460774 461382 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962629.1 protein_id gnl|my_center|LOCUS_03620 461533 463695 gene locus_tag LOCUS_03630 461533 463695 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_03630 464429 466222 gene locus_tag LOCUS_03640 464429 466222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 466359 467045 gene locus_tag LOCUS_03650 466359 467045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 467501 467109 gene locus_tag LOCUS_03660 467501 467109 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071181.1 protein_id gnl|my_center|LOCUS_03660 467825 467559 gene locus_tag LOCUS_03670 467825 467559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 468970 467879 gene locus_tag LOCUS_03680 468970 467879 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222927961.1 protein_id gnl|my_center|LOCUS_03680 469243 469043 gene locus_tag LOCUS_03690 gene tatA 469243 469043 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760985.1 protein_id gnl|my_center|LOCUS_03690 470485 469448 gene locus_tag LOCUS_03700 gene gldB 470485 469448 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964168.1 protein_id gnl|my_center|LOCUS_03700 470776 471720 gene locus_tag LOCUS_03710 470776 471720 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764535.1 protein_id gnl|my_center|LOCUS_03710 472436 471786 gene locus_tag LOCUS_03720 472436 471786 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549852.1 protein_id gnl|my_center|LOCUS_03720 473409 472429 gene locus_tag LOCUS_03730 473409 472429 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933791.1 protein_id gnl|my_center|LOCUS_03730 474446 476818 gene locus_tag LOCUS_03740 474446 476818 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141609.1 protein_id gnl|my_center|LOCUS_03740 476936 477085 gene locus_tag LOCUS_03750 476936 477085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03750 478660 477296 gene locus_tag LOCUS_03760 478660 477296 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671775.1 protein_id gnl|my_center|LOCUS_03760 478772 479608 gene locus_tag LOCUS_03770 478772 479608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 479757 483212 gene locus_tag LOCUS_03780 479757 483212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 483385 483459 gene locus_tag LOCUS_t00090 483385 483459 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 483492 483740 gene locus_tag LOCUS_03790 gene rpmB 483492 483740 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216391.1 protein_id gnl|my_center|LOCUS_03790 483768 483956 gene locus_tag LOCUS_03800 gene rpmG 483768 483956 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002560155.1 protein_id gnl|my_center|LOCUS_03800 483959 484135 gene locus_tag LOCUS_03810 483959 484135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 484256 485227 gene locus_tag LOCUS_03820 gene ftsY 484256 485227 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963551.1 protein_id gnl|my_center|LOCUS_03820 485696 485292 gene locus_tag LOCUS_03830 485696 485292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 485806 487392 gene locus_tag LOCUS_03840 485806 487392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 487599 488498 gene locus_tag LOCUS_03850 487599 488498 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962779.1 protein_id gnl|my_center|LOCUS_03850 489188 489523 gene locus_tag LOCUS_03860 489188 489523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03860 489520 490419 gene locus_tag LOCUS_03870 gene rsmH 489520 490419 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784016.1 protein_id gnl|my_center|LOCUS_03870 490443 490760 gene locus_tag LOCUS_03880 490443 490760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 490785 492893 gene locus_tag LOCUS_03890 490785 492893 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_03890 492989 494383 gene locus_tag LOCUS_03900 492989 494383 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201929.1 protein_id gnl|my_center|LOCUS_03900 494547 495812 gene locus_tag LOCUS_03910 gene mraY 494547 495812 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964159.1 protein_id gnl|my_center|LOCUS_03910 495813 496994 gene locus_tag LOCUS_03920 gene murD 495813 496994 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964158.1 protein_id gnl|my_center|LOCUS_03920 496906 497127 gene locus_tag LOCUS_03930 496906 497127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03930 497141 498322 gene locus_tag LOCUS_03940 497141 498322 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_03940 498306 499415 gene locus_tag LOCUS_03950 gene murG 498306 499415 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784003.1 protein_id gnl|my_center|LOCUS_03950 499417 500796 gene locus_tag LOCUS_03960 gene murC 499417 500796 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964155.1 protein_id gnl|my_center|LOCUS_03960 500850 501632 gene locus_tag LOCUS_03970 500850 501632 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108836.1 protein_id gnl|my_center|LOCUS_03970 501675 503063 gene locus_tag LOCUS_03980 gene ftsA 501675 503063 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098846.1 protein_id gnl|my_center|LOCUS_03980 503088 504569 gene locus_tag LOCUS_03990 503088 504569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 505991 505155 gene locus_tag LOCUS_04000 505991 505155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946551.1 protein_id gnl|my_center|LOCUS_04000 506113 506574 gene locus_tag LOCUS_04010 506113 506574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 506587 507126 gene locus_tag LOCUS_04020 506587 507126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 507542 507294 gene locus_tag LOCUS_04030 507542 507294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 507741 507493 gene locus_tag LOCUS_04040 507741 507493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 508376 507789 gene locus_tag LOCUS_04050 508376 507789 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962847.1 protein_id gnl|my_center|LOCUS_04050 508902 508432 gene locus_tag LOCUS_04060 508902 508432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531514.1 protein_id gnl|my_center|LOCUS_04060 509433 508912 gene locus_tag LOCUS_04070 509433 508912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 509895 509452 gene locus_tag LOCUS_04080 509895 509452 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223866.1 protein_id gnl|my_center|LOCUS_04080 512471 509898 gene locus_tag LOCUS_04090 512471 509898 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057830.1 protein_id gnl|my_center|LOCUS_04090 513396 512473 gene locus_tag LOCUS_04100 513396 512473 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970774.1 protein_id gnl|my_center|LOCUS_04100 514839 513616 gene locus_tag LOCUS_04110 514839 513616 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119682992.1 protein_id gnl|my_center|LOCUS_04110 516377 515535 gene locus_tag LOCUS_04120 516377 515535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04120 516467 517768 gene locus_tag LOCUS_04130 516467 517768 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768269.1 protein_id gnl|my_center|LOCUS_04130 517765 518445 gene locus_tag LOCUS_04140 517765 518445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 519571 518462 gene locus_tag LOCUS_04150 519571 518462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 520778 519594 gene locus_tag LOCUS_04160 520778 519594 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_04160 522271 521039 gene locus_tag LOCUS_04170 522271 521039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 523150 533634 gene locus_tag LOCUS_04180 523150 533634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 534460 533804 gene locus_tag LOCUS_04190 534460 533804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04190 534777 534454 gene locus_tag LOCUS_04200 534777 534454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04200 535195 535569 gene locus_tag LOCUS_04210 gene rpsL 535195 535569 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545079.1 protein_id gnl|my_center|LOCUS_04210 535601 536068 gene locus_tag LOCUS_04220 gene rpsG 535601 536068 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963472.1 protein_id gnl|my_center|LOCUS_04220 536114 538276 gene locus_tag LOCUS_04230 gene fusA 536114 538276 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963471.1 protein_id gnl|my_center|LOCUS_04230 538379 538687 gene locus_tag LOCUS_04240 gene rpsJ 538379 538687 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963470.1 protein_id gnl|my_center|LOCUS_04240 538776 539396 gene locus_tag LOCUS_04250 gene rplC 538776 539396 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963469.1 protein_id gnl|my_center|LOCUS_04250 539401 540024 gene locus_tag LOCUS_04260 gene rplD 539401 540024 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782191.1 protein_id gnl|my_center|LOCUS_04260 540035 540337 gene locus_tag LOCUS_04270 gene rplW 540035 540337 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007747932.1 protein_id gnl|my_center|LOCUS_04270 540368 541192 gene locus_tag LOCUS_04280 gene rplB 540368 541192 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963466.1 protein_id gnl|my_center|LOCUS_04280 541210 541473 gene locus_tag LOCUS_04290 gene rpsS 541210 541473 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_04290 541511 541867 gene locus_tag LOCUS_04300 gene rplV 541511 541867 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963465.1 protein_id gnl|my_center|LOCUS_04300 541883 542671 gene locus_tag LOCUS_04310 gene rpsC 541883 542671 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963464.1 protein_id gnl|my_center|LOCUS_04310 542803 543180 gene locus_tag LOCUS_04320 gene rplP 542803 543180 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933835.1 protein_id gnl|my_center|LOCUS_04320 543201 543455 gene locus_tag LOCUS_04330 543201 543455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 543468 543725 gene locus_tag LOCUS_04340 gene rpsQ 543468 543725 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963461.1 protein_id gnl|my_center|LOCUS_04340 543744 544109 gene locus_tag LOCUS_04350 gene rplN 543744 544109 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963460.1 protein_id gnl|my_center|LOCUS_04350 544109 544453 gene locus_tag LOCUS_04360 gene rplX 544109 544453 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728539.1 protein_id gnl|my_center|LOCUS_04360 544453 545010 gene locus_tag LOCUS_04370 gene rplE 544453 545010 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963458.1 protein_id gnl|my_center|LOCUS_04370 545015 545284 gene locus_tag LOCUS_04380 gene rpsN 545015 545284 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963457.1 protein_id gnl|my_center|LOCUS_04380 545305 545706 gene locus_tag LOCUS_04390 gene rpsH 545305 545706 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963456.1 protein_id gnl|my_center|LOCUS_04390 545727 546287 gene locus_tag LOCUS_04400 gene rplF 545727 546287 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963455.1 protein_id gnl|my_center|LOCUS_04400 546310 546654 gene locus_tag LOCUS_04410 gene rplR 546310 546654 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549040.1 protein_id gnl|my_center|LOCUS_04410 546666 547178 gene locus_tag LOCUS_04420 gene rpsE 546666 547178 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963453.1 protein_id gnl|my_center|LOCUS_04420 547203 547382 gene locus_tag LOCUS_04430 gene rpmD 547203 547382 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974250.1 protein_id gnl|my_center|LOCUS_04430 547413 547862 gene locus_tag LOCUS_04440 gene rplO 547413 547862 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762046.1 protein_id gnl|my_center|LOCUS_04440 547868 549235 gene locus_tag LOCUS_04450 gene secY 547868 549235 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782223.1 protein_id gnl|my_center|LOCUS_04450 549254 550051 gene locus_tag LOCUS_04460 gene map 549254 550051 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791569.1 protein_id gnl|my_center|LOCUS_04460 550087 550305 gene locus_tag LOCUS_04470 gene infA 550087 550305 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_04470 550452 550829 gene locus_tag LOCUS_04480 gene rpsM 550452 550829 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558050.1 protein_id gnl|my_center|LOCUS_04480 550849 551235 gene locus_tag LOCUS_04490 gene rpsK 550849 551235 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296327.1 protein_id gnl|my_center|LOCUS_04490 551257 551868 gene locus_tag LOCUS_04500 gene rpsD 551257 551868 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963446.1 protein_id gnl|my_center|LOCUS_04500 551930 552928 gene locus_tag LOCUS_04510 551930 552928 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963445.1 protein_id gnl|my_center|LOCUS_04510 553106 553576 gene locus_tag LOCUS_04520 553106 553576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04520 555170 553857 gene locus_tag LOCUS_04530 555170 553857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 555709 555164 gene locus_tag LOCUS_04540 555709 555164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 556037 555962 gene locus_tag LOCUS_t00100 556037 555962 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 556203 556274 gene locus_tag LOCUS_t00110 556203 556274 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 556800 556507 gene locus_tag LOCUS_04550 556800 556507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 556927 556853 gene locus_tag LOCUS_t00120 556927 556853 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 557723 556989 gene locus_tag LOCUS_04560 557723 556989 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765667.1 protein_id gnl|my_center|LOCUS_04560 557849 558457 gene locus_tag LOCUS_04570 gene pnuC 557849 558457 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962363.1 protein_id gnl|my_center|LOCUS_04570 559276 561144 gene locus_tag LOCUS_04580 559276 561144 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004311295.1 protein_id gnl|my_center|LOCUS_04580 561212 562135 gene locus_tag LOCUS_04590 561212 562135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 563190 562159 gene locus_tag LOCUS_04600 563190 562159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 565327 563207 gene locus_tag LOCUS_04610 565327 563207 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202602.1 protein_id gnl|my_center|LOCUS_04610 565886 566245 gene locus_tag LOCUS_04620 565886 566245 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_04620 566443 566249 gene locus_tag LOCUS_04630 566443 566249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 568560 579617 gene locus_tag LOCUS_04640 568560 579617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 579832 580698 gene locus_tag LOCUS_04650 579832 580698 CDS product cupin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192781.1 protein_id gnl|my_center|LOCUS_04650 580691 581434 gene locus_tag LOCUS_04660 580691 581434 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704227.1 protein_id gnl|my_center|LOCUS_04660 582884 581442 gene locus_tag LOCUS_04670 582884 581442 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870741.1 protein_id gnl|my_center|LOCUS_04670 583855 586452 gene locus_tag LOCUS_04680 583855 586452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 586501 588321 gene locus_tag LOCUS_04690 586501 588321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 588581 589075 gene locus_tag LOCUS_04700 588581 589075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 589072 589962 gene locus_tag LOCUS_04710 589072 589962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 590760 590008 gene locus_tag LOCUS_04720 590760 590008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 592037 591855 gene locus_tag LOCUS_04730 592037 591855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 592189 594144 gene locus_tag LOCUS_04740 592189 594144 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259232.1 protein_id gnl|my_center|LOCUS_04740 594149 595021 gene locus_tag LOCUS_04750 594149 595021 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963593.1 protein_id gnl|my_center|LOCUS_04750 595337 595113 gene locus_tag LOCUS_04760 595337 595113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 597037 597759 gene locus_tag LOCUS_04770 597037 597759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 598263 599495 gene locus_tag LOCUS_04780 598263 599495 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202567.1 protein_id gnl|my_center|LOCUS_04780 599488 600507 gene locus_tag LOCUS_04790 599488 600507 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202566.1 protein_id gnl|my_center|LOCUS_04790 600508 601419 gene locus_tag LOCUS_04800 600508 601419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 601770 602450 gene locus_tag LOCUS_04810 601770 602450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04810 602438 603364 gene locus_tag LOCUS_04820 602438 603364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04820 603382 604359 gene locus_tag LOCUS_04830 603382 604359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 604363 605646 gene locus_tag LOCUS_04840 604363 605646 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027693.1 protein_id gnl|my_center|LOCUS_04840 605696 606442 gene locus_tag LOCUS_04850 605696 606442 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054522704.1 protein_id gnl|my_center|LOCUS_04850 606435 607040 gene locus_tag LOCUS_04860 606435 607040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04860 607097 609421 gene locus_tag LOCUS_04870 607097 609421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04870 609718 609903 gene locus_tag LOCUS_04880 609718 609903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 610151 612757 gene locus_tag LOCUS_04890 610151 612757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 612754 616698 gene locus_tag LOCUS_04900 612754 616698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 616928 617152 gene locus_tag LOCUS_04910 616928 617152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 618159 617425 gene locus_tag LOCUS_04920 618159 617425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 618574 618350 gene locus_tag LOCUS_04930 618574 618350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 619001 618675 gene locus_tag LOCUS_04940 619001 618675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 620104 619196 gene locus_tag LOCUS_04950 620104 619196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 621597 620206 gene locus_tag LOCUS_04960 621597 620206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 622166 621600 gene locus_tag LOCUS_04970 622166 621600 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_04970 623381 622227 gene locus_tag LOCUS_04980 623381 622227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 625155 623656 gene locus_tag LOCUS_04990 625155 623656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 625559 626503 gene locus_tag LOCUS_05000 625559 626503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 626590 627402 gene locus_tag LOCUS_05010 626590 627402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 627750 628337 gene locus_tag LOCUS_05020 627750 628337 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_05020 628341 629726 gene locus_tag LOCUS_05030 628341 629726 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184492906.1 protein_id gnl|my_center|LOCUS_05030 629770 630918 gene locus_tag LOCUS_05040 629770 630918 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_05040 630924 634343 gene locus_tag LOCUS_05050 630924 634343 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_05050 634674 635300 gene locus_tag LOCUS_05060 634674 635300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 635297 636124 gene locus_tag LOCUS_05070 635297 636124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 636619 636215 gene locus_tag LOCUS_05080 636619 636215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 637647 636625 gene locus_tag LOCUS_05090 637647 636625 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_05090 638499 637741 gene locus_tag LOCUS_05100 638499 637741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 639433 638561 gene locus_tag LOCUS_05110 639433 638561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962741.1 protein_id gnl|my_center|LOCUS_05110 639972 639625 gene locus_tag LOCUS_05120 639972 639625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 640718 640146 gene locus_tag LOCUS_05130 640718 640146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05130 640854 640684 gene locus_tag LOCUS_05140 640854 640684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05140 642858 640867 gene locus_tag LOCUS_05150 642858 640867 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962273.1 protein_id gnl|my_center|LOCUS_05150 643229 642870 gene locus_tag LOCUS_05160 643229 642870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05160 643502 643272 gene locus_tag LOCUS_05170 643502 643272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05170 643790 644410 gene locus_tag LOCUS_05180 643790 644410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 644854 644429 gene locus_tag LOCUS_05190 644854 644429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 646217 645072 gene locus_tag LOCUS_05200 646217 645072 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_05200 646967 646386 gene locus_tag LOCUS_05210 646967 646386 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_05210 647587 646973 gene locus_tag LOCUS_05220 gene tmk 647587 646973 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496455.1 protein_id gnl|my_center|LOCUS_05220 648444 647638 gene locus_tag LOCUS_05230 gene pyrF 648444 647638 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759883.1 protein_id gnl|my_center|LOCUS_05230 648836 648573 gene locus_tag LOCUS_05240 648836 648573 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_05240 650010 648919 gene locus_tag LOCUS_05250 650010 648919 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764152.1 protein_id gnl|my_center|LOCUS_05250 650219 652114 gene locus_tag LOCUS_05260 650219 652114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 652165 652902 gene locus_tag LOCUS_05270 652165 652902 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_05270 653687 658270 gene locus_tag LOCUS_05280 653687 658270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 658476 662744 gene locus_tag LOCUS_05290 658476 662744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 662980 663273 gene locus_tag LOCUS_05300 662980 663273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 663365 664111 gene locus_tag LOCUS_05310 663365 664111 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922781.1 protein_id gnl|my_center|LOCUS_05310 664849 664148 gene locus_tag LOCUS_05320 664849 664148 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_05320 665075 666151 gene locus_tag LOCUS_05330 gene corA 665075 666151 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081315.1 protein_id gnl|my_center|LOCUS_05330 666293 666679 gene locus_tag LOCUS_05340 666293 666679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 666858 670013 gene locus_tag LOCUS_05350 666858 670013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05350 670018 671256 gene locus_tag LOCUS_05360 670018 671256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05360 671358 672449 gene locus_tag LOCUS_05370 671358 672449 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_05370 672485 673186 gene locus_tag LOCUS_05380 672485 673186 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963886.1 protein_id gnl|my_center|LOCUS_05380 673191 674288 gene locus_tag LOCUS_05390 673191 674288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 674334 674834 gene locus_tag LOCUS_05400 674334 674834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963109.1 protein_id gnl|my_center|LOCUS_05400 674827 675774 gene locus_tag LOCUS_05410 674827 675774 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966047.1 protein_id gnl|my_center|LOCUS_05410 675776 676006 gene locus_tag LOCUS_05420 675776 676006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 676027 677238 gene locus_tag LOCUS_05430 676027 677238 CDS product DUF3570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963601.1 protein_id gnl|my_center|LOCUS_05430 677350 678105 gene locus_tag LOCUS_05440 gene lmtA 677350 678105 CDS product lipid A Kdo2 1-phosphate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173879.1 protein_id gnl|my_center|LOCUS_05440 679019 678138 gene locus_tag LOCUS_05450 679019 678138 CDS product DUF2279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963344.1 protein_id gnl|my_center|LOCUS_05450 679442 680428 gene locus_tag LOCUS_05460 679442 680428 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530707.1 protein_id gnl|my_center|LOCUS_05460 680533 681159 gene locus_tag LOCUS_05470 gene can 680533 681159 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964129.1 protein_id gnl|my_center|LOCUS_05470 681580 682782 gene locus_tag LOCUS_05480 681580 682782 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190526.1 protein_id gnl|my_center|LOCUS_05480 683135 683764 gene locus_tag LOCUS_05490 683135 683764 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963710.1 protein_id gnl|my_center|LOCUS_05490 683894 684838 gene locus_tag LOCUS_05500 gene chrA 683894 684838 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530105.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05500 684811 685023 gene locus_tag LOCUS_05510 684811 685023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 685107 685937 gene locus_tag LOCUS_05520 gene blaOXA 685107 685937 CDS product OXA-48 family carbapenem-hydrolyzing class D beta-lactamase OXA-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071128.1 protein_id gnl|my_center|LOCUS_05520 686087 686812 gene locus_tag LOCUS_05530 686087 686812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 687122 688045 gene locus_tag LOCUS_05540 687122 688045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 689058 688075 gene locus_tag LOCUS_05550 689058 688075 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962707.1 protein_id gnl|my_center|LOCUS_05550 689932 689276 gene locus_tag LOCUS_05560 689932 689276 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760381.1 protein_id gnl|my_center|LOCUS_05560 691725 689941 gene locus_tag LOCUS_05570 691725 689941 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109365.1 protein_id gnl|my_center|LOCUS_05570 692052 692210 gene locus_tag LOCUS_05580 692052 692210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 692468 692785 gene locus_tag LOCUS_05590 692468 692785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 692874 694193 gene locus_tag LOCUS_05600 692874 694193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 694203 696701 gene locus_tag LOCUS_05610 694203 696701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 696705 698573 gene locus_tag LOCUS_05620 696705 698573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 698962 699324 gene locus_tag LOCUS_05630 698962 699324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 699428 701371 gene locus_tag LOCUS_05640 699428 701371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 704201 701391 gene locus_tag LOCUS_05650 704201 701391 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962910.1 protein_id gnl|my_center|LOCUS_05650 704269 705384 gene locus_tag LOCUS_05660 704269 705384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 705475 706533 gene locus_tag LOCUS_05670 705475 706533 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759761.1 protein_id gnl|my_center|LOCUS_05670 706730 708715 gene locus_tag LOCUS_05680 706730 708715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 708875 711334 gene locus_tag LOCUS_05690 708875 711334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 711295 711822 gene locus_tag LOCUS_05700 711295 711822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 711872 712186 gene locus_tag LOCUS_05710 711872 712186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05710 712165 713049 gene locus_tag LOCUS_05720 gene mqnE 712165 713049 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941110.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05720 713487 713056 gene locus_tag LOCUS_05730 gene paaI 713487 713056 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535436.1 protein_id gnl|my_center|LOCUS_05730 714332 713505 gene locus_tag LOCUS_05740 714332 713505 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789915.1 protein_id gnl|my_center|LOCUS_05740 715487 714339 gene locus_tag LOCUS_05750 gene mqnC 715487 714339 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940023.1 protein_id gnl|my_center|LOCUS_05750 715714 716322 gene locus_tag LOCUS_05760 715714 716322 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962337.1 protein_id gnl|my_center|LOCUS_05760 717054 716380 gene locus_tag LOCUS_05770 717054 716380 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_05770 717295 720159 gene locus_tag LOCUS_05780 gene leuS 717295 720159 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108648.1 protein_id gnl|my_center|LOCUS_05780 720332 720895 gene locus_tag LOCUS_05790 720332 720895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 721156 723951 gene locus_tag LOCUS_05800 721156 723951 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201890.1 protein_id gnl|my_center|LOCUS_05800 724618 726021 gene locus_tag LOCUS_05810 724618 726021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 726083 726796 gene locus_tag LOCUS_05820 726083 726796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 726809 727507 gene locus_tag LOCUS_05830 726809 727507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 727844 728113 gene locus_tag LOCUS_05840 727844 728113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 728771 729871 gene locus_tag LOCUS_05850 728771 729871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 729881 730585 gene locus_tag LOCUS_05860 729881 730585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 730645 731397 gene locus_tag LOCUS_05870 730645 731397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 731443 732159 gene locus_tag LOCUS_05880 731443 732159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 732117 732431 gene locus_tag LOCUS_05890 732117 732431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 732617 733087 gene locus_tag LOCUS_05900 732617 733087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 733508 734200 gene locus_tag LOCUS_05910 733508 734200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 734418 735851 gene locus_tag LOCUS_05920 gene asnS 734418 735851 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964340.1 protein_id gnl|my_center|LOCUS_05920 736073 737188 gene locus_tag LOCUS_05930 gene carA 736073 737188 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963443.1 protein_id gnl|my_center|LOCUS_05930 737190 738476 gene locus_tag LOCUS_05940 gene eno 737190 738476 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931839.1 protein_id gnl|my_center|LOCUS_05940 738584 738913 gene locus_tag LOCUS_05950 738584 738913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 738992 739867 gene locus_tag LOCUS_05960 gene sucD 738992 739867 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963119.1 protein_id gnl|my_center|LOCUS_05960 741573 739921 gene locus_tag LOCUS_05970 741573 739921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 742679 741600 gene locus_tag LOCUS_05980 742679 741600 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_05980 743329 742685 gene locus_tag LOCUS_05990 gene pyrE 743329 742685 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288884.1 protein_id gnl|my_center|LOCUS_05990 743342 744016 gene locus_tag LOCUS_06000 743342 744016 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097944.1 protein_id gnl|my_center|LOCUS_06000 744157 744771 gene locus_tag LOCUS_06010 gene mtgA 744157 744771 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210144.1 protein_id gnl|my_center|LOCUS_06010 747432 744898 gene locus_tag LOCUS_06020 gene topA 747432 744898 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964077.1 protein_id gnl|my_center|LOCUS_06020 748434 747604 gene locus_tag LOCUS_06030 748434 747604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 748822 748442 gene locus_tag LOCUS_06040 748822 748442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 749892 748819 gene locus_tag LOCUS_06050 749892 748819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 752499 751651 gene locus_tag LOCUS_06060 752499 751651 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335559.1 protein_id gnl|my_center|LOCUS_06060 752915 753307 gene locus_tag LOCUS_06070 752915 753307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 753341 753781 gene locus_tag LOCUS_06080 753341 753781 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788218.1 protein_id gnl|my_center|LOCUS_06080 753979 755844 gene locus_tag LOCUS_06090 gene mnmG 753979 755844 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962184.1 protein_id gnl|my_center|LOCUS_06090 755953 757401 gene locus_tag LOCUS_06100 755953 757401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 758292 757408 gene locus_tag LOCUS_06110 758292 757408 CDS product DUF5777 family beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_06110 758603 759397 gene locus_tag LOCUS_06120 758603 759397 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398587.1 protein_id gnl|my_center|LOCUS_06120 759398 759676 gene locus_tag LOCUS_06130 759398 759676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 759880 760899 gene locus_tag LOCUS_06140 759880 760899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 761400 760981 gene locus_tag LOCUS_06150 761400 760981 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759603.1 protein_id gnl|my_center|LOCUS_06150 761568 763049 gene locus_tag LOCUS_06160 gene guaB 761568 763049 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791859.1 protein_id gnl|my_center|LOCUS_06160 763773 770708 gene locus_tag LOCUS_06170 763773 770708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 771213 770725 gene locus_tag LOCUS_06180 gene folK 771213 770725 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545434.1 protein_id gnl|my_center|LOCUS_06180 771293 773773 gene locus_tag LOCUS_06190 gene priA 771293 773773 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963958.1 protein_id gnl|my_center|LOCUS_06190 773827 774492 gene locus_tag LOCUS_06200 773827 774492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 774573 775373 gene locus_tag LOCUS_06210 774573 775373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 775386 775646 gene locus_tag LOCUS_06220 775386 775646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 775671 777269 gene locus_tag LOCUS_06230 775671 777269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 777283 778350 gene locus_tag LOCUS_06240 777283 778350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 778352 778969 gene locus_tag LOCUS_06250 778352 778969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06250 778912 779163 gene locus_tag LOCUS_06260 778912 779163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06260 780122 779238 gene locus_tag LOCUS_06270 780122 779238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 780680 782086 gene locus_tag LOCUS_06280 gene dnaA 780680 782086 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099187.1 protein_id gnl|my_center|LOCUS_06280 782372 782560 gene locus_tag LOCUS_06290 782372 782560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 782850 782925 gene locus_tag LOCUS_t00130 782850 782925 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 786114 782947 gene locus_tag LOCUS_06300 786114 782947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_06300 786460 786179 gene locus_tag LOCUS_06310 786460 786179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 787250 786438 gene locus_tag LOCUS_06320 787250 786438 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767849.1 protein_id gnl|my_center|LOCUS_06320 790098 787264 gene locus_tag LOCUS_06330 790098 787264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 790494 790102 gene locus_tag LOCUS_06340 790494 790102 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404917.1 protein_id gnl|my_center|LOCUS_06340 791049 798566 gene locus_tag LOCUS_06350 791049 798566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 798749 799726 gene locus_tag LOCUS_06360 798749 799726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 800006 800815 gene locus_tag LOCUS_06370 800006 800815 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786931.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06370 800995 802017 gene locus_tag LOCUS_06380 800995 802017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 802494 802814 gene locus_tag LOCUS_06390 802494 802814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 802811 803308 gene locus_tag LOCUS_06400 802811 803308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 803770 803696 gene locus_tag LOCUS_t00140 803770 803696 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 803876 804910 gene locus_tag LOCUS_06410 gene holA 803876 804910 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_06410 804920 806077 gene locus_tag LOCUS_06420 804920 806077 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963492.1 protein_id gnl|my_center|LOCUS_06420 806085 806576 gene locus_tag LOCUS_06430 gene purE 806085 806576 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963493.1 protein_id gnl|my_center|LOCUS_06430 806673 806987 gene locus_tag LOCUS_06440 806673 806987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 806987 808360 gene locus_tag LOCUS_06450 806987 808360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 809135 808383 gene locus_tag LOCUS_06460 809135 808383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 810654 809140 gene locus_tag LOCUS_06470 gene lysS 810654 809140 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802230.1 protein_id gnl|my_center|LOCUS_06470 811431 810793 gene locus_tag LOCUS_06480 811431 810793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06480 812099 811377 gene locus_tag LOCUS_06490 812099 811377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06490 812204 813655 gene locus_tag LOCUS_06500 812204 813655 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964538.1 protein_id gnl|my_center|LOCUS_06500 816617 813729 gene locus_tag LOCUS_06510 816617 813729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 816866 817300 gene locus_tag LOCUS_06520 816866 817300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 817349 817558 gene locus_tag LOCUS_06530 817349 817558 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582834.1 protein_id gnl|my_center|LOCUS_06530 818261 817686 gene locus_tag LOCUS_06540 gene lacC 818261 817686 CDS product lactose 3-dehydrogenase subunit gamma LacC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919508.1 protein_id gnl|my_center|LOCUS_06540 819976 818270 gene locus_tag LOCUS_06550 819976 818270 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_06550 820861 819989 gene locus_tag LOCUS_06560 820861 819989 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_06560 821378 822835 gene locus_tag LOCUS_06570 821378 822835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06570 822866 823516 gene locus_tag LOCUS_06580 822866 823516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06580 823523 823714 gene locus_tag LOCUS_06590 823523 823714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 823731 824693 gene locus_tag LOCUS_06600 823731 824693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 824722 826233 gene locus_tag LOCUS_06610 gene ccoG 824722 826233 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_06610 826298 826744 gene locus_tag LOCUS_06620 826298 826744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 826747 827445 gene locus_tag LOCUS_06630 826747 827445 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_06630 828541 827432 gene locus_tag LOCUS_06640 828541 827432 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072879556.1 protein_id gnl|my_center|LOCUS_06640 828767 828531 gene locus_tag LOCUS_06650 828767 828531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06650 829217 828768 gene locus_tag LOCUS_06660 829217 828768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06660 829564 829292 gene locus_tag LOCUS_06670 829564 829292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 829784 830179 gene locus_tag LOCUS_06680 829784 830179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06680 830200 830859 gene locus_tag LOCUS_06690 830200 830859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06690 830873 831592 gene locus_tag LOCUS_06700 gene dapB 830873 831592 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_06700 831596 833542 gene locus_tag LOCUS_06710 gene dnaG 831596 833542 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802118.1 protein_id gnl|my_center|LOCUS_06710 833703 834002 gene locus_tag LOCUS_06720 833703 834002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 834190 835155 gene locus_tag LOCUS_06730 834190 835155 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_06730 835148 835636 gene locus_tag LOCUS_06740 835148 835636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 835760 836011 gene locus_tag LOCUS_06750 835760 836011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 836014 837438 gene locus_tag LOCUS_06760 836014 837438 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910880.1 protein_id gnl|my_center|LOCUS_06760 837438 838175 gene locus_tag LOCUS_06770 837438 838175 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963879.1 protein_id gnl|my_center|LOCUS_06770 838172 839374 gene locus_tag LOCUS_06780 838172 839374 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_06780 839375 839884 gene locus_tag LOCUS_06790 839375 839884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 839917 841161 gene locus_tag LOCUS_06800 839917 841161 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579489.1 protein_id gnl|my_center|LOCUS_06800 842310 841174 gene locus_tag LOCUS_06810 842310 841174 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_06810 842804 842310 gene locus_tag LOCUS_06820 842804 842310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 843231 845192 gene locus_tag LOCUS_06830 gene gyrB 843231 845192 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783987.1 protein_id gnl|my_center|LOCUS_06830 846039 845329 gene locus_tag LOCUS_06840 846039 845329 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780603.1 protein_id gnl|my_center|LOCUS_06840 847186 846119 gene locus_tag LOCUS_06850 847186 846119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06850 847696 847268 gene locus_tag LOCUS_06860 847696 847268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06860 847996 849093 gene locus_tag LOCUS_06870 gene ychF 847996 849093 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108642.1 protein_id gnl|my_center|LOCUS_06870 850490 849108 gene locus_tag LOCUS_06880 850490 849108 CDS product rRNA cytosine-C5-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108106.1 protein_id gnl|my_center|LOCUS_06880 851209 850511 gene locus_tag LOCUS_06890 851209 850511 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963913.1 protein_id gnl|my_center|LOCUS_06890 852767 851268 gene locus_tag LOCUS_06900 852767 851268 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109230.1 protein_id gnl|my_center|LOCUS_06900 852917 858820 gene locus_tag LOCUS_06910 852917 858820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 858853 859797 gene locus_tag LOCUS_06920 858853 859797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 860001 861824 gene locus_tag LOCUS_06930 860001 861824 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963110.1 protein_id gnl|my_center|LOCUS_06930 862689 862021 gene locus_tag LOCUS_06940 862689 862021 CDS product fibrobacter succinogenes major paralogous domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931754.1 protein_id gnl|my_center|LOCUS_06940 862882 862763 gene locus_tag LOCUS_06950 862882 862763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 864183 863599 gene locus_tag LOCUS_06960 864183 863599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 864754 864197 gene locus_tag LOCUS_06970 864754 864197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 864849 865472 gene locus_tag LOCUS_06980 864849 865472 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074266.1 protein_id gnl|my_center|LOCUS_06980 866606 866088 gene locus_tag LOCUS_06990 866606 866088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 866855 866634 gene locus_tag LOCUS_07000 866855 866634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 868183 867299 gene locus_tag LOCUS_07010 868183 867299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 869981 868383 gene locus_tag LOCUS_07020 869981 868383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 871887 870268 gene locus_tag LOCUS_07030 871887 870268 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122885.1 protein_id gnl|my_center|LOCUS_07030 873097 872168 gene locus_tag LOCUS_07040 873097 872168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 873898 873113 gene locus_tag LOCUS_07050 873898 873113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 874098 875099 gene locus_tag LOCUS_07060 gene fbp 874098 875099 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171118.1 protein_id gnl|my_center|LOCUS_07060 875190 876572 gene locus_tag LOCUS_07070 875190 876572 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249477.1 protein_id gnl|my_center|LOCUS_07070 877268 876600 gene locus_tag LOCUS_07080 gene udk 877268 876600 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963257.1 protein_id gnl|my_center|LOCUS_07080 877347 878690 gene locus_tag LOCUS_07090 877347 878690 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_07090 878803 879903 gene locus_tag LOCUS_07100 878803 879903 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_07100 879913 881379 gene locus_tag LOCUS_07110 879913 881379 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_07110 881617 881838 gene locus_tag LOCUS_07120 881617 881838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 881840 882106 gene locus_tag LOCUS_07130 881840 882106 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481712.1 protein_id gnl|my_center|LOCUS_07130 882060 882296 gene locus_tag LOCUS_07140 882060 882296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 882534 882722 gene locus_tag LOCUS_07150 882534 882722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 883014 883226 gene locus_tag LOCUS_07160 883014 883226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 883213 883551 gene locus_tag LOCUS_07170 883213 883551 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928563.1 protein_id gnl|my_center|LOCUS_07170 884198 886108 gene locus_tag LOCUS_07180 884198 886108 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963172.1 protein_id gnl|my_center|LOCUS_07180 886570 887418 gene locus_tag LOCUS_07190 886570 887418 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_07190 887623 888093 gene locus_tag LOCUS_07200 887623 888093 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404264.1 protein_id gnl|my_center|LOCUS_07200 888113 888415 gene locus_tag LOCUS_07210 888113 888415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 888446 889132 gene locus_tag LOCUS_07220 gene aat 888446 889132 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546338.1 protein_id gnl|my_center|LOCUS_07220 889798 889157 gene locus_tag LOCUS_07230 889798 889157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 891278 889788 gene locus_tag LOCUS_07240 gene crtI 891278 889788 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066789316.1 protein_id gnl|my_center|LOCUS_07240 891459 892082 gene locus_tag LOCUS_07250 891459 892082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 893061 892108 gene locus_tag LOCUS_07260 893061 892108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 893810 893019 gene locus_tag LOCUS_07270 893810 893019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 894371 895771 gene locus_tag LOCUS_07280 894371 895771 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_07280 895811 898981 gene locus_tag LOCUS_07290 895811 898981 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_07290 899012 900418 gene locus_tag LOCUS_07300 gene nrfD 899012 900418 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_07300 900445 900966 gene locus_tag LOCUS_07310 900445 900966 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_07310 900978 901790 gene locus_tag LOCUS_07320 900978 901790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 901806 903113 gene locus_tag LOCUS_07330 901806 903113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 903145 904665 gene locus_tag LOCUS_07340 903145 904665 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 protein_id gnl|my_center|LOCUS_07340 904610 906454 gene locus_tag LOCUS_07350 904610 906454 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_07350 906474 907373 gene locus_tag LOCUS_07360 906474 907373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 907370 907951 gene locus_tag LOCUS_07370 907370 907951 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_07370 907966 908817 gene locus_tag LOCUS_07380 907966 908817 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964207.1 protein_id gnl|my_center|LOCUS_07380 908836 909243 gene locus_tag LOCUS_07390 908836 909243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 909353 909829 gene locus_tag LOCUS_07400 909353 909829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 910566 910748 gene locus_tag LOCUS_07410 910566 910748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 910760 911737 gene locus_tag LOCUS_07420 910760 911737 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964493.1 protein_id gnl|my_center|LOCUS_07420 914242 911759 gene locus_tag LOCUS_07430 914242 911759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 914344 915558 gene locus_tag LOCUS_07440 gene hflX 914344 915558 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964502.1 protein_id gnl|my_center|LOCUS_07440 916599 915559 gene locus_tag LOCUS_07450 gene pdhA 916599 915559 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963513.1 protein_id gnl|my_center|LOCUS_07450 916992 918599 gene locus_tag LOCUS_07460 916992 918599 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964003.1 protein_id gnl|my_center|LOCUS_07460 918664 919209 gene locus_tag LOCUS_07470 918664 919209 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782842.1 protein_id gnl|my_center|LOCUS_07470 919459 919893 gene locus_tag LOCUS_07480 919459 919893 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963697.1 protein_id gnl|my_center|LOCUS_07480 919922 920497 gene locus_tag LOCUS_07490 919922 920497 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962853.1 protein_id gnl|my_center|LOCUS_07490 922026 920560 gene locus_tag LOCUS_07500 922026 920560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_07500 922705 922037 gene locus_tag LOCUS_07510 922705 922037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 924241 922952 gene locus_tag LOCUS_07520 gene rocD 924241 922952 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_07520 924349 924810 gene locus_tag LOCUS_07530 924349 924810 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993802.1 protein_id gnl|my_center|LOCUS_07530 925326 924832 gene locus_tag LOCUS_07540 gene pyrR 925326 924832 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548034.1 protein_id gnl|my_center|LOCUS_07540 925409 926785 gene locus_tag LOCUS_07550 925409 926785 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_07550 926808 927596 gene locus_tag LOCUS_07560 926808 927596 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_07560 927679 928167 gene locus_tag LOCUS_07570 927679 928167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_07570 928251 928715 gene locus_tag LOCUS_07580 928251 928715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 929158 928844 gene locus_tag LOCUS_07590 929158 928844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 930462 929845 gene locus_tag LOCUS_07600 gene tsaB 930462 929845 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_07600 932179 930515 gene locus_tag LOCUS_07610 932179 930515 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_07610 933010 932228 gene locus_tag LOCUS_07620 933010 932228 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 protein_id gnl|my_center|LOCUS_07620 933206 934510 gene locus_tag LOCUS_07630 933206 934510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07630 934503 935219 gene locus_tag LOCUS_07640 934503 935219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07640 935554 935228 gene locus_tag LOCUS_07650 935554 935228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 942856 935660 gene locus_tag LOCUS_07660 942856 935660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 943296 943132 gene locus_tag LOCUS_07670 943296 943132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 944152 943256 gene locus_tag LOCUS_07680 944152 943256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 944733 946898 gene locus_tag LOCUS_07690 944733 946898 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839622.1 protein_id gnl|my_center|LOCUS_07690 947009 947785 gene locus_tag LOCUS_07700 947009 947785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 947962 948120 gene locus_tag LOCUS_07710 947962 948120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 948113 949333 gene locus_tag LOCUS_07720 948113 949333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 950116 949652 gene locus_tag LOCUS_07730 950116 949652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 950491 950117 gene locus_tag LOCUS_07740 950491 950117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07740 950557 950739 gene locus_tag LOCUS_07750 950557 950739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 951170 952624 gene locus_tag LOCUS_07760 951170 952624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07760 952615 954804 gene locus_tag LOCUS_07770 952615 954804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07770 954856 958494 gene locus_tag LOCUS_07780 954856 958494 CDS product zinc-dependent metalloprotease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962407.1 protein_id gnl|my_center|LOCUS_07780 958598 960622 gene locus_tag LOCUS_07790 958598 960622 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267166.1 protein_id gnl|my_center|LOCUS_07790 960979 961713 gene locus_tag LOCUS_07800 960979 961713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 962524 962111 gene locus_tag LOCUS_07810 962524 962111 CDS product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_07810 962738 963502 gene locus_tag LOCUS_07820 962738 963502 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 protein_id gnl|my_center|LOCUS_07820 963947 963513 gene locus_tag LOCUS_07830 gene rnpA 963947 963513 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964465.1 protein_id gnl|my_center|LOCUS_07830 966029 964332 gene locus_tag LOCUS_07840 gene rho 966029 964332 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962876.1 protein_id gnl|my_center|LOCUS_07840 966235 966849 gene locus_tag LOCUS_07850 966235 966849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07850 966861 967514 gene locus_tag LOCUS_07860 966861 967514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07860 967532 968221 gene locus_tag LOCUS_07870 967532 968221 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_07870 968241 968804 gene locus_tag LOCUS_07880 gene frr 968241 968804 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962605.1 protein_id gnl|my_center|LOCUS_07880 969510 968935 gene locus_tag LOCUS_07890 969510 968935 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931957.1 protein_id gnl|my_center|LOCUS_07890 970660 969704 gene locus_tag LOCUS_07900 970660 969704 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_07900 971417 970677 gene locus_tag LOCUS_07910 971417 970677 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_07910 971596 971913 gene locus_tag LOCUS_07920 971596 971913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 971919 972800 gene locus_tag LOCUS_07930 971919 972800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 972793 973329 gene locus_tag LOCUS_07940 972793 973329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 973269 973592 gene locus_tag LOCUS_07950 973269 973592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07950 973954 974403 gene locus_tag LOCUS_07960 973954 974403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07960 974671 976230 gene locus_tag LOCUS_07970 974671 976230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 976545 977609 gene locus_tag LOCUS_07980 gene queA 976545 977609 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962415.1 protein_id gnl|my_center|LOCUS_07980 977711 977932 gene locus_tag LOCUS_07990 977711 977932 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_07990 977980 978654 gene locus_tag LOCUS_08000 gene cmk 977980 978654 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963822.1 protein_id gnl|my_center|LOCUS_08000 978780 979277 gene locus_tag LOCUS_08010 978780 979277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 980784 979468 gene locus_tag LOCUS_08020 980784 979468 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880031.1 protein_id gnl|my_center|LOCUS_08020 981200 982207 gene locus_tag LOCUS_08030 981200 982207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 982445 984349 gene locus_tag LOCUS_08040 gene dnaK 982445 984349 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764765.1 protein_id gnl|my_center|LOCUS_08040 985691 984477 gene locus_tag LOCUS_08050 985691 984477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 986566 985715 gene locus_tag LOCUS_08060 986566 985715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 988087 986591 gene locus_tag LOCUS_08070 988087 986591 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 protein_id gnl|my_center|LOCUS_08070 991205 988119 gene locus_tag LOCUS_08080 991205 988119 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036562.1 protein_id gnl|my_center|LOCUS_08080 993319 991268 gene locus_tag LOCUS_08090 993319 991268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 993479 996334 gene locus_tag LOCUS_08100 993479 996334 CDS product triple tyrosine motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091372500.1 protein_id gnl|my_center|LOCUS_08100 1000683 996466 gene locus_tag LOCUS_08110 1000683 996466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 1001165 1000839 gene locus_tag LOCUS_08120 1001165 1000839 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_08120 1001635 1001177 gene locus_tag LOCUS_08130 gene iscU 1001635 1001177 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599506.1 protein_id gnl|my_center|LOCUS_08130 1002846 1001620 gene locus_tag LOCUS_08140 1002846 1001620 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_08140 1003232 1005391 gene locus_tag LOCUS_08150 1003232 1005391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 1005709 1005503 gene locus_tag LOCUS_08160 1005709 1005503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 1006487 1005732 gene locus_tag LOCUS_08170 1006487 1005732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 1007314 1007126 gene locus_tag LOCUS_08180 1007314 1007126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 1009145 1008087 gene locus_tag LOCUS_08190 1009145 1008087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 1009295 1010125 gene locus_tag LOCUS_08200 1009295 1010125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 1010622 1014371 gene locus_tag LOCUS_08210 1010622 1014371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 1014617 1015408 gene locus_tag LOCUS_08220 1014617 1015408 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836548.1 protein_id gnl|my_center|LOCUS_08220 1015412 1016770 gene locus_tag LOCUS_08230 1015412 1016770 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203189.1 protein_id gnl|my_center|LOCUS_08230 1016942 1018330 gene locus_tag LOCUS_08240 1016942 1018330 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 protein_id gnl|my_center|LOCUS_08240 1018356 1019738 gene locus_tag LOCUS_08250 1018356 1019738 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_08250 1019738 1020349 gene locus_tag LOCUS_08260 1019738 1020349 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_08260 1020666 1020388 gene locus_tag LOCUS_08270 1020666 1020388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 1021315 1020776 gene locus_tag LOCUS_08280 1021315 1020776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 1021578 1021378 gene locus_tag LOCUS_08290 1021578 1021378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 1021972 1023300 gene locus_tag LOCUS_08300 1021972 1023300 CDS product DASH family cryptochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140837.1 protein_id gnl|my_center|LOCUS_08300 1023329 1024312 gene locus_tag LOCUS_08310 1023329 1024312 CDS product DUF6089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964193.1 protein_id gnl|my_center|LOCUS_08310 1024741 1024448 gene locus_tag LOCUS_08320 1024741 1024448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 1025331 1024831 gene locus_tag LOCUS_08330 1025331 1024831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 1025455 1026477 gene locus_tag LOCUS_08340 1025455 1026477 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097278.1 protein_id gnl|my_center|LOCUS_08340 1026592 1027905 gene locus_tag LOCUS_08350 1026592 1027905 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404664.1 protein_id gnl|my_center|LOCUS_08350 1028825 1027908 gene locus_tag LOCUS_08360 1028825 1027908 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787685.1 protein_id gnl|my_center|LOCUS_08360 1028817 1030052 gene locus_tag LOCUS_08370 1028817 1030052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 1030013 1031284 gene locus_tag LOCUS_08380 1030013 1031284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 1031634 1033754 gene locus_tag LOCUS_08390 1031634 1033754 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203174.1 protein_id gnl|my_center|LOCUS_08390 1033969 1034745 gene locus_tag LOCUS_08400 1033969 1034745 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658267.1 protein_id gnl|my_center|LOCUS_08400 1034915 1035394 gene locus_tag LOCUS_08410 1034915 1035394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 1035388 1037154 gene locus_tag LOCUS_08420 1035388 1037154 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203288.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08420 1037179 1037733 gene locus_tag LOCUS_08430 1037179 1037733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 1039699 1038038 gene locus_tag LOCUS_08440 1039699 1038038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 1040115 1039822 gene locus_tag LOCUS_08450 1040115 1039822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 1040138 1040329 gene locus_tag LOCUS_08460 1040138 1040329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 1041431 1040379 gene locus_tag LOCUS_08470 1041431 1040379 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143552.1 protein_id gnl|my_center|LOCUS_08470 1042722 1041445 gene locus_tag LOCUS_08480 1042722 1041445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 1042917 1043363 gene locus_tag LOCUS_08490 1042917 1043363 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942653.1 protein_id gnl|my_center|LOCUS_08490 1043389 1044483 gene locus_tag LOCUS_08500 1043389 1044483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 1045534 1044494 gene locus_tag LOCUS_08510 gene mltG 1045534 1044494 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963345.1 protein_id gnl|my_center|LOCUS_08510 1046366 1045548 gene locus_tag LOCUS_08520 gene panB 1046366 1045548 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963041.1 protein_id gnl|my_center|LOCUS_08520 1046560 1046633 gene locus_tag LOCUS_t00150 1046560 1046633 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1046762 1047577 gene locus_tag LOCUS_08530 1046762 1047577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 1047942 1047589 gene locus_tag LOCUS_08540 1047942 1047589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 1048499 1047948 gene locus_tag LOCUS_08550 1048499 1047948 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_08550 1048903 1049454 gene locus_tag LOCUS_08560 1048903 1049454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 1049460 1050104 gene locus_tag LOCUS_08570 1049460 1050104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 1050727 1050113 gene locus_tag LOCUS_08580 1050727 1050113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08580 1051755 1050868 gene locus_tag LOCUS_08590 1051755 1050868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08590 1056239 1051899 gene locus_tag LOCUS_08600 1056239 1051899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 1056801 1056433 gene locus_tag LOCUS_08610 1056801 1056433 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958148.1 protein_id gnl|my_center|LOCUS_08610 1057897 1056788 gene locus_tag LOCUS_08620 1057897 1056788 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_08620 1059088 1058507 gene locus_tag LOCUS_08630 1059088 1058507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 1059280 1060320 gene locus_tag LOCUS_08640 1059280 1060320 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488759.1 protein_id gnl|my_center|LOCUS_08640 1060586 1061812 gene locus_tag LOCUS_08650 1060586 1061812 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259615.1 protein_id gnl|my_center|LOCUS_08650 1062525 1061878 gene locus_tag LOCUS_08660 1062525 1061878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 1063417 1062518 gene locus_tag LOCUS_08670 1063417 1062518 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963268.1 protein_id gnl|my_center|LOCUS_08670 1064222 1063446 gene locus_tag LOCUS_08680 1064222 1063446 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 protein_id gnl|my_center|LOCUS_08680 1064907 1064224 gene locus_tag LOCUS_08690 1064907 1064224 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868927.1 protein_id gnl|my_center|LOCUS_08690 1065207 1065614 gene locus_tag LOCUS_08700 1065207 1065614 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963898.1 protein_id gnl|my_center|LOCUS_08700 1065639 1066004 gene locus_tag LOCUS_08710 gene gldC 1065639 1066004 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_08710 1066276 1068774 gene locus_tag LOCUS_08720 1066276 1068774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 1068782 1069393 gene locus_tag LOCUS_08730 1068782 1069393 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796757.1 protein_id gnl|my_center|LOCUS_08730 1070223 1069390 gene locus_tag LOCUS_08740 gene prmA 1070223 1069390 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_08740 1070775 1070284 gene locus_tag LOCUS_08750 1070775 1070284 CDS product DUF1761 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553178.1 protein_id gnl|my_center|LOCUS_08750 1071238 1070882 gene locus_tag LOCUS_08760 1071238 1070882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 1072352 1071240 gene locus_tag LOCUS_08770 1072352 1071240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 1073938 1072421 gene locus_tag LOCUS_08780 1073938 1072421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 1075107 1073962 gene locus_tag LOCUS_08790 1075107 1073962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 1076006 1075050 gene locus_tag LOCUS_08800 1076006 1075050 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763955.1 protein_id gnl|my_center|LOCUS_08800 1076396 1076076 gene locus_tag LOCUS_08810 1076396 1076076 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_08810 1076801 1078348 gene locus_tag LOCUS_08820 1076801 1078348 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303090.1 protein_id gnl|my_center|LOCUS_08820 1078798 1078361 gene locus_tag LOCUS_08830 1078798 1078361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 1078882 1080012 gene locus_tag LOCUS_08840 1078882 1080012 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964437.1 protein_id gnl|my_center|LOCUS_08840 1080616 1079990 gene locus_tag LOCUS_08850 gene rsmG 1080616 1079990 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817853.1 protein_id gnl|my_center|LOCUS_08850 1081700 1080990 gene locus_tag LOCUS_08860 1081700 1080990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 1081965 1085516 gene locus_tag LOCUS_08870 gene smc 1081965 1085516 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092731919.1 protein_id gnl|my_center|LOCUS_08870 1085524 1086111 gene locus_tag LOCUS_08880 1085524 1086111 CDS product acyl carrier protein phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_08880 1087698 1086127 gene locus_tag LOCUS_08890 1087698 1086127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 1088189 1088533 gene locus_tag LOCUS_08900 gene rplT 1088189 1088533 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297540.1 protein_id gnl|my_center|LOCUS_08900 1088955 1089542 gene locus_tag LOCUS_08910 1088955 1089542 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963075.1 protein_id gnl|my_center|LOCUS_08910 1089548 1090876 gene locus_tag LOCUS_08920 1089548 1090876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 1090943 1092001 gene locus_tag LOCUS_08930 1090943 1092001 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963074.1 protein_id gnl|my_center|LOCUS_08930 1092014 1093258 gene locus_tag LOCUS_08940 1092014 1093258 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963073.1 protein_id gnl|my_center|LOCUS_08940 1093306 1093971 gene locus_tag LOCUS_08950 1093306 1093971 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963072.1 protein_id gnl|my_center|LOCUS_08950 1094104 1097532 gene locus_tag LOCUS_08960 1094104 1097532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 1098378 1098305 gene locus_tag LOCUS_t00160 1098378 1098305 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1099109 1098504 gene locus_tag LOCUS_08970 1099109 1098504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 1099409 1099684 gene locus_tag LOCUS_08980 gene rpsO 1099409 1099684 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964145.1 protein_id gnl|my_center|LOCUS_08980 1099834 1101954 gene locus_tag LOCUS_08990 gene pnp 1099834 1101954 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791373.1 protein_id gnl|my_center|LOCUS_08990 1102433 1102014 gene locus_tag LOCUS_09000 1102433 1102014 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023470.1 protein_id gnl|my_center|LOCUS_09000 1106426 1102437 gene locus_tag LOCUS_09010 1106426 1102437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 1107642 1106494 gene locus_tag LOCUS_09020 1107642 1106494 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213649.1 protein_id gnl|my_center|LOCUS_09020 1108132 1110651 gene locus_tag LOCUS_09030 1108132 1110651 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_09030 1111238 1110735 gene locus_tag LOCUS_09040 gene lysM 1111238 1110735 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963486.1 protein_id gnl|my_center|LOCUS_09040 1111782 1114793 gene locus_tag LOCUS_09050 gene secDF 1111782 1114793 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765303.1 protein_id gnl|my_center|LOCUS_09050 1116408 1115296 gene locus_tag LOCUS_09060 1116408 1115296 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967588.1 protein_id gnl|my_center|LOCUS_09060 1117576 1116398 gene locus_tag LOCUS_09070 1117576 1116398 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_09070 1117853 1118296 gene locus_tag LOCUS_09080 1117853 1118296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 1118334 1118693 gene locus_tag LOCUS_09090 1118334 1118693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 1118811 1119392 gene locus_tag LOCUS_09100 gene scpB 1118811 1119392 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842431.1 protein_id gnl|my_center|LOCUS_09100 1119434 1119946 gene locus_tag LOCUS_09110 1119434 1119946 CDS product DUF2480 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405390.1 protein_id gnl|my_center|LOCUS_09110 1120015 1120644 gene locus_tag LOCUS_09120 1120015 1120644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09120 1120635 1120937 gene locus_tag LOCUS_09130 1120635 1120937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09130 1122804 1121101 gene locus_tag LOCUS_09140 1122804 1121101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 1123151 1122855 gene locus_tag LOCUS_09150 1123151 1122855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 1124239 1123184 gene locus_tag LOCUS_09160 1124239 1123184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 1124827 1127445 gene locus_tag LOCUS_09170 1124827 1127445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 1128246 1127491 gene locus_tag LOCUS_09180 1128246 1127491 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_09180 1128995 1128249 gene locus_tag LOCUS_09190 1128995 1128249 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_09190 1129358 1130227 gene locus_tag LOCUS_09200 1129358 1130227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 1130238 1131422 gene locus_tag LOCUS_09210 1130238 1131422 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065081.1 protein_id gnl|my_center|LOCUS_09210 1131439 1132566 gene locus_tag LOCUS_09220 1131439 1132566 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784515.1 protein_id gnl|my_center|LOCUS_09220 1132671 1132982 gene locus_tag LOCUS_09230 1132671 1132982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 1133244 1134308 gene locus_tag LOCUS_09240 1133244 1134308 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_09240 1136075 1134369 gene locus_tag LOCUS_09250 1136075 1134369 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228733.1 protein_id gnl|my_center|LOCUS_09250 1136825 1136196 gene locus_tag LOCUS_09260 1136825 1136196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 1136895 1138181 gene locus_tag LOCUS_09270 1136895 1138181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 1138983 1138183 gene locus_tag LOCUS_09280 1138983 1138183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09280 1142593 1139078 gene locus_tag LOCUS_09290 1142593 1139078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 1143166 1142714 gene locus_tag LOCUS_09300 1143166 1142714 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100451.1 protein_id gnl|my_center|LOCUS_09300 1144091 1143168 gene locus_tag LOCUS_09310 1144091 1143168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 1144823 1145290 gene locus_tag LOCUS_09320 1144823 1145290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 1145381 1145965 gene locus_tag LOCUS_09330 1145381 1145965 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_09330 1146000 1146467 gene locus_tag LOCUS_09340 1146000 1146467 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_09340 1146474 1146995 gene locus_tag LOCUS_09350 1146474 1146995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 1147296 1146967 gene locus_tag LOCUS_09360 gene cutA 1147296 1146967 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879470.1 protein_id gnl|my_center|LOCUS_09360 1148279 1147299 gene locus_tag LOCUS_09370 gene pfkA 1148279 1147299 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963726.1 protein_id gnl|my_center|LOCUS_09370 1148901 1148332 gene locus_tag LOCUS_09380 1148901 1148332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09380 1149164 1148934 gene locus_tag LOCUS_09390 1149164 1148934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 1150221 1149166 gene locus_tag LOCUS_09400 1150221 1149166 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027223809.1 protein_id gnl|my_center|LOCUS_09400 1150776 1150408 gene locus_tag LOCUS_09410 1150776 1150408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09410 1152329 1150788 gene locus_tag LOCUS_09420 1152329 1150788 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421548.1 protein_id gnl|my_center|LOCUS_09420 1153355 1152447 gene locus_tag LOCUS_09430 gene mgrA 1153355 1152447 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031556.1 protein_id gnl|my_center|LOCUS_09430 1153626 1155662 gene locus_tag LOCUS_09440 1153626 1155662 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964061.1 protein_id gnl|my_center|LOCUS_09440 1155664 1156173 gene locus_tag LOCUS_09450 1155664 1156173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 1157345 1156455 gene locus_tag LOCUS_09460 gene rfbD 1157345 1156455 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767804.1 protein_id gnl|my_center|LOCUS_09460 1157667 1157338 gene locus_tag LOCUS_09470 1157667 1157338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09470 1159200 1157893 gene locus_tag LOCUS_09480 gene der 1159200 1157893 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964065.1 protein_id gnl|my_center|LOCUS_09480 1162065 1159327 gene locus_tag LOCUS_09490 gene fdhF 1162065 1159327 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195994.1 protein_id gnl|my_center|LOCUS_09490 1162417 1163253 gene locus_tag LOCUS_09500 gene dapF 1162417 1163253 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963347.1 protein_id gnl|my_center|LOCUS_09500 1163469 1165646 gene locus_tag LOCUS_09510 1163469 1165646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 1165932 1166573 gene locus_tag LOCUS_09520 1165932 1166573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 1168743 1166683 gene locus_tag LOCUS_09530 1168743 1166683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 1168962 1169648 gene locus_tag LOCUS_09540 1168962 1169648 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760839.1 protein_id gnl|my_center|LOCUS_09540 1169741 1170064 gene locus_tag LOCUS_09550 1169741 1170064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 1170068 1170466 gene locus_tag LOCUS_09560 1170068 1170466 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791127.1 protein_id gnl|my_center|LOCUS_09560 1170579 1171370 gene locus_tag LOCUS_09570 1170579 1171370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 1171490 1174366 gene locus_tag LOCUS_09580 1171490 1174366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 1174394 1176814 gene locus_tag LOCUS_09590 1174394 1176814 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963906.1 protein_id gnl|my_center|LOCUS_09590 1176818 1178332 gene locus_tag LOCUS_09600 1176818 1178332 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870580.1 protein_id gnl|my_center|LOCUS_09600 1179493 1178333 gene locus_tag LOCUS_09610 gene aar 1179493 1178333 CDS product bifunctional L-alanine/L-glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079973.1 protein_id gnl|my_center|LOCUS_09610 1179743 1180276 gene locus_tag LOCUS_09620 gene ftnA 1179743 1180276 CDS product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070543.1 protein_id gnl|my_center|LOCUS_09620 1180425 1181540 gene locus_tag LOCUS_09630 1180425 1181540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 1181546 1182400 gene locus_tag LOCUS_09640 1181546 1182400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 1182410 1183132 gene locus_tag LOCUS_09650 1182410 1183132 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_09650 1183653 1183135 gene locus_tag LOCUS_09660 1183653 1183135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 1183896 1184270 gene locus_tag LOCUS_09670 1183896 1184270 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962523.1 protein_id gnl|my_center|LOCUS_09670 1184411 1184890 gene locus_tag LOCUS_09680 1184411 1184890 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796768.1 protein_id gnl|my_center|LOCUS_09680 1184929 1185849 gene locus_tag LOCUS_09690 1184929 1185849 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107892.1 protein_id gnl|my_center|LOCUS_09690 1185843 1188494 gene locus_tag LOCUS_09700 1185843 1188494 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_09700 1188718 1189566 gene locus_tag LOCUS_09710 1188718 1189566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 1189569 1190012 gene locus_tag LOCUS_09720 1189569 1190012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 1192832 1190076 gene locus_tag LOCUS_09730 1192832 1190076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 1194070 1193132 gene locus_tag LOCUS_09740 1194070 1193132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 1195981 1194194 gene locus_tag LOCUS_09750 1195981 1194194 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403141.1 protein_id gnl|my_center|LOCUS_09750 1196833 1196003 gene locus_tag LOCUS_09760 1196833 1196003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 1198501 1196846 gene locus_tag LOCUS_09770 1198501 1196846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1198676 1199230 gene locus_tag LOCUS_09780 1198676 1199230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 1200353 1199241 gene locus_tag LOCUS_09790 gene lpxB 1200353 1199241 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_09790 1200720 1200421 gene locus_tag LOCUS_09800 1200720 1200421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 1201485 1200730 gene locus_tag LOCUS_09810 gene surE 1201485 1200730 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964421.1 protein_id gnl|my_center|LOCUS_09810 1202477 1201482 gene locus_tag LOCUS_09820 1202477 1201482 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 protein_id gnl|my_center|LOCUS_09820 1202851 1202444 gene locus_tag LOCUS_09830 1202851 1202444 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_09830 1204169 1202856 gene locus_tag LOCUS_09840 1204169 1202856 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403437.1 protein_id gnl|my_center|LOCUS_09840 1205016 1204216 gene locus_tag LOCUS_09850 1205016 1204216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 1205255 1206217 gene locus_tag LOCUS_09860 1205255 1206217 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962800.1 protein_id gnl|my_center|LOCUS_09860 1206478 1207176 gene locus_tag LOCUS_09870 gene truC 1206478 1207176 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063386.1 protein_id gnl|my_center|LOCUS_09870 1208191 1207181 gene locus_tag LOCUS_09880 gene tsaD 1208191 1207181 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503448.1 protein_id gnl|my_center|LOCUS_09880 1208319 1208906 gene locus_tag LOCUS_09890 1208319 1208906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760896.1 protein_id gnl|my_center|LOCUS_09890 1208900 1209649 gene locus_tag LOCUS_09900 1208900 1209649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 1209646 1210182 gene locus_tag LOCUS_09910 1209646 1210182 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202123.1 protein_id gnl|my_center|LOCUS_09910 1211552 1210191 gene locus_tag LOCUS_09920 1211552 1210191 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963328.1 protein_id gnl|my_center|LOCUS_09920 1212400 1211573 gene locus_tag LOCUS_09930 1212400 1211573 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962448.1 protein_id gnl|my_center|LOCUS_09930 1212933 1212424 gene locus_tag LOCUS_09940 1212933 1212424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 1214542 1213154 gene locus_tag LOCUS_09950 1214542 1213154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 1215161 1214583 gene locus_tag LOCUS_09960 gene infC 1215161 1214583 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768315.1 protein_id gnl|my_center|LOCUS_09960 1217014 1215212 gene locus_tag LOCUS_09970 1217014 1215212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09970 1217766 1217164 gene locus_tag LOCUS_09980 1217766 1217164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09980 1218261 1218650 gene locus_tag LOCUS_09990 1218261 1218650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 1218637 1219551 gene locus_tag LOCUS_10000 1218637 1219551 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801215.1 protein_id gnl|my_center|LOCUS_10000 1219785 1221743 gene locus_tag LOCUS_10010 1219785 1221743 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964423.1 protein_id gnl|my_center|LOCUS_10010 1222967 1221756 gene locus_tag LOCUS_10020 1222967 1221756 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_10020 1223168 1223599 gene locus_tag LOCUS_10030 1223168 1223599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 1223647 1224477 gene locus_tag LOCUS_10040 1223647 1224477 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403347.1 protein_id gnl|my_center|LOCUS_10040 1224666 1224502 gene locus_tag LOCUS_10050 1224666 1224502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 1224953 1224642 gene locus_tag LOCUS_10060 1224953 1224642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 1225846 1225076 gene locus_tag LOCUS_10070 1225846 1225076 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403682.1 protein_id gnl|my_center|LOCUS_10070 1226376 1225843 gene locus_tag LOCUS_10080 1226376 1225843 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963857.1 protein_id gnl|my_center|LOCUS_10080 1227360 1226464 gene locus_tag LOCUS_10090 1227360 1226464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 1228937 1227357 gene locus_tag LOCUS_10100 1228937 1227357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 1229049 1229648 gene locus_tag LOCUS_10110 1229049 1229648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 1230091 1229654 gene locus_tag LOCUS_10120 1230091 1229654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 1230891 1230229 gene locus_tag LOCUS_10130 gene mnmD 1230891 1230229 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108715.1 protein_id gnl|my_center|LOCUS_10130 1231225 1230878 gene locus_tag LOCUS_10140 gene ytxJ 1231225 1230878 CDS product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_10140 1232536 1231523 gene locus_tag LOCUS_10150 1232536 1231523 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_10150 1233791 1232568 gene locus_tag LOCUS_10160 1233791 1232568 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963858.1 protein_id gnl|my_center|LOCUS_10160 1235449 1233794 gene locus_tag LOCUS_10170 gene recN 1235449 1233794 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963946.1 protein_id gnl|my_center|LOCUS_10170 1235644 1236144 gene locus_tag LOCUS_10180 1235644 1236144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 1236689 1236150 gene locus_tag LOCUS_10190 1236689 1236150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1238028 1236811 gene locus_tag LOCUS_10200 1238028 1236811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 1239126 1241318 gene locus_tag LOCUS_10210 1239126 1241318 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 protein_id gnl|my_center|LOCUS_10210 1241499 1242443 gene locus_tag LOCUS_10220 1241499 1242443 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 protein_id gnl|my_center|LOCUS_10220 1243915 1242542 gene locus_tag LOCUS_10230 1243915 1242542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 1244397 1244771 gene locus_tag LOCUS_10240 1244397 1244771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 1244806 1245177 gene locus_tag LOCUS_10250 1244806 1245177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 1245190 1246008 gene locus_tag LOCUS_10260 1245190 1246008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 1246017 1250648 gene locus_tag LOCUS_10270 1246017 1250648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1250682 1250933 gene locus_tag LOCUS_10280 1250682 1250933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1250939 1251724 gene locus_tag LOCUS_10290 1250939 1251724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 1252040 1253506 gene locus_tag LOCUS_10300 1252040 1253506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 1253610 1254458 gene locus_tag LOCUS_10310 1253610 1254458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 1254672 1255241 gene locus_tag LOCUS_10320 1254672 1255241 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785889.1 protein_id gnl|my_center|LOCUS_10320 1255267 1256247 gene locus_tag LOCUS_10330 1255267 1256247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 1256356 1258992 gene locus_tag LOCUS_10340 1256356 1258992 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_10340 1259273 1260091 gene locus_tag LOCUS_10350 1259273 1260091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 1260145 1260837 gene locus_tag LOCUS_10360 1260145 1260837 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392343.1 protein_id gnl|my_center|LOCUS_10360 1261057 1261143 gene locus_tag LOCUS_t00170 1261057 1261143 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1261308 1263530 gene locus_tag LOCUS_10370 gene alaS 1261308 1263530 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964045.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10370 1263509 1263928 gene locus_tag LOCUS_10380 1263509 1263928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 1263936 1264772 gene locus_tag LOCUS_10390 gene folP 1263936 1264772 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963546.1 protein_id gnl|my_center|LOCUS_10390 1264898 1266724 gene locus_tag LOCUS_10400 1264898 1266724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 1266703 1269654 gene locus_tag LOCUS_10410 1266703 1269654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 1270211 1269783 gene locus_tag LOCUS_10420 1270211 1269783 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_10420 1270485 1273385 gene locus_tag LOCUS_10430 1270485 1273385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 1273443 1274057 gene locus_tag LOCUS_10440 1273443 1274057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10440 1274075 1275643 gene locus_tag LOCUS_10450 1274075 1275643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10450 1276394 1275669 gene locus_tag LOCUS_10460 gene bshB1 1276394 1275669 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_10460 1277423 1276410 gene locus_tag LOCUS_10470 gene murB 1277423 1276410 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964097.1 protein_id gnl|my_center|LOCUS_10470 1278077 1277439 gene locus_tag LOCUS_10480 1278077 1277439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 1279923 1278091 gene locus_tag LOCUS_10490 1279923 1278091 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 protein_id gnl|my_center|LOCUS_10490 1280397 1279945 gene locus_tag LOCUS_10500 1280397 1279945 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_10500 1282730 1280421 gene locus_tag LOCUS_10510 1282730 1280421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 1283511 1282768 gene locus_tag LOCUS_10520 1283511 1282768 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791132.1 protein_id gnl|my_center|LOCUS_10520 1284527 1283556 gene locus_tag LOCUS_10530 1284527 1283556 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399251.1 protein_id gnl|my_center|LOCUS_10530 1285262 1284531 gene locus_tag LOCUS_10540 1285262 1284531 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289836.1 protein_id gnl|my_center|LOCUS_10540 1285428 1285997 gene locus_tag LOCUS_10550 1285428 1285997 CDS product thioredoxin fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964425.1 protein_id gnl|my_center|LOCUS_10550 1286128 1287750 gene locus_tag LOCUS_10560 gene bshC 1286128 1287750 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963529.1 protein_id gnl|my_center|LOCUS_10560 1288608 1287739 gene locus_tag LOCUS_10570 gene accD 1288608 1287739 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962493.1 protein_id gnl|my_center|LOCUS_10570 1289249 1288950 gene locus_tag LOCUS_10580 1289249 1288950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 1289545 1289240 gene locus_tag LOCUS_10590 1289545 1289240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 1289800 1290969 gene locus_tag LOCUS_10600 1289800 1290969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 1290969 1291961 gene locus_tag LOCUS_10610 1290969 1291961 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057642364.1 protein_id gnl|my_center|LOCUS_10610 1291968 1292546 gene locus_tag LOCUS_10620 1291968 1292546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10620 1292474 1292773 gene locus_tag LOCUS_10630 1292474 1292773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10630 1293247 1294227 gene locus_tag LOCUS_10640 1293247 1294227 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_10640 1294281 1295033 gene locus_tag LOCUS_10650 1294281 1295033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10650 1295103 1296665 gene locus_tag LOCUS_10660 1295103 1296665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10660 1297157 1305829 gene locus_tag LOCUS_10670 1297157 1305829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 1305715 1310922 gene locus_tag LOCUS_10680 1305715 1310922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 1312292 1311279 gene locus_tag LOCUS_10690 1312292 1311279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 1313371 1312367 gene locus_tag LOCUS_10700 1313371 1312367 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038037.1 protein_id gnl|my_center|LOCUS_10700 1313662 1315146 gene locus_tag LOCUS_10710 1313662 1315146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 1315153 1315887 gene locus_tag LOCUS_10720 1315153 1315887 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202815.1 protein_id gnl|my_center|LOCUS_10720 1316073 1315924 gene locus_tag LOCUS_10730 1316073 1315924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 1316261 1317055 gene locus_tag LOCUS_10740 1316261 1317055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 1317664 1317068 gene locus_tag LOCUS_10750 1317664 1317068 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538541.1 protein_id gnl|my_center|LOCUS_10750 1320315 1317667 gene locus_tag LOCUS_10760 1320315 1317667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 1321386 1320463 gene locus_tag LOCUS_10770 1321386 1320463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 1323192 1321564 gene locus_tag LOCUS_10780 1323192 1321564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 1324534 1323329 gene locus_tag LOCUS_10790 1324534 1323329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10790 1326358 1324547 gene locus_tag LOCUS_10800 1326358 1324547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 1328009 1327296 gene locus_tag LOCUS_10810 1328009 1327296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 1328254 1330311 gene locus_tag LOCUS_10820 1328254 1330311 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479228.1 protein_id gnl|my_center|LOCUS_10820 1330329 1331717 gene locus_tag LOCUS_10830 1330329 1331717 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_10830 1331741 1332424 gene locus_tag LOCUS_10840 1331741 1332424 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761811.1 protein_id gnl|my_center|LOCUS_10840 1332424 1333107 gene locus_tag LOCUS_10850 gene trmD 1332424 1333107 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963979.1 protein_id gnl|my_center|LOCUS_10850 1333820 1333119 gene locus_tag LOCUS_10860 1333820 1333119 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785232.1 protein_id gnl|my_center|LOCUS_10860 1334691 1334236 gene locus_tag LOCUS_10870 1334691 1334236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 1336076 1334991 gene locus_tag LOCUS_10880 1336076 1334991 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_10880 1336279 1336683 gene locus_tag LOCUS_10890 1336279 1336683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 1336742 1337335 gene locus_tag LOCUS_10900 1336742 1337335 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783551.1 protein_id gnl|my_center|LOCUS_10900 1338179 1337310 gene locus_tag LOCUS_10910 gene ubiA 1338179 1337310 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941108.1 protein_id gnl|my_center|LOCUS_10910 1338811 1338260 gene locus_tag LOCUS_10920 1338811 1338260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 1340547 1338931 gene locus_tag LOCUS_10930 1340547 1338931 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839088.1 protein_id gnl|my_center|LOCUS_10930 1340665 1341402 gene locus_tag LOCUS_10940 gene ubiE 1340665 1341402 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403588.1 protein_id gnl|my_center|LOCUS_10940 1341399 1342091 gene locus_tag LOCUS_10950 1341399 1342091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 1342332 1342093 gene locus_tag LOCUS_10960 1342332 1342093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 1343054 1342548 gene locus_tag LOCUS_10970 1343054 1342548 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767597.1 protein_id gnl|my_center|LOCUS_10970 1343201 1343527 gene locus_tag LOCUS_10980 gene yajC 1343201 1343527 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919858.1 protein_id gnl|my_center|LOCUS_10980 1344472 1343528 gene locus_tag LOCUS_10990 1344472 1343528 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722692.1 protein_id gnl|my_center|LOCUS_10990 1344643 1346856 gene locus_tag LOCUS_11000 1344643 1346856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11000 1346847 1347746 gene locus_tag LOCUS_11010 1346847 1347746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 1349633 1347927 gene locus_tag LOCUS_11020 gene ggt 1349633 1347927 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 protein_id gnl|my_center|LOCUS_11020 1349783 1350856 gene locus_tag LOCUS_11030 1349783 1350856 CDS product PorV/PorQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099202.1 protein_id gnl|my_center|LOCUS_11030 1352105 1350864 gene locus_tag LOCUS_11040 gene pepT 1352105 1350864 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087691.1 protein_id gnl|my_center|LOCUS_11040 1353074 1352250 gene locus_tag LOCUS_11050 1353074 1352250 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964510.1 protein_id gnl|my_center|LOCUS_11050 1353297 1353980 gene locus_tag LOCUS_11060 1353297 1353980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11060 1353955 1354323 gene locus_tag LOCUS_11070 1353955 1354323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11070 1354320 1355504 gene locus_tag LOCUS_11080 gene pseC 1354320 1355504 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097863.1 protein_id gnl|my_center|LOCUS_11080 1355497 1356189 gene locus_tag LOCUS_11090 gene pseF 1355497 1356189 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002777693.1 protein_id gnl|my_center|LOCUS_11090 1356186 1356815 gene locus_tag LOCUS_11100 1356186 1356815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 1356812 1357828 gene locus_tag LOCUS_11110 1356812 1357828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 1357821 1358045 gene locus_tag LOCUS_11120 1357821 1358045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11120 1358157 1358831 gene locus_tag LOCUS_11130 1358157 1358831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11130 1358835 1359677 gene locus_tag LOCUS_11140 1358835 1359677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 1359692 1360453 gene locus_tag LOCUS_11150 1359692 1360453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 1360625 1362040 gene locus_tag LOCUS_11160 1360625 1362040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 1362059 1365187 gene locus_tag LOCUS_11170 1362059 1365187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 1365262 1365831 gene locus_tag LOCUS_11180 1365262 1365831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1365852 1367072 gene locus_tag LOCUS_11190 1365852 1367072 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100706.1 protein_id gnl|my_center|LOCUS_11190 1367065 1370439 gene locus_tag LOCUS_11200 1367065 1370439 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109099.1 protein_id gnl|my_center|LOCUS_11200 1372973 1370418 gene locus_tag LOCUS_11210 1372973 1370418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 1374112 1373003 gene locus_tag LOCUS_11220 1374112 1373003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11220 1374757 1374176 gene locus_tag LOCUS_11230 1374757 1374176 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_11230 1375869 1374757 gene locus_tag LOCUS_11240 1375869 1374757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 1376737 1375958 gene locus_tag LOCUS_11250 1376737 1375958 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_11250 1376836 1377891 gene locus_tag LOCUS_11260 1376836 1377891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11260 1377900 1378700 gene locus_tag LOCUS_11270 1377900 1378700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11270 1378799 1380013 gene locus_tag LOCUS_11280 1378799 1380013 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038876.1 protein_id gnl|my_center|LOCUS_11280 1380024 1380389 gene locus_tag LOCUS_11290 1380024 1380389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11290 1380289 1383024 gene locus_tag LOCUS_11300 gene sbcC 1380289 1383024 CDS product exonuclease subunit SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880625.1 protein_id gnl|my_center|LOCUS_11300 1383102 1384127 gene locus_tag LOCUS_11310 1383102 1384127 CDS product DUF3667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928862.1 protein_id gnl|my_center|LOCUS_11310 1384741 1384202 gene locus_tag LOCUS_11320 1384741 1384202 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766910.1 protein_id gnl|my_center|LOCUS_11320 1386413 1384812 gene locus_tag LOCUS_11330 1386413 1384812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 1387020 1386424 gene locus_tag LOCUS_11340 gene yihA 1387020 1386424 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964166.1 protein_id gnl|my_center|LOCUS_11340 1387221 1387853 gene locus_tag LOCUS_11350 1387221 1387853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 1387951 1388874 gene locus_tag LOCUS_11360 gene fmt 1387951 1388874 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770001.1 protein_id gnl|my_center|LOCUS_11360 1389408 1388857 gene locus_tag LOCUS_11370 1389408 1388857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1389642 1390229 gene locus_tag LOCUS_11380 1389642 1390229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 1390226 1390657 gene locus_tag LOCUS_11390 1390226 1390657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11390 1390843 1391142 gene locus_tag LOCUS_11400 1390843 1391142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11400 1391256 1392263 gene locus_tag LOCUS_11410 1391256 1392263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 1392558 1395101 gene locus_tag LOCUS_11420 1392558 1395101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1395199 1396872 gene locus_tag LOCUS_11430 1395199 1396872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 1397003 1399471 gene locus_tag LOCUS_11440 gene gyrA 1397003 1399471 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962907.1 protein_id gnl|my_center|LOCUS_11440 1399625 1400875 gene locus_tag LOCUS_11450 1399625 1400875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 1400978 1402288 gene locus_tag LOCUS_11460 1400978 1402288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 1403162 1402293 gene locus_tag LOCUS_11470 1403162 1402293 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_11470 1406993 1403253 gene locus_tag LOCUS_11480 1406993 1403253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 1407405 1408040 gene locus_tag LOCUS_11490 gene pssA 1407405 1408040 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853992.1 protein_id gnl|my_center|LOCUS_11490 1408087 1408785 gene locus_tag LOCUS_11500 1408087 1408785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11500 1408981 1410156 gene locus_tag LOCUS_11510 1408981 1410156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11510 1410247 1411641 gene locus_tag LOCUS_11520 1410247 1411641 CDS product aspartate:alanine exchanger family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258651.1 protein_id gnl|my_center|LOCUS_11520 1411623 1411877 gene locus_tag LOCUS_11530 1411623 1411877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11530 1411885 1412796 gene locus_tag LOCUS_11540 1411885 1412796 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_11540 1413293 1412805 gene locus_tag LOCUS_11550 1413293 1412805 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 protein_id gnl|my_center|LOCUS_11550 1414642 1413302 gene locus_tag LOCUS_11560 1414642 1413302 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_11560 1415016 1415474 gene locus_tag LOCUS_11570 1415016 1415474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1415576 1417360 gene locus_tag LOCUS_11580 gene sppA 1415576 1417360 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962568.1 protein_id gnl|my_center|LOCUS_11580 1418554 1417484 gene locus_tag LOCUS_11590 gene fbaA 1418554 1417484 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 protein_id gnl|my_center|LOCUS_11590 1419513 1418575 gene locus_tag LOCUS_11600 gene trxB 1419513 1418575 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_11600 1419674 1421254 gene locus_tag LOCUS_11610 gene ade 1419674 1421254 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963204.1 protein_id gnl|my_center|LOCUS_11610 1421285 1422166 gene locus_tag LOCUS_11620 1421285 1422166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1422160 1422912 gene locus_tag LOCUS_11630 1422160 1422912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1422924 1423466 gene locus_tag LOCUS_11640 1422924 1423466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 1423867 1423481 gene locus_tag LOCUS_11650 1423867 1423481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11650 1424396 1423836 gene locus_tag LOCUS_11660 1424396 1423836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11660 1424697 1425242 gene locus_tag LOCUS_11670 1424697 1425242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 1427917 1425314 gene locus_tag LOCUS_11680 1427917 1425314 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927048.1 protein_id gnl|my_center|LOCUS_11680 1428252 1427920 gene locus_tag LOCUS_11690 1428252 1427920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11690 1429387 1428488 gene locus_tag LOCUS_11700 1429387 1428488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 1430477 1430280 gene locus_tag LOCUS_11710 1430477 1430280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1430710 1430495 gene locus_tag LOCUS_11720 1430710 1430495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 1431134 1430667 gene locus_tag LOCUS_11730 1431134 1430667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 1431599 1431405 gene locus_tag LOCUS_11740 1431599 1431405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 1432227 1431664 gene locus_tag LOCUS_11750 1432227 1431664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1432420 1432196 gene locus_tag LOCUS_11760 1432420 1432196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 1432963 1432616 gene locus_tag LOCUS_11770 1432963 1432616 CDS product DHCW motif cupin fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816257.1 protein_id gnl|my_center|LOCUS_11770 1433832 1432960 gene locus_tag LOCUS_11780 1433832 1432960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 1434968 1434510 gene locus_tag LOCUS_11790 1434968 1434510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447940.1 protein_id gnl|my_center|LOCUS_11790 1435493 1435032 gene locus_tag LOCUS_11800 1435493 1435032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 1436185 1435598 gene locus_tag LOCUS_11810 1436185 1435598 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_11810 1436436 1436266 gene locus_tag LOCUS_11820 1436436 1436266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 1436658 1436440 gene locus_tag LOCUS_11830 1436658 1436440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 1437049 1436765 gene locus_tag LOCUS_11840 1437049 1436765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 1437276 1437076 gene locus_tag LOCUS_11850 1437276 1437076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1437752 1437372 gene locus_tag LOCUS_11860 1437752 1437372 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392206.1 protein_id gnl|my_center|LOCUS_11860 1437903 1437742 gene locus_tag LOCUS_11870 1437903 1437742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 1438998 1438474 gene locus_tag LOCUS_11880 1438998 1438474 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814588.1 protein_id gnl|my_center|LOCUS_11880 1439799 1439158 gene locus_tag LOCUS_11890 1439799 1439158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 1440827 1439955 gene locus_tag LOCUS_11900 1440827 1439955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11900 1442707 1441484 gene locus_tag LOCUS_11910 gene ltrA 1442707 1441484 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022749.1 protein_id gnl|my_center|LOCUS_11910 1443446 1443222 gene locus_tag LOCUS_11920 1443446 1443222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 1443994 1443443 gene locus_tag LOCUS_11930 1443994 1443443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 1444401 1444054 gene locus_tag LOCUS_11940 1444401 1444054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 1445869 1444934 gene locus_tag LOCUS_11950 1445869 1444934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 1446908 1446234 gene locus_tag LOCUS_11960 1446908 1446234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 1447281 1446916 gene locus_tag LOCUS_11970 1447281 1446916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11970 1448411 1447338 gene locus_tag LOCUS_11980 1448411 1447338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 1449247 1448585 gene locus_tag LOCUS_11990 1449247 1448585 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814588.1 protein_id gnl|my_center|LOCUS_11990 1450350 1450042 gene locus_tag LOCUS_12000 1450350 1450042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 1450991 1450350 gene locus_tag LOCUS_12010 1450991 1450350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12010 1451254 1451015 gene locus_tag LOCUS_12020 1451254 1451015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12020 1451710 1451456 gene locus_tag LOCUS_12030 1451710 1451456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12030 1453746 1451989 gene locus_tag LOCUS_12040 1453746 1451989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12040 1453981 1453721 gene locus_tag LOCUS_12050 1453981 1453721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12050 1454382 1453978 gene locus_tag LOCUS_12060 1454382 1453978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 1454969 1454325 gene locus_tag LOCUS_12070 1454969 1454325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12070 1455536 1455369 gene locus_tag LOCUS_12080 1455536 1455369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12080 1456913 1455696 gene locus_tag LOCUS_12090 1456913 1455696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12090 1457147 1456917 gene locus_tag LOCUS_12100 1457147 1456917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12100 1457496 1457134 gene locus_tag LOCUS_12110 1457496 1457134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12110 >Feature sequence02 1162 740 gene locus_tag LOCUS_12120 1162 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12120 1382 1209 gene locus_tag LOCUS_12130 1382 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 2173 1637 gene locus_tag LOCUS_12140 2173 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12140 3023 2529 gene locus_tag LOCUS_12150 3023 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 3241 3023 gene locus_tag LOCUS_12160 3241 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 4562 4320 gene locus_tag LOCUS_12170 4562 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 7595 4848 gene locus_tag LOCUS_12180 7595 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 9661 7553 gene locus_tag LOCUS_12190 9661 7553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 10659 9664 gene locus_tag LOCUS_12200 10659 9664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533560.1 protein_id gnl|my_center|LOCUS_12200 11649 10909 gene locus_tag LOCUS_12210 11649 10909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 13369 11594 gene locus_tag LOCUS_12220 13369 11594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 15273 15127 gene locus_tag LOCUS_12230 15273 15127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 15683 16177 gene locus_tag LOCUS_12240 15683 16177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 16205 16465 gene locus_tag LOCUS_12250 16205 16465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 17475 16564 gene locus_tag LOCUS_12260 17475 16564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 17608 18084 gene locus_tag LOCUS_12270 17608 18084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 18317 18709 gene locus_tag LOCUS_12280 18317 18709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 19844 18846 gene locus_tag LOCUS_12290 19844 18846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 20774 19854 gene locus_tag LOCUS_12300 20774 19854 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963929.1 protein_id gnl|my_center|LOCUS_12300 22589 21156 gene locus_tag LOCUS_12310 22589 21156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 23125 22604 gene locus_tag LOCUS_12320 23125 22604 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942963.1 protein_id gnl|my_center|LOCUS_12320 25823 24225 gene locus_tag LOCUS_12330 25823 24225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 26657 25887 gene locus_tag LOCUS_12340 26657 25887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 27126 27410 gene locus_tag LOCUS_12350 27126 27410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 27573 27337 gene locus_tag LOCUS_12360 27573 27337 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229777.1 protein_id gnl|my_center|LOCUS_12360 28099 27554 gene locus_tag LOCUS_12370 28099 27554 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479525.1 protein_id gnl|my_center|LOCUS_12370 28976 28140 gene locus_tag LOCUS_12380 28976 28140 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766240.1 protein_id gnl|my_center|LOCUS_12380 29103 29996 gene locus_tag LOCUS_12390 29103 29996 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389819.1 protein_id gnl|my_center|LOCUS_12390 30007 31476 gene locus_tag LOCUS_12400 30007 31476 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490184.1 protein_id gnl|my_center|LOCUS_12400 31473 32477 gene locus_tag LOCUS_12410 31473 32477 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480619.1 protein_id gnl|my_center|LOCUS_12410 33063 32491 gene locus_tag LOCUS_12420 33063 32491 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357726.1 protein_id gnl|my_center|LOCUS_12420 33859 33053 gene locus_tag LOCUS_12430 gene fdhD 33859 33053 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876561.1 protein_id gnl|my_center|LOCUS_12430 35012 34035 gene locus_tag LOCUS_12440 35012 34035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 35253 35612 gene locus_tag LOCUS_12450 35253 35612 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788181.1 protein_id gnl|my_center|LOCUS_12450 35596 36252 gene locus_tag LOCUS_12460 35596 36252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 36478 36329 gene locus_tag LOCUS_12470 36478 36329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 36648 37115 gene locus_tag LOCUS_12480 36648 37115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 37364 39397 gene locus_tag LOCUS_12490 37364 39397 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113760.1 protein_id gnl|my_center|LOCUS_12490 40726 39434 gene locus_tag LOCUS_12500 40726 39434 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962473.1 protein_id gnl|my_center|LOCUS_12500 40897 43623 gene locus_tag LOCUS_12510 gene clpB 40897 43623 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764749.1 protein_id gnl|my_center|LOCUS_12510 44312 43983 gene locus_tag LOCUS_12520 44312 43983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 44859 45668 gene locus_tag LOCUS_12530 44859 45668 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_12530 45695 46324 gene locus_tag LOCUS_12540 45695 46324 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839424.1 protein_id gnl|my_center|LOCUS_12540 49741 46337 gene locus_tag LOCUS_12550 49741 46337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 49883 51316 gene locus_tag LOCUS_12560 49883 51316 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404928.1 protein_id gnl|my_center|LOCUS_12560 51859 51476 gene locus_tag LOCUS_12570 51859 51476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 53963 52362 gene locus_tag LOCUS_12580 gene nadB 53963 52362 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783573.1 protein_id gnl|my_center|LOCUS_12580 54566 53973 gene locus_tag LOCUS_12590 54566 53973 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763837.1 protein_id gnl|my_center|LOCUS_12590 55500 54613 gene locus_tag LOCUS_12600 55500 54613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 55678 56166 gene locus_tag LOCUS_12610 55678 56166 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087757.1 protein_id gnl|my_center|LOCUS_12610 57947 56247 gene locus_tag LOCUS_12620 57947 56247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12620 59332 57908 gene locus_tag LOCUS_12630 59332 57908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12630 60195 59449 gene locus_tag LOCUS_12640 60195 59449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 61014 60310 gene locus_tag LOCUS_12650 61014 60310 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973884.1 protein_id gnl|my_center|LOCUS_12650 61139 62062 gene locus_tag LOCUS_12660 61139 62062 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_12660 62074 62841 gene locus_tag LOCUS_12670 62074 62841 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816946.1 protein_id gnl|my_center|LOCUS_12670 63172 62894 gene locus_tag LOCUS_12680 63172 62894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 63851 63525 gene locus_tag LOCUS_12690 63851 63525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 64294 64082 gene locus_tag LOCUS_12700 64294 64082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 64532 64239 gene locus_tag LOCUS_12710 64532 64239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12710 65045 64593 gene locus_tag LOCUS_12720 gene dtd 65045 64593 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962422.1 protein_id gnl|my_center|LOCUS_12720 66579 65047 gene locus_tag LOCUS_12730 66579 65047 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964517.1 protein_id gnl|my_center|LOCUS_12730 66703 67065 gene locus_tag LOCUS_12740 66703 67065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 67168 68586 gene locus_tag LOCUS_12750 gene panP 67168 68586 CDS product putative pyridoxal-dependent aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483514.1 protein_id gnl|my_center|LOCUS_12750 69622 68699 gene locus_tag LOCUS_12760 69622 68699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 70237 69824 gene locus_tag LOCUS_12770 70237 69824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962370.1 protein_id gnl|my_center|LOCUS_12770 70556 71425 gene locus_tag LOCUS_12780 70556 71425 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 protein_id gnl|my_center|LOCUS_12780 71518 72003 gene locus_tag LOCUS_12790 71518 72003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 72006 72605 gene locus_tag LOCUS_12800 72006 72605 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404799.1 protein_id gnl|my_center|LOCUS_12800 72602 73084 gene locus_tag LOCUS_12810 72602 73084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 73100 73516 gene locus_tag LOCUS_12820 73100 73516 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249144.1 protein_id gnl|my_center|LOCUS_12820 73588 74364 gene locus_tag LOCUS_12830 gene rsmA 73588 74364 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784867.1 protein_id gnl|my_center|LOCUS_12830 74368 74814 gene locus_tag LOCUS_12840 74368 74814 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 protein_id gnl|my_center|LOCUS_12840 75297 74908 gene locus_tag LOCUS_12850 75297 74908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 76841 75426 gene locus_tag LOCUS_12860 76841 75426 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 protein_id gnl|my_center|LOCUS_12860 77182 76880 gene locus_tag LOCUS_12870 77182 76880 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401030.1 protein_id gnl|my_center|LOCUS_12870 78277 77198 gene locus_tag LOCUS_12880 78277 77198 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020567.1 protein_id gnl|my_center|LOCUS_12880 79098 78388 gene locus_tag LOCUS_12890 79098 78388 CDS product SMUG2 DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990078.1 protein_id gnl|my_center|LOCUS_12890 81695 79101 gene locus_tag LOCUS_12900 81695 79101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 82689 81793 gene locus_tag LOCUS_12910 82689 81793 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704730.1 protein_id gnl|my_center|LOCUS_12910 82799 83338 gene locus_tag LOCUS_12920 82799 83338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 83347 84585 gene locus_tag LOCUS_12930 gene nusA 83347 84585 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783919.1 protein_id gnl|my_center|LOCUS_12930 84683 87427 gene locus_tag LOCUS_12940 gene infB 84683 87427 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783920.1 protein_id gnl|my_center|LOCUS_12940 87468 88247 gene locus_tag LOCUS_12950 87468 88247 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503931.1 protein_id gnl|my_center|LOCUS_12950 88314 88388 gene locus_tag LOCUS_t00180 88314 88388 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 88460 89857 gene locus_tag LOCUS_12960 gene mnmE 88460 89857 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962791.1 protein_id gnl|my_center|LOCUS_12960 90009 91142 gene locus_tag LOCUS_12970 90009 91142 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361999.1 protein_id gnl|my_center|LOCUS_12970 91135 91950 gene locus_tag LOCUS_12980 91135 91950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 92078 92371 gene locus_tag LOCUS_12990 92078 92371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 92368 92910 gene locus_tag LOCUS_13000 92368 92910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 92947 93876 gene locus_tag LOCUS_13010 92947 93876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 94409 93894 gene locus_tag LOCUS_13020 94409 93894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 95178 94729 gene locus_tag LOCUS_13030 95178 94729 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562679.1 protein_id gnl|my_center|LOCUS_13030 95374 95994 gene locus_tag LOCUS_13040 95374 95994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 95978 96817 gene locus_tag LOCUS_13050 95978 96817 CDS product DUF2764 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788436.1 protein_id gnl|my_center|LOCUS_13050 96814 98601 gene locus_tag LOCUS_13060 96814 98601 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538526.1 protein_id gnl|my_center|LOCUS_13060 98606 99241 gene locus_tag LOCUS_13070 98606 99241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13070 99250 99918 gene locus_tag LOCUS_13080 99250 99918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13080 99977 100522 gene locus_tag LOCUS_13090 99977 100522 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788431.1 protein_id gnl|my_center|LOCUS_13090 100519 102321 gene locus_tag LOCUS_13100 100519 102321 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660668.1 protein_id gnl|my_center|LOCUS_13100 104343 102475 gene locus_tag LOCUS_13110 gene htpG 104343 102475 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963627.1 protein_id gnl|my_center|LOCUS_13110 106055 104601 gene locus_tag LOCUS_13120 106055 104601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 110006 106185 gene locus_tag LOCUS_13130 110006 106185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 111450 110527 gene locus_tag LOCUS_13140 gene xerD 111450 110527 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791940.1 protein_id gnl|my_center|LOCUS_13140 112016 111459 gene locus_tag LOCUS_13150 112016 111459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 112972 112145 gene locus_tag LOCUS_13160 112972 112145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 114092 113013 gene locus_tag LOCUS_13170 114092 113013 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962285.1 protein_id gnl|my_center|LOCUS_13170 114449 114102 gene locus_tag LOCUS_13180 114449 114102 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759980.1 protein_id gnl|my_center|LOCUS_13180 114865 114539 gene locus_tag LOCUS_13190 114865 114539 CDS product DUF4286 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_13190 115571 114873 gene locus_tag LOCUS_13200 115571 114873 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 protein_id gnl|my_center|LOCUS_13200 117038 115602 gene locus_tag LOCUS_13210 117038 115602 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963934.1 protein_id gnl|my_center|LOCUS_13210 118185 117154 gene locus_tag LOCUS_13220 118185 117154 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963994.1 protein_id gnl|my_center|LOCUS_13220 118372 120831 gene locus_tag LOCUS_13230 gene thrA 118372 120831 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784545.1 protein_id gnl|my_center|LOCUS_13230 120884 121816 gene locus_tag LOCUS_13240 120884 121816 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933689.1 protein_id gnl|my_center|LOCUS_13240 121838 123127 gene locus_tag LOCUS_13250 gene thrC 121838 123127 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_13250 123256 123609 gene locus_tag LOCUS_13260 123256 123609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719490.1 protein_id gnl|my_center|LOCUS_13260 123880 126111 gene locus_tag LOCUS_13270 123880 126111 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964226.1 protein_id gnl|my_center|LOCUS_13270 126914 126108 gene locus_tag LOCUS_13280 126914 126108 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_13280 127971 126955 gene locus_tag LOCUS_13290 127971 126955 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963757.1 protein_id gnl|my_center|LOCUS_13290 128648 130204 gene locus_tag LOCUS_13300 128648 130204 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_13300 131520 130201 gene locus_tag LOCUS_13310 131520 130201 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_13310 132433 131513 gene locus_tag LOCUS_13320 132433 131513 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_13320 132613 134433 gene locus_tag LOCUS_13330 132613 134433 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026955981.1 protein_id gnl|my_center|LOCUS_13330 134863 134438 gene locus_tag LOCUS_13340 134863 134438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962914.1 protein_id gnl|my_center|LOCUS_13340 135956 135153 gene locus_tag LOCUS_13350 135956 135153 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817352.1 protein_id gnl|my_center|LOCUS_13350 136165 139086 gene locus_tag LOCUS_13360 136165 139086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 139740 149759 gene locus_tag LOCUS_13370 139740 149759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 151737 150508 gene locus_tag LOCUS_13380 151737 150508 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764235.1 protein_id gnl|my_center|LOCUS_13380 152177 155398 gene locus_tag LOCUS_13390 152177 155398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 155487 155843 gene locus_tag LOCUS_13400 155487 155843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 155850 156758 gene locus_tag LOCUS_13410 155850 156758 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761051.1 protein_id gnl|my_center|LOCUS_13410 158605 156917 gene locus_tag LOCUS_13420 158605 156917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 159409 158723 gene locus_tag LOCUS_13430 159409 158723 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081289.1 protein_id gnl|my_center|LOCUS_13430 159750 159409 gene locus_tag LOCUS_13440 159750 159409 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 protein_id gnl|my_center|LOCUS_13440 160764 159760 gene locus_tag LOCUS_13450 160764 159760 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963782.1 protein_id gnl|my_center|LOCUS_13450 161784 160918 gene locus_tag LOCUS_13460 161784 160918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 162016 163290 gene locus_tag LOCUS_13470 162016 163290 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962841.1 protein_id gnl|my_center|LOCUS_13470 163715 163278 gene locus_tag LOCUS_13480 163715 163278 CDS product DUF5606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963864.1 protein_id gnl|my_center|LOCUS_13480 163645 163914 gene locus_tag LOCUS_13490 163645 163914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 163935 166583 gene locus_tag LOCUS_13500 163935 166583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 166600 167004 gene locus_tag LOCUS_13510 166600 167004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 167086 169572 gene locus_tag LOCUS_13520 167086 169572 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_13520 170511 169585 gene locus_tag LOCUS_13530 170511 169585 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963338.1 protein_id gnl|my_center|LOCUS_13530 172222 170492 gene locus_tag LOCUS_13540 172222 170492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 173732 172596 gene locus_tag LOCUS_13550 gene bshA 173732 172596 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962921.1 protein_id gnl|my_center|LOCUS_13550 174084 174701 gene locus_tag LOCUS_13560 174084 174701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 174652 177456 gene locus_tag LOCUS_13570 174652 177456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13570 177558 178097 gene locus_tag LOCUS_13580 177558 178097 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962897.1 protein_id gnl|my_center|LOCUS_13580 178664 178104 gene locus_tag LOCUS_13590 gene pth 178664 178104 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100438.1 protein_id gnl|my_center|LOCUS_13590 179307 181079 gene locus_tag LOCUS_13600 179307 181079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 181935 181216 gene locus_tag LOCUS_13610 181935 181216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 182238 183545 gene locus_tag LOCUS_13620 182238 183545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403217.1 protein_id gnl|my_center|LOCUS_13620 183623 186496 gene locus_tag LOCUS_13630 183623 186496 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680902.1 protein_id gnl|my_center|LOCUS_13630 188258 186591 gene locus_tag LOCUS_13640 gene asnB 188258 186591 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107317.1 protein_id gnl|my_center|LOCUS_13640 189513 188467 gene locus_tag LOCUS_13650 gene porQ 189513 188467 CDS product type IX secretion system protein PorQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 protein_id gnl|my_center|LOCUS_13650 190037 189510 gene locus_tag LOCUS_13660 190037 189510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 190449 191789 gene locus_tag LOCUS_13670 gene trkA 190449 191789 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_13670 191797 193251 gene locus_tag LOCUS_13680 191797 193251 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109098.1 protein_id gnl|my_center|LOCUS_13680 193360 193779 gene locus_tag LOCUS_13690 193360 193779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 193772 194542 gene locus_tag LOCUS_13700 193772 194542 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921388.1 protein_id gnl|my_center|LOCUS_13700 195185 196213 gene locus_tag LOCUS_13710 195185 196213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 196329 197366 gene locus_tag LOCUS_13720 196329 197366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 197382 198749 gene locus_tag LOCUS_13730 197382 198749 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461820.1 protein_id gnl|my_center|LOCUS_13730 198742 200064 gene locus_tag LOCUS_13740 198742 200064 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940915.1 protein_id gnl|my_center|LOCUS_13740 200082 201206 gene locus_tag LOCUS_13750 200082 201206 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927236.1 protein_id gnl|my_center|LOCUS_13750 201528 202922 gene locus_tag LOCUS_13760 201528 202922 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940879.1 protein_id gnl|my_center|LOCUS_13760 202913 203548 gene locus_tag LOCUS_13770 202913 203548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 203831 204259 gene locus_tag LOCUS_13780 203831 204259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13780 206047 204467 gene locus_tag LOCUS_13790 206047 204467 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963308.1 protein_id gnl|my_center|LOCUS_13790 206218 206625 gene locus_tag LOCUS_13800 206218 206625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 206607 207218 gene locus_tag LOCUS_13810 206607 207218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 208172 207324 gene locus_tag LOCUS_13820 208172 207324 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108322.1 protein_id gnl|my_center|LOCUS_13820 210766 208277 gene locus_tag LOCUS_13830 210766 208277 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790607.1 protein_id gnl|my_center|LOCUS_13830 211142 212125 gene locus_tag LOCUS_13840 211142 212125 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_13840 212232 213503 gene locus_tag LOCUS_13850 212232 213503 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787725.1 protein_id gnl|my_center|LOCUS_13850 215008 213596 gene locus_tag LOCUS_13860 215008 213596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 216411 215320 gene locus_tag LOCUS_13870 216411 215320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 216676 218475 gene locus_tag LOCUS_13880 216676 218475 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114561.1 protein_id gnl|my_center|LOCUS_13880 218496 218786 gene locus_tag LOCUS_13890 218496 218786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 219159 220193 gene locus_tag LOCUS_13900 gene recA 219159 220193 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964335.1 protein_id gnl|my_center|LOCUS_13900 220227 221393 gene locus_tag LOCUS_13910 220227 221393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 221517 221867 gene locus_tag LOCUS_13920 221517 221867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 223711 221885 gene locus_tag LOCUS_13930 223711 221885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 224383 223838 gene locus_tag LOCUS_13940 224383 223838 CDS product DUF4230 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964057.1 protein_id gnl|my_center|LOCUS_13940 224999 224514 gene locus_tag LOCUS_13950 224999 224514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 225298 224978 gene locus_tag LOCUS_13960 225298 224978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 226820 225642 gene locus_tag LOCUS_13970 226820 225642 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963348.1 protein_id gnl|my_center|LOCUS_13970 228075 226915 gene locus_tag LOCUS_13980 228075 226915 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022331.1 protein_id gnl|my_center|LOCUS_13980 228302 228075 gene locus_tag LOCUS_13990 228302 228075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 228583 228299 gene locus_tag LOCUS_14000 228583 228299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 230666 228570 gene locus_tag LOCUS_14010 230666 228570 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_14010 231780 230782 gene locus_tag LOCUS_14020 231780 230782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 231947 232405 gene locus_tag LOCUS_14030 231947 232405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 232440 233147 gene locus_tag LOCUS_14040 232440 233147 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888106.1 protein_id gnl|my_center|LOCUS_14040 233153 233755 gene locus_tag LOCUS_14050 233153 233755 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763683.1 protein_id gnl|my_center|LOCUS_14050 233789 235066 gene locus_tag LOCUS_14060 233789 235066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 235169 236140 gene locus_tag LOCUS_14070 235169 236140 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243358.1 protein_id gnl|my_center|LOCUS_14070 236347 237306 gene locus_tag LOCUS_14080 236347 237306 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107805.1 protein_id gnl|my_center|LOCUS_14080 237453 238322 gene locus_tag LOCUS_14090 237453 238322 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962538.1 protein_id gnl|my_center|LOCUS_14090 238325 239302 gene locus_tag LOCUS_14100 238325 239302 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926841.1 protein_id gnl|my_center|LOCUS_14100 239581 239982 gene locus_tag LOCUS_14110 239581 239982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 239985 240797 gene locus_tag LOCUS_14120 239985 240797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14120 240838 241578 gene locus_tag LOCUS_14130 240838 241578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14130 241878 243041 gene locus_tag LOCUS_14140 241878 243041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 244265 243285 gene locus_tag LOCUS_14150 244265 243285 CDS product bifunctional methionine sulfoxide reductase B/A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072538.1 protein_id gnl|my_center|LOCUS_14150 244963 245157 gene locus_tag LOCUS_14160 244963 245157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 245127 245900 gene locus_tag LOCUS_14170 245127 245900 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964090.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14170 245931 246299 gene locus_tag LOCUS_14180 245931 246299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 247129 247386 gene locus_tag LOCUS_14190 247129 247386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14190 247507 247932 gene locus_tag LOCUS_14200 247507 247932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 249509 248118 gene locus_tag LOCUS_14210 249509 248118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 250203 249880 gene locus_tag LOCUS_14220 250203 249880 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074374.1 protein_id gnl|my_center|LOCUS_14220 250439 250200 gene locus_tag LOCUS_14230 250439 250200 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680104.1 protein_id gnl|my_center|LOCUS_14230 252091 250517 gene locus_tag LOCUS_14240 252091 250517 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_14240 253781 252156 gene locus_tag LOCUS_14250 253781 252156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 255270 254104 gene locus_tag LOCUS_14260 255270 254104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 255934 255596 gene locus_tag LOCUS_14270 255934 255596 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135500.1 protein_id gnl|my_center|LOCUS_14270 256962 256165 gene locus_tag LOCUS_14280 256962 256165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 257738 256959 gene locus_tag LOCUS_14290 257738 256959 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992443.1 protein_id gnl|my_center|LOCUS_14290 258300 257743 gene locus_tag LOCUS_14300 258300 257743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 258944 258396 gene locus_tag LOCUS_14310 258944 258396 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_159656972.1 protein_id gnl|my_center|LOCUS_14310 260728 259247 gene locus_tag LOCUS_14320 260728 259247 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139328020.1 protein_id gnl|my_center|LOCUS_14320 261154 260942 gene locus_tag LOCUS_14330 261154 260942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 262228 262013 gene locus_tag LOCUS_14340 262228 262013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14340 263412 262198 gene locus_tag LOCUS_14350 263412 262198 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122546.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14350 263763 266405 gene locus_tag LOCUS_14360 263763 266405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 266617 267204 gene locus_tag LOCUS_14370 266617 267204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 267217 268089 gene locus_tag LOCUS_14380 267217 268089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 268100 268375 gene locus_tag LOCUS_14390 268100 268375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 268811 269692 gene locus_tag LOCUS_14400 268811 269692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 270160 269750 gene locus_tag LOCUS_14410 270160 269750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 270433 273687 gene locus_tag LOCUS_14420 270433 273687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_14420 274101 273697 gene locus_tag LOCUS_14430 274101 273697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 277410 274243 gene locus_tag LOCUS_14440 277410 274243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_14440 277725 280877 gene locus_tag LOCUS_14450 277725 280877 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070433.1 protein_id gnl|my_center|LOCUS_14450 282961 281027 gene locus_tag LOCUS_14460 282961 281027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 283400 283032 gene locus_tag LOCUS_14470 283400 283032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 284005 283520 gene locus_tag LOCUS_14480 284005 283520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 284422 286233 gene locus_tag LOCUS_14490 284422 286233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 286264 286965 gene locus_tag LOCUS_14500 286264 286965 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_14500 287138 289267 gene locus_tag LOCUS_14510 287138 289267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 289319 289801 gene locus_tag LOCUS_14520 289319 289801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 290877 289873 gene locus_tag LOCUS_14530 290877 289873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 291058 291510 gene locus_tag LOCUS_14540 291058 291510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 292477 291635 gene locus_tag LOCUS_14550 292477 291635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 293274 292474 gene locus_tag LOCUS_14560 293274 292474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 294403 293366 gene locus_tag LOCUS_14570 294403 293366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 297558 295345 gene locus_tag LOCUS_14580 297558 295345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 298929 297856 gene locus_tag LOCUS_14590 298929 297856 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 protein_id gnl|my_center|LOCUS_14590 299142 301580 gene locus_tag LOCUS_14600 299142 301580 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_14600 301778 302473 gene locus_tag LOCUS_14610 301778 302473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 302601 303065 gene locus_tag LOCUS_14620 302601 303065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 305958 303073 gene locus_tag LOCUS_14630 305958 303073 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_14630 307023 305971 gene locus_tag LOCUS_14640 307023 305971 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089483.1 protein_id gnl|my_center|LOCUS_14640 308840 307035 gene locus_tag LOCUS_14650 308840 307035 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174555.1 protein_id gnl|my_center|LOCUS_14650 310717 308933 gene locus_tag LOCUS_14660 310717 308933 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089481.1 protein_id gnl|my_center|LOCUS_14660 311058 313406 gene locus_tag LOCUS_14670 311058 313406 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109335.1 protein_id gnl|my_center|LOCUS_14670 314399 313419 gene locus_tag LOCUS_14680 314399 313419 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764326.1 protein_id gnl|my_center|LOCUS_14680 315018 314410 gene locus_tag LOCUS_14690 315018 314410 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_14690 318216 315040 gene locus_tag LOCUS_14700 318216 315040 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120701253.1 protein_id gnl|my_center|LOCUS_14700 318837 319580 gene locus_tag LOCUS_14710 gene fabG 318837 319580 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_14710 319591 320304 gene locus_tag LOCUS_14720 319591 320304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 321975 320452 gene locus_tag LOCUS_14730 321975 320452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 322256 322029 gene locus_tag LOCUS_14740 322256 322029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 322621 322223 gene locus_tag LOCUS_14750 322621 322223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 324265 322772 gene locus_tag LOCUS_14760 324265 322772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 327834 324262 gene locus_tag LOCUS_14770 327834 324262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 329526 328798 gene locus_tag LOCUS_14780 329526 328798 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964577.1 protein_id gnl|my_center|LOCUS_14780 330784 329705 gene locus_tag LOCUS_14790 gene aroB 330784 329705 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963817.1 protein_id gnl|my_center|LOCUS_14790 331082 330765 gene locus_tag LOCUS_14800 331082 330765 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963226.1 protein_id gnl|my_center|LOCUS_14800 331867 331097 gene locus_tag LOCUS_14810 331867 331097 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_14810 332016 332492 gene locus_tag LOCUS_14820 332016 332492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14820 332537 333058 gene locus_tag LOCUS_14830 332537 333058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14830 333045 333452 gene locus_tag LOCUS_14840 333045 333452 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964001.1 protein_id gnl|my_center|LOCUS_14840 333452 334747 gene locus_tag LOCUS_14850 gene aroA 333452 334747 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303115.1 protein_id gnl|my_center|LOCUS_14850 335789 335130 gene locus_tag LOCUS_14860 335789 335130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 335846 336742 gene locus_tag LOCUS_14870 335846 336742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 336812 337348 gene locus_tag LOCUS_14880 gene dcd 336812 337348 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963354.1 protein_id gnl|my_center|LOCUS_14880 337366 338583 gene locus_tag LOCUS_14890 337366 338583 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027385545.1 protein_id gnl|my_center|LOCUS_14890 339080 338718 gene locus_tag LOCUS_14900 339080 338718 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963921.1 protein_id gnl|my_center|LOCUS_14900 339453 339112 gene locus_tag LOCUS_14910 339453 339112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 340543 339617 gene locus_tag LOCUS_14920 340543 339617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 340671 341861 gene locus_tag LOCUS_14930 340671 341861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 341851 342798 gene locus_tag LOCUS_14940 341851 342798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 342803 343933 gene locus_tag LOCUS_14950 342803 343933 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202690.1 protein_id gnl|my_center|LOCUS_14950 344121 345701 gene locus_tag LOCUS_14960 344121 345701 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964514.1 protein_id gnl|my_center|LOCUS_14960 345704 346459 gene locus_tag LOCUS_14970 gene lptB 345704 346459 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_14970 346533 346685 gene locus_tag LOCUS_14980 346533 346685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 346645 347031 gene locus_tag LOCUS_14990 346645 347031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 349013 347082 gene locus_tag LOCUS_15000 gene thrS 349013 347082 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107262.1 protein_id gnl|my_center|LOCUS_15000 349865 349137 gene locus_tag LOCUS_15010 gene radC 349865 349137 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_15010 351091 349946 gene locus_tag LOCUS_15020 351091 349946 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_15020 351454 353640 gene locus_tag LOCUS_15030 gene rpsA 351454 353640 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_15030 354504 353722 gene locus_tag LOCUS_15040 354504 353722 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_15040 355274 354513 gene locus_tag LOCUS_15050 355274 354513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 356147 355350 gene locus_tag LOCUS_15060 356147 355350 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_15060 356686 356150 gene locus_tag LOCUS_15070 356686 356150 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964325.1 protein_id gnl|my_center|LOCUS_15070 357571 356792 gene locus_tag LOCUS_15080 357571 356792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 364724 357621 gene locus_tag LOCUS_15090 gene sprA 364724 357621 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964220.1 protein_id gnl|my_center|LOCUS_15090 365068 364640 gene locus_tag LOCUS_15100 365068 364640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 365865 365269 gene locus_tag LOCUS_15110 gene ruvA 365865 365269 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964221.1 protein_id gnl|my_center|LOCUS_15110 366038 367444 gene locus_tag LOCUS_15120 366038 367444 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963238.1 protein_id gnl|my_center|LOCUS_15120 367916 367458 gene locus_tag LOCUS_15130 367916 367458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 368168 369271 gene locus_tag LOCUS_15140 368168 369271 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963743.1 protein_id gnl|my_center|LOCUS_15140 371218 369257 gene locus_tag LOCUS_15150 371218 369257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 372246 371362 gene locus_tag LOCUS_15160 372246 371362 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203200.1 protein_id gnl|my_center|LOCUS_15160 373213 372248 gene locus_tag LOCUS_15170 373213 372248 CDS product deoxyhypusine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963819.1 protein_id gnl|my_center|LOCUS_15170 374654 373251 gene locus_tag LOCUS_15180 374654 373251 CDS product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963818.1 protein_id gnl|my_center|LOCUS_15180 375177 375839 gene locus_tag LOCUS_15190 375177 375839 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116185855.1 protein_id gnl|my_center|LOCUS_15190 375855 376778 gene locus_tag LOCUS_15200 375855 376778 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759986.1 protein_id gnl|my_center|LOCUS_15200 377500 376820 gene locus_tag LOCUS_15210 377500 376820 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582974.1 protein_id gnl|my_center|LOCUS_15210 378098 377508 gene locus_tag LOCUS_15220 378098 377508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 379358 378195 gene locus_tag LOCUS_15230 379358 378195 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839857.1 protein_id gnl|my_center|LOCUS_15230 380496 379366 gene locus_tag LOCUS_15240 380496 379366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 380819 381397 gene locus_tag LOCUS_15250 380819 381397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 381454 382356 gene locus_tag LOCUS_15260 381454 382356 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_15260 383093 382404 gene locus_tag LOCUS_15270 383093 382404 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_15270 383319 384605 gene locus_tag LOCUS_15280 383319 384605 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965326.1 protein_id gnl|my_center|LOCUS_15280 384704 385693 gene locus_tag LOCUS_15290 384704 385693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 385851 386246 gene locus_tag LOCUS_15300 385851 386246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 387642 386248 gene locus_tag LOCUS_15310 387642 386248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 387761 389134 gene locus_tag LOCUS_15320 387761 389134 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974991.1 protein_id gnl|my_center|LOCUS_15320 389590 393045 gene locus_tag LOCUS_15330 gene dnaE 389590 393045 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962512.1 protein_id gnl|my_center|LOCUS_15330 393261 396347 gene locus_tag LOCUS_15340 393261 396347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 396344 397909 gene locus_tag LOCUS_15350 396344 397909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 398648 397995 gene locus_tag LOCUS_15360 398648 397995 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461763.1 protein_id gnl|my_center|LOCUS_15360 399130 398663 gene locus_tag LOCUS_15370 399130 398663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 399327 399659 gene locus_tag LOCUS_15380 399327 399659 CDS product arsenosugar biosynthesis-associated peroxidase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986517.1 protein_id gnl|my_center|LOCUS_15380 399752 400747 gene locus_tag LOCUS_15390 gene arsS 399752 400747 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257184.1 protein_id gnl|my_center|LOCUS_15390 400821 401423 gene locus_tag LOCUS_15400 400821 401423 CDS product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206404.1 protein_id gnl|my_center|LOCUS_15400 401808 401434 gene locus_tag LOCUS_15410 401808 401434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 403675 402071 gene locus_tag LOCUS_15420 403675 402071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964567.1 protein_id gnl|my_center|LOCUS_15420 403946 405487 gene locus_tag LOCUS_15430 403946 405487 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246610.1 protein_id gnl|my_center|LOCUS_15430 405572 406597 gene locus_tag LOCUS_15440 405572 406597 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_15440 407671 406634 gene locus_tag LOCUS_15450 407671 406634 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922558.1 protein_id gnl|my_center|LOCUS_15450 407862 411221 gene locus_tag LOCUS_15460 gene ileS 407862 411221 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962393.1 protein_id gnl|my_center|LOCUS_15460 411766 411356 gene locus_tag LOCUS_15470 411766 411356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 412140 412937 gene locus_tag LOCUS_15480 412140 412937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 412941 413285 gene locus_tag LOCUS_15490 412941 413285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 415070 413757 gene locus_tag LOCUS_15500 gene radA 415070 413757 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962283.1 protein_id gnl|my_center|LOCUS_15500 418358 415314 gene locus_tag LOCUS_15510 418358 415314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 418942 418469 gene locus_tag LOCUS_15520 418942 418469 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_15520 419203 420648 gene locus_tag LOCUS_15530 gene pyk 419203 420648 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962380.1 protein_id gnl|my_center|LOCUS_15530 420650 421303 gene locus_tag LOCUS_15540 420650 421303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 422194 421325 gene locus_tag LOCUS_15550 gene lipA 422194 421325 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963587.1 protein_id gnl|my_center|LOCUS_15550 423019 422222 gene locus_tag LOCUS_15560 423019 422222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 423132 424463 gene locus_tag LOCUS_15570 423132 424463 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047913.1 protein_id gnl|my_center|LOCUS_15570 424508 425731 gene locus_tag LOCUS_15580 424508 425731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 425749 426516 gene locus_tag LOCUS_15590 425749 426516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 426583 427242 gene locus_tag LOCUS_15600 426583 427242 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839781.1 protein_id gnl|my_center|LOCUS_15600 427271 428632 gene locus_tag LOCUS_15610 427271 428632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 428902 429516 gene locus_tag LOCUS_15620 428902 429516 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_15620 429575 430843 gene locus_tag LOCUS_15630 429575 430843 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963512.1 protein_id gnl|my_center|LOCUS_15630 430847 431215 gene locus_tag LOCUS_15640 430847 431215 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207903.1 protein_id gnl|my_center|LOCUS_15640 431724 431239 gene locus_tag LOCUS_15650 431724 431239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 432056 432526 gene locus_tag LOCUS_15660 432056 432526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 432523 434217 gene locus_tag LOCUS_15670 432523 434217 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099968.1 protein_id gnl|my_center|LOCUS_15670 434441 435235 gene locus_tag LOCUS_15680 434441 435235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 438451 435395 gene locus_tag LOCUS_15690 438451 435395 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162445741.1 protein_id gnl|my_center|LOCUS_15690 439351 439965 gene locus_tag LOCUS_15700 439351 439965 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919073.1 protein_id gnl|my_center|LOCUS_15700 439981 441321 gene locus_tag LOCUS_15710 439981 441321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 441356 442399 gene locus_tag LOCUS_15720 441356 442399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 442477 445542 gene locus_tag LOCUS_15730 442477 445542 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920956.1 protein_id gnl|my_center|LOCUS_15730 445961 446356 gene locus_tag LOCUS_15740 445961 446356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 447818 446457 gene locus_tag LOCUS_15750 447818 446457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 448865 447867 gene locus_tag LOCUS_15760 448865 447867 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962688.1 protein_id gnl|my_center|LOCUS_15760 449106 450869 gene locus_tag LOCUS_15770 449106 450869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 450881 451828 gene locus_tag LOCUS_15780 450881 451828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 451818 452264 gene locus_tag LOCUS_15790 451818 452264 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454683.1 protein_id gnl|my_center|LOCUS_15790 453015 452272 gene locus_tag LOCUS_15800 453015 452272 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 protein_id gnl|my_center|LOCUS_15800 453397 453053 gene locus_tag LOCUS_15810 453397 453053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15810 453958 453500 gene locus_tag LOCUS_15820 453958 453500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15820 454713 454054 gene locus_tag LOCUS_15830 454713 454054 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_15830 454845 455543 gene locus_tag LOCUS_15840 454845 455543 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202238.1 protein_id gnl|my_center|LOCUS_15840 456183 455587 gene locus_tag LOCUS_15850 gene ruvC 456183 455587 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962385.1 protein_id gnl|my_center|LOCUS_15850 456900 456190 gene locus_tag LOCUS_15860 456900 456190 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_15860 457633 456953 gene locus_tag LOCUS_15870 457633 456953 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962862.1 protein_id gnl|my_center|LOCUS_15870 459473 457761 gene locus_tag LOCUS_15880 459473 457761 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802867.1 protein_id gnl|my_center|LOCUS_15880 461856 460642 gene locus_tag LOCUS_15890 461856 460642 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858484.1 protein_id gnl|my_center|LOCUS_15890 462449 462069 gene locus_tag LOCUS_15900 462449 462069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 462791 462471 gene locus_tag LOCUS_15910 462791 462471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 463381 462833 gene locus_tag LOCUS_15920 463381 462833 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964424.1 protein_id gnl|my_center|LOCUS_15920 464906 463749 gene locus_tag LOCUS_15930 464906 463749 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_15930 465449 464955 gene locus_tag LOCUS_15940 gene dfrA 465449 464955 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637205.1 protein_id gnl|my_center|LOCUS_15940 466153 465599 gene locus_tag LOCUS_15950 466153 465599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 466631 466158 gene locus_tag LOCUS_15960 466631 466158 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405408.1 protein_id gnl|my_center|LOCUS_15960 468879 466639 gene locus_tag LOCUS_15970 468879 466639 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_15970 469459 468962 gene locus_tag LOCUS_15980 469459 468962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 469665 469844 gene locus_tag LOCUS_15990 469665 469844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 469946 470974 gene locus_tag LOCUS_16000 469946 470974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 470971 472080 gene locus_tag LOCUS_16010 470971 472080 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765630.1 protein_id gnl|my_center|LOCUS_16010 472465 473442 gene locus_tag LOCUS_16020 472465 473442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 473689 474102 gene locus_tag LOCUS_16030 473689 474102 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791781.1 protein_id gnl|my_center|LOCUS_16030 474103 474339 gene locus_tag LOCUS_16040 474103 474339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 474336 474719 gene locus_tag LOCUS_16050 474336 474719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 474728 475210 gene locus_tag LOCUS_16060 474728 475210 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838404.1 protein_id gnl|my_center|LOCUS_16060 476320 475241 gene locus_tag LOCUS_16070 476320 475241 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792023.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16070 477179 476505 gene locus_tag LOCUS_16080 gene rsmI 477179 476505 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108201.1 protein_id gnl|my_center|LOCUS_16080 477547 479643 gene locus_tag LOCUS_16090 477547 479643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 479636 480220 gene locus_tag LOCUS_16100 479636 480220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 480251 481510 gene locus_tag LOCUS_16110 480251 481510 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760040.1 protein_id gnl|my_center|LOCUS_16110 483236 481584 gene locus_tag LOCUS_16120 gene fadD 483236 481584 CDS product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169210.1 protein_id gnl|my_center|LOCUS_16120 484871 483606 gene locus_tag LOCUS_16130 484871 483606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 485120 485704 gene locus_tag LOCUS_16140 485120 485704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 485877 486089 gene locus_tag LOCUS_16150 485877 486089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 486220 487497 gene locus_tag LOCUS_16160 486220 487497 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100623.1 protein_id gnl|my_center|LOCUS_16160 487553 488242 gene locus_tag LOCUS_16170 487553 488242 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963527.1 protein_id gnl|my_center|LOCUS_16170 488246 488860 gene locus_tag LOCUS_16180 488246 488860 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016415.1 protein_id gnl|my_center|LOCUS_16180 488975 489859 gene locus_tag LOCUS_16190 488975 489859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 489955 489764 gene locus_tag LOCUS_16200 489955 489764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 489991 490281 gene locus_tag LOCUS_16210 489991 490281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 490325 491014 gene locus_tag LOCUS_16220 gene trmB 490325 491014 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962539.1 protein_id gnl|my_center|LOCUS_16220 491018 492097 gene locus_tag LOCUS_16230 gene rlmN 491018 492097 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964179.1 protein_id gnl|my_center|LOCUS_16230 492110 492835 gene locus_tag LOCUS_16240 492110 492835 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356729.1 protein_id gnl|my_center|LOCUS_16240 494262 492943 gene locus_tag LOCUS_16250 494262 492943 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107846.1 protein_id gnl|my_center|LOCUS_16250 495307 494492 gene locus_tag LOCUS_16260 495307 494492 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_16260 495904 495320 gene locus_tag LOCUS_16270 495904 495320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 496431 499634 gene locus_tag LOCUS_16280 496431 499634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 499657 500616 gene locus_tag LOCUS_16290 499657 500616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 500695 501636 gene locus_tag LOCUS_16300 gene queG 500695 501636 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964223.1 protein_id gnl|my_center|LOCUS_16300 502383 501628 gene locus_tag LOCUS_16310 502383 501628 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404513.1 protein_id gnl|my_center|LOCUS_16310 503888 502383 gene locus_tag LOCUS_16320 503888 502383 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_16320 504289 505305 gene locus_tag LOCUS_16330 504289 505305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 505871 505341 gene locus_tag LOCUS_16340 505871 505341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 506041 506442 gene locus_tag LOCUS_16350 gene apaG 506041 506442 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172741.1 protein_id gnl|my_center|LOCUS_16350 506552 508450 gene locus_tag LOCUS_16360 506552 508450 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_16360 508625 509656 gene locus_tag LOCUS_16370 508625 509656 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_16370 509676 510497 gene locus_tag LOCUS_16380 gene mreC 509676 510497 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792052.1 protein_id gnl|my_center|LOCUS_16380 510490 511008 gene locus_tag LOCUS_16390 510490 511008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 511010 512881 gene locus_tag LOCUS_16400 gene mrdA 511010 512881 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_16400 514350 512938 gene locus_tag LOCUS_16410 514350 512938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 514880 514356 gene locus_tag LOCUS_16420 514880 514356 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760422.1 protein_id gnl|my_center|LOCUS_16420 515058 515627 gene locus_tag LOCUS_16430 515058 515627 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384313.1 protein_id gnl|my_center|LOCUS_16430 515555 517849 gene locus_tag LOCUS_16440 515555 517849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 518363 519052 gene locus_tag LOCUS_16450 518363 519052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018339507.1 protein_id gnl|my_center|LOCUS_16450 519965 519333 gene locus_tag LOCUS_16460 519965 519333 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883143.1 protein_id gnl|my_center|LOCUS_16460 521571 519967 gene locus_tag LOCUS_16470 521571 519967 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523287.1 protein_id gnl|my_center|LOCUS_16470 522842 521640 gene locus_tag LOCUS_16480 522842 521640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964068.1 protein_id gnl|my_center|LOCUS_16480 524888 523107 gene locus_tag LOCUS_16490 524888 523107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 536805 524989 gene locus_tag LOCUS_16500 536805 524989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 537076 537777 gene locus_tag LOCUS_16510 537076 537777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 538133 538657 gene locus_tag LOCUS_16520 538133 538657 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205912.1 protein_id gnl|my_center|LOCUS_16520 538644 540134 gene locus_tag LOCUS_16530 538644 540134 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989605.1 protein_id gnl|my_center|LOCUS_16530 540606 540148 gene locus_tag LOCUS_16540 540606 540148 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100664.1 protein_id gnl|my_center|LOCUS_16540 540943 541344 gene locus_tag LOCUS_16550 540943 541344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 541463 541825 gene locus_tag LOCUS_16560 gene ssb 541463 541825 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361980.1 protein_id gnl|my_center|LOCUS_16560 543067 541997 gene locus_tag LOCUS_16570 gene prfA 543067 541997 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940174.1 protein_id gnl|my_center|LOCUS_16570 544025 543153 gene locus_tag LOCUS_16580 544025 543153 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246655.1 protein_id gnl|my_center|LOCUS_16580 544726 544523 gene locus_tag LOCUS_16590 544726 544523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 544872 548804 gene locus_tag LOCUS_16600 544872 548804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 549077 549748 gene locus_tag LOCUS_16610 549077 549748 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695801.1 protein_id gnl|my_center|LOCUS_16610 549903 554060 gene locus_tag LOCUS_16620 549903 554060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 556722 554347 gene locus_tag LOCUS_16630 556722 554347 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109335.1 protein_id gnl|my_center|LOCUS_16630 557403 557131 gene locus_tag LOCUS_16640 557403 557131 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806049.1 protein_id gnl|my_center|LOCUS_16640 559873 558053 gene locus_tag LOCUS_16650 559873 558053 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962252.1 protein_id gnl|my_center|LOCUS_16650 563059 559919 gene locus_tag LOCUS_16660 563059 559919 CDS product basic secretory protein-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839758.1 protein_id gnl|my_center|LOCUS_16660 563497 565722 gene locus_tag LOCUS_16670 563497 565722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16670 565749 566675 gene locus_tag LOCUS_16680 565749 566675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16680 566683 568131 gene locus_tag LOCUS_16690 566683 568131 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100991023.1 protein_id gnl|my_center|LOCUS_16690 568149 569066 gene locus_tag LOCUS_16700 568149 569066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 569134 569904 gene locus_tag LOCUS_16710 569134 569904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 570138 571244 gene locus_tag LOCUS_16720 570138 571244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16720 571147 571629 gene locus_tag LOCUS_16730 571147 571629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16730 571747 572376 gene locus_tag LOCUS_16740 571747 572376 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226991426.1 protein_id gnl|my_center|LOCUS_16740 572394 573683 gene locus_tag LOCUS_16750 572394 573683 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864646.1 protein_id gnl|my_center|LOCUS_16750 573787 574182 gene locus_tag LOCUS_16760 573787 574182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 574166 575047 gene locus_tag LOCUS_16770 574166 575047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 575072 575491 gene locus_tag LOCUS_16780 575072 575491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 575518 576309 gene locus_tag LOCUS_16790 575518 576309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16790 577191 576382 gene locus_tag LOCUS_16800 577191 576382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16800 577505 577128 gene locus_tag LOCUS_16810 577505 577128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16810 577667 578971 gene locus_tag LOCUS_16820 577667 578971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 579079 579330 gene locus_tag LOCUS_16830 579079 579330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 579386 579526 gene locus_tag LOCUS_16840 579386 579526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 579546 579920 gene locus_tag LOCUS_16850 579546 579920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16850 580540 580091 gene locus_tag LOCUS_16860 580540 580091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 580912 580562 gene locus_tag LOCUS_16870 580912 580562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 581150 580893 gene locus_tag LOCUS_16880 581150 580893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 581521 581147 gene locus_tag LOCUS_16890 581521 581147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 581970 581497 gene locus_tag LOCUS_16900 581970 581497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 582971 582084 gene locus_tag LOCUS_16910 582971 582084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255955.1 protein_id gnl|my_center|LOCUS_16910 584579 583209 gene locus_tag LOCUS_16920 584579 583209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 585011 584586 gene locus_tag LOCUS_16930 585011 584586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 586023 586763 gene locus_tag LOCUS_16940 586023 586763 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089713553.1 protein_id gnl|my_center|LOCUS_16940 587878 587027 gene locus_tag LOCUS_16950 587878 587027 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 protein_id gnl|my_center|LOCUS_16950 588016 588546 gene locus_tag LOCUS_16960 588016 588546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 588641 589186 gene locus_tag LOCUS_16970 588641 589186 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107672.1 protein_id gnl|my_center|LOCUS_16970 589208 590368 gene locus_tag LOCUS_16980 gene dnaJ 589208 590368 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763399.1 protein_id gnl|my_center|LOCUS_16980 590551 594186 gene locus_tag LOCUS_16990 590551 594186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 594189 595853 gene locus_tag LOCUS_17000 594189 595853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 598863 596068 gene locus_tag LOCUS_17010 598863 596068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 599782 599081 gene locus_tag LOCUS_17020 599782 599081 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963527.1 protein_id gnl|my_center|LOCUS_17020 601053 599785 gene locus_tag LOCUS_17030 601053 599785 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100623.1 protein_id gnl|my_center|LOCUS_17030 602683 601172 gene locus_tag LOCUS_17040 602683 601172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 607115 603870 gene locus_tag LOCUS_17050 607115 603870 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_17050 608425 607115 gene locus_tag LOCUS_17060 608425 607115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 609933 608452 gene locus_tag LOCUS_17070 609933 608452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 611393 609984 gene locus_tag LOCUS_17080 611393 609984 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_17080 611927 611406 gene locus_tag LOCUS_17090 611927 611406 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_17090 612726 612028 gene locus_tag LOCUS_17100 612726 612028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 612952 614412 gene locus_tag LOCUS_17110 612952 614412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 614496 615389 gene locus_tag LOCUS_17120 614496 615389 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761539.1 protein_id gnl|my_center|LOCUS_17120 615476 616228 gene locus_tag LOCUS_17130 615476 616228 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905448.1 protein_id gnl|my_center|LOCUS_17130 619877 616209 gene locus_tag LOCUS_17140 gene purL 619877 616209 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962854.1 protein_id gnl|my_center|LOCUS_17140 620157 620945 gene locus_tag LOCUS_17150 620157 620945 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_17150 620951 621685 gene locus_tag LOCUS_17160 620951 621685 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920731.1 protein_id gnl|my_center|LOCUS_17160 622158 623822 gene locus_tag LOCUS_17170 622158 623822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 623822 624754 gene locus_tag LOCUS_17180 623822 624754 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140702.1 protein_id gnl|my_center|LOCUS_17180 624934 626319 gene locus_tag LOCUS_17190 624934 626319 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_17190 626330 626875 gene locus_tag LOCUS_17200 gene hpt 626330 626875 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760055.1 protein_id gnl|my_center|LOCUS_17200 628091 626937 gene locus_tag LOCUS_17210 628091 626937 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 protein_id gnl|my_center|LOCUS_17210 628223 629779 gene locus_tag LOCUS_17220 628223 629779 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_17220 630529 629792 gene locus_tag LOCUS_17230 630529 629792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 630931 630548 gene locus_tag LOCUS_17240 630931 630548 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021683.1 protein_id gnl|my_center|LOCUS_17240 631817 630933 gene locus_tag LOCUS_17250 631817 630933 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_17250 632061 634190 gene locus_tag LOCUS_17260 632061 634190 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763951.1 protein_id gnl|my_center|LOCUS_17260 635064 634306 gene locus_tag LOCUS_17270 gene truA 635064 634306 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764438.1 protein_id gnl|my_center|LOCUS_17270 636252 635074 gene locus_tag LOCUS_17280 gene clpX 636252 635074 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791864.1 protein_id gnl|my_center|LOCUS_17280 637041 636343 gene locus_tag LOCUS_17290 gene clpP 637041 636343 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964184.1 protein_id gnl|my_center|LOCUS_17290 638460 637084 gene locus_tag LOCUS_17300 gene tig 638460 637084 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764110.1 protein_id gnl|my_center|LOCUS_17300 638613 638531 gene locus_tag LOCUS_t00190 638613 638531 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 639324 638851 gene locus_tag LOCUS_17310 639324 638851 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_17310 639880 639353 gene locus_tag LOCUS_17320 639880 639353 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790648.1 protein_id gnl|my_center|LOCUS_17320 640384 639926 gene locus_tag LOCUS_17330 640384 639926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 641137 640403 gene locus_tag LOCUS_17340 641137 640403 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766463.1 protein_id gnl|my_center|LOCUS_17340 641321 641233 gene locus_tag LOCUS_t00200 641321 641233 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 642281 641478 gene locus_tag LOCUS_17350 642281 641478 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478755.1 protein_id gnl|my_center|LOCUS_17350 642329 642934 gene locus_tag LOCUS_17360 642329 642934 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108811.1 protein_id gnl|my_center|LOCUS_17360 643095 643592 gene locus_tag LOCUS_17370 643095 643592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 643977 643759 gene locus_tag LOCUS_17380 643977 643759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 644688 645197 gene locus_tag LOCUS_17390 644688 645197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 646237 647373 gene locus_tag LOCUS_17400 646237 647373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 648633 647359 gene locus_tag LOCUS_17410 648633 647359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 649570 648833 gene locus_tag LOCUS_17420 649570 648833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 650457 649654 gene locus_tag LOCUS_17430 650457 649654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 651153 650593 gene locus_tag LOCUS_17440 651153 650593 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962996.1 protein_id gnl|my_center|LOCUS_17440 651258 651833 gene locus_tag LOCUS_17450 651258 651833 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962784.1 protein_id gnl|my_center|LOCUS_17450 651848 652345 gene locus_tag LOCUS_17460 651848 652345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 652441 652911 gene locus_tag LOCUS_17470 652441 652911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 654022 653084 gene locus_tag LOCUS_17480 654022 653084 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963121.1 protein_id gnl|my_center|LOCUS_17480 654579 654292 gene locus_tag LOCUS_17490 654579 654292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 654981 655835 gene locus_tag LOCUS_17500 gene moaA 654981 655835 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722673.1 protein_id gnl|my_center|LOCUS_17500 655835 657022 gene locus_tag LOCUS_17510 655835 657022 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_17510 657024 657758 gene locus_tag LOCUS_17520 657024 657758 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014858053.1 protein_id gnl|my_center|LOCUS_17520 657807 658040 gene locus_tag LOCUS_17530 657807 658040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 658050 659138 gene locus_tag LOCUS_17540 gene moeB 658050 659138 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_17540 659128 659565 gene locus_tag LOCUS_17550 659128 659565 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251065.1 protein_id gnl|my_center|LOCUS_17550 659572 660486 gene locus_tag LOCUS_17560 gene moaCB 659572 660486 CDS product bifunctional molybdenum cofactor biosynthesis protein MoaC/MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207007.1 protein_id gnl|my_center|LOCUS_17560 661653 660493 gene locus_tag LOCUS_17570 661653 660493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 663513 661768 gene locus_tag LOCUS_17580 663513 661768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 663640 664302 gene locus_tag LOCUS_17590 663640 664302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 664295 665365 gene locus_tag LOCUS_17600 gene mvaD 664295 665365 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 protein_id gnl|my_center|LOCUS_17600 665355 665888 gene locus_tag LOCUS_17610 665355 665888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 666788 665928 gene locus_tag LOCUS_17620 666788 665928 CDS product GYDIA family GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 protein_id gnl|my_center|LOCUS_17620 667139 669184 gene locus_tag LOCUS_17630 667139 669184 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840085.1 protein_id gnl|my_center|LOCUS_17630 670413 669337 gene locus_tag LOCUS_17640 670413 669337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 670646 671638 gene locus_tag LOCUS_17650 670646 671638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 671786 672538 gene locus_tag LOCUS_17660 671786 672538 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462044.1 protein_id gnl|my_center|LOCUS_17660 672569 673591 gene locus_tag LOCUS_17670 672569 673591 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957837.1 protein_id gnl|my_center|LOCUS_17670 674293 673586 gene locus_tag LOCUS_17680 674293 673586 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_17680 674453 674283 gene locus_tag LOCUS_17690 674453 674283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 675925 674525 gene locus_tag LOCUS_17700 675925 674525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 676295 678751 gene locus_tag LOCUS_17710 676295 678751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 680054 679290 gene locus_tag LOCUS_17720 680054 679290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 680171 680785 gene locus_tag LOCUS_17730 680171 680785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17730 681730 680921 gene locus_tag LOCUS_17740 gene suhB 681730 680921 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072272.1 protein_id gnl|my_center|LOCUS_17740 682106 681732 gene locus_tag LOCUS_17750 682106 681732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17750 682336 682058 gene locus_tag LOCUS_17760 682336 682058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 682632 685484 gene locus_tag LOCUS_17770 gene metH 682632 685484 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933516.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17770 685562 686296 gene locus_tag LOCUS_17780 685562 686296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17780 686314 688209 gene locus_tag LOCUS_17790 686314 688209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17790 688212 688607 gene locus_tag LOCUS_17800 688212 688607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17800 688747 689091 gene locus_tag LOCUS_17810 688747 689091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 689142 689486 gene locus_tag LOCUS_17820 689142 689486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17820 689453 689674 gene locus_tag LOCUS_17830 689453 689674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17830 689687 690172 gene locus_tag LOCUS_17840 689687 690172 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202523.1 protein_id gnl|my_center|LOCUS_17840 690166 690345 gene locus_tag LOCUS_17850 690166 690345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 690483 690938 gene locus_tag LOCUS_17860 690483 690938 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963264.1 protein_id gnl|my_center|LOCUS_17860 690892 691500 gene locus_tag LOCUS_17870 690892 691500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17870 691440 691634 gene locus_tag LOCUS_17880 691440 691634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17880 692029 692640 gene locus_tag LOCUS_17890 692029 692640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17890 692565 692822 gene locus_tag LOCUS_17900 692565 692822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17900 692890 693321 gene locus_tag LOCUS_17910 692890 693321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17910 693359 693694 gene locus_tag LOCUS_17920 693359 693694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17920 693805 694134 gene locus_tag LOCUS_17930 693805 694134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17930 694152 694295 gene locus_tag LOCUS_17940 694152 694295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17940 694835 695317 gene locus_tag LOCUS_17950 694835 695317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 695386 695580 gene locus_tag LOCUS_17960 695386 695580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 696247 696819 gene locus_tag LOCUS_17970 696247 696819 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_17970 696956 697822 gene locus_tag LOCUS_17980 gene rfbA 696956 697822 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286449.1 protein_id gnl|my_center|LOCUS_17980 697825 698421 gene locus_tag LOCUS_17990 697825 698421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 698455 698649 gene locus_tag LOCUS_18000 698455 698649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 698639 699094 gene locus_tag LOCUS_18010 698639 699094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 699132 699494 gene locus_tag LOCUS_18020 699132 699494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18020 699969 700412 gene locus_tag LOCUS_18030 699969 700412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18030 700930 701877 gene locus_tag LOCUS_18040 700930 701877 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_18040 701896 702864 gene locus_tag LOCUS_18050 701896 702864 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208044.1 protein_id gnl|my_center|LOCUS_18050 702867 703082 gene locus_tag LOCUS_18060 702867 703082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18060 703084 703623 gene locus_tag LOCUS_18070 703084 703623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18070 703976 704449 gene locus_tag LOCUS_18080 703976 704449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 704553 705056 gene locus_tag LOCUS_18090 704553 705056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 705010 705396 gene locus_tag LOCUS_18100 705010 705396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 705687 706049 gene locus_tag LOCUS_18110 705687 706049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 706049 706342 gene locus_tag LOCUS_18120 706049 706342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18120 706330 706656 gene locus_tag LOCUS_18130 706330 706656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18130 706666 707427 gene locus_tag LOCUS_18140 706666 707427 CDS product AglZ/HisF2 family acetamidino modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113421.1 protein_id gnl|my_center|LOCUS_18140 707506 707904 gene locus_tag LOCUS_18150 707506 707904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18150 708132 708464 gene locus_tag LOCUS_18160 708132 708464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 708759 709604 gene locus_tag LOCUS_18170 708759 709604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 709636 709881 gene locus_tag LOCUS_18180 709636 709881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 709986 710177 gene locus_tag LOCUS_18190 709986 710177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 710202 710702 gene locus_tag LOCUS_18200 710202 710702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 710696 711244 gene locus_tag LOCUS_18210 710696 711244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 711371 712123 gene locus_tag LOCUS_18220 711371 712123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 712095 712511 gene locus_tag LOCUS_18230 712095 712511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 712508 712777 gene locus_tag LOCUS_18240 712508 712777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 713233 713748 gene locus_tag LOCUS_18250 713233 713748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 713897 714163 gene locus_tag LOCUS_18260 713897 714163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 714476 714736 gene locus_tag LOCUS_18270 714476 714736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 714733 715005 gene locus_tag LOCUS_18280 714733 715005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 715012 715815 gene locus_tag LOCUS_18290 715012 715815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18290 715803 715994 gene locus_tag LOCUS_18300 715803 715994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 715946 716620 gene locus_tag LOCUS_18310 715946 716620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18310 716536 716778 gene locus_tag LOCUS_18320 716536 716778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18320 717132 717800 gene locus_tag LOCUS_18330 717132 717800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18330 717803 718522 gene locus_tag LOCUS_18340 717803 718522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 718512 719264 gene locus_tag LOCUS_18350 718512 719264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18350 719269 719595 gene locus_tag LOCUS_18360 719269 719595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18360 719700 720260 gene locus_tag LOCUS_18370 719700 720260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 720439 720687 gene locus_tag LOCUS_18380 720439 720687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18380 720869 721309 gene locus_tag LOCUS_18390 720869 721309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18390 721269 721481 gene locus_tag LOCUS_18400 721269 721481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 721517 721903 gene locus_tag LOCUS_18410 721517 721903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18410 721994 722458 gene locus_tag LOCUS_18420 721994 722458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18420 722670 722894 gene locus_tag LOCUS_18430 722670 722894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 722905 723405 gene locus_tag LOCUS_18440 722905 723405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 723402 723662 gene locus_tag LOCUS_18450 723402 723662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 723769 724053 gene locus_tag LOCUS_18460 723769 724053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 724023 724601 gene locus_tag LOCUS_18470 724023 724601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 724899 725504 gene locus_tag LOCUS_18480 724899 725504 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202264.1 protein_id gnl|my_center|LOCUS_18480 725504 726154 gene locus_tag LOCUS_18490 725504 726154 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775527.1 protein_id gnl|my_center|LOCUS_18490 726157 726906 gene locus_tag LOCUS_18500 726157 726906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18500 726963 727250 gene locus_tag LOCUS_18510 726963 727250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 727517 728791 gene locus_tag LOCUS_18520 727517 728791 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18520 728784 729605 gene locus_tag LOCUS_18530 728784 729605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 729619 729855 gene locus_tag LOCUS_18540 729619 729855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 729852 730589 gene locus_tag LOCUS_18550 729852 730589 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103768.1 protein_id gnl|my_center|LOCUS_18550 730601 731359 gene locus_tag LOCUS_18560 730601 731359 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103768.1 protein_id gnl|my_center|LOCUS_18560 731377 731598 gene locus_tag LOCUS_18570 731377 731598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 731606 732094 gene locus_tag LOCUS_18580 731606 732094 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801359.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18580 732031 732219 gene locus_tag LOCUS_18590 732031 732219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 732216 732575 gene locus_tag LOCUS_18600 732216 732575 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393656.1 protein_id gnl|my_center|LOCUS_18600 732635 733171 gene locus_tag LOCUS_18610 732635 733171 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005947811.1 protein_id gnl|my_center|LOCUS_18610 733171 733851 gene locus_tag LOCUS_18620 733171 733851 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107355.1 protein_id gnl|my_center|LOCUS_18620 734377 734979 gene locus_tag LOCUS_18630 734377 734979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 735031 735510 gene locus_tag LOCUS_18640 735031 735510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 735525 735950 gene locus_tag LOCUS_18650 735525 735950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 735928 736077 gene locus_tag LOCUS_18660 735928 736077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 736107 736592 gene locus_tag LOCUS_18670 736107 736592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 736675 736824 gene locus_tag LOCUS_18680 736675 736824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 737521 738150 gene locus_tag LOCUS_18690 gene elyC 737521 738150 CDS product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704890.1 protein_id gnl|my_center|LOCUS_18690 738209 738853 gene locus_tag LOCUS_18700 738209 738853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18700 738850 739365 gene locus_tag LOCUS_18710 738850 739365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18710 739594 739956 gene locus_tag LOCUS_18720 739594 739956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 740149 741360 gene locus_tag LOCUS_18730 740149 741360 CDS product UDP-N-acetylglucosamine 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202418.1 protein_id gnl|my_center|LOCUS_18730 741595 742266 gene locus_tag LOCUS_18740 741595 742266 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203508.1 protein_id gnl|my_center|LOCUS_18740 742462 744735 gene locus_tag LOCUS_18750 742462 744735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 744741 746180 gene locus_tag LOCUS_18760 744741 746180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18760 746214 747269 gene locus_tag LOCUS_18770 746214 747269 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963509.1 protein_id gnl|my_center|LOCUS_18770 747443 748468 gene locus_tag LOCUS_18780 747443 748468 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550082.1 protein_id gnl|my_center|LOCUS_18780 750542 748629 gene locus_tag LOCUS_18790 750542 748629 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964457.1 protein_id gnl|my_center|LOCUS_18790 751001 757666 gene locus_tag LOCUS_18800 751001 757666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 758167 757826 gene locus_tag LOCUS_18810 758167 757826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18810 758868 758179 gene locus_tag LOCUS_18820 758868 758179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18820 760161 758893 gene locus_tag LOCUS_18830 760161 758893 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964006.1 protein_id gnl|my_center|LOCUS_18830 760765 760265 gene locus_tag LOCUS_18840 760765 760265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18840 761636 760773 gene locus_tag LOCUS_18850 761636 760773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18850 762515 761853 gene locus_tag LOCUS_18860 762515 761853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 762828 764240 gene locus_tag LOCUS_18870 762828 764240 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405167.1 protein_id gnl|my_center|LOCUS_18870 764251 765480 gene locus_tag LOCUS_18880 764251 765480 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108036.1 protein_id gnl|my_center|LOCUS_18880 765500 767347 gene locus_tag LOCUS_18890 765500 767347 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962749.1 protein_id gnl|my_center|LOCUS_18890 767826 768494 gene locus_tag LOCUS_18900 767826 768494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 768699 775070 gene locus_tag LOCUS_18910 768699 775070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18910 774994 776043 gene locus_tag LOCUS_18920 774994 776043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18920 775947 776507 gene locus_tag LOCUS_18930 775947 776507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18930 776453 776659 gene locus_tag LOCUS_18940 776453 776659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 776637 776954 gene locus_tag LOCUS_18950 776637 776954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 777052 779517 gene locus_tag LOCUS_18960 777052 779517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18960 779468 780049 gene locus_tag LOCUS_18970 779468 780049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18970 780055 784026 gene locus_tag LOCUS_18980 780055 784026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18980 784866 784090 gene locus_tag LOCUS_18990 gene cysQ 784866 784090 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071807.1 protein_id gnl|my_center|LOCUS_18990 784980 786005 gene locus_tag LOCUS_19000 gene galE 784980 786005 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788150.1 protein_id gnl|my_center|LOCUS_19000 786482 786000 gene locus_tag LOCUS_19010 786482 786000 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816623.1 protein_id gnl|my_center|LOCUS_19010 787130 791584 gene locus_tag LOCUS_19020 787130 791584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 791482 804618 gene locus_tag LOCUS_19030 791482 804618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19030 805342 804695 gene locus_tag LOCUS_19040 gene nreC 805342 804695 CDS product nitrate respiration regulation response regulator NreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706315.1 protein_id gnl|my_center|LOCUS_19040 807081 806056 gene locus_tag LOCUS_19050 gene meaB 807081 806056 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085832.1 protein_id gnl|my_center|LOCUS_19050 807352 809190 gene locus_tag LOCUS_19060 gene katG 807352 809190 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963840.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19060 809184 809582 gene locus_tag LOCUS_19070 809184 809582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19070 810958 809720 gene locus_tag LOCUS_19080 810958 809720 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964122.1 protein_id gnl|my_center|LOCUS_19080 813798 811111 gene locus_tag LOCUS_19090 813798 811111 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962806.1 protein_id gnl|my_center|LOCUS_19090 814403 814038 gene locus_tag LOCUS_19100 814403 814038 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_19100 814424 814624 gene locus_tag LOCUS_19110 814424 814624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 814729 815721 gene locus_tag LOCUS_19120 814729 815721 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789175.1 protein_id gnl|my_center|LOCUS_19120 815787 816353 gene locus_tag LOCUS_19130 gene efp 815787 816353 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963122.1 protein_id gnl|my_center|LOCUS_19130 816371 816871 gene locus_tag LOCUS_19140 gene accB 816371 816871 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_19140 816926 817222 gene locus_tag LOCUS_19150 816926 817222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19150 817219 818205 gene locus_tag LOCUS_19160 817219 818205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19160 818215 820020 gene locus_tag LOCUS_19170 818215 820020 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963277.1 protein_id gnl|my_center|LOCUS_19170 820248 823115 gene locus_tag LOCUS_19180 gene gcvP 820248 823115 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963500.1 protein_id gnl|my_center|LOCUS_19180 826329 823393 gene locus_tag LOCUS_19190 826329 823393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 826793 826326 gene locus_tag LOCUS_19200 826793 826326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 828183 827539 gene locus_tag LOCUS_19210 828183 827539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 828352 830121 gene locus_tag LOCUS_19220 gene aspS 828352 830121 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962449.1 protein_id gnl|my_center|LOCUS_19220 830534 830187 gene locus_tag LOCUS_19230 830534 830187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 831416 830538 gene locus_tag LOCUS_19240 831416 830538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19240 831946 831359 gene locus_tag LOCUS_19250 831946 831359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19250 834068 831951 gene locus_tag LOCUS_19260 834068 831951 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962553.1 protein_id gnl|my_center|LOCUS_19260 835164 834430 gene locus_tag LOCUS_19270 835164 834430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 835923 835729 gene locus_tag LOCUS_19280 835923 835729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 836507 835920 gene locus_tag LOCUS_19290 836507 835920 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948438.1 protein_id gnl|my_center|LOCUS_19290 836927 836514 gene locus_tag LOCUS_19300 836927 836514 CDS product DUF6157 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090582.1 protein_id gnl|my_center|LOCUS_19300 837782 837045 gene locus_tag LOCUS_19310 837782 837045 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939274.1 protein_id gnl|my_center|LOCUS_19310 837900 838964 gene locus_tag LOCUS_19320 gene lpxK 837900 838964 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765467.1 protein_id gnl|my_center|LOCUS_19320 840154 839039 gene locus_tag LOCUS_19330 840154 839039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 840650 840126 gene locus_tag LOCUS_19340 840650 840126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 842152 840647 gene locus_tag LOCUS_19350 842152 840647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 843517 842249 gene locus_tag LOCUS_19360 843517 842249 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202792.1 protein_id gnl|my_center|LOCUS_19360 845457 843550 gene locus_tag LOCUS_19370 845457 843550 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062080.1 protein_id gnl|my_center|LOCUS_19370 846264 845596 gene locus_tag LOCUS_19380 846264 845596 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_19380 847312 846431 gene locus_tag LOCUS_19390 847312 846431 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_19390 848239 847451 gene locus_tag LOCUS_19400 848239 847451 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083192.1 protein_id gnl|my_center|LOCUS_19400 848648 848229 gene locus_tag LOCUS_19410 gene mce 848648 848229 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_19410 848841 849317 gene locus_tag LOCUS_19420 848841 849317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 849322 851118 gene locus_tag LOCUS_19430 849322 851118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 851122 852579 gene locus_tag LOCUS_19440 851122 852579 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920272.1 protein_id gnl|my_center|LOCUS_19440 852586 854961 gene locus_tag LOCUS_19450 852586 854961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 856992 855091 gene locus_tag LOCUS_19460 856992 855091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 857387 857004 gene locus_tag LOCUS_19470 857387 857004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 859940 858000 gene locus_tag LOCUS_19480 859940 858000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 874228 860327 gene locus_tag LOCUS_19490 874228 860327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 874296 874541 gene locus_tag LOCUS_19500 874296 874541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 888128 875109 gene locus_tag LOCUS_19510 888128 875109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 888777 888010 gene locus_tag LOCUS_19520 888777 888010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 890761 889541 gene locus_tag LOCUS_19530 890761 889541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 894095 890721 gene locus_tag LOCUS_19540 894095 890721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19540 911887 894092 gene locus_tag LOCUS_19550 911887 894092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 912517 913695 gene locus_tag LOCUS_19560 912517 913695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 913831 914607 gene locus_tag LOCUS_19570 gene paaG 913831 914607 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046117561.1 protein_id gnl|my_center|LOCUS_19570 914957 917923 gene locus_tag LOCUS_19580 914957 917923 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_19580 917946 919400 gene locus_tag LOCUS_19590 917946 919400 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_19590 919457 920920 gene locus_tag LOCUS_19600 919457 920920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 921166 921537 gene locus_tag LOCUS_19610 921166 921537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19610 922540 921800 gene locus_tag LOCUS_19620 922540 921800 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_19620 925525 922577 gene locus_tag LOCUS_19630 925525 922577 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094146567.1 protein_id gnl|my_center|LOCUS_19630 928468 925844 gene locus_tag LOCUS_19640 928468 925844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 930166 928517 gene locus_tag LOCUS_19650 930166 928517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 933142 930683 gene locus_tag LOCUS_19660 933142 930683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 935423 933585 gene locus_tag LOCUS_19670 935423 933585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 937481 935448 gene locus_tag LOCUS_19680 937481 935448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 943666 937511 gene locus_tag LOCUS_19690 943666 937511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 945441 943678 gene locus_tag LOCUS_19700 945441 943678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 945637 945449 gene locus_tag LOCUS_19710 945637 945449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 946127 949039 gene locus_tag LOCUS_19720 946127 949039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 949105 952488 gene locus_tag LOCUS_19730 949105 952488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 952449 952964 gene locus_tag LOCUS_19740 952449 952964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 952968 955634 gene locus_tag LOCUS_19750 952968 955634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 955771 958905 gene locus_tag LOCUS_19760 955771 958905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 958916 959665 gene locus_tag LOCUS_19770 958916 959665 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_19770 960638 960030 gene locus_tag LOCUS_19780 960638 960030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 962377 960650 gene locus_tag LOCUS_19790 962377 960650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 962859 962647 gene locus_tag LOCUS_19800 962859 962647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 962954 963694 gene locus_tag LOCUS_19810 962954 963694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 963694 964419 gene locus_tag LOCUS_19820 963694 964419 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_19820 964712 964939 gene locus_tag LOCUS_19830 964712 964939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 965865 965110 gene locus_tag LOCUS_19840 965865 965110 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_19840 966025 966999 gene locus_tag LOCUS_19850 966025 966999 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_19850 967003 967674 gene locus_tag LOCUS_19860 967003 967674 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966053.1 protein_id gnl|my_center|LOCUS_19860 967720 968604 gene locus_tag LOCUS_19870 967720 968604 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964192.1 protein_id gnl|my_center|LOCUS_19870 968606 969355 gene locus_tag LOCUS_19880 968606 969355 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_19880 969876 969388 gene locus_tag LOCUS_19890 969876 969388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 970289 970762 gene locus_tag LOCUS_19900 970289 970762 CDS product ribonuclease H-like YkuK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963491.1 protein_id gnl|my_center|LOCUS_19900 970965 971186 gene locus_tag LOCUS_19910 970965 971186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 971183 972088 gene locus_tag LOCUS_19920 971183 972088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 972078 973121 gene locus_tag LOCUS_19930 972078 973121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 973297 978804 gene locus_tag LOCUS_19940 973297 978804 CDS product MG2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202408.1 protein_id gnl|my_center|LOCUS_19940 978816 981137 gene locus_tag LOCUS_19950 gene pbpC 978816 981137 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964324.1 protein_id gnl|my_center|LOCUS_19950 981283 981708 gene locus_tag LOCUS_19960 981283 981708 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405497.1 protein_id gnl|my_center|LOCUS_19960 981720 982316 gene locus_tag LOCUS_19970 gene folE 981720 982316 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791113.1 protein_id gnl|my_center|LOCUS_19970 982336 983211 gene locus_tag LOCUS_19980 gene fabD 982336 983211 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962577.1 protein_id gnl|my_center|LOCUS_19980 983214 983762 gene locus_tag LOCUS_19990 983214 983762 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932347.1 protein_id gnl|my_center|LOCUS_19990 983782 985689 gene locus_tag LOCUS_20000 983782 985689 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964069.1 protein_id gnl|my_center|LOCUS_20000 987072 985675 gene locus_tag LOCUS_20010 987072 985675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 987352 988194 gene locus_tag LOCUS_20020 987352 988194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 989171 988077 gene locus_tag LOCUS_20030 gene rfaD 989171 988077 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015772.1 protein_id gnl|my_center|LOCUS_20030 989343 989182 gene locus_tag LOCUS_20040 989343 989182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 989710 990915 gene locus_tag LOCUS_20050 989710 990915 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_20050 990926 991390 gene locus_tag LOCUS_20060 990926 991390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 991400 991747 gene locus_tag LOCUS_20070 991400 991747 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963368.1 protein_id gnl|my_center|LOCUS_20070 991844 992206 gene locus_tag LOCUS_20080 991844 992206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 992986 992546 gene locus_tag LOCUS_20090 992986 992546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 993963 992938 gene locus_tag LOCUS_20100 993963 992938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 995360 994314 gene locus_tag LOCUS_20110 995360 994314 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919504.1 protein_id gnl|my_center|LOCUS_20110 997423 995447 gene locus_tag LOCUS_20120 997423 995447 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 protein_id gnl|my_center|LOCUS_20120 997868 997449 gene locus_tag LOCUS_20130 997868 997449 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964269.1 protein_id gnl|my_center|LOCUS_20130 1000044 997876 gene locus_tag LOCUS_20140 gene metG 1000044 997876 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962236.1 protein_id gnl|my_center|LOCUS_20140 1000594 1002003 gene locus_tag LOCUS_20150 1000594 1002003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 1002696 1003067 gene locus_tag LOCUS_20160 1002696 1003067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 1003080 1006337 gene locus_tag LOCUS_20170 1003080 1006337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 1006490 1008949 gene locus_tag LOCUS_20180 1006490 1008949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 1008946 1009311 gene locus_tag LOCUS_20190 1008946 1009311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 1010141 1014937 gene locus_tag LOCUS_20200 1010141 1014937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 1015091 1015693 gene locus_tag LOCUS_20210 1015091 1015693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 1016465 1015731 gene locus_tag LOCUS_20220 1016465 1015731 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_20220 1016804 1017706 gene locus_tag LOCUS_20230 1016804 1017706 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_20230 1017708 1018343 gene locus_tag LOCUS_20240 1017708 1018343 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_20240 1022234 1018386 gene locus_tag LOCUS_20250 1022234 1018386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 1022964 1024112 gene locus_tag LOCUS_20260 1022964 1024112 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031138.1 protein_id gnl|my_center|LOCUS_20260 1024474 1024136 gene locus_tag LOCUS_20270 1024474 1024136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 1026866 1024593 gene locus_tag LOCUS_20280 1026866 1024593 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202543.1 protein_id gnl|my_center|LOCUS_20280 1027386 1026868 gene locus_tag LOCUS_20290 1027386 1026868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 1028670 1027393 gene locus_tag LOCUS_20300 1028670 1027393 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228748.1 protein_id gnl|my_center|LOCUS_20300 1029719 1028772 gene locus_tag LOCUS_20310 1029719 1028772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20310 1030277 1032628 gene locus_tag LOCUS_20320 1030277 1032628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 1032846 1033628 gene locus_tag LOCUS_20330 1032846 1033628 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941592.1 protein_id gnl|my_center|LOCUS_20330 1033625 1034380 gene locus_tag LOCUS_20340 1033625 1034380 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405214.1 protein_id gnl|my_center|LOCUS_20340 1034383 1035378 gene locus_tag LOCUS_20350 1034383 1035378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 1038784 1035719 gene locus_tag LOCUS_20360 1038784 1035719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 1040160 1039156 gene locus_tag LOCUS_20370 1040160 1039156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 1041252 1040257 gene locus_tag LOCUS_20380 1041252 1040257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 1041968 1041498 gene locus_tag LOCUS_20390 1041968 1041498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 1043051 1042083 gene locus_tag LOCUS_20400 1043051 1042083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 1043500 1043150 gene locus_tag LOCUS_20410 1043500 1043150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 1044927 1043689 gene locus_tag LOCUS_20420 1044927 1043689 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_20420 1045344 1045156 gene locus_tag LOCUS_20430 1045344 1045156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 1045728 1046903 gene locus_tag LOCUS_20440 1045728 1046903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 1047249 1048409 gene locus_tag LOCUS_20450 1047249 1048409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 1048866 1049444 gene locus_tag LOCUS_20460 1048866 1049444 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_20460 1049807 1050442 gene locus_tag LOCUS_20470 1049807 1050442 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705044.1 protein_id gnl|my_center|LOCUS_20470 1050450 1051889 gene locus_tag LOCUS_20480 1050450 1051889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 1051955 1052308 gene locus_tag LOCUS_20490 1051955 1052308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 1052993 1052364 gene locus_tag LOCUS_20500 1052993 1052364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 1053511 1052990 gene locus_tag LOCUS_20510 1053511 1052990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 1054435 1054809 gene locus_tag LOCUS_20520 1054435 1054809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 1054937 1056826 gene locus_tag LOCUS_20530 1054937 1056826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 1056884 1057342 gene locus_tag LOCUS_20540 1056884 1057342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 1058331 1059509 gene locus_tag LOCUS_20550 1058331 1059509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 1059533 1060918 gene locus_tag LOCUS_20560 1059533 1060918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 1061247 1061429 gene locus_tag LOCUS_20570 1061247 1061429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 1061408 1061986 gene locus_tag LOCUS_20580 1061408 1061986 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_20580 1062449 1062886 gene locus_tag LOCUS_20590 1062449 1062886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20590 1063349 1063786 gene locus_tag LOCUS_20600 1063349 1063786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20600 1064480 1064277 gene locus_tag LOCUS_20610 1064480 1064277 CDS product 2-oxoisovalerate dehydrogenase E1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545302.1 protein_id gnl|my_center|LOCUS_20610 1066015 1064858 gene locus_tag LOCUS_20620 gene hppD 1066015 1064858 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_20620 1067230 1066061 gene locus_tag LOCUS_20630 1067230 1066061 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962401.1 protein_id gnl|my_center|LOCUS_20630 1067565 1068377 gene locus_tag LOCUS_20640 1067565 1068377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 1068394 1070775 gene locus_tag LOCUS_20650 1068394 1070775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 1070952 1073960 gene locus_tag LOCUS_20660 1070952 1073960 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_20660 1073983 1074621 gene locus_tag LOCUS_20670 1073983 1074621 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226658.1 protein_id gnl|my_center|LOCUS_20670 1074625 1075851 gene locus_tag LOCUS_20680 1074625 1075851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 1075868 1077247 gene locus_tag LOCUS_20690 1075868 1077247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 1077292 1077891 gene locus_tag LOCUS_20700 1077292 1077891 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705044.1 protein_id gnl|my_center|LOCUS_20700 1078348 1078151 gene locus_tag LOCUS_20710 1078348 1078151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 1079909 1078707 gene locus_tag LOCUS_20720 1079909 1078707 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_20720 1080212 1080361 gene locus_tag LOCUS_20730 1080212 1080361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 1081206 1080472 gene locus_tag LOCUS_20740 1081206 1080472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 1082217 1081231 gene locus_tag LOCUS_20750 1082217 1081231 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328040.1 protein_id gnl|my_center|LOCUS_20750 1083144 1082254 gene locus_tag LOCUS_20760 1083144 1082254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 1086599 1083525 gene locus_tag LOCUS_20770 1086599 1083525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 1087142 1088179 gene locus_tag LOCUS_20780 1087142 1088179 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963799.1 protein_id gnl|my_center|LOCUS_20780 1088214 1088900 gene locus_tag LOCUS_20790 1088214 1088900 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721665.1 protein_id gnl|my_center|LOCUS_20790 1089518 1090345 gene locus_tag LOCUS_20800 1089518 1090345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 1090329 1091198 gene locus_tag LOCUS_20810 gene cysM 1090329 1091198 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532363.1 protein_id gnl|my_center|LOCUS_20810 1091614 1094310 gene locus_tag LOCUS_20820 1091614 1094310 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_20820 1094380 1095090 gene locus_tag LOCUS_20830 1094380 1095090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 1095555 1095124 gene locus_tag LOCUS_20840 1095555 1095124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 1097208 1097519 gene locus_tag LOCUS_20850 1097208 1097519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 1097523 1098242 gene locus_tag LOCUS_20860 1097523 1098242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 1098265 1098852 gene locus_tag LOCUS_20870 1098265 1098852 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963650.1 protein_id gnl|my_center|LOCUS_20870 1101246 1099168 gene locus_tag LOCUS_20880 1101246 1099168 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962595.1 protein_id gnl|my_center|LOCUS_20880 1101796 1101365 gene locus_tag LOCUS_20890 1101796 1101365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20890 1104121 1101860 gene locus_tag LOCUS_20900 1104121 1101860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 1104546 1104136 gene locus_tag LOCUS_20910 1104546 1104136 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795574.1 protein_id gnl|my_center|LOCUS_20910 1105307 1104753 gene locus_tag LOCUS_20920 1105307 1104753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 1106585 1105356 gene locus_tag LOCUS_20930 1106585 1105356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962254.1 protein_id gnl|my_center|LOCUS_20930 1107028 1106582 gene locus_tag LOCUS_20940 1107028 1106582 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962255.1 protein_id gnl|my_center|LOCUS_20940 1108199 1107030 gene locus_tag LOCUS_20950 1108199 1107030 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962256.1 protein_id gnl|my_center|LOCUS_20950 1108546 1108325 gene locus_tag LOCUS_20960 1108546 1108325 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527838.1 protein_id gnl|my_center|LOCUS_20960 1108808 1108608 gene locus_tag LOCUS_20970 1108808 1108608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 1109470 1109309 gene locus_tag LOCUS_20980 1109470 1109309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 1109700 1109503 gene locus_tag LOCUS_20990 1109700 1109503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 1110198 1109731 gene locus_tag LOCUS_21000 1110198 1109731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 1110744 1110265 gene locus_tag LOCUS_21010 1110744 1110265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 1111225 1110755 gene locus_tag LOCUS_21020 1111225 1110755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 1114540 1111421 gene locus_tag LOCUS_21030 1114540 1111421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21030 1115217 1114765 gene locus_tag LOCUS_21040 1115217 1114765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 1116370 1116297 gene locus_tag LOCUS_t00210 1116370 1116297 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1117168 1116722 gene locus_tag LOCUS_21050 1117168 1116722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21050 1117742 1117161 gene locus_tag LOCUS_21060 1117742 1117161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21060 1118257 1117769 gene locus_tag LOCUS_21070 1118257 1117769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21070 1121205 1118674 gene locus_tag LOCUS_21080 1121205 1118674 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403467.1 protein_id gnl|my_center|LOCUS_21080 1121912 1121211 gene locus_tag LOCUS_21090 1121912 1121211 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072831.1 protein_id gnl|my_center|LOCUS_21090 1121970 1122704 gene locus_tag LOCUS_21100 1121970 1122704 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839642.1 protein_id gnl|my_center|LOCUS_21100 1123690 1122890 gene locus_tag LOCUS_21110 1123690 1122890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 1125358 1124783 gene locus_tag LOCUS_21120 1125358 1124783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 1126747 1125506 gene locus_tag LOCUS_21130 1126747 1125506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 1127826 1126813 gene locus_tag LOCUS_21140 1127826 1126813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 1128282 1127827 gene locus_tag LOCUS_21150 1128282 1127827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 1129335 1128625 gene locus_tag LOCUS_21160 1129335 1128625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 1129966 1129340 gene locus_tag LOCUS_21170 1129966 1129340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 1131169 1130855 gene locus_tag LOCUS_21180 1131169 1130855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 1131402 1131160 gene locus_tag LOCUS_21190 1131402 1131160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 1132079 1131540 gene locus_tag LOCUS_21200 1132079 1131540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 1132839 1132654 gene locus_tag LOCUS_21210 1132839 1132654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 1134173 1133133 gene locus_tag LOCUS_21220 1134173 1133133 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254572.1 protein_id gnl|my_center|LOCUS_21220 1135228 1134779 gene locus_tag LOCUS_21230 1135228 1134779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 1137225 1135699 gene locus_tag LOCUS_21240 1137225 1135699 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787651.1 protein_id gnl|my_center|LOCUS_21240 1138198 1137509 gene locus_tag LOCUS_21250 gene can 1138198 1137509 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964129.1 protein_id gnl|my_center|LOCUS_21250 1138420 1138971 gene locus_tag LOCUS_21260 1138420 1138971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 1139043 1139750 gene locus_tag LOCUS_21270 1139043 1139750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 1139811 1140023 gene locus_tag LOCUS_21280 1139811 1140023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21280 1140356 1143457 gene locus_tag LOCUS_21290 1140356 1143457 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_21290 1143660 1145036 gene locus_tag LOCUS_21300 1143660 1145036 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767657.1 protein_id gnl|my_center|LOCUS_21300 1145148 1146437 gene locus_tag LOCUS_21310 1145148 1146437 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_21310 1148703 1146445 gene locus_tag LOCUS_21320 1148703 1146445 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202543.1 protein_id gnl|my_center|LOCUS_21320 1150680 1148731 gene locus_tag LOCUS_21330 1150680 1148731 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330748.1 protein_id gnl|my_center|LOCUS_21330 1150879 1152216 gene locus_tag LOCUS_21340 1150879 1152216 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 protein_id gnl|my_center|LOCUS_21340 1152279 1153346 gene locus_tag LOCUS_21350 1152279 1153346 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793311.1 protein_id gnl|my_center|LOCUS_21350 1153401 1154339 gene locus_tag LOCUS_21360 1153401 1154339 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933746.1 protein_id gnl|my_center|LOCUS_21360 1155686 1154385 gene locus_tag LOCUS_21370 1155686 1154385 CDS product cystathionine gamma-synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259114.1 protein_id gnl|my_center|LOCUS_21370 1155889 1156350 gene locus_tag LOCUS_21380 1155889 1156350 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763774.1 protein_id gnl|my_center|LOCUS_21380 1156386 1156859 gene locus_tag LOCUS_21390 1156386 1156859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 1157089 1157943 gene locus_tag LOCUS_21400 1157089 1157943 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 protein_id gnl|my_center|LOCUS_21400 1158072 1158611 gene locus_tag LOCUS_21410 1158072 1158611 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263911.1 protein_id gnl|my_center|LOCUS_21410 1162199 1158627 gene locus_tag LOCUS_21420 1162199 1158627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 1162369 1163808 gene locus_tag LOCUS_21430 1162369 1163808 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196631.1 protein_id gnl|my_center|LOCUS_21430 1163821 1165437 gene locus_tag LOCUS_21440 1163821 1165437 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_21440 1165564 1166499 gene locus_tag LOCUS_21450 1165564 1166499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 1166605 1167732 gene locus_tag LOCUS_21460 1166605 1167732 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_21460 1169037 1167799 gene locus_tag LOCUS_21470 1169037 1167799 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921846.1 protein_id gnl|my_center|LOCUS_21470 1170073 1169126 gene locus_tag LOCUS_21480 1170073 1169126 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975158.1 protein_id gnl|my_center|LOCUS_21480 1171605 1170049 gene locus_tag LOCUS_21490 1171605 1170049 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206892.1 protein_id gnl|my_center|LOCUS_21490 1172520 1171618 gene locus_tag LOCUS_21500 1172520 1171618 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389819.1 protein_id gnl|my_center|LOCUS_21500 1173895 1172654 gene locus_tag LOCUS_21510 1173895 1172654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 1174449 1174048 gene locus_tag LOCUS_21520 gene mscL 1174449 1174048 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027547170.1 protein_id gnl|my_center|LOCUS_21520 1176873 1174600 gene locus_tag LOCUS_21530 1176873 1174600 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_21530 1177330 1177935 gene locus_tag LOCUS_21540 1177330 1177935 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_21540 1178457 1180175 gene locus_tag LOCUS_21550 1178457 1180175 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109110.1 protein_id gnl|my_center|LOCUS_21550 1183708 1180211 gene locus_tag LOCUS_21560 1183708 1180211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962474.1 protein_id gnl|my_center|LOCUS_21560 1184048 1186927 gene locus_tag LOCUS_21570 gene gcvP 1184048 1186927 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963500.1 protein_id gnl|my_center|LOCUS_21570 1187615 1187007 gene locus_tag LOCUS_21580 1187615 1187007 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785759.1 protein_id gnl|my_center|LOCUS_21580 1188855 1187917 gene locus_tag LOCUS_21590 1188855 1187917 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_21590 1189035 1189937 gene locus_tag LOCUS_21600 1189035 1189937 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037769.1 protein_id gnl|my_center|LOCUS_21600 1189940 1190575 gene locus_tag LOCUS_21610 1189940 1190575 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_21610 1190627 1191745 gene locus_tag LOCUS_21620 1190627 1191745 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 protein_id gnl|my_center|LOCUS_21620 1191766 1192143 gene locus_tag LOCUS_21630 1191766 1192143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 1194585 1192216 gene locus_tag LOCUS_21640 1194585 1192216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 >Feature sequence03 1352 1026 gene locus_tag LOCUS_21650 1352 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 2275 2820 gene locus_tag LOCUS_21660 2275 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21660 2792 3577 gene locus_tag LOCUS_21670 2792 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21670 3587 3841 gene locus_tag LOCUS_21680 3587 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21680 3867 4079 gene locus_tag LOCUS_21690 3867 4079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21690 4120 4647 gene locus_tag LOCUS_21700 4120 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21700 4797 5108 gene locus_tag LOCUS_21710 4797 5108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 5491 6048 gene locus_tag LOCUS_21720 5491 6048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21720 6799 6038 gene locus_tag LOCUS_21730 gene kdsA 6799 6038 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759991.1 protein_id gnl|my_center|LOCUS_21730 7425 6979 gene locus_tag LOCUS_21740 gene rplI 7425 6979 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759741.1 protein_id gnl|my_center|LOCUS_21740 7708 7442 gene locus_tag LOCUS_21750 gene rpsR 7708 7442 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759740.1 protein_id gnl|my_center|LOCUS_21750 8258 7737 gene locus_tag LOCUS_21760 8258 7737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 8691 8329 gene locus_tag LOCUS_21770 gene rplS 8691 8329 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778830.1 protein_id gnl|my_center|LOCUS_21770 9386 8781 gene locus_tag LOCUS_21780 9386 8781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 11040 9478 gene locus_tag LOCUS_21790 11040 9478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 13489 11249 gene locus_tag LOCUS_21800 13489 11249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 14863 13550 gene locus_tag LOCUS_21810 gene rimO 14863 13550 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963524.1 protein_id gnl|my_center|LOCUS_21810 14988 17417 gene locus_tag LOCUS_21820 14988 17417 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454344.1 protein_id gnl|my_center|LOCUS_21820 17498 17770 gene locus_tag LOCUS_21830 17498 17770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 17777 18688 gene locus_tag LOCUS_21840 17777 18688 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 protein_id gnl|my_center|LOCUS_21840 20056 18713 gene locus_tag LOCUS_21850 20056 18713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 20625 20068 gene locus_tag LOCUS_21860 20625 20068 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_21860 22886 20643 gene locus_tag LOCUS_21870 22886 20643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 24441 23743 gene locus_tag LOCUS_21880 24441 23743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 26310 24601 gene locus_tag LOCUS_21890 gene gldG 26310 24601 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_21890 27034 26336 gene locus_tag LOCUS_21900 gene gldF 27034 26336 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_21900 27555 27031 gene locus_tag LOCUS_21910 27555 27031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21910 27947 27456 gene locus_tag LOCUS_21920 27947 27456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21920 28709 28080 gene locus_tag LOCUS_21930 gene msrA 28709 28080 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013187310.1 protein_id gnl|my_center|LOCUS_21930 32363 28935 gene locus_tag LOCUS_21940 32363 28935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 32851 33171 gene locus_tag LOCUS_21950 32851 33171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 34250 33168 gene locus_tag LOCUS_21960 34250 33168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 35415 34312 gene locus_tag LOCUS_21970 35415 34312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 36450 35461 gene locus_tag LOCUS_21980 36450 35461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 37033 40041 gene locus_tag LOCUS_21990 37033 40041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 40200 40970 gene locus_tag LOCUS_22000 40200 40970 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_22000 41791 42090 gene locus_tag LOCUS_22010 41791 42090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 42162 42437 gene locus_tag LOCUS_22020 42162 42437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 42376 42555 gene locus_tag LOCUS_22030 42376 42555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 42774 43091 gene locus_tag LOCUS_22040 42774 43091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 43099 43704 gene locus_tag LOCUS_22050 43099 43704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 44664 43834 gene locus_tag LOCUS_22060 44664 43834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 46520 45588 gene locus_tag LOCUS_22070 46520 45588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 47345 46710 gene locus_tag LOCUS_22080 47345 46710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 48215 47364 gene locus_tag LOCUS_22090 48215 47364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 49592 48759 gene locus_tag LOCUS_22100 49592 48759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 50702 50187 gene locus_tag LOCUS_22110 gene rimM 50702 50187 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962516.1 protein_id gnl|my_center|LOCUS_22110 51456 50707 gene locus_tag LOCUS_22120 51456 50707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 52637 51537 gene locus_tag LOCUS_22130 gene mnmA 52637 51537 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405206.1 protein_id gnl|my_center|LOCUS_22130 52872 53627 gene locus_tag LOCUS_22140 52872 53627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 53606 53755 gene locus_tag LOCUS_22150 53606 53755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 56186 55800 gene locus_tag LOCUS_22160 56186 55800 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077414893.1 protein_id gnl|my_center|LOCUS_22160 56709 56254 gene locus_tag LOCUS_22170 56709 56254 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027268.1 protein_id gnl|my_center|LOCUS_22170 57225 56722 gene locus_tag LOCUS_22180 57225 56722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 59292 57820 gene locus_tag LOCUS_22190 59292 57820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 59726 59502 gene locus_tag LOCUS_22200 59726 59502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 61292 59937 gene locus_tag LOCUS_22210 61292 59937 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681529.1 protein_id gnl|my_center|LOCUS_22210 62102 61722 gene locus_tag LOCUS_22220 62102 61722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 62521 62186 gene locus_tag LOCUS_22230 62521 62186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 65620 65853 gene locus_tag LOCUS_22240 65620 65853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 66228 66977 gene locus_tag LOCUS_22250 66228 66977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 68135 67752 gene locus_tag LOCUS_22260 68135 67752 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077414893.1 protein_id gnl|my_center|LOCUS_22260 70256 69309 gene locus_tag LOCUS_22270 70256 69309 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759891.1 protein_id gnl|my_center|LOCUS_22270 70688 70263 gene locus_tag LOCUS_22280 70688 70263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 70864 70685 gene locus_tag LOCUS_22290 70864 70685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 70961 73060 gene locus_tag LOCUS_22300 70961 73060 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108091.1 protein_id gnl|my_center|LOCUS_22300 73066 74400 gene locus_tag LOCUS_22310 gene purB 73066 74400 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963912.1 protein_id gnl|my_center|LOCUS_22310 74404 75351 gene locus_tag LOCUS_22320 74404 75351 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360255.1 protein_id gnl|my_center|LOCUS_22320 75357 76037 gene locus_tag LOCUS_22330 75357 76037 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_22330 76839 76162 gene locus_tag LOCUS_22340 76839 76162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 77883 76879 gene locus_tag LOCUS_22350 77883 76879 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393185.1 protein_id gnl|my_center|LOCUS_22350 78048 78938 gene locus_tag LOCUS_22360 78048 78938 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_22360 79101 80027 gene locus_tag LOCUS_22370 79101 80027 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862451.1 protein_id gnl|my_center|LOCUS_22370 80154 81182 gene locus_tag LOCUS_22380 80154 81182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 81197 83464 gene locus_tag LOCUS_22390 81197 83464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 83437 83634 gene locus_tag LOCUS_22400 83437 83634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 83663 87880 gene locus_tag LOCUS_22410 83663 87880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 88602 87946 gene locus_tag LOCUS_22420 88602 87946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 89031 88603 gene locus_tag LOCUS_22430 89031 88603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 89468 88998 gene locus_tag LOCUS_22440 89468 88998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 89642 90628 gene locus_tag LOCUS_22450 89642 90628 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028525108.1 protein_id gnl|my_center|LOCUS_22450 90660 91178 gene locus_tag LOCUS_22460 gene ribE 90660 91178 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152414.1 protein_id gnl|my_center|LOCUS_22460 91253 92107 gene locus_tag LOCUS_22470 91253 92107 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_22470 92110 92988 gene locus_tag LOCUS_22480 92110 92988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 92990 93580 gene locus_tag LOCUS_22490 92990 93580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 93634 94203 gene locus_tag LOCUS_22500 93634 94203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 94468 96183 gene locus_tag LOCUS_22510 94468 96183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 96272 97921 gene locus_tag LOCUS_22520 gene glgP 96272 97921 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871155.1 protein_id gnl|my_center|LOCUS_22520 98283 97942 gene locus_tag LOCUS_22530 98283 97942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 98390 98980 gene locus_tag LOCUS_22540 98390 98980 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767733.1 protein_id gnl|my_center|LOCUS_22540 98970 99377 gene locus_tag LOCUS_22550 98970 99377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 100389 99553 gene locus_tag LOCUS_22560 100389 99553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 101202 100618 gene locus_tag LOCUS_22570 101202 100618 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119755.1 protein_id gnl|my_center|LOCUS_22570 103019 101199 gene locus_tag LOCUS_22580 103019 101199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22580 104554 102962 gene locus_tag LOCUS_22590 104554 102962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22590 104773 105489 gene locus_tag LOCUS_22600 104773 105489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 105521 106345 gene locus_tag LOCUS_22610 105521 106345 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941121.1 protein_id gnl|my_center|LOCUS_22610 108238 106460 gene locus_tag LOCUS_22620 gene typA 108238 106460 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108480.1 protein_id gnl|my_center|LOCUS_22620 109993 108260 gene locus_tag LOCUS_22630 109993 108260 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108753.1 protein_id gnl|my_center|LOCUS_22630 110832 110161 gene locus_tag LOCUS_22640 110832 110161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22640 111562 112431 gene locus_tag LOCUS_22650 111562 112431 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787896.1 protein_id gnl|my_center|LOCUS_22650 112551 113351 gene locus_tag LOCUS_22660 112551 113351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 113348 114016 gene locus_tag LOCUS_22670 gene mqnB 113348 114016 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941120.1 protein_id gnl|my_center|LOCUS_22670 114811 114062 gene locus_tag LOCUS_22680 114811 114062 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963855.1 protein_id gnl|my_center|LOCUS_22680 115449 114760 gene locus_tag LOCUS_22690 115449 114760 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963856.1 protein_id gnl|my_center|LOCUS_22690 117041 115461 gene locus_tag LOCUS_22700 gene pckA 117041 115461 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405091.1 protein_id gnl|my_center|LOCUS_22700 119019 117166 gene locus_tag LOCUS_22710 119019 117166 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062080.1 protein_id gnl|my_center|LOCUS_22710 119556 119053 gene locus_tag LOCUS_22720 119556 119053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 122763 119638 gene locus_tag LOCUS_22730 122763 119638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 124898 122832 gene locus_tag LOCUS_22740 124898 122832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 125325 125714 gene locus_tag LOCUS_22750 gene tsaE 125325 125714 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784762.1 protein_id gnl|my_center|LOCUS_22750 125748 126977 gene locus_tag LOCUS_22760 125748 126977 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_22760 126993 127541 gene locus_tag LOCUS_22770 126993 127541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 128120 127548 gene locus_tag LOCUS_22780 128120 127548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 129530 128202 gene locus_tag LOCUS_22790 129530 128202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 130246 129581 gene locus_tag LOCUS_22800 130246 129581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 130464 131528 gene locus_tag LOCUS_22810 130464 131528 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 protein_id gnl|my_center|LOCUS_22810 131750 132697 gene locus_tag LOCUS_22820 131750 132697 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_22820 132704 133909 gene locus_tag LOCUS_22830 gene kbl 132704 133909 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962334.1 protein_id gnl|my_center|LOCUS_22830 134586 134092 gene locus_tag LOCUS_22840 gene lrp 134586 134092 CDS product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005664572.1 protein_id gnl|my_center|LOCUS_22840 136328 134907 gene locus_tag LOCUS_22850 136328 134907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 136882 136529 gene locus_tag LOCUS_22860 136882 136529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 136977 137825 gene locus_tag LOCUS_22870 136977 137825 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920701.1 protein_id gnl|my_center|LOCUS_22870 138028 137942 gene locus_tag LOCUS_t00220 138028 137942 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 138186 139970 gene locus_tag LOCUS_22880 138186 139970 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_22880 139973 141259 gene locus_tag LOCUS_22890 139973 141259 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_22890 141318 141881 gene locus_tag LOCUS_22900 141318 141881 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869594.1 protein_id gnl|my_center|LOCUS_22900 141989 143197 gene locus_tag LOCUS_22910 141989 143197 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_22910 143194 144948 gene locus_tag LOCUS_22920 143194 144948 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_22920 148162 145439 gene locus_tag LOCUS_22930 148162 145439 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091514757.1 protein_id gnl|my_center|LOCUS_22930 148803 150014 gene locus_tag LOCUS_22940 148803 150014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22940 149999 151246 gene locus_tag LOCUS_22950 149999 151246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22950 151277 151588 gene locus_tag LOCUS_22960 151277 151588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 151590 151883 gene locus_tag LOCUS_22970 151590 151883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 151987 153636 gene locus_tag LOCUS_22980 gene rny 151987 153636 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790424.1 protein_id gnl|my_center|LOCUS_22980 153668 155152 gene locus_tag LOCUS_22990 gene cysS 153668 155152 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962759.1 protein_id gnl|my_center|LOCUS_22990 155158 155727 gene locus_tag LOCUS_23000 155158 155727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23000 155799 156146 gene locus_tag LOCUS_23010 155799 156146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23010 156248 157285 gene locus_tag LOCUS_23020 156248 157285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 160014 157351 gene locus_tag LOCUS_23030 gene mutS 160014 157351 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962564.1 protein_id gnl|my_center|LOCUS_23030 160529 160074 gene locus_tag LOCUS_23040 160529 160074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 162740 160584 gene locus_tag LOCUS_23050 162740 160584 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693189.1 protein_id gnl|my_center|LOCUS_23050 163210 162788 gene locus_tag LOCUS_23060 163210 162788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 163421 164452 gene locus_tag LOCUS_23070 163421 164452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 164505 166316 gene locus_tag LOCUS_23080 164505 166316 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942647.1 protein_id gnl|my_center|LOCUS_23080 166856 166383 gene locus_tag LOCUS_23090 166856 166383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 172335 166837 gene locus_tag LOCUS_23100 172335 166837 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122194.1 protein_id gnl|my_center|LOCUS_23100 173274 172552 gene locus_tag LOCUS_23110 173274 172552 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_23110 173540 173902 gene locus_tag LOCUS_23120 173540 173902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23120 173968 175218 gene locus_tag LOCUS_23130 173968 175218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23130 175602 175255 gene locus_tag LOCUS_23140 175602 175255 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_23140 175862 177178 gene locus_tag LOCUS_23150 175862 177178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 177835 178281 gene locus_tag LOCUS_23160 177835 178281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 178678 178343 gene locus_tag LOCUS_23170 178678 178343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 181225 178772 gene locus_tag LOCUS_23180 181225 178772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 181800 183770 gene locus_tag LOCUS_23190 181800 183770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 183897 184901 gene locus_tag LOCUS_23200 183897 184901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23200 184793 185143 gene locus_tag LOCUS_23210 184793 185143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23210 185171 185653 gene locus_tag LOCUS_23220 185171 185653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 185698 186216 gene locus_tag LOCUS_23230 185698 186216 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783878.1 protein_id gnl|my_center|LOCUS_23230 186285 186764 gene locus_tag LOCUS_23240 186285 186764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769198.1 protein_id gnl|my_center|LOCUS_23240 186853 187329 gene locus_tag LOCUS_23250 186853 187329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 187440 187946 gene locus_tag LOCUS_23260 187440 187946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 188054 188548 gene locus_tag LOCUS_23270 188054 188548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 189259 188522 gene locus_tag LOCUS_23280 gene folE 189259 188522 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962758.1 protein_id gnl|my_center|LOCUS_23280 189484 190155 gene locus_tag LOCUS_23290 gene rpe 189484 190155 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964149.1 protein_id gnl|my_center|LOCUS_23290 190183 192705 gene locus_tag LOCUS_23300 190183 192705 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_23300 192801 193478 gene locus_tag LOCUS_23310 192801 193478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23310 193445 193906 gene locus_tag LOCUS_23320 193445 193906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 194044 195270 gene locus_tag LOCUS_23330 194044 195270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 195379 196752 gene locus_tag LOCUS_23340 gene nhaD 195379 196752 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966224.1 protein_id gnl|my_center|LOCUS_23340 197835 198035 gene locus_tag LOCUS_23350 197835 198035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 199208 198246 gene locus_tag LOCUS_23360 199208 198246 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079544.1 protein_id gnl|my_center|LOCUS_23360 199573 199403 gene locus_tag LOCUS_23370 199573 199403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 201374 199710 gene locus_tag LOCUS_23380 201374 199710 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964580.1 protein_id gnl|my_center|LOCUS_23380 203238 201391 gene locus_tag LOCUS_23390 gene argS 203238 201391 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765307.1 protein_id gnl|my_center|LOCUS_23390 204220 203249 gene locus_tag LOCUS_23400 204220 203249 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081007.1 protein_id gnl|my_center|LOCUS_23400 205334 204225 gene locus_tag LOCUS_23410 205334 204225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23410 206853 205339 gene locus_tag LOCUS_23420 206853 205339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23420 207461 206850 gene locus_tag LOCUS_23430 207461 206850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 208747 207485 gene locus_tag LOCUS_23440 gene lysA 208747 207485 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_23440 210091 208850 gene locus_tag LOCUS_23450 210091 208850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 211140 210205 gene locus_tag LOCUS_23460 211140 210205 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_23460 211353 211718 gene locus_tag LOCUS_23470 211353 211718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 211950 211876 gene locus_tag LOCUS_t00230 211950 211876 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 213058 212009 gene locus_tag LOCUS_23480 gene pdxA 213058 212009 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785465.1 protein_id gnl|my_center|LOCUS_23480 213358 213891 gene locus_tag LOCUS_23490 213358 213891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 216206 213966 gene locus_tag LOCUS_23500 216206 213966 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055269995.1 protein_id gnl|my_center|LOCUS_23500 217620 216286 gene locus_tag LOCUS_23510 217620 216286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23510 218756 217620 gene locus_tag LOCUS_23520 218756 217620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23520 220029 218779 gene locus_tag LOCUS_23530 gene purD 220029 218779 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964560.1 protein_id gnl|my_center|LOCUS_23530 220584 220174 gene locus_tag LOCUS_23540 220584 220174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 220884 223043 gene locus_tag LOCUS_23550 220884 223043 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138432165.1 protein_id gnl|my_center|LOCUS_23550 223147 223998 gene locus_tag LOCUS_23560 223147 223998 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 protein_id gnl|my_center|LOCUS_23560 224309 225712 gene locus_tag LOCUS_23570 224309 225712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 225917 227785 gene locus_tag LOCUS_23580 225917 227785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 228862 227813 gene locus_tag LOCUS_23590 228862 227813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 229346 231574 gene locus_tag LOCUS_23600 229346 231574 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480716.1 protein_id gnl|my_center|LOCUS_23600 231679 232080 gene locus_tag LOCUS_23610 231679 232080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 232548 232087 gene locus_tag LOCUS_23620 232548 232087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 233090 234391 gene locus_tag LOCUS_23630 233090 234391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 234576 234785 gene locus_tag LOCUS_23640 234576 234785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 235861 235361 gene locus_tag LOCUS_23650 235861 235361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 236075 236635 gene locus_tag LOCUS_23660 236075 236635 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_23660 236628 237398 gene locus_tag LOCUS_23670 236628 237398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 237430 238485 gene locus_tag LOCUS_23680 237430 238485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964174.1 protein_id gnl|my_center|LOCUS_23680 239410 238532 gene locus_tag LOCUS_23690 239410 238532 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963966.1 protein_id gnl|my_center|LOCUS_23690 241281 239422 gene locus_tag LOCUS_23700 241281 239422 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 protein_id gnl|my_center|LOCUS_23700 242295 241336 gene locus_tag LOCUS_23710 242295 241336 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963714.1 protein_id gnl|my_center|LOCUS_23710 242461 242799 gene locus_tag LOCUS_23720 242461 242799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 243026 245050 gene locus_tag LOCUS_23730 243026 245050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 245280 245086 gene locus_tag LOCUS_23740 245280 245086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 245552 245316 gene locus_tag LOCUS_23750 245552 245316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23750 246088 245774 gene locus_tag LOCUS_23760 246088 245774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23760 246288 246707 gene locus_tag LOCUS_23770 246288 246707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 246640 247488 gene locus_tag LOCUS_23780 246640 247488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 249729 247621 gene locus_tag LOCUS_23790 249729 247621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23790 250469 249726 gene locus_tag LOCUS_23800 250469 249726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 250923 251180 gene locus_tag LOCUS_23810 250923 251180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 251186 251608 gene locus_tag LOCUS_23820 251186 251608 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666459.1 protein_id gnl|my_center|LOCUS_23820 252062 251628 gene locus_tag LOCUS_23830 252062 251628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 252801 252016 gene locus_tag LOCUS_23840 252801 252016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 253336 252935 gene locus_tag LOCUS_23850 253336 252935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 253892 253431 gene locus_tag LOCUS_23860 253892 253431 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939136.1 protein_id gnl|my_center|LOCUS_23860 254410 254018 gene locus_tag LOCUS_23870 254410 254018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 255930 257234 gene locus_tag LOCUS_23880 255930 257234 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361992.1 protein_id gnl|my_center|LOCUS_23880 257239 258051 gene locus_tag LOCUS_23890 257239 258051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 258138 258443 gene locus_tag LOCUS_23900 258138 258443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 258424 258879 gene locus_tag LOCUS_23910 258424 258879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962787.1 protein_id gnl|my_center|LOCUS_23910 258872 259591 gene locus_tag LOCUS_23920 258872 259591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962786.1 protein_id gnl|my_center|LOCUS_23920 259542 259712 gene locus_tag LOCUS_23930 259542 259712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 259814 260086 gene locus_tag LOCUS_23940 259814 260086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 260094 260366 gene locus_tag LOCUS_23950 260094 260366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 260385 260681 gene locus_tag LOCUS_23960 260385 260681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 260762 260887 gene locus_tag LOCUS_23970 260762 260887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 261054 261398 gene locus_tag LOCUS_23980 261054 261398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 261745 261455 gene locus_tag LOCUS_23990 261745 261455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 262227 261793 gene locus_tag LOCUS_24000 262227 261793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 262571 262499 gene locus_tag LOCUS_t00240 262571 262499 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 262748 264178 gene locus_tag LOCUS_24010 gene glgA 262748 264178 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546574.1 protein_id gnl|my_center|LOCUS_24010 265507 264173 gene locus_tag LOCUS_24020 265507 264173 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964430.1 protein_id gnl|my_center|LOCUS_24020 266556 265504 gene locus_tag LOCUS_24030 gene fni 266556 265504 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599487.1 protein_id gnl|my_center|LOCUS_24030 266731 267846 gene locus_tag LOCUS_24040 266731 267846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 268480 267929 gene locus_tag LOCUS_24050 268480 267929 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577498.1 protein_id gnl|my_center|LOCUS_24050 268951 268559 gene locus_tag LOCUS_24060 268951 268559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 269451 269095 gene locus_tag LOCUS_24070 269451 269095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 269667 270467 gene locus_tag LOCUS_24080 269667 270467 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775707.1 protein_id gnl|my_center|LOCUS_24080 270595 271026 gene locus_tag LOCUS_24090 270595 271026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 271036 271449 gene locus_tag LOCUS_24100 271036 271449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 271482 272234 gene locus_tag LOCUS_24110 271482 272234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 272388 273539 gene locus_tag LOCUS_24120 272388 273539 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_24120 273554 274180 gene locus_tag LOCUS_24130 273554 274180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24130 274177 274533 gene locus_tag LOCUS_24140 274177 274533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24140 274756 277218 gene locus_tag LOCUS_24150 274756 277218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 278240 277539 gene locus_tag LOCUS_24160 gene deoD 278240 277539 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681557.1 protein_id gnl|my_center|LOCUS_24160 280637 278259 gene locus_tag LOCUS_24170 280637 278259 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173615039.1 protein_id gnl|my_center|LOCUS_24170 281662 280655 gene locus_tag LOCUS_24180 gene deoC 281662 280655 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974219.1 protein_id gnl|my_center|LOCUS_24180 282981 281686 gene locus_tag LOCUS_24190 282981 281686 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986425.1 protein_id gnl|my_center|LOCUS_24190 283158 285785 gene locus_tag LOCUS_24200 283158 285785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 285897 286538 gene locus_tag LOCUS_24210 285897 286538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 286909 286553 gene locus_tag LOCUS_24220 286909 286553 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053204416.1 protein_id gnl|my_center|LOCUS_24220 289679 286989 gene locus_tag LOCUS_24230 289679 286989 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143241.1 protein_id gnl|my_center|LOCUS_24230 290124 289684 gene locus_tag LOCUS_24240 290124 289684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 290596 290264 gene locus_tag LOCUS_24250 290596 290264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 290801 290586 gene locus_tag LOCUS_24260 290801 290586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 292066 290876 gene locus_tag LOCUS_24270 gene dinB 292066 290876 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937382.1 protein_id gnl|my_center|LOCUS_24270 292355 293467 gene locus_tag LOCUS_24280 292355 293467 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113032.1 protein_id gnl|my_center|LOCUS_24280 294137 293478 gene locus_tag LOCUS_24290 294137 293478 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694124.1 protein_id gnl|my_center|LOCUS_24290 294419 294162 gene locus_tag LOCUS_24300 gene sdpR 294419 294162 CDS product sporulation delaying system autorepressor SdpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243541.1 protein_id gnl|my_center|LOCUS_24300 294623 295381 gene locus_tag LOCUS_24310 294623 295381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 295456 296385 gene locus_tag LOCUS_24320 295456 296385 CDS product DUF2279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963344.1 protein_id gnl|my_center|LOCUS_24320 296594 296863 gene locus_tag LOCUS_24330 296594 296863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24330 296913 299123 gene locus_tag LOCUS_24340 296913 299123 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766433.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24340 299202 300710 gene locus_tag LOCUS_24350 299202 300710 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928910.1 protein_id gnl|my_center|LOCUS_24350 300797 301249 gene locus_tag LOCUS_24360 300797 301249 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531786.1 protein_id gnl|my_center|LOCUS_24360 303512 301293 gene locus_tag LOCUS_24370 303512 301293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 304480 303671 gene locus_tag LOCUS_24380 gene mazG 304480 303671 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_24380 305589 304513 gene locus_tag LOCUS_24390 305589 304513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24390 306614 305586 gene locus_tag LOCUS_24400 306614 305586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24400 307989 306649 gene locus_tag LOCUS_24410 gene ffh 307989 306649 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789195.1 protein_id gnl|my_center|LOCUS_24410 308896 308264 gene locus_tag LOCUS_24420 gene queE 308896 308264 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189241.1 protein_id gnl|my_center|LOCUS_24420 309284 308904 gene locus_tag LOCUS_24430 309284 308904 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_24430 309921 309325 gene locus_tag LOCUS_24440 309921 309325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 310508 309918 gene locus_tag LOCUS_24450 310508 309918 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966335.1 protein_id gnl|my_center|LOCUS_24450 310863 311120 gene locus_tag LOCUS_24460 310863 311120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 311191 311511 gene locus_tag LOCUS_24470 311191 311511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 311537 312556 gene locus_tag LOCUS_24480 311537 312556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 312598 312825 gene locus_tag LOCUS_24490 312598 312825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 312818 314239 gene locus_tag LOCUS_24500 312818 314239 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827171.1 protein_id gnl|my_center|LOCUS_24500 314479 314553 gene locus_tag LOCUS_t00250 314479 314553 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 314592 315128 gene locus_tag LOCUS_24510 314592 315128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 315257 315568 gene locus_tag LOCUS_24520 315257 315568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 315604 316230 gene locus_tag LOCUS_24530 315604 316230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 318045 316393 gene locus_tag LOCUS_24540 318045 316393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 320450 318336 gene locus_tag LOCUS_24550 gene ligA 320450 318336 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880378.1 protein_id gnl|my_center|LOCUS_24550 320659 320462 gene locus_tag LOCUS_24560 320659 320462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 321603 320833 gene locus_tag LOCUS_24570 321603 320833 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962360.1 protein_id gnl|my_center|LOCUS_24570 323638 321593 gene locus_tag LOCUS_24580 gene paaZ 323638 321593 CDS product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186481.1 protein_id gnl|my_center|LOCUS_24580 325365 323944 gene locus_tag LOCUS_24590 325365 323944 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964144.1 protein_id gnl|my_center|LOCUS_24590 325873 328068 gene locus_tag LOCUS_24600 325873 328068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 332695 328313 gene locus_tag LOCUS_24610 332695 328313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 333236 334633 gene locus_tag LOCUS_24620 gene lpdA 333236 334633 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_24620 334756 335205 gene locus_tag LOCUS_24630 334756 335205 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962868.1 protein_id gnl|my_center|LOCUS_24630 336812 335337 gene locus_tag LOCUS_24640 336812 335337 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188467563.1 protein_id gnl|my_center|LOCUS_24640 339208 336923 gene locus_tag LOCUS_24650 339208 336923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 339503 342238 gene locus_tag LOCUS_24660 339503 342238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 342843 342388 gene locus_tag LOCUS_24670 342843 342388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 343937 342840 gene locus_tag LOCUS_24680 343937 342840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 344347 344168 gene locus_tag LOCUS_24690 344347 344168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 344916 344365 gene locus_tag LOCUS_24700 344916 344365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 345802 345050 gene locus_tag LOCUS_24710 345802 345050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 346685 345936 gene locus_tag LOCUS_24720 346685 345936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 347909 346845 gene locus_tag LOCUS_24730 gene ruvB 347909 346845 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964224.1 protein_id gnl|my_center|LOCUS_24730 348286 347933 gene locus_tag LOCUS_24740 348286 347933 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404070.1 protein_id gnl|my_center|LOCUS_24740 348423 348935 gene locus_tag LOCUS_24750 348423 348935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 348949 349698 gene locus_tag LOCUS_24760 348949 349698 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763633.1 protein_id gnl|my_center|LOCUS_24760 349708 350625 gene locus_tag LOCUS_24770 349708 350625 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963938.1 protein_id gnl|my_center|LOCUS_24770 350755 351222 gene locus_tag LOCUS_24780 350755 351222 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418035.1 protein_id gnl|my_center|LOCUS_24780 351233 352390 gene locus_tag LOCUS_24790 351233 352390 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962401.1 protein_id gnl|my_center|LOCUS_24790 352417 353541 gene locus_tag LOCUS_24800 gene hppD 352417 353541 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838760.1 protein_id gnl|my_center|LOCUS_24800 354492 353560 gene locus_tag LOCUS_24810 354492 353560 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114699.1 protein_id gnl|my_center|LOCUS_24810 354820 354626 gene locus_tag LOCUS_24820 gene rpsU 354820 354626 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963322.1 protein_id gnl|my_center|LOCUS_24820 356084 354981 gene locus_tag LOCUS_24830 356084 354981 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_24830 356914 356177 gene locus_tag LOCUS_24840 356914 356177 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963001.1 protein_id gnl|my_center|LOCUS_24840 358213 356939 gene locus_tag LOCUS_24850 358213 356939 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403955.1 protein_id gnl|my_center|LOCUS_24850 358965 359783 gene locus_tag LOCUS_24860 358965 359783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 360237 360902 gene locus_tag LOCUS_24870 360237 360902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 363084 361120 gene locus_tag LOCUS_24880 363084 361120 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962188.1 protein_id gnl|my_center|LOCUS_24880 363383 363093 gene locus_tag LOCUS_24890 363383 363093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24890 363957 363625 gene locus_tag LOCUS_24900 363957 363625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24900 364542 363964 gene locus_tag LOCUS_24910 364542 363964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24910 365167 365943 gene locus_tag LOCUS_24920 365167 365943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 367150 367485 gene locus_tag LOCUS_24930 367150 367485 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766756.1 protein_id gnl|my_center|LOCUS_24930 367475 367774 gene locus_tag LOCUS_24940 367475 367774 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851388.1 protein_id gnl|my_center|LOCUS_24940 368241 368651 gene locus_tag LOCUS_24950 368241 368651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 368662 369255 gene locus_tag LOCUS_24960 368662 369255 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963075.1 protein_id gnl|my_center|LOCUS_24960 369252 369569 gene locus_tag LOCUS_24970 369252 369569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 369648 370109 gene locus_tag LOCUS_24980 369648 370109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 370106 370393 gene locus_tag LOCUS_24990 370106 370393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 370407 371528 gene locus_tag LOCUS_25000 370407 371528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 371552 371740 gene locus_tag LOCUS_25010 371552 371740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 371749 372819 gene locus_tag LOCUS_25020 371749 372819 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275358.1 protein_id gnl|my_center|LOCUS_25020 372832 375924 gene locus_tag LOCUS_25030 372832 375924 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_25030 377498 376845 gene locus_tag LOCUS_25040 377498 376845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25040 377908 377477 gene locus_tag LOCUS_25050 377908 377477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 378264 378109 gene locus_tag LOCUS_25060 378264 378109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 378657 379157 gene locus_tag LOCUS_25070 378657 379157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 379172 380260 gene locus_tag LOCUS_25080 379172 380260 CDS product leucine-rich repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962345.1 protein_id gnl|my_center|LOCUS_25080 380368 380997 gene locus_tag LOCUS_25090 380368 380997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 381083 382549 gene locus_tag LOCUS_25100 381083 382549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 382779 383060 gene locus_tag LOCUS_25110 382779 383060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25110 384388 385101 gene locus_tag LOCUS_25120 384388 385101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 386736 385192 gene locus_tag LOCUS_25130 386736 385192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 387243 386773 gene locus_tag LOCUS_25140 387243 386773 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971326.1 protein_id gnl|my_center|LOCUS_25140 388070 387534 gene locus_tag LOCUS_25150 388070 387534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 388442 388077 gene locus_tag LOCUS_25160 388442 388077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 388922 388482 gene locus_tag LOCUS_25170 388922 388482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 389922 389044 gene locus_tag LOCUS_25180 389922 389044 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769918.1 protein_id gnl|my_center|LOCUS_25180 390150 390464 gene locus_tag LOCUS_25190 390150 390464 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 protein_id gnl|my_center|LOCUS_25190 390474 391253 gene locus_tag LOCUS_25200 390474 391253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 391654 393204 gene locus_tag LOCUS_25210 391654 393204 CDS product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963779.1 protein_id gnl|my_center|LOCUS_25210 393983 393228 gene locus_tag LOCUS_25220 393983 393228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 395428 394004 gene locus_tag LOCUS_25230 395428 394004 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_25230 395609 397606 gene locus_tag LOCUS_25240 395609 397606 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_25240 398201 397620 gene locus_tag LOCUS_25250 398201 397620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25250 398464 398213 gene locus_tag LOCUS_25260 398464 398213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 399762 398452 gene locus_tag LOCUS_25270 399762 398452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 400724 399780 gene locus_tag LOCUS_25280 400724 399780 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990820.1 protein_id gnl|my_center|LOCUS_25280 401402 400869 gene locus_tag LOCUS_25290 401402 400869 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636204.1 protein_id gnl|my_center|LOCUS_25290 402895 401687 gene locus_tag LOCUS_25300 402895 401687 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_25300 403215 403694 gene locus_tag LOCUS_25310 403215 403694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 404388 403627 gene locus_tag LOCUS_25320 404388 403627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25320 404634 404389 gene locus_tag LOCUS_25330 404634 404389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25330 405132 404689 gene locus_tag LOCUS_25340 gene aroQ 405132 404689 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964118.1 protein_id gnl|my_center|LOCUS_25340 407339 405138 gene locus_tag LOCUS_25350 gene recQ 407339 405138 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764112.1 protein_id gnl|my_center|LOCUS_25350 407479 408516 gene locus_tag LOCUS_25360 407479 408516 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099197.1 protein_id gnl|my_center|LOCUS_25360 408749 409579 gene locus_tag LOCUS_25370 408749 409579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 409581 409895 gene locus_tag LOCUS_25380 409581 409895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 409992 410483 gene locus_tag LOCUS_25390 409992 410483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 412432 411482 gene locus_tag LOCUS_25400 gene metF 412432 411482 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792069.1 protein_id gnl|my_center|LOCUS_25400 413930 412470 gene locus_tag LOCUS_25410 gene rpoN 413930 412470 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_25410 414222 415337 gene locus_tag LOCUS_25420 414222 415337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25420 415358 415966 gene locus_tag LOCUS_25430 415358 415966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25430 416307 416801 gene locus_tag LOCUS_25440 416307 416801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 416811 417506 gene locus_tag LOCUS_25450 416811 417506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 417701 418402 gene locus_tag LOCUS_25460 417701 418402 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405499.1 protein_id gnl|my_center|LOCUS_25460 418412 419080 gene locus_tag LOCUS_25470 418412 419080 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_25470 420620 419085 gene locus_tag LOCUS_25480 420620 419085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 422178 420949 gene locus_tag LOCUS_25490 422178 420949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25490 422497 422180 gene locus_tag LOCUS_25500 422497 422180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25500 424105 422528 gene locus_tag LOCUS_25510 424105 422528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 424558 424905 gene locus_tag LOCUS_25520 424558 424905 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118195647.1 protein_id gnl|my_center|LOCUS_25520 425022 426056 gene locus_tag LOCUS_25530 gene arsB 425022 426056 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421624.1 protein_id gnl|my_center|LOCUS_25530 426169 426783 gene locus_tag LOCUS_25540 426169 426783 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615927.1 protein_id gnl|my_center|LOCUS_25540 427706 427188 gene locus_tag LOCUS_25550 427706 427188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 428643 427918 gene locus_tag LOCUS_25560 428643 427918 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_25560 429707 428655 gene locus_tag LOCUS_25570 429707 428655 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107708.1 protein_id gnl|my_center|LOCUS_25570 430981 429821 gene locus_tag LOCUS_25580 430981 429821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 431339 431028 gene locus_tag LOCUS_25590 431339 431028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 434421 431368 gene locus_tag LOCUS_25600 434421 431368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 434971 434525 gene locus_tag LOCUS_25610 434971 434525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 436324 435059 gene locus_tag LOCUS_25620 436324 435059 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_25620 436869 436483 gene locus_tag LOCUS_25630 436869 436483 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_25630 437085 436879 gene locus_tag LOCUS_25640 437085 436879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 437369 437121 gene locus_tag LOCUS_25650 437369 437121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 437770 437570 gene locus_tag LOCUS_25660 gene rpmF 437770 437570 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964469.1 protein_id gnl|my_center|LOCUS_25660 438304 437789 gene locus_tag LOCUS_25670 438304 437789 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814383.1 protein_id gnl|my_center|LOCUS_25670 438701 438423 gene locus_tag LOCUS_25680 438701 438423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 440921 438918 gene locus_tag LOCUS_25690 440921 438918 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108682.1 protein_id gnl|my_center|LOCUS_25690 441497 441394 gene locus_tag LOCUS_r00010 441497 441394 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 444532 441689 gene locus_tag LOCUS_r00020 444532 441689 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 444995 444921 gene locus_tag LOCUS_t00260 444995 444921 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 445105 445031 gene locus_tag LOCUS_t00270 445105 445031 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 446928 445415 gene locus_tag LOCUS_r00030 446928 445415 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 449002 447548 gene locus_tag LOCUS_25700 449002 447548 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962589.1 protein_id gnl|my_center|LOCUS_25700 450357 449005 gene locus_tag LOCUS_25710 450357 449005 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 protein_id gnl|my_center|LOCUS_25710 452018 450360 gene locus_tag LOCUS_25720 452018 450360 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962591.1 protein_id gnl|my_center|LOCUS_25720 452696 452025 gene locus_tag LOCUS_25730 452696 452025 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_25730 452956 454026 gene locus_tag LOCUS_25740 gene serC 452956 454026 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962801.1 protein_id gnl|my_center|LOCUS_25740 454029 454757 gene locus_tag LOCUS_25750 454029 454757 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948163.1 protein_id gnl|my_center|LOCUS_25750 455010 454774 gene locus_tag LOCUS_25760 455010 454774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 455598 455017 gene locus_tag LOCUS_25770 455598 455017 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_25770 456420 455701 gene locus_tag LOCUS_25780 gene pdeM 456420 455701 CDS product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268716.1 protein_id gnl|my_center|LOCUS_25780 456509 457135 gene locus_tag LOCUS_25790 456509 457135 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028787344.1 protein_id gnl|my_center|LOCUS_25790 457359 458159 gene locus_tag LOCUS_25800 gene proC 457359 458159 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804294.1 protein_id gnl|my_center|LOCUS_25800 458316 458951 gene locus_tag LOCUS_25810 458316 458951 CDS product YdeI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989716.1 protein_id gnl|my_center|LOCUS_25810 459123 459398 gene locus_tag LOCUS_25820 459123 459398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 459435 459671 gene locus_tag LOCUS_25830 459435 459671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 459681 460064 gene locus_tag LOCUS_25840 459681 460064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 460296 460859 gene locus_tag LOCUS_25850 460296 460859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 461188 462096 gene locus_tag LOCUS_25860 461188 462096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 462075 462743 gene locus_tag LOCUS_25870 462075 462743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 462918 463532 gene locus_tag LOCUS_25880 462918 463532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 463545 464189 gene locus_tag LOCUS_25890 463545 464189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 464291 464470 gene locus_tag LOCUS_25900 464291 464470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 464464 465207 gene locus_tag LOCUS_25910 464464 465207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 465290 465592 gene locus_tag LOCUS_25920 465290 465592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 466095 466667 gene locus_tag LOCUS_25930 466095 466667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 466753 467163 gene locus_tag LOCUS_25940 466753 467163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 467175 467423 gene locus_tag LOCUS_25950 467175 467423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 467691 469304 gene locus_tag LOCUS_25960 467691 469304 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633861.1 protein_id gnl|my_center|LOCUS_25960 469771 469460 gene locus_tag LOCUS_25970 469771 469460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25970 470896 469838 gene locus_tag LOCUS_25980 470896 469838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25980 471065 471325 gene locus_tag LOCUS_25990 471065 471325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 471514 472221 gene locus_tag LOCUS_26000 471514 472221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 472436 472852 gene locus_tag LOCUS_26010 472436 472852 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537483.1 protein_id gnl|my_center|LOCUS_26010 472966 473181 gene locus_tag LOCUS_26020 472966 473181 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016020.1 protein_id gnl|my_center|LOCUS_26020 473184 474422 gene locus_tag LOCUS_26030 gene dcm 473184 474422 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203404.1 protein_id gnl|my_center|LOCUS_26030 474361 475533 gene locus_tag LOCUS_26040 474361 475533 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203405.1 protein_id gnl|my_center|LOCUS_26040 476340 480683 gene locus_tag LOCUS_26050 476340 480683 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459235.1 protein_id gnl|my_center|LOCUS_26050 480680 481159 gene locus_tag LOCUS_26060 480680 481159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26060 481180 481956 gene locus_tag LOCUS_26070 481180 481956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 481995 483395 gene locus_tag LOCUS_26080 481995 483395 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114264.1 protein_id gnl|my_center|LOCUS_26080 484516 483746 gene locus_tag LOCUS_26090 484516 483746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 487392 484549 gene locus_tag LOCUS_26100 487392 484549 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_26100 488025 487420 gene locus_tag LOCUS_26110 488025 487420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26110 489027 488032 gene locus_tag LOCUS_26120 489027 488032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26120 490851 489052 gene locus_tag LOCUS_26130 gene sulP 490851 489052 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404965.1 protein_id gnl|my_center|LOCUS_26130 492496 491087 gene locus_tag LOCUS_26140 492496 491087 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_26140 492620 493405 gene locus_tag LOCUS_26150 492620 493405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 493919 493410 gene locus_tag LOCUS_26160 493919 493410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 494028 494951 gene locus_tag LOCUS_26170 494028 494951 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964584.1 protein_id gnl|my_center|LOCUS_26170 495647 494997 gene locus_tag LOCUS_26180 495647 494997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 497129 495834 gene locus_tag LOCUS_26190 gene dacB 497129 495834 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403836.1 protein_id gnl|my_center|LOCUS_26190 498248 497226 gene locus_tag LOCUS_26200 498248 497226 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958325.1 protein_id gnl|my_center|LOCUS_26200 499176 498250 gene locus_tag LOCUS_26210 gene rimK 499176 498250 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689982.1 protein_id gnl|my_center|LOCUS_26210 499366 499587 gene locus_tag LOCUS_26220 499366 499587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26220 499674 500693 gene locus_tag LOCUS_26230 499674 500693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26230 501284 500769 gene locus_tag LOCUS_26240 501284 500769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 501451 503580 gene locus_tag LOCUS_26250 501451 503580 CDS product zinc-dependent metalloprotease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356699.1 protein_id gnl|my_center|LOCUS_26250 503528 504475 gene locus_tag LOCUS_26260 503528 504475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 505056 504586 gene locus_tag LOCUS_26270 505056 504586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26270 506057 505053 gene locus_tag LOCUS_26280 506057 505053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26280 506351 507022 gene locus_tag LOCUS_26290 506351 507022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 507211 507567 gene locus_tag LOCUS_26300 507211 507567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 509890 507632 gene locus_tag LOCUS_26310 509890 507632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 510230 509988 gene locus_tag LOCUS_26320 510230 509988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 511224 510424 gene locus_tag LOCUS_26330 511224 510424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 511460 513241 gene locus_tag LOCUS_26340 511460 513241 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_26340 513309 513482 gene locus_tag LOCUS_26350 513309 513482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26350 513497 514030 gene locus_tag LOCUS_26360 513497 514030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26360 514345 515004 gene locus_tag LOCUS_26370 gene fsa 514345 515004 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963193.1 protein_id gnl|my_center|LOCUS_26370 516859 515084 gene locus_tag LOCUS_26380 516859 515084 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826015.1 protein_id gnl|my_center|LOCUS_26380 517355 518011 gene locus_tag LOCUS_26390 517355 518011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 518128 519396 gene locus_tag LOCUS_26400 518128 519396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 525761 519960 gene locus_tag LOCUS_26410 525761 519960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 526033 526953 gene locus_tag LOCUS_26420 526033 526953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 527749 527273 gene locus_tag LOCUS_26430 527749 527273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 528250 527843 gene locus_tag LOCUS_26440 528250 527843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 529201 528353 gene locus_tag LOCUS_26450 529201 528353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 530132 529551 gene locus_tag LOCUS_26460 530132 529551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 533622 530707 gene locus_tag LOCUS_26470 533622 530707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 534363 533845 gene locus_tag LOCUS_26480 534363 533845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 535572 534973 gene locus_tag LOCUS_26490 535572 534973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 536715 537887 gene locus_tag LOCUS_26500 536715 537887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 537930 539297 gene locus_tag LOCUS_26510 537930 539297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 539261 539596 gene locus_tag LOCUS_26520 539261 539596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 539668 540405 gene locus_tag LOCUS_26530 539668 540405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 540426 540860 gene locus_tag LOCUS_26540 540426 540860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 541154 541537 gene locus_tag LOCUS_26550 541154 541537 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_26550 541563 541781 gene locus_tag LOCUS_26560 541563 541781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 542410 541892 gene locus_tag LOCUS_26570 542410 541892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 543462 542767 gene locus_tag LOCUS_26580 543462 542767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 543926 543627 gene locus_tag LOCUS_26590 543926 543627 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277486.1 protein_id gnl|my_center|LOCUS_26590 544170 543919 gene locus_tag LOCUS_26600 544170 543919 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918759.1 protein_id gnl|my_center|LOCUS_26600 545253 544555 gene locus_tag LOCUS_26610 545253 544555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 545762 546007 gene locus_tag LOCUS_26620 545762 546007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 546155 546745 gene locus_tag LOCUS_26630 546155 546745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 548668 546938 gene locus_tag LOCUS_26640 548668 546938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 549448 549209 gene locus_tag LOCUS_26650 549448 549209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 551095 549557 gene locus_tag LOCUS_26660 551095 549557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 552340 551159 gene locus_tag LOCUS_26670 552340 551159 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147744042.1 protein_id gnl|my_center|LOCUS_26670 553059 552529 gene locus_tag LOCUS_26680 553059 552529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 553480 553073 gene locus_tag LOCUS_26690 553480 553073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 554375 553554 gene locus_tag LOCUS_26700 554375 553554 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861584.1 protein_id gnl|my_center|LOCUS_26700 555456 554503 gene locus_tag LOCUS_26710 555456 554503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 556112 555618 gene locus_tag LOCUS_26720 556112 555618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 556759 556208 gene locus_tag LOCUS_26730 556759 556208 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962189.1 protein_id gnl|my_center|LOCUS_26730 558254 557796 gene locus_tag LOCUS_26740 558254 557796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 558544 558362 gene locus_tag LOCUS_26750 558544 558362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 559101 558685 gene locus_tag LOCUS_26760 559101 558685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 559694 559284 gene locus_tag LOCUS_26770 559694 559284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 561598 559817 gene locus_tag LOCUS_26780 561598 559817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 562681 561950 gene locus_tag LOCUS_26790 562681 561950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26790 563425 564624 gene locus_tag LOCUS_26800 563425 564624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 565143 565361 gene locus_tag LOCUS_26810 565143 565361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 566361 565432 gene locus_tag LOCUS_26820 566361 565432 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004328062.1 protein_id gnl|my_center|LOCUS_26820 567692 566979 gene locus_tag LOCUS_26830 567692 566979 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065753.1 protein_id gnl|my_center|LOCUS_26830 568174 567764 gene locus_tag LOCUS_26840 568174 567764 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972513.1 protein_id gnl|my_center|LOCUS_26840 568742 568209 gene locus_tag LOCUS_26850 gene bstA 568742 568209 CDS product bacillithiol transferase BstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243944.1 protein_id gnl|my_center|LOCUS_26850 569135 568782 gene locus_tag LOCUS_26860 569135 568782 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258318.1 protein_id gnl|my_center|LOCUS_26860 572672 569289 gene locus_tag LOCUS_26870 572672 569289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962474.1 protein_id gnl|my_center|LOCUS_26870 573471 572881 gene locus_tag LOCUS_26880 573471 572881 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_26880 573675 574394 gene locus_tag LOCUS_26890 573675 574394 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962235.1 protein_id gnl|my_center|LOCUS_26890 574813 574397 gene locus_tag LOCUS_26900 574813 574397 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785756.1 protein_id gnl|my_center|LOCUS_26900 575539 574814 gene locus_tag LOCUS_26910 575539 574814 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886780.1 protein_id gnl|my_center|LOCUS_26910 576009 575665 gene locus_tag LOCUS_26920 576009 575665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26920 576583 576050 gene locus_tag LOCUS_26930 576583 576050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26930 576982 576668 gene locus_tag LOCUS_26940 gene trxA 576982 576668 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784741.1 protein_id gnl|my_center|LOCUS_26940 577329 578279 gene locus_tag LOCUS_26950 577329 578279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 578294 578908 gene locus_tag LOCUS_26960 578294 578908 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_26960 579065 579439 gene locus_tag LOCUS_26970 579065 579439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 579508 579849 gene locus_tag LOCUS_26980 579508 579849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 579924 580382 gene locus_tag LOCUS_26990 579924 580382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26990 580689 581027 gene locus_tag LOCUS_27000 580689 581027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 581342 581417 gene locus_tag LOCUS_t00280 581342 581417 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 584512 581666 gene locus_tag LOCUS_27010 gene uvrA 584512 581666 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963246.1 protein_id gnl|my_center|LOCUS_27010 585657 584551 gene locus_tag LOCUS_27020 585657 584551 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444177.1 protein_id gnl|my_center|LOCUS_27020 589182 586063 gene locus_tag LOCUS_27030 589182 586063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 589589 592573 gene locus_tag LOCUS_27040 589589 592573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 593242 592577 gene locus_tag LOCUS_27050 593242 592577 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814649.1 protein_id gnl|my_center|LOCUS_27050 593913 593296 gene locus_tag LOCUS_27060 593913 593296 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030480.1 protein_id gnl|my_center|LOCUS_27060 594102 594308 gene locus_tag LOCUS_27070 594102 594308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 594644 595984 gene locus_tag LOCUS_27080 594644 595984 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964302.1 protein_id gnl|my_center|LOCUS_27080 596188 597945 gene locus_tag LOCUS_27090 596188 597945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 597935 599236 gene locus_tag LOCUS_27100 gene dacB 597935 599236 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957323.1 protein_id gnl|my_center|LOCUS_27100 600641 599343 gene locus_tag LOCUS_27110 600641 599343 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_27110 602093 600954 gene locus_tag LOCUS_27120 gene paaK 602093 600954 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969778.1 protein_id gnl|my_center|LOCUS_27120 602235 602939 gene locus_tag LOCUS_27130 602235 602939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27130 602849 603466 gene locus_tag LOCUS_27140 602849 603466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27140 603609 603992 gene locus_tag LOCUS_27150 603609 603992 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392789.1 protein_id gnl|my_center|LOCUS_27150 604007 605806 gene locus_tag LOCUS_27160 gene uvrC 604007 605806 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962398.1 protein_id gnl|my_center|LOCUS_27160 607335 605851 gene locus_tag LOCUS_27170 607335 605851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 608466 607375 gene locus_tag LOCUS_27180 608466 607375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 610002 609217 gene locus_tag LOCUS_27190 610002 609217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27190 610860 610165 gene locus_tag LOCUS_27200 610860 610165 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421621.1 protein_id gnl|my_center|LOCUS_27200 610964 611347 gene locus_tag LOCUS_27210 610964 611347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 612732 611380 gene locus_tag LOCUS_27220 612732 611380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 614607 612889 gene locus_tag LOCUS_27230 614607 612889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 614704 615153 gene locus_tag LOCUS_27240 614704 615153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 615243 616358 gene locus_tag LOCUS_27250 gene acdA 615243 616358 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_27250 616491 617690 gene locus_tag LOCUS_27260 gene sucC 616491 617690 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963059.1 protein_id gnl|my_center|LOCUS_27260 617709 618944 gene locus_tag LOCUS_27270 gene xseA 617709 618944 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203547.1 protein_id gnl|my_center|LOCUS_27270 619005 619142 gene locus_tag LOCUS_27280 619005 619142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 619171 619821 gene locus_tag LOCUS_27290 619171 619821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27290 619757 620260 gene locus_tag LOCUS_27300 619757 620260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27300 620496 620568 gene locus_tag LOCUS_t00290 620496 620568 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 620851 621018 gene locus_tag LOCUS_27310 620851 621018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 621135 621395 gene locus_tag LOCUS_27320 621135 621395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 621486 622055 gene locus_tag LOCUS_27330 621486 622055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27330 623654 623959 gene locus_tag LOCUS_27340 623654 623959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 623987 624418 gene locus_tag LOCUS_27350 623987 624418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27350 624436 624906 gene locus_tag LOCUS_27360 624436 624906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27360 624881 625840 gene locus_tag LOCUS_27370 624881 625840 CDS product DUF3871 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107537.1 protein_id gnl|my_center|LOCUS_27370 626901 626107 gene locus_tag LOCUS_27380 626901 626107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 627112 626891 gene locus_tag LOCUS_27390 627112 626891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 627990 628211 gene locus_tag LOCUS_27400 627990 628211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 628272 628439 gene locus_tag LOCUS_27410 628272 628439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 628682 628867 gene locus_tag LOCUS_27420 628682 628867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 629027 629206 gene locus_tag LOCUS_27430 629027 629206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 629954 629625 gene locus_tag LOCUS_27440 629954 629625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 630401 630057 gene locus_tag LOCUS_27450 630401 630057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 631358 630768 gene locus_tag LOCUS_27460 631358 630768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 631668 631324 gene locus_tag LOCUS_27470 631668 631324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 632396 632211 gene locus_tag LOCUS_27480 632396 632211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 633219 632890 gene locus_tag LOCUS_27490 633219 632890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 633702 633442 gene locus_tag LOCUS_27500 633702 633442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 634520 634308 gene locus_tag LOCUS_27510 634520 634308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 635831 635613 gene locus_tag LOCUS_27520 635831 635613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 637523 637152 gene locus_tag LOCUS_27530 637523 637152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27530 638319 637846 gene locus_tag LOCUS_27540 638319 637846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27540 639108 638860 gene locus_tag LOCUS_27550 639108 638860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 640602 640766 gene locus_tag LOCUS_27560 640602 640766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27560 641350 641598 gene locus_tag LOCUS_27570 641350 641598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27570 641728 641961 gene locus_tag LOCUS_27580 641728 641961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 642239 642565 gene locus_tag LOCUS_27590 642239 642565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 >Feature sequence04 470 234 gene locus_tag LOCUS_27600 470 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 2472 787 gene locus_tag LOCUS_27610 2472 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 4335 3811 gene locus_tag LOCUS_27620 4335 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 4795 4508 gene locus_tag LOCUS_27630 4795 4508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 5453 7003 gene locus_tag LOCUS_27640 5453 7003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 7119 8840 gene locus_tag LOCUS_27650 7119 8840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 9455 9093 gene locus_tag LOCUS_27660 gene crcB 9455 9093 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963905.1 protein_id gnl|my_center|LOCUS_27660 10507 9452 gene locus_tag LOCUS_27670 10507 9452 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790532.1 protein_id gnl|my_center|LOCUS_27670 10674 12071 gene locus_tag LOCUS_27680 10674 12071 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657956.1 protein_id gnl|my_center|LOCUS_27680 12068 12958 gene locus_tag LOCUS_27690 12068 12958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 13967 13014 gene locus_tag LOCUS_27700 13967 13014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 15174 14170 gene locus_tag LOCUS_27710 15174 14170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 15741 15223 gene locus_tag LOCUS_27720 15741 15223 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768015.1 protein_id gnl|my_center|LOCUS_27720 18332 15816 gene locus_tag LOCUS_27730 gene lon 18332 15816 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963824.1 protein_id gnl|my_center|LOCUS_27730 18536 19852 gene locus_tag LOCUS_27740 gene murA 18536 19852 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108085.1 protein_id gnl|my_center|LOCUS_27740 20981 19926 gene locus_tag LOCUS_27750 20981 19926 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816129.1 protein_id gnl|my_center|LOCUS_27750 22025 21168 gene locus_tag LOCUS_27760 22025 21168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 22705 22022 gene locus_tag LOCUS_27770 22705 22022 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27770 22854 22723 gene locus_tag LOCUS_27780 22854 22723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 23886 22936 gene locus_tag LOCUS_27790 23886 22936 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785727.1 protein_id gnl|my_center|LOCUS_27790 29990 24327 gene locus_tag LOCUS_27800 29990 24327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 30654 29953 gene locus_tag LOCUS_27810 30654 29953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27810 32215 30548 gene locus_tag LOCUS_27820 32215 30548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27820 35449 32237 gene locus_tag LOCUS_27830 35449 32237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27830 36726 35503 gene locus_tag LOCUS_27840 36726 35503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 36707 36949 gene locus_tag LOCUS_27850 36707 36949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 40575 37507 gene locus_tag LOCUS_27860 40575 37507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 40643 40819 gene locus_tag LOCUS_27870 40643 40819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 41553 40927 gene locus_tag LOCUS_27880 41553 40927 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_27880 41786 43300 gene locus_tag LOCUS_27890 gene gltX 41786 43300 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765418.1 protein_id gnl|my_center|LOCUS_27890 43466 44434 gene locus_tag LOCUS_27900 43466 44434 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_27900 45070 44903 gene locus_tag LOCUS_27910 45070 44903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 45368 46024 gene locus_tag LOCUS_27920 45368 46024 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553324.1 protein_id gnl|my_center|LOCUS_27920 46131 46664 gene locus_tag LOCUS_27930 46131 46664 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762480.1 protein_id gnl|my_center|LOCUS_27930 46885 50181 gene locus_tag LOCUS_27940 gene secA 46885 50181 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202248.1 protein_id gnl|my_center|LOCUS_27940 50578 50222 gene locus_tag LOCUS_27950 50578 50222 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047694002.1 protein_id gnl|my_center|LOCUS_27950 50779 51582 gene locus_tag LOCUS_27960 50779 51582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 51689 52651 gene locus_tag LOCUS_27970 51689 52651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27970 52801 54084 gene locus_tag LOCUS_27980 52801 54084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27980 54113 55282 gene locus_tag LOCUS_27990 54113 55282 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_27990 55731 58871 gene locus_tag LOCUS_28000 55731 58871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 58878 60755 gene locus_tag LOCUS_28010 58878 60755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 60776 61603 gene locus_tag LOCUS_28020 60776 61603 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256962.1 protein_id gnl|my_center|LOCUS_28020 61636 65085 gene locus_tag LOCUS_28030 61636 65085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 65168 66394 gene locus_tag LOCUS_28040 65168 66394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 66394 67884 gene locus_tag LOCUS_28050 66394 67884 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036277.1 protein_id gnl|my_center|LOCUS_28050 67905 69461 gene locus_tag LOCUS_28060 67905 69461 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144234.1 protein_id gnl|my_center|LOCUS_28060 69510 70418 gene locus_tag LOCUS_28070 69510 70418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 70793 71653 gene locus_tag LOCUS_28080 70793 71653 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_28080 71903 72325 gene locus_tag LOCUS_28090 71903 72325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 72331 73350 gene locus_tag LOCUS_28100 72331 73350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 73446 74330 gene locus_tag LOCUS_28110 73446 74330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 74377 75648 gene locus_tag LOCUS_28120 74377 75648 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765915.1 protein_id gnl|my_center|LOCUS_28120 75738 76256 gene locus_tag LOCUS_28130 75738 76256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 76262 77194 gene locus_tag LOCUS_28140 76262 77194 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_28140 77598 77239 gene locus_tag LOCUS_28150 77598 77239 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022410.1 protein_id gnl|my_center|LOCUS_28150 77821 79137 gene locus_tag LOCUS_28160 77821 79137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 79256 81211 gene locus_tag LOCUS_28170 gene glgB 79256 81211 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_28170 81220 81918 gene locus_tag LOCUS_28180 81220 81918 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025456712.1 protein_id gnl|my_center|LOCUS_28180 81998 83359 gene locus_tag LOCUS_28190 81998 83359 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_28190 84816 83464 gene locus_tag LOCUS_28200 84816 83464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 85891 84896 gene locus_tag LOCUS_28210 85891 84896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28210 86237 85809 gene locus_tag LOCUS_28220 86237 85809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28220 86949 86230 gene locus_tag LOCUS_28230 86949 86230 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764531.1 protein_id gnl|my_center|LOCUS_28230 88487 86952 gene locus_tag LOCUS_28240 gene purH 88487 86952 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964504.1 protein_id gnl|my_center|LOCUS_28240 89574 88696 gene locus_tag LOCUS_28250 gene gldN 89574 88696 CDS product gliding motility protein GldN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964072.1 protein_id gnl|my_center|LOCUS_28250 91133 89613 gene locus_tag LOCUS_28260 91133 89613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 91794 91210 gene locus_tag LOCUS_28270 91794 91210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 93130 91889 gene locus_tag LOCUS_28280 gene gldK 93130 91889 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_28280 94416 93502 gene locus_tag LOCUS_28290 94416 93502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 95361 94558 gene locus_tag LOCUS_28300 95361 94558 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_28300 95630 95361 gene locus_tag LOCUS_28310 95630 95361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 95987 96631 gene locus_tag LOCUS_28320 95987 96631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 96796 97290 gene locus_tag LOCUS_28330 96796 97290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 97571 98218 gene locus_tag LOCUS_28340 97571 98218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28340 98623 100539 gene locus_tag LOCUS_28350 98623 100539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 101073 105293 gene locus_tag LOCUS_28360 101073 105293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 106346 105348 gene locus_tag LOCUS_28370 106346 105348 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103912749.1 protein_id gnl|my_center|LOCUS_28370 106522 107745 gene locus_tag LOCUS_28380 106522 107745 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 protein_id gnl|my_center|LOCUS_28380 107823 109571 gene locus_tag LOCUS_28390 107823 109571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 109648 110133 gene locus_tag LOCUS_28400 109648 110133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 110155 110952 gene locus_tag LOCUS_28410 110155 110952 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964615.1 protein_id gnl|my_center|LOCUS_28410 110965 111711 gene locus_tag LOCUS_28420 110965 111711 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_28420 111689 113272 gene locus_tag LOCUS_28430 111689 113272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 114821 113292 gene locus_tag LOCUS_28440 114821 113292 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_28440 115059 115562 gene locus_tag LOCUS_28450 115059 115562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 116282 115584 gene locus_tag LOCUS_28460 116282 115584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 116825 116307 gene locus_tag LOCUS_28470 116825 116307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28470 118144 116831 gene locus_tag LOCUS_28480 118144 116831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28480 119452 118154 gene locus_tag LOCUS_28490 119452 118154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 120359 119547 gene locus_tag LOCUS_28500 120359 119547 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767986.1 protein_id gnl|my_center|LOCUS_28500 120841 120620 gene locus_tag LOCUS_28510 120841 120620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 121305 120910 gene locus_tag LOCUS_28520 121305 120910 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507213.1 protein_id gnl|my_center|LOCUS_28520 121758 121426 gene locus_tag LOCUS_28530 121758 121426 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_28530 121789 122385 gene locus_tag LOCUS_28540 121789 122385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 122478 125303 gene locus_tag LOCUS_28550 gene polA 122478 125303 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_28550 128185 125348 gene locus_tag LOCUS_28560 128185 125348 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_28560 130327 128351 gene locus_tag LOCUS_28570 130327 128351 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_28570 131499 130606 gene locus_tag LOCUS_28580 gene atpG 131499 130606 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964544.1 protein_id gnl|my_center|LOCUS_28580 132728 131529 gene locus_tag LOCUS_28590 gene atpA 132728 131529 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964545.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28590 133112 132852 gene locus_tag LOCUS_28600 133112 132852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28600 133694 133134 gene locus_tag LOCUS_28610 133694 133134 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931712.1 protein_id gnl|my_center|LOCUS_28610 134147 133725 gene locus_tag LOCUS_28620 gene atpF 134147 133725 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787487.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28620 134532 134323 gene locus_tag LOCUS_28630 134532 134323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 135728 134565 gene locus_tag LOCUS_28640 gene atpB 135728 134565 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964549.1 protein_id gnl|my_center|LOCUS_28640 136520 136969 gene locus_tag LOCUS_28650 136520 136969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 137871 137143 gene locus_tag LOCUS_28660 137871 137143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 138576 138292 gene locus_tag LOCUS_28670 138576 138292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28670 138746 138513 gene locus_tag LOCUS_28680 138746 138513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28680 141105 139069 gene locus_tag LOCUS_28690 141105 139069 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202310.1 protein_id gnl|my_center|LOCUS_28690 142551 142931 gene locus_tag LOCUS_28700 142551 142931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 143219 143959 gene locus_tag LOCUS_28710 143219 143959 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545876.1 protein_id gnl|my_center|LOCUS_28710 143966 144355 gene locus_tag LOCUS_28720 143966 144355 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071713.1 protein_id gnl|my_center|LOCUS_28720 145407 144412 gene locus_tag LOCUS_28730 145407 144412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 145868 145404 gene locus_tag LOCUS_28740 145868 145404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 146088 146516 gene locus_tag LOCUS_28750 146088 146516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 146534 146770 gene locus_tag LOCUS_28760 gene yidD 146534 146770 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816027.1 protein_id gnl|my_center|LOCUS_28760 147535 146807 gene locus_tag LOCUS_28770 gene recO 147535 146807 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108822.1 protein_id gnl|my_center|LOCUS_28770 147857 147546 gene locus_tag LOCUS_28780 147857 147546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 149333 147882 gene locus_tag LOCUS_28790 149333 147882 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783832.1 protein_id gnl|my_center|LOCUS_28790 150580 149579 gene locus_tag LOCUS_28800 150580 149579 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530707.1 protein_id gnl|my_center|LOCUS_28800 150828 151421 gene locus_tag LOCUS_28810 150828 151421 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889002.1 protein_id gnl|my_center|LOCUS_28810 151471 152526 gene locus_tag LOCUS_28820 gene paaK 151471 152526 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976332.1 protein_id gnl|my_center|LOCUS_28820 152531 153478 gene locus_tag LOCUS_28830 gene paaA 152531 153478 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813298.1 protein_id gnl|my_center|LOCUS_28830 153478 153762 gene locus_tag LOCUS_28840 gene paaB 153478 153762 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551024.1 protein_id gnl|my_center|LOCUS_28840 153764 154531 gene locus_tag LOCUS_28850 gene paaC 153764 154531 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965788.1 protein_id gnl|my_center|LOCUS_28850 154535 155026 gene locus_tag LOCUS_28860 gene paaJ 154535 155026 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085678.1 protein_id gnl|my_center|LOCUS_28860 156262 155033 gene locus_tag LOCUS_28870 156262 155033 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_28870 156627 156370 gene locus_tag LOCUS_28880 156627 156370 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963273.1 protein_id gnl|my_center|LOCUS_28880 157011 157493 gene locus_tag LOCUS_28890 157011 157493 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_28890 157529 158050 gene locus_tag LOCUS_28900 157529 158050 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162890626.1 protein_id gnl|my_center|LOCUS_28900 158047 158844 gene locus_tag LOCUS_28910 gene murI 158047 158844 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545640.1 protein_id gnl|my_center|LOCUS_28910 161626 158906 gene locus_tag LOCUS_28920 161626 158906 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_28920 162474 161773 gene locus_tag LOCUS_28930 162474 161773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 162595 163983 gene locus_tag LOCUS_28940 162595 163983 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555756.1 protein_id gnl|my_center|LOCUS_28940 164074 165276 gene locus_tag LOCUS_28950 164074 165276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 165498 166052 gene locus_tag LOCUS_28960 165498 166052 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392708.1 protein_id gnl|my_center|LOCUS_28960 166062 167744 gene locus_tag LOCUS_28970 166062 167744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 168089 169360 gene locus_tag LOCUS_28980 168089 169360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 172311 169570 gene locus_tag LOCUS_28990 gene ppdK 172311 169570 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_28990 172519 174150 gene locus_tag LOCUS_29000 172519 174150 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_29000 174153 177740 gene locus_tag LOCUS_29010 gene nifJ 174153 177740 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705395.1 protein_id gnl|my_center|LOCUS_29010 177769 178767 gene locus_tag LOCUS_29020 177769 178767 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_29020 178997 179347 gene locus_tag LOCUS_29030 178997 179347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 179514 181952 gene locus_tag LOCUS_29040 179514 181952 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964133.1 protein_id gnl|my_center|LOCUS_29040 182488 184611 gene locus_tag LOCUS_29050 182488 184611 CDS product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268715.1 protein_id gnl|my_center|LOCUS_29050 185150 184635 gene locus_tag LOCUS_29060 185150 184635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 186154 185156 gene locus_tag LOCUS_29070 186154 185156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 186717 186247 gene locus_tag LOCUS_29080 186717 186247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 188104 186806 gene locus_tag LOCUS_29090 188104 186806 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 protein_id gnl|my_center|LOCUS_29090 188965 188132 gene locus_tag LOCUS_29100 188965 188132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29100 189530 188976 gene locus_tag LOCUS_29110 189530 188976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29110 190087 189539 gene locus_tag LOCUS_29120 190087 189539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 190979 190134 gene locus_tag LOCUS_29130 190979 190134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29130 192160 191009 gene locus_tag LOCUS_29140 192160 191009 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_29140 193109 192249 gene locus_tag LOCUS_29150 gene panC 193109 192249 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202230.1 protein_id gnl|my_center|LOCUS_29150 194242 193115 gene locus_tag LOCUS_29160 194242 193115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 195055 194342 gene locus_tag LOCUS_29170 195055 194342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 196357 195134 gene locus_tag LOCUS_29180 196357 195134 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797236.1 protein_id gnl|my_center|LOCUS_29180 196583 200530 gene locus_tag LOCUS_29190 196583 200530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 200493 207464 gene locus_tag LOCUS_29200 200493 207464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 207687 207908 gene locus_tag LOCUS_29210 207687 207908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29210 207905 208612 gene locus_tag LOCUS_29220 207905 208612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29220 208629 209483 gene locus_tag LOCUS_29230 208629 209483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29230 210323 209556 gene locus_tag LOCUS_29240 gene tpiA 210323 209556 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791115.1 protein_id gnl|my_center|LOCUS_29240 211057 210386 gene locus_tag LOCUS_29250 211057 210386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 211140 213047 gene locus_tag LOCUS_29260 211140 213047 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_29260 213055 214152 gene locus_tag LOCUS_29270 gene dprA 213055 214152 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172795629.1 protein_id gnl|my_center|LOCUS_29270 214599 214168 gene locus_tag LOCUS_29280 214599 214168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 214793 215560 gene locus_tag LOCUS_29290 214793 215560 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962364.1 protein_id gnl|my_center|LOCUS_29290 215567 216520 gene locus_tag LOCUS_29300 gene rsgA 215567 216520 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962423.1 protein_id gnl|my_center|LOCUS_29300 216978 216526 gene locus_tag LOCUS_29310 216978 216526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 218588 217011 gene locus_tag LOCUS_29320 218588 217011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 218827 219441 gene locus_tag LOCUS_29330 218827 219441 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902951.1 protein_id gnl|my_center|LOCUS_29330 220544 219516 gene locus_tag LOCUS_29340 220544 219516 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787732.1 protein_id gnl|my_center|LOCUS_29340 221736 220606 gene locus_tag LOCUS_29350 gene tgt 221736 220606 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202814.1 protein_id gnl|my_center|LOCUS_29350 223142 221739 gene locus_tag LOCUS_29360 gene rodA 223142 221739 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792061.1 protein_id gnl|my_center|LOCUS_29360 223517 223152 gene locus_tag LOCUS_29370 223517 223152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 223867 225669 gene locus_tag LOCUS_29380 223867 225669 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461056.1 protein_id gnl|my_center|LOCUS_29380 225851 227125 gene locus_tag LOCUS_29390 225851 227125 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693669.1 protein_id gnl|my_center|LOCUS_29390 227428 228762 gene locus_tag LOCUS_29400 227428 228762 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962751.1 protein_id gnl|my_center|LOCUS_29400 228767 230008 gene locus_tag LOCUS_29410 228767 230008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 230005 230931 gene locus_tag LOCUS_29420 230005 230931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 231529 230945 gene locus_tag LOCUS_29430 gene coaE 231529 230945 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785766.1 protein_id gnl|my_center|LOCUS_29430 232756 231548 gene locus_tag LOCUS_29440 232756 231548 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403533.1 protein_id gnl|my_center|LOCUS_29440 234689 232746 gene locus_tag LOCUS_29450 234689 232746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 235310 234699 gene locus_tag LOCUS_29460 gene recR 235310 234699 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963432.1 protein_id gnl|my_center|LOCUS_29460 235566 236189 gene locus_tag LOCUS_29470 235566 236189 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028787344.1 protein_id gnl|my_center|LOCUS_29470 236293 236499 gene locus_tag LOCUS_29480 236293 236499 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257467.1 protein_id gnl|my_center|LOCUS_29480 236909 239359 gene locus_tag LOCUS_29490 236909 239359 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_29490 239362 240696 gene locus_tag LOCUS_29500 gene mtaB 239362 240696 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_29500 240774 241865 gene locus_tag LOCUS_29510 gene rlmG 240774 241865 CDS product 23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817237.1 protein_id gnl|my_center|LOCUS_29510 242164 245253 gene locus_tag LOCUS_29520 242164 245253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 245360 246673 gene locus_tag LOCUS_29530 gene ahcY 245360 246673 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962366.1 protein_id gnl|my_center|LOCUS_29530 247021 249132 gene locus_tag LOCUS_29540 247021 249132 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016194724.1 protein_id gnl|my_center|LOCUS_29540 249726 249247 gene locus_tag LOCUS_29550 249726 249247 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943062.1 protein_id gnl|my_center|LOCUS_29550 250067 249759 gene locus_tag LOCUS_29560 250067 249759 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808391.1 protein_id gnl|my_center|LOCUS_29560 251327 250086 gene locus_tag LOCUS_29570 251327 250086 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461847.1 protein_id gnl|my_center|LOCUS_29570 251803 252093 gene locus_tag LOCUS_29580 251803 252093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 252498 252088 gene locus_tag LOCUS_29590 252498 252088 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791382.1 protein_id gnl|my_center|LOCUS_29590 252974 252498 gene locus_tag LOCUS_29600 gene greA 252974 252498 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765198.1 protein_id gnl|my_center|LOCUS_29600 254174 253116 gene locus_tag LOCUS_29610 254174 253116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 258367 254249 gene locus_tag LOCUS_29620 258367 254249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 262020 258388 gene locus_tag LOCUS_29630 262020 258388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 263255 262308 gene locus_tag LOCUS_29640 263255 262308 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_29640 264000 263266 gene locus_tag LOCUS_29650 264000 263266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 264678 264061 gene locus_tag LOCUS_29660 264678 264061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 264965 265966 gene locus_tag LOCUS_29670 264965 265966 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_29670 265987 267297 gene locus_tag LOCUS_29680 265987 267297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 267300 268172 gene locus_tag LOCUS_29690 267300 268172 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_29690 268169 269227 gene locus_tag LOCUS_29700 268169 269227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202862.1 protein_id gnl|my_center|LOCUS_29700 269233 270231 gene locus_tag LOCUS_29710 269233 270231 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962311.1 protein_id gnl|my_center|LOCUS_29710 270360 271919 gene locus_tag LOCUS_29720 270360 271919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 273150 272470 gene locus_tag LOCUS_29730 273150 272470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 274400 273270 gene locus_tag LOCUS_29740 274400 273270 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071679105.1 protein_id gnl|my_center|LOCUS_29740 274648 278211 gene locus_tag LOCUS_29750 274648 278211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 278223 279008 gene locus_tag LOCUS_29760 278223 279008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926920.1 protein_id gnl|my_center|LOCUS_29760 279088 279327 gene locus_tag LOCUS_29770 279088 279327 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291965.1 protein_id gnl|my_center|LOCUS_29770 279510 280754 gene locus_tag LOCUS_29780 gene fabF 279510 280754 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201893.1 protein_id gnl|my_center|LOCUS_29780 280751 281473 gene locus_tag LOCUS_29790 280751 281473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 281593 282798 gene locus_tag LOCUS_29800 281593 282798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 284597 282834 gene locus_tag LOCUS_29810 284597 282834 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_29810 284678 285787 gene locus_tag LOCUS_29820 284678 285787 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396744.1 protein_id gnl|my_center|LOCUS_29820 285789 286193 gene locus_tag LOCUS_29830 285789 286193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 286267 287451 gene locus_tag LOCUS_29840 286267 287451 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_29840 287451 288107 gene locus_tag LOCUS_29850 287451 288107 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042743.1 protein_id gnl|my_center|LOCUS_29850 288969 288097 gene locus_tag LOCUS_29860 288969 288097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 289548 288982 gene locus_tag LOCUS_29870 289548 288982 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071746.1 protein_id gnl|my_center|LOCUS_29870 289939 291279 gene locus_tag LOCUS_29880 289939 291279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 291453 292031 gene locus_tag LOCUS_29890 291453 292031 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802006.1 protein_id gnl|my_center|LOCUS_29890 293699 292056 gene locus_tag LOCUS_29900 293699 292056 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962719.1 protein_id gnl|my_center|LOCUS_29900 294695 295486 gene locus_tag LOCUS_29910 294695 295486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 295508 296494 gene locus_tag LOCUS_29920 295508 296494 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801668.1 protein_id gnl|my_center|LOCUS_29920 296949 296524 gene locus_tag LOCUS_29930 296949 296524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 297315 298109 gene locus_tag LOCUS_29940 297315 298109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 298909 298124 gene locus_tag LOCUS_29950 298909 298124 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108474.1 protein_id gnl|my_center|LOCUS_29950 299519 298959 gene locus_tag LOCUS_29960 299519 298959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 300001 299591 gene locus_tag LOCUS_29970 300001 299591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 300309 299998 gene locus_tag LOCUS_29980 300309 299998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29980 300758 300426 gene locus_tag LOCUS_29990 300758 300426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29990 302522 300801 gene locus_tag LOCUS_30000 302522 300801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 302706 303818 gene locus_tag LOCUS_30010 302706 303818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 304005 304556 gene locus_tag LOCUS_30020 304005 304556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 304560 305411 gene locus_tag LOCUS_30030 304560 305411 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_30030 305517 306947 gene locus_tag LOCUS_30040 305517 306947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 308125 306977 gene locus_tag LOCUS_30050 308125 306977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482679.1 protein_id gnl|my_center|LOCUS_30050 308814 308122 gene locus_tag LOCUS_30060 308814 308122 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261737.1 protein_id gnl|my_center|LOCUS_30060 310044 308827 gene locus_tag LOCUS_30070 310044 308827 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 protein_id gnl|my_center|LOCUS_30070 311204 310059 gene locus_tag LOCUS_30080 311204 310059 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261735.1 protein_id gnl|my_center|LOCUS_30080 312063 311278 gene locus_tag LOCUS_30090 312063 311278 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_30090 313699 312263 gene locus_tag LOCUS_30100 313699 312263 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480302.1 protein_id gnl|my_center|LOCUS_30100 315543 313714 gene locus_tag LOCUS_30110 315543 313714 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106392.1 protein_id gnl|my_center|LOCUS_30110 316323 315613 gene locus_tag LOCUS_30120 316323 315613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 316679 317059 gene locus_tag LOCUS_30130 316679 317059 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361979.1 protein_id gnl|my_center|LOCUS_30130 317617 317180 gene locus_tag LOCUS_30140 gene rpiB 317617 317180 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 protein_id gnl|my_center|LOCUS_30140 320657 317604 gene locus_tag LOCUS_30150 320657 317604 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_30150 323053 320777 gene locus_tag LOCUS_30160 323053 320777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 323233 323577 gene locus_tag LOCUS_30170 323233 323577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30170 324416 323727 gene locus_tag LOCUS_30180 324416 323727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30180 324775 324413 gene locus_tag LOCUS_30190 324775 324413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 325227 324838 gene locus_tag LOCUS_30200 gene gcvH 325227 324838 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964219.1 protein_id gnl|my_center|LOCUS_30200 326545 325238 gene locus_tag LOCUS_30210 326545 325238 CDS product citrate (Si)-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_30210 327802 326753 gene locus_tag LOCUS_30220 327802 326753 CDS product agmatinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 protein_id gnl|my_center|LOCUS_30220 328043 327935 gene locus_tag LOCUS_r00040 328043 327935 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 331079 328233 gene locus_tag LOCUS_r00050 331079 328233 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 331532 331458 gene locus_tag LOCUS_t00300 331532 331458 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 331642 331568 gene locus_tag LOCUS_t00310 331642 331568 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 333469 331955 gene locus_tag LOCUS_r00060 333469 331955 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 334140 336050 gene locus_tag LOCUS_30230 gene acs 334140 336050 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_30230 336625 336110 gene locus_tag LOCUS_30240 336625 336110 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802164.1 protein_id gnl|my_center|LOCUS_30240 336982 337923 gene locus_tag LOCUS_30250 336982 337923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 337924 338436 gene locus_tag LOCUS_30260 337924 338436 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906354.1 protein_id gnl|my_center|LOCUS_30260 340444 338720 gene locus_tag LOCUS_30270 340444 338720 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001800966.1 protein_id gnl|my_center|LOCUS_30270 340791 340480 gene locus_tag LOCUS_30280 340791 340480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 341162 340833 gene locus_tag LOCUS_30290 341162 340833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 341551 341234 gene locus_tag LOCUS_30300 341551 341234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 341852 342514 gene locus_tag LOCUS_30310 341852 342514 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478649.1 protein_id gnl|my_center|LOCUS_30310 345164 342594 gene locus_tag LOCUS_30320 345164 342594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 346163 345582 gene locus_tag LOCUS_30330 346163 345582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30330 347686 346163 gene locus_tag LOCUS_30340 347686 346163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30340 347931 347683 gene locus_tag LOCUS_30350 347931 347683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 348535 347972 gene locus_tag LOCUS_30360 348535 347972 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947316.1 protein_id gnl|my_center|LOCUS_30360 348706 348632 gene locus_tag LOCUS_t00320 348706 348632 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 349504 348893 gene locus_tag LOCUS_30370 349504 348893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 349690 351168 gene locus_tag LOCUS_30380 349690 351168 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_30380 351175 351993 gene locus_tag LOCUS_30390 gene murQ 351175 351993 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962884.1 protein_id gnl|my_center|LOCUS_30390 352654 352256 gene locus_tag LOCUS_30400 352654 352256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 353591 352944 gene locus_tag LOCUS_30410 353591 352944 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466562.1 protein_id gnl|my_center|LOCUS_30410 354029 354790 gene locus_tag LOCUS_30420 354029 354790 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766989.1 protein_id gnl|my_center|LOCUS_30420 354944 357460 gene locus_tag LOCUS_30430 gene bamA 354944 357460 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100221.1 protein_id gnl|my_center|LOCUS_30430 357531 358040 gene locus_tag LOCUS_30440 357531 358040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 358654 359772 gene locus_tag LOCUS_30450 358654 359772 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963516.1 protein_id gnl|my_center|LOCUS_30450 359841 360401 gene locus_tag LOCUS_30460 359841 360401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 360409 361653 gene locus_tag LOCUS_30470 360409 361653 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037710.1 protein_id gnl|my_center|LOCUS_30470 362458 362159 gene locus_tag LOCUS_30480 362458 362159 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953396.1 protein_id gnl|my_center|LOCUS_30480 362740 364962 gene locus_tag LOCUS_30490 362740 364962 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225341.1 protein_id gnl|my_center|LOCUS_30490 365094 365462 gene locus_tag LOCUS_30500 365094 365462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30500 365459 366427 gene locus_tag LOCUS_30510 365459 366427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30510 366427 366966 gene locus_tag LOCUS_30520 gene hscB 366427 366966 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384413.1 protein_id gnl|my_center|LOCUS_30520 366972 367056 gene locus_tag LOCUS_t00330 366972 367056 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 367120 369024 gene locus_tag LOCUS_30530 367120 369024 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203426.1 protein_id gnl|my_center|LOCUS_30530 369276 369049 gene locus_tag LOCUS_30540 369276 369049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 370508 369273 gene locus_tag LOCUS_30550 370508 369273 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761719.1 protein_id gnl|my_center|LOCUS_30550 370781 373585 gene locus_tag LOCUS_30560 370781 373585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 373782 374309 gene locus_tag LOCUS_30570 373782 374309 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962565.1 protein_id gnl|my_center|LOCUS_30570 374584 375573 gene locus_tag LOCUS_30580 374584 375573 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_30580 375588 377495 gene locus_tag LOCUS_30590 375588 377495 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962807.1 protein_id gnl|my_center|LOCUS_30590 379001 377625 gene locus_tag LOCUS_30600 379001 377625 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778115.1 protein_id gnl|my_center|LOCUS_30600 379611 380339 gene locus_tag LOCUS_30610 379611 380339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 381221 380577 gene locus_tag LOCUS_30620 381221 380577 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788686.1 protein_id gnl|my_center|LOCUS_30620 381856 381221 gene locus_tag LOCUS_30630 381856 381221 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_30630 383572 381926 gene locus_tag LOCUS_30640 gene pgi 383572 381926 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789994.1 protein_id gnl|my_center|LOCUS_30640 383796 385877 gene locus_tag LOCUS_30650 383796 385877 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766126.1 protein_id gnl|my_center|LOCUS_30650 385957 386289 gene locus_tag LOCUS_30660 385957 386289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 386308 388161 gene locus_tag LOCUS_30670 gene mutL 386308 388161 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963285.1 protein_id gnl|my_center|LOCUS_30670 388173 388778 gene locus_tag LOCUS_30680 388173 388778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 388780 389640 gene locus_tag LOCUS_30690 388780 389640 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_30690 389710 390774 gene locus_tag LOCUS_30700 389710 390774 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202685.1 protein_id gnl|my_center|LOCUS_30700 390778 391803 gene locus_tag LOCUS_30710 gene nadA 390778 391803 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140196.1 protein_id gnl|my_center|LOCUS_30710 391948 396924 gene locus_tag LOCUS_30720 391948 396924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 396890 398050 gene locus_tag LOCUS_30730 gene rffA 396890 398050 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176203.1 protein_id gnl|my_center|LOCUS_30730 398225 399646 gene locus_tag LOCUS_30740 398225 399646 CDS product MOP flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244371.1 protein_id gnl|my_center|LOCUS_30740 399637 400200 gene locus_tag LOCUS_30750 399637 400200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 400088 400798 gene locus_tag LOCUS_30760 400088 400798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 400862 402499 gene locus_tag LOCUS_30770 400862 402499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 402560 403222 gene locus_tag LOCUS_30780 402560 403222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 404223 403252 gene locus_tag LOCUS_30790 404223 403252 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30790 404609 404220 gene locus_tag LOCUS_30800 404609 404220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 404725 405375 gene locus_tag LOCUS_30810 gene upp 404725 405375 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761972.1 protein_id gnl|my_center|LOCUS_30810 405381 405938 gene locus_tag LOCUS_30820 405381 405938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 408942 405931 gene locus_tag LOCUS_30830 408942 405931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 409157 410320 gene locus_tag LOCUS_30840 409157 410320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 410603 411190 gene locus_tag LOCUS_30850 410603 411190 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_30850 411556 411326 gene locus_tag LOCUS_30860 411556 411326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 411889 411710 gene locus_tag LOCUS_30870 411889 411710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 412134 413612 gene locus_tag LOCUS_30880 gene crtI 412134 413612 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_30880 413628 414464 gene locus_tag LOCUS_30890 413628 414464 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_30890 414625 416880 gene locus_tag LOCUS_30900 414625 416880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 418754 416895 gene locus_tag LOCUS_30910 418754 416895 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111477477.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30910 419161 418733 gene locus_tag LOCUS_30920 419161 418733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30920 422005 419189 gene locus_tag LOCUS_30930 gene carB 422005 419189 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964089.1 protein_id gnl|my_center|LOCUS_30930 422469 422122 gene locus_tag LOCUS_30940 422469 422122 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003637688.1 protein_id gnl|my_center|LOCUS_30940 422752 422450 gene locus_tag LOCUS_30950 422752 422450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 423419 422916 gene locus_tag LOCUS_30960 423419 422916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 424943 423426 gene locus_tag LOCUS_30970 424943 423426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 425299 426159 gene locus_tag LOCUS_30980 gene nadC 425299 426159 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762206.1 protein_id gnl|my_center|LOCUS_30980 426226 426669 gene locus_tag LOCUS_30990 426226 426669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 426671 428809 gene locus_tag LOCUS_31000 gene rnr 426671 428809 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161889612.1 protein_id gnl|my_center|LOCUS_31000 428910 430250 gene locus_tag LOCUS_31010 428910 430250 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328040.1 protein_id gnl|my_center|LOCUS_31010 430496 431617 gene locus_tag LOCUS_31020 gene dnaN 430496 431617 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963230.1 protein_id gnl|my_center|LOCUS_31020 431655 432242 gene locus_tag LOCUS_31030 gene nadD 431655 432242 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116975564.1 protein_id gnl|my_center|LOCUS_31030 432315 434636 gene locus_tag LOCUS_31040 432315 434636 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_31040 435891 434626 gene locus_tag LOCUS_31050 gene kynU 435891 434626 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964305.1 protein_id gnl|my_center|LOCUS_31050 436964 435900 gene locus_tag LOCUS_31060 436964 435900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 437058 437393 gene locus_tag LOCUS_31070 437058 437393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 438008 437529 gene locus_tag LOCUS_31080 438008 437529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31080 439278 437959 gene locus_tag LOCUS_31090 439278 437959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31090 439566 445766 gene locus_tag LOCUS_31100 439566 445766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 445787 446737 gene locus_tag LOCUS_31110 445787 446737 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_31110 446737 448935 gene locus_tag LOCUS_31120 446737 448935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 450195 448942 gene locus_tag LOCUS_31130 gene metK 450195 448942 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962442.1 protein_id gnl|my_center|LOCUS_31130 451816 450341 gene locus_tag LOCUS_31140 gene fumC 451816 450341 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963718.1 protein_id gnl|my_center|LOCUS_31140 451998 453635 gene locus_tag LOCUS_31150 451998 453635 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403181.1 protein_id gnl|my_center|LOCUS_31150 453667 455496 gene locus_tag LOCUS_31160 453667 455496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 455580 455948 gene locus_tag LOCUS_31170 455580 455948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_31170 455959 456609 gene locus_tag LOCUS_31180 455959 456609 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792021.1 protein_id gnl|my_center|LOCUS_31180 456609 457493 gene locus_tag LOCUS_31190 456609 457493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 457501 458238 gene locus_tag LOCUS_31200 457501 458238 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704857.1 protein_id gnl|my_center|LOCUS_31200 458366 459166 gene locus_tag LOCUS_31210 458366 459166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 465823 459359 gene locus_tag LOCUS_31220 465823 459359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 467195 465975 gene locus_tag LOCUS_31230 467195 465975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 467321 467587 gene locus_tag LOCUS_31240 467321 467587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31240 467950 468468 gene locus_tag LOCUS_31250 467950 468468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 469323 469000 gene locus_tag LOCUS_31260 469323 469000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 469637 469449 gene locus_tag LOCUS_31270 469637 469449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 470420 469740 gene locus_tag LOCUS_31280 470420 469740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31280 470647 470438 gene locus_tag LOCUS_31290 470647 470438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 471134 470874 gene locus_tag LOCUS_31300 471134 470874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 471973 471140 gene locus_tag LOCUS_31310 471973 471140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31310 472664 472464 gene locus_tag LOCUS_31320 472664 472464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 473038 472817 gene locus_tag LOCUS_31330 473038 472817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 >Feature sequence05 986 1201 gene locus_tag LOCUS_31340 986 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31340 1326 1547 gene locus_tag LOCUS_31350 1326 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 2704 3165 gene locus_tag LOCUS_31360 2704 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31360 3331 3501 gene locus_tag LOCUS_31370 3331 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 3567 3920 gene locus_tag LOCUS_31380 3567 3920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31380 3968 4438 gene locus_tag LOCUS_31390 3968 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31390 4411 4749 gene locus_tag LOCUS_31400 4411 4749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31400 4890 4962 gene locus_tag LOCUS_t00340 4890 4962 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5242 5781 gene locus_tag LOCUS_31410 5242 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 5772 6212 gene locus_tag LOCUS_31420 5772 6212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31420 6221 6436 gene locus_tag LOCUS_31430 6221 6436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 6693 7082 gene locus_tag LOCUS_31440 6693 7082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 7179 7994 gene locus_tag LOCUS_31450 7179 7994 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062542960.1 protein_id gnl|my_center|LOCUS_31450 8004 8963 gene locus_tag LOCUS_31460 8004 8963 CDS product DUF3871 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107537.1 protein_id gnl|my_center|LOCUS_31460 9815 9567 gene locus_tag LOCUS_31470 9815 9567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 10672 10433 gene locus_tag LOCUS_31480 10672 10433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 10836 10669 gene locus_tag LOCUS_31490 10836 10669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 11398 11039 gene locus_tag LOCUS_31500 11398 11039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 11689 12204 gene locus_tag LOCUS_31510 11689 12204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 12257 12592 gene locus_tag LOCUS_31520 12257 12592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 13155 12820 gene locus_tag LOCUS_31530 13155 12820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 13825 13682 gene locus_tag LOCUS_31540 13825 13682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 14379 13912 gene locus_tag LOCUS_31550 14379 13912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 14646 14440 gene locus_tag LOCUS_31560 14646 14440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 15123 14707 gene locus_tag LOCUS_31570 15123 14707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 15441 15184 gene locus_tag LOCUS_31580 15441 15184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 16280 15738 gene locus_tag LOCUS_31590 16280 15738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 16537 16277 gene locus_tag LOCUS_31600 16537 16277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 17133 16861 gene locus_tag LOCUS_31610 17133 16861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 17264 17112 gene locus_tag LOCUS_31620 17264 17112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 17886 17494 gene locus_tag LOCUS_31630 17886 17494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 18470 17925 gene locus_tag LOCUS_31640 18470 17925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 18883 18647 gene locus_tag LOCUS_31650 18883 18647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 22069 19322 gene locus_tag LOCUS_31660 22069 19322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31660 23654 22521 gene locus_tag LOCUS_31670 23654 22521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 23897 25735 gene locus_tag LOCUS_31680 23897 25735 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788960.1 protein_id gnl|my_center|LOCUS_31680 25902 27050 gene locus_tag LOCUS_31690 25902 27050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 26999 27604 gene locus_tag LOCUS_31700 26999 27604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 27665 28735 gene locus_tag LOCUS_31710 27665 28735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 29435 28755 gene locus_tag LOCUS_31720 29435 28755 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956832.1 protein_id gnl|my_center|LOCUS_31720 30361 29591 gene locus_tag LOCUS_31730 30361 29591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31730 32076 30358 gene locus_tag LOCUS_31740 32076 30358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 34372 32273 gene locus_tag LOCUS_31750 34372 32273 CDS product T9SS type A sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128388620.1 protein_id gnl|my_center|LOCUS_31750 36809 34440 gene locus_tag LOCUS_31760 36809 34440 CDS product T9SS type A sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128388620.1 protein_id gnl|my_center|LOCUS_31760 37246 38589 gene locus_tag LOCUS_31770 37246 38589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 39178 38693 gene locus_tag LOCUS_31780 39178 38693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 39779 39270 gene locus_tag LOCUS_31790 39779 39270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 40243 41556 gene locus_tag LOCUS_31800 40243 41556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 41520 44423 gene locus_tag LOCUS_31810 41520 44423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 44644 45129 gene locus_tag LOCUS_31820 44644 45129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 45446 48715 gene locus_tag LOCUS_31830 45446 48715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 49228 50826 gene locus_tag LOCUS_31840 49228 50826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 51332 51721 gene locus_tag LOCUS_31850 51332 51721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 52258 51794 gene locus_tag LOCUS_31860 52258 51794 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_31860 52889 52248 gene locus_tag LOCUS_31870 52889 52248 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964126.1 protein_id gnl|my_center|LOCUS_31870 53832 52915 gene locus_tag LOCUS_31880 53832 52915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 54035 54286 gene locus_tag LOCUS_31890 gene rpsT 54035 54286 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783989.1 protein_id gnl|my_center|LOCUS_31890 54576 55565 gene locus_tag LOCUS_31900 54576 55565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 55852 56427 gene locus_tag LOCUS_31910 55852 56427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 56495 57070 gene locus_tag LOCUS_31920 56495 57070 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963489.1 protein_id gnl|my_center|LOCUS_31920 57130 58125 gene locus_tag LOCUS_31930 gene obgE 57130 58125 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785536.1 protein_id gnl|my_center|LOCUS_31930 59698 58259 gene locus_tag LOCUS_31940 59698 58259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 60715 59936 gene locus_tag LOCUS_31950 60715 59936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 63628 60785 gene locus_tag LOCUS_31960 gene uvrA 63628 60785 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963005.1 protein_id gnl|my_center|LOCUS_31960 64197 63757 gene locus_tag LOCUS_31970 gene ybeY 64197 63757 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108739.1 protein_id gnl|my_center|LOCUS_31970 64625 64212 gene locus_tag LOCUS_31980 64625 64212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 68139 64792 gene locus_tag LOCUS_31990 68139 64792 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_31990 68366 69550 gene locus_tag LOCUS_32000 68366 69550 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_32000 71133 69556 gene locus_tag LOCUS_32010 71133 69556 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964301.1 protein_id gnl|my_center|LOCUS_32010 71427 72701 gene locus_tag LOCUS_32020 71427 72701 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963488.1 protein_id gnl|my_center|LOCUS_32020 72871 73716 gene locus_tag LOCUS_32030 72871 73716 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962903.1 protein_id gnl|my_center|LOCUS_32030 74246 73773 gene locus_tag LOCUS_32040 74246 73773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 75749 74352 gene locus_tag LOCUS_32050 75749 74352 CDS product hemin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795092.1 protein_id gnl|my_center|LOCUS_32050 77427 75946 gene locus_tag LOCUS_32060 77427 75946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 77678 79144 gene locus_tag LOCUS_32070 gene proS 77678 79144 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107525.1 protein_id gnl|my_center|LOCUS_32070 79177 79551 gene locus_tag LOCUS_32080 79177 79551 CDS product DUF3127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788752.1 protein_id gnl|my_center|LOCUS_32080 81578 79635 gene locus_tag LOCUS_32090 81578 79635 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963039.1 protein_id gnl|my_center|LOCUS_32090 83641 81698 gene locus_tag LOCUS_32100 gene ftsH 83641 81698 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962764.1 protein_id gnl|my_center|LOCUS_32100 84107 83730 gene locus_tag LOCUS_32110 gene rsfS 84107 83730 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816526.1 protein_id gnl|my_center|LOCUS_32110 84430 84948 gene locus_tag LOCUS_32120 84430 84948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 85209 86645 gene locus_tag LOCUS_32130 85209 86645 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205394818.1 protein_id gnl|my_center|LOCUS_32130 86723 87760 gene locus_tag LOCUS_32140 gene pheS 86723 87760 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962303.1 protein_id gnl|my_center|LOCUS_32140 88639 87896 gene locus_tag LOCUS_32150 gene kdsB 88639 87896 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761419.1 protein_id gnl|my_center|LOCUS_32150 88816 89742 gene locus_tag LOCUS_32160 88816 89742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 90745 89819 gene locus_tag LOCUS_32170 90745 89819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 91735 90803 gene locus_tag LOCUS_32180 91735 90803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32180 92928 91717 gene locus_tag LOCUS_32190 92928 91717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32190 94430 93480 gene locus_tag LOCUS_32200 94430 93480 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072162.1 protein_id gnl|my_center|LOCUS_32200 96617 94881 gene locus_tag LOCUS_32210 96617 94881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 97590 96628 gene locus_tag LOCUS_32220 97590 96628 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_32220 103880 97587 gene locus_tag LOCUS_32230 103880 97587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 105084 104149 gene locus_tag LOCUS_32240 105084 104149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 105434 106996 gene locus_tag LOCUS_32250 105434 106996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 106993 107736 gene locus_tag LOCUS_32260 106993 107736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 107643 108164 gene locus_tag LOCUS_32270 107643 108164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 108240 109376 gene locus_tag LOCUS_32280 108240 109376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 109656 110225 gene locus_tag LOCUS_32290 109656 110225 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722009.1 protein_id gnl|my_center|LOCUS_32290 110537 111709 gene locus_tag LOCUS_32300 110537 111709 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921980.1 protein_id gnl|my_center|LOCUS_32300 111882 112139 gene locus_tag LOCUS_32310 111882 112139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 112876 112145 gene locus_tag LOCUS_32320 gene rlmB 112876 112145 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_32320 113313 113852 gene locus_tag LOCUS_32330 113313 113852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 113798 116806 gene locus_tag LOCUS_32340 113798 116806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32340 117027 119720 gene locus_tag LOCUS_32350 117027 119720 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013547257.1 protein_id gnl|my_center|LOCUS_32350 119956 122898 gene locus_tag LOCUS_32360 119956 122898 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_32360 122953 124485 gene locus_tag LOCUS_32370 122953 124485 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201972.1 protein_id gnl|my_center|LOCUS_32370 124539 125450 gene locus_tag LOCUS_32380 124539 125450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 125599 127158 gene locus_tag LOCUS_32390 125599 127158 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791295.1 protein_id gnl|my_center|LOCUS_32390 127172 128308 gene locus_tag LOCUS_32400 127172 128308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32400 128392 128646 gene locus_tag LOCUS_32410 128392 128646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32410 128746 130911 gene locus_tag LOCUS_32420 gene bglX 128746 130911 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_32420 136974 131203 gene locus_tag LOCUS_32430 136974 131203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 137533 138012 gene locus_tag LOCUS_32440 137533 138012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 138052 139521 gene locus_tag LOCUS_32450 138052 139521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 139742 140227 gene locus_tag LOCUS_32460 139742 140227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 140714 140244 gene locus_tag LOCUS_32470 140714 140244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 140974 141366 gene locus_tag LOCUS_32480 140974 141366 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940847.1 protein_id gnl|my_center|LOCUS_32480 141752 142126 gene locus_tag LOCUS_32490 141752 142126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 142712 143458 gene locus_tag LOCUS_32500 142712 143458 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881230.1 protein_id gnl|my_center|LOCUS_32500 144541 143489 gene locus_tag LOCUS_32510 144541 143489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 144688 145746 gene locus_tag LOCUS_32520 144688 145746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 145748 147163 gene locus_tag LOCUS_32530 145748 147163 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_32530 147322 147816 gene locus_tag LOCUS_32540 147322 147816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 154484 148329 gene locus_tag LOCUS_32550 154484 148329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 154918 155373 gene locus_tag LOCUS_32560 154918 155373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 155896 158787 gene locus_tag LOCUS_32570 155896 158787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 159065 159247 gene locus_tag LOCUS_32580 159065 159247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 159606 159295 gene locus_tag LOCUS_32590 159606 159295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 160689 159778 gene locus_tag LOCUS_32600 160689 159778 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091336.1 protein_id gnl|my_center|LOCUS_32600 162382 160976 gene locus_tag LOCUS_32610 162382 160976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 163063 164967 gene locus_tag LOCUS_32620 163063 164967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 165251 166807 gene locus_tag LOCUS_32630 165251 166807 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275523.1 protein_id gnl|my_center|LOCUS_32630 166832 167794 gene locus_tag LOCUS_32640 166832 167794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 169185 167809 gene locus_tag LOCUS_32650 169185 167809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 170613 169369 gene locus_tag LOCUS_32660 170613 169369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 171137 170934 gene locus_tag LOCUS_32670 171137 170934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32670 171580 171146 gene locus_tag LOCUS_32680 171580 171146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 173000 171657 gene locus_tag LOCUS_32690 173000 171657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 173446 174213 gene locus_tag LOCUS_32700 173446 174213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 175949 176413 gene locus_tag LOCUS_32710 175949 176413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 177068 177721 gene locus_tag LOCUS_32720 177068 177721 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676633.1 protein_id gnl|my_center|LOCUS_32720 178219 178022 gene locus_tag LOCUS_32730 178219 178022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 180013 178370 gene locus_tag LOCUS_32740 180013 178370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 180534 180010 gene locus_tag LOCUS_32750 180534 180010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 180959 180519 gene locus_tag LOCUS_32760 180959 180519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 181440 181886 gene locus_tag LOCUS_32770 181440 181886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 181890 183515 gene locus_tag LOCUS_32780 181890 183515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 183869 188809 gene locus_tag LOCUS_32790 183869 188809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 188852 190447 gene locus_tag LOCUS_32800 188852 190447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 190437 190793 gene locus_tag LOCUS_32810 190437 190793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 190735 191226 gene locus_tag LOCUS_32820 190735 191226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32820 194394 191287 gene locus_tag LOCUS_32830 gene ccsA 194394 191287 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963539.1 protein_id gnl|my_center|LOCUS_32830 195094 195270 gene locus_tag LOCUS_32840 195094 195270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 195656 195982 gene locus_tag LOCUS_32850 195656 195982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 196240 196830 gene locus_tag LOCUS_32860 gene nudK 196240 196830 CDS product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540486.1 protein_id gnl|my_center|LOCUS_32860 197061 197594 gene locus_tag LOCUS_32870 197061 197594 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763722.1 protein_id gnl|my_center|LOCUS_32870 197697 198233 gene locus_tag LOCUS_32880 197697 198233 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108357.1 protein_id gnl|my_center|LOCUS_32880 198349 199356 gene locus_tag LOCUS_32890 gene mutY 198349 199356 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 protein_id gnl|my_center|LOCUS_32890 199460 199687 gene locus_tag LOCUS_32900 199460 199687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32900 199986 201326 gene locus_tag LOCUS_32910 199986 201326 CDS product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 protein_id gnl|my_center|LOCUS_32910 201585 201887 gene locus_tag LOCUS_32920 201585 201887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32920 203776 201968 gene locus_tag LOCUS_32930 203776 201968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 204372 203893 gene locus_tag LOCUS_32940 204372 203893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 204622 205386 gene locus_tag LOCUS_32950 gene yaaA 204622 205386 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420750.1 protein_id gnl|my_center|LOCUS_32950 205461 206882 gene locus_tag LOCUS_32960 205461 206882 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963040.1 protein_id gnl|my_center|LOCUS_32960 206955 209471 gene locus_tag LOCUS_32970 206955 209471 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784143.1 protein_id gnl|my_center|LOCUS_32970 209686 210027 gene locus_tag LOCUS_32980 209686 210027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 210067 210927 gene locus_tag LOCUS_32990 gene tesB 210067 210927 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208625.1 protein_id gnl|my_center|LOCUS_32990 214224 210952 gene locus_tag LOCUS_33000 214224 210952 CDS product T9SS type A sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962267.1 protein_id gnl|my_center|LOCUS_33000 215817 214405 gene locus_tag LOCUS_33010 215817 214405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 216370 215804 gene locus_tag LOCUS_33020 216370 215804 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760422.1 protein_id gnl|my_center|LOCUS_33020 219338 216663 gene locus_tag LOCUS_33030 219338 216663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 220664 219531 gene locus_tag LOCUS_33040 220664 219531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 221967 220657 gene locus_tag LOCUS_33050 221967 220657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 223311 222040 gene locus_tag LOCUS_33060 223311 222040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 224795 223323 gene locus_tag LOCUS_33070 224795 223323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 225332 224802 gene locus_tag LOCUS_33080 225332 224802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 226306 225335 gene locus_tag LOCUS_33090 226306 225335 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962774.1 protein_id gnl|my_center|LOCUS_33090 226734 226810 gene locus_tag LOCUS_t00350 226734 226810 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 227063 228313 gene locus_tag LOCUS_33100 227063 228313 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_33100 228485 229231 gene locus_tag LOCUS_33110 228485 229231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 230104 230592 gene locus_tag LOCUS_33120 230104 230592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 231112 231369 gene locus_tag LOCUS_33130 231112 231369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964410.1 protein_id gnl|my_center|LOCUS_33130 231353 231577 gene locus_tag LOCUS_33140 231353 231577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 232592 231747 gene locus_tag LOCUS_33150 232592 231747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 232977 233147 gene locus_tag LOCUS_33160 232977 233147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 234250 234438 gene locus_tag LOCUS_33170 234250 234438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 235147 234815 gene locus_tag LOCUS_33180 235147 234815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 235295 235098 gene locus_tag LOCUS_33190 235295 235098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 236053 235379 gene locus_tag LOCUS_33200 236053 235379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 236342 236184 gene locus_tag LOCUS_33210 236342 236184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 236579 236494 gene locus_tag LOCUS_t00360 236579 236494 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 237567 237046 gene locus_tag LOCUS_33220 237567 237046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 238661 237702 gene locus_tag LOCUS_33230 238661 237702 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007836183.1 protein_id gnl|my_center|LOCUS_33230 238783 238646 gene locus_tag LOCUS_33240 238783 238646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33240 239643 238807 gene locus_tag LOCUS_33250 239643 238807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 239999 239589 gene locus_tag LOCUS_33260 239999 239589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33260 240628 240005 gene locus_tag LOCUS_33270 240628 240005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 242174 243439 gene locus_tag LOCUS_33280 242174 243439 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072530700.1 protein_id gnl|my_center|LOCUS_33280 243609 243457 gene locus_tag LOCUS_33290 243609 243457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 243608 243982 gene locus_tag LOCUS_33300 243608 243982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 244025 244822 gene locus_tag LOCUS_33310 244025 244822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 244833 245657 gene locus_tag LOCUS_33320 244833 245657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 246063 246512 gene locus_tag LOCUS_33330 246063 246512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 246627 247448 gene locus_tag LOCUS_33340 246627 247448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 247478 248140 gene locus_tag LOCUS_33350 247478 248140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 248233 249159 gene locus_tag LOCUS_33360 248233 249159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 249225 250184 gene locus_tag LOCUS_33370 249225 250184 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328040.1 protein_id gnl|my_center|LOCUS_33370 250246 251274 gene locus_tag LOCUS_33380 250246 251274 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_33380 251322 251798 gene locus_tag LOCUS_33390 251322 251798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33390 251801 253048 gene locus_tag LOCUS_33400 251801 253048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33400 >Feature sequence06 1072 365 gene locus_tag LOCUS_33410 1072 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 3324 1087 gene locus_tag LOCUS_33420 3324 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 4354 3677 gene locus_tag LOCUS_33430 4354 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33430 4763 4317 gene locus_tag LOCUS_33440 4763 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33440 4960 7632 gene locus_tag LOCUS_33450 4960 7632 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762511.1 protein_id gnl|my_center|LOCUS_33450 7681 9105 gene locus_tag LOCUS_33460 7681 9105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 9966 9109 gene locus_tag LOCUS_33470 9966 9109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 10804 9974 gene locus_tag LOCUS_33480 10804 9974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 11738 10848 gene locus_tag LOCUS_33490 11738 10848 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963771.1 protein_id gnl|my_center|LOCUS_33490 14329 11771 gene locus_tag LOCUS_33500 14329 11771 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_33500 15384 14335 gene locus_tag LOCUS_33510 15384 14335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 15578 16762 gene locus_tag LOCUS_33520 15578 16762 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764417.1 protein_id gnl|my_center|LOCUS_33520 16790 18583 gene locus_tag LOCUS_33530 gene lepA 16790 18583 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765513.1 protein_id gnl|my_center|LOCUS_33530 18610 19521 gene locus_tag LOCUS_33540 18610 19521 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_33540 20625 19555 gene locus_tag LOCUS_33550 20625 19555 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_33550 20906 20625 gene locus_tag LOCUS_33560 20906 20625 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089433.1 protein_id gnl|my_center|LOCUS_33560 22434 21112 gene locus_tag LOCUS_33570 gene nqrF 22434 21112 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337386.1 protein_id gnl|my_center|LOCUS_33570 23055 22450 gene locus_tag LOCUS_33580 gene nqrE 23055 22450 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418136.1 protein_id gnl|my_center|LOCUS_33580 23776 23075 gene locus_tag LOCUS_33590 23776 23075 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787205.1 protein_id gnl|my_center|LOCUS_33590 24440 23778 gene locus_tag LOCUS_33600 24440 23778 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105182.1 protein_id gnl|my_center|LOCUS_33600 25767 24517 gene locus_tag LOCUS_33610 25767 24517 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763477.1 protein_id gnl|my_center|LOCUS_33610 27300 25789 gene locus_tag LOCUS_33620 27300 25789 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765874.1 protein_id gnl|my_center|LOCUS_33620 29002 27563 gene locus_tag LOCUS_33630 29002 27563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 29670 29017 gene locus_tag LOCUS_33640 gene pdxH 29670 29017 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403320.1 protein_id gnl|my_center|LOCUS_33640 31355 29679 gene locus_tag LOCUS_33650 31355 29679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 33616 31412 gene locus_tag LOCUS_33660 33616 31412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 33729 35735 gene locus_tag LOCUS_33670 33729 35735 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838696.1 protein_id gnl|my_center|LOCUS_33670 36814 35786 gene locus_tag LOCUS_33680 36814 35786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 36928 37635 gene locus_tag LOCUS_33690 gene lipB 36928 37635 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963333.1 protein_id gnl|my_center|LOCUS_33690 37653 38174 gene locus_tag LOCUS_33700 37653 38174 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_33700 39455 38214 gene locus_tag LOCUS_33710 gene hutI 39455 38214 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963888.1 protein_id gnl|my_center|LOCUS_33710 40223 39474 gene locus_tag LOCUS_33720 40223 39474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 40585 40672 gene locus_tag LOCUS_t00370 40585 40672 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 40705 40780 gene locus_tag LOCUS_t00380 40705 40780 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 41048 41950 gene locus_tag LOCUS_33730 gene nusB 41048 41950 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962698.1 protein_id gnl|my_center|LOCUS_33730 41978 42526 gene locus_tag LOCUS_33740 41978 42526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 43564 42560 gene locus_tag LOCUS_33750 43564 42560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 43809 43630 gene locus_tag LOCUS_33760 43809 43630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 44185 43790 gene locus_tag LOCUS_33770 44185 43790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 44898 44263 gene locus_tag LOCUS_33780 gene trmH 44898 44263 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209003.1 protein_id gnl|my_center|LOCUS_33780 45911 44907 gene locus_tag LOCUS_33790 45911 44907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 46251 45970 gene locus_tag LOCUS_33800 46251 45970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 47815 46277 gene locus_tag LOCUS_33810 gene guaA 47815 46277 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124903406.1 protein_id gnl|my_center|LOCUS_33810 49222 47876 gene locus_tag LOCUS_33820 49222 47876 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962341.1 protein_id gnl|my_center|LOCUS_33820 50617 49259 gene locus_tag LOCUS_33830 50617 49259 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799064.1 protein_id gnl|my_center|LOCUS_33830 51486 50653 gene locus_tag LOCUS_33840 51486 50653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 52321 51488 gene locus_tag LOCUS_33850 52321 51488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 53357 52335 gene locus_tag LOCUS_33860 53357 52335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33860 63019 53654 gene locus_tag LOCUS_33870 63019 53654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 75797 63471 gene locus_tag LOCUS_33880 75797 63471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 76576 76037 gene locus_tag LOCUS_33890 76576 76037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 76727 77932 gene locus_tag LOCUS_33900 gene tilS 76727 77932 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963738.1 protein_id gnl|my_center|LOCUS_33900 78275 78054 gene locus_tag LOCUS_33910 78275 78054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33910 78486 78331 gene locus_tag LOCUS_33920 78486 78331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33920 78911 78426 gene locus_tag LOCUS_33930 78911 78426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33930 79381 78911 gene locus_tag LOCUS_33940 79381 78911 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962524.1 protein_id gnl|my_center|LOCUS_33940 82054 79625 gene locus_tag LOCUS_33950 82054 79625 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964459.1 protein_id gnl|my_center|LOCUS_33950 83435 82326 gene locus_tag LOCUS_33960 83435 82326 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941549.1 protein_id gnl|my_center|LOCUS_33960 83705 85153 gene locus_tag LOCUS_33970 83705 85153 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250663.1 protein_id gnl|my_center|LOCUS_33970 85177 86259 gene locus_tag LOCUS_33980 85177 86259 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942498.1 protein_id gnl|my_center|LOCUS_33980 86240 87697 gene locus_tag LOCUS_33990 86240 87697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 87864 88835 gene locus_tag LOCUS_34000 87864 88835 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555792.1 protein_id gnl|my_center|LOCUS_34000 88911 90032 gene locus_tag LOCUS_34010 gene recF 88911 90032 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964102.1 protein_id gnl|my_center|LOCUS_34010 90126 90419 gene locus_tag LOCUS_34020 90126 90419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 90563 91279 gene locus_tag LOCUS_34030 90563 91279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 91353 92801 gene locus_tag LOCUS_34040 91353 92801 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046312529.1 protein_id gnl|my_center|LOCUS_34040 92887 92960 gene locus_tag LOCUS_t00390 92887 92960 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 92978 93062 gene locus_tag LOCUS_t00400 92978 93062 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 93157 93573 gene locus_tag LOCUS_34050 93157 93573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 93663 94340 gene locus_tag LOCUS_34060 93663 94340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 97716 94468 gene locus_tag LOCUS_34070 97716 94468 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404656.1 protein_id gnl|my_center|LOCUS_34070 98049 98594 gene locus_tag LOCUS_34080 98049 98594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 99438 98602 gene locus_tag LOCUS_34090 99438 98602 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100725.1 protein_id gnl|my_center|LOCUS_34090 99914 99444 gene locus_tag LOCUS_34100 99914 99444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 100841 99993 gene locus_tag LOCUS_34110 100841 99993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 102157 100847 gene locus_tag LOCUS_34120 102157 100847 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_34120 102305 104032 gene locus_tag LOCUS_34130 102305 104032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 104180 104049 gene locus_tag LOCUS_34140 104180 104049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 104241 104669 gene locus_tag LOCUS_34150 104241 104669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 104671 104856 gene locus_tag LOCUS_34160 104671 104856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 105501 104926 gene locus_tag LOCUS_34170 105501 104926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 105826 105542 gene locus_tag LOCUS_34180 105826 105542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 106203 105826 gene locus_tag LOCUS_34190 106203 105826 CDS product START-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 protein_id gnl|my_center|LOCUS_34190 106494 106360 gene locus_tag LOCUS_34200 106494 106360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 106568 107437 gene locus_tag LOCUS_34210 106568 107437 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_34210 107456 107863 gene locus_tag LOCUS_34220 107456 107863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 108152 108502 gene locus_tag LOCUS_34230 108152 108502 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962382.1 protein_id gnl|my_center|LOCUS_34230 108509 109219 gene locus_tag LOCUS_34240 108509 109219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34240 109206 109556 gene locus_tag LOCUS_34250 109206 109556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34250 110560 109637 gene locus_tag LOCUS_34260 110560 109637 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_34260 111389 110595 gene locus_tag LOCUS_34270 111389 110595 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944168.1 protein_id gnl|my_center|LOCUS_34270 111998 111525 gene locus_tag LOCUS_34280 111998 111525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 112531 112049 gene locus_tag LOCUS_34290 gene sixA 112531 112049 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_34290 113295 113107 gene locus_tag LOCUS_34300 113295 113107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 113628 114635 gene locus_tag LOCUS_34310 gene dusB 113628 114635 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964342.1 protein_id gnl|my_center|LOCUS_34310 114614 116077 gene locus_tag LOCUS_34320 114614 116077 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303110.1 protein_id gnl|my_center|LOCUS_34320 117489 116080 gene locus_tag LOCUS_34330 117489 116080 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_34330 118794 117502 gene locus_tag LOCUS_34340 118794 117502 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503865.1 protein_id gnl|my_center|LOCUS_34340 119008 119835 gene locus_tag LOCUS_34350 119008 119835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 119841 120665 gene locus_tag LOCUS_34360 gene mscS 119841 120665 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_34360 120680 122164 gene locus_tag LOCUS_34370 120680 122164 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399966.1 protein_id gnl|my_center|LOCUS_34370 123131 122193 gene locus_tag LOCUS_34380 gene miaA 123131 122193 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964020.1 protein_id gnl|my_center|LOCUS_34380 123173 123859 gene locus_tag LOCUS_34390 123173 123859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 123944 124426 gene locus_tag LOCUS_34400 123944 124426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 124493 125470 gene locus_tag LOCUS_34410 124493 125470 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072178.1 protein_id gnl|my_center|LOCUS_34410 125506 126006 gene locus_tag LOCUS_34420 125506 126006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 126509 126075 gene locus_tag LOCUS_34430 126509 126075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 127478 126675 gene locus_tag LOCUS_34440 127478 126675 CDS product DUF1460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794479.1 protein_id gnl|my_center|LOCUS_34440 127582 128007 gene locus_tag LOCUS_34450 127582 128007 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705622.1 protein_id gnl|my_center|LOCUS_34450 128223 128474 gene locus_tag LOCUS_34460 128223 128474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 128602 128907 gene locus_tag LOCUS_34470 gene trxA 128602 128907 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760534.1 protein_id gnl|my_center|LOCUS_34470 130327 129041 gene locus_tag LOCUS_34480 130327 129041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 130431 130979 gene locus_tag LOCUS_34490 gene pyrR 130431 130979 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_34490 131000 131929 gene locus_tag LOCUS_34500 131000 131929 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963902.1 protein_id gnl|my_center|LOCUS_34500 132007 133425 gene locus_tag LOCUS_34510 132007 133425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 136229 135486 gene locus_tag LOCUS_34520 136229 135486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 137570 138763 gene locus_tag LOCUS_34530 137570 138763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 139032 139781 gene locus_tag LOCUS_34540 139032 139781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 142054 141434 gene locus_tag LOCUS_34550 142054 141434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 142609 142983 gene locus_tag LOCUS_34560 142609 142983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 143423 143935 gene locus_tag LOCUS_34570 143423 143935 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460553.1 protein_id gnl|my_center|LOCUS_34570 143937 144224 gene locus_tag LOCUS_34580 143937 144224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 144521 144703 gene locus_tag LOCUS_34590 144521 144703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 144700 145266 gene locus_tag LOCUS_34600 144700 145266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 145590 145826 gene locus_tag LOCUS_34610 145590 145826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 145982 146335 gene locus_tag LOCUS_34620 145982 146335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34620 146416 146616 gene locus_tag LOCUS_34630 146416 146616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34630 146730 147116 gene locus_tag LOCUS_34640 146730 147116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34640 147987 148358 gene locus_tag LOCUS_34650 147987 148358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34650 >Feature sequence07 62 502 gene locus_tag LOCUS_34660 62 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34660 519 911 gene locus_tag LOCUS_34670 519 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34670 911 1447 gene locus_tag LOCUS_34680 911 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34680 1545 1856 gene locus_tag LOCUS_34690 1545 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34690 1965 2756 gene locus_tag LOCUS_34700 1965 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 3591 4385 gene locus_tag LOCUS_34710 3591 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 5696 6046 gene locus_tag LOCUS_34720 5696 6046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 7421 6132 gene locus_tag LOCUS_34730 7421 6132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 7527 9197 gene locus_tag LOCUS_34740 7527 9197 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109110.1 protein_id gnl|my_center|LOCUS_34740 11406 9751 gene locus_tag LOCUS_34750 11406 9751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 12278 11526 gene locus_tag LOCUS_34760 12278 11526 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839974.1 protein_id gnl|my_center|LOCUS_34760 14083 12275 gene locus_tag LOCUS_34770 14083 12275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 14588 15388 gene locus_tag LOCUS_34780 14588 15388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 15447 15914 gene locus_tag LOCUS_34790 15447 15914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 15983 16402 gene locus_tag LOCUS_34800 15983 16402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 16444 16851 gene locus_tag LOCUS_34810 16444 16851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 18329 17847 gene locus_tag LOCUS_34820 18329 17847 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788988.1 protein_id gnl|my_center|LOCUS_34820 19491 18934 gene locus_tag LOCUS_34830 19491 18934 CDS product DUF1572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 protein_id gnl|my_center|LOCUS_34830 20890 19520 gene locus_tag LOCUS_34840 20890 19520 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404453.1 protein_id gnl|my_center|LOCUS_34840 21111 22412 gene locus_tag LOCUS_34850 21111 22412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 22831 22409 gene locus_tag LOCUS_34860 22831 22409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 22920 23879 gene locus_tag LOCUS_34870 22920 23879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34870 23794 23976 gene locus_tag LOCUS_34880 23794 23976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34880 24118 26463 gene locus_tag LOCUS_34890 24118 26463 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_34890 26460 27407 gene locus_tag LOCUS_34900 26460 27407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 28160 27432 gene locus_tag LOCUS_34910 28160 27432 CDS product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242863.1 protein_id gnl|my_center|LOCUS_34910 29887 28301 gene locus_tag LOCUS_34920 29887 28301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 32709 29914 gene locus_tag LOCUS_34930 32709 29914 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_34930 33053 35458 gene locus_tag LOCUS_34940 33053 35458 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107142.1 protein_id gnl|my_center|LOCUS_34940 36343 35552 gene locus_tag LOCUS_34950 36343 35552 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867386.1 protein_id gnl|my_center|LOCUS_34950 37371 36358 gene locus_tag LOCUS_34960 37371 36358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 37683 38093 gene locus_tag LOCUS_34970 37683 38093 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056577.1 protein_id gnl|my_center|LOCUS_34970 38116 39228 gene locus_tag LOCUS_34980 38116 39228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 39246 40694 gene locus_tag LOCUS_34990 39246 40694 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229069.1 protein_id gnl|my_center|LOCUS_34990 42461 40716 gene locus_tag LOCUS_35000 42461 40716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 43270 43019 gene locus_tag LOCUS_35010 43270 43019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787898.1 protein_id gnl|my_center|LOCUS_35010 44630 43380 gene locus_tag LOCUS_35020 44630 43380 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962581.1 protein_id gnl|my_center|LOCUS_35020 45980 44736 gene locus_tag LOCUS_35030 45980 44736 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_35030 46113 47318 gene locus_tag LOCUS_35040 46113 47318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 47903 47325 gene locus_tag LOCUS_35050 47903 47325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 50397 48037 gene locus_tag LOCUS_35060 50397 48037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 51629 50505 gene locus_tag LOCUS_35070 51629 50505 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_35070 52838 51705 gene locus_tag LOCUS_35080 52838 51705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35080 53340 52846 gene locus_tag LOCUS_35090 53340 52846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35090 54553 53357 gene locus_tag LOCUS_35100 54553 53357 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962199.1 protein_id gnl|my_center|LOCUS_35100 55572 54559 gene locus_tag LOCUS_35110 gene gap 55572 54559 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016560.1 protein_id gnl|my_center|LOCUS_35110 57051 55753 gene locus_tag LOCUS_35120 57051 55753 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211395.1 protein_id gnl|my_center|LOCUS_35120 58154 57048 gene locus_tag LOCUS_35130 58154 57048 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975888.1 protein_id gnl|my_center|LOCUS_35130 59119 58268 gene locus_tag LOCUS_35140 59119 58268 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765729.1 protein_id gnl|my_center|LOCUS_35140 60028 59396 gene locus_tag LOCUS_35150 60028 59396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 60800 61279 gene locus_tag LOCUS_35160 gene coaD 60800 61279 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681221.1 protein_id gnl|my_center|LOCUS_35160 61302 62933 gene locus_tag LOCUS_35170 gene pruA 61302 62933 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_35170 62938 63348 gene locus_tag LOCUS_35180 gene ruvX 62938 63348 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583387.1 protein_id gnl|my_center|LOCUS_35180 63351 63908 gene locus_tag LOCUS_35190 gene def 63351 63908 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760700.1 protein_id gnl|my_center|LOCUS_35190 64030 64872 gene locus_tag LOCUS_35200 64030 64872 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964449.1 protein_id gnl|my_center|LOCUS_35200 64918 65136 gene locus_tag LOCUS_35210 64918 65136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 65213 66019 gene locus_tag LOCUS_35220 65213 66019 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_35220 66009 66743 gene locus_tag LOCUS_35230 gene truB 66009 66743 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964446.1 protein_id gnl|my_center|LOCUS_35230 66835 68235 gene locus_tag LOCUS_35240 66835 68235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35240 68259 69119 gene locus_tag LOCUS_35250 68259 69119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 69642 69139 gene locus_tag LOCUS_35260 69642 69139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 71394 69733 gene locus_tag LOCUS_35270 71394 69733 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403341.1 protein_id gnl|my_center|LOCUS_35270 71617 72471 gene locus_tag LOCUS_35280 71617 72471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 72484 74403 gene locus_tag LOCUS_35290 72484 74403 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 protein_id gnl|my_center|LOCUS_35290 74393 75505 gene locus_tag LOCUS_35300 74393 75505 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986993.1 protein_id gnl|my_center|LOCUS_35300 75658 76167 gene locus_tag LOCUS_35310 75658 76167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403631.1 protein_id gnl|my_center|LOCUS_35310 76294 76989 gene locus_tag LOCUS_35320 76294 76989 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202004.1 protein_id gnl|my_center|LOCUS_35320 77022 79403 gene locus_tag LOCUS_35330 77022 79403 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109374.1 protein_id gnl|my_center|LOCUS_35330 79517 80491 gene locus_tag LOCUS_35340 79517 80491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 81775 80531 gene locus_tag LOCUS_35350 81775 80531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 82470 82024 gene locus_tag LOCUS_35360 82470 82024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 83081 82584 gene locus_tag LOCUS_35370 83081 82584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 84719 83184 gene locus_tag LOCUS_35380 gene gpmI 84719 83184 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964233.1 protein_id gnl|my_center|LOCUS_35380 84999 85352 gene locus_tag LOCUS_35390 84999 85352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 86509 85388 gene locus_tag LOCUS_35400 86509 85388 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_35400 86595 87632 gene locus_tag LOCUS_35410 gene lpxD 86595 87632 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764416.1 protein_id gnl|my_center|LOCUS_35410 87663 89045 gene locus_tag LOCUS_35420 87663 89045 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963124.1 protein_id gnl|my_center|LOCUS_35420 89049 89822 gene locus_tag LOCUS_35430 gene lpxA 89049 89822 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963123.1 protein_id gnl|my_center|LOCUS_35430 89824 90438 gene locus_tag LOCUS_35440 89824 90438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 90984 90499 gene locus_tag LOCUS_35450 90984 90499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35450 91682 90963 gene locus_tag LOCUS_35460 91682 90963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35460 92098 91760 gene locus_tag LOCUS_35470 92098 91760 CDS product DUF2853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963785.1 protein_id gnl|my_center|LOCUS_35470 94074 92134 gene locus_tag LOCUS_35480 94074 92134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 94724 94041 gene locus_tag LOCUS_35490 94724 94041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 95869 94814 gene locus_tag LOCUS_35500 95869 94814 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962812.1 protein_id gnl|my_center|LOCUS_35500 95953 97152 gene locus_tag LOCUS_35510 gene megL 95953 97152 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017138.1 protein_id gnl|my_center|LOCUS_35510 97154 97657 gene locus_tag LOCUS_35520 97154 97657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 97579 97947 gene locus_tag LOCUS_35530 97579 97947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 98010 100712 gene locus_tag LOCUS_35540 98010 100712 CDS product T9SS-dependent M36 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962455.1 protein_id gnl|my_center|LOCUS_35540 101351 100716 gene locus_tag LOCUS_35550 101351 100716 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963240.1 protein_id gnl|my_center|LOCUS_35550 101451 101696 gene locus_tag LOCUS_35560 101451 101696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 101714 102088 gene locus_tag LOCUS_35570 101714 102088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 102156 102623 gene locus_tag LOCUS_35580 gene rlmH 102156 102623 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963965.1 protein_id gnl|my_center|LOCUS_35580 102627 103253 gene locus_tag LOCUS_35590 102627 103253 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117778.1 protein_id gnl|my_center|LOCUS_35590 103337 104767 gene locus_tag LOCUS_35600 gene miaB 103337 104767 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964081.1 protein_id gnl|my_center|LOCUS_35600 104778 106049 gene locus_tag LOCUS_35610 104778 106049 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_35610 106279 106848 gene locus_tag LOCUS_35620 106279 106848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 106979 112381 gene locus_tag LOCUS_35630 106979 112381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 112443 112838 gene locus_tag LOCUS_35640 112443 112838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 113549 112842 gene locus_tag LOCUS_35650 113549 112842 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964100.1 protein_id gnl|my_center|LOCUS_35650 114712 113555 gene locus_tag LOCUS_35660 114712 113555 CDS product lycopene cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963565.1 protein_id gnl|my_center|LOCUS_35660 115514 114705 gene locus_tag LOCUS_35670 115514 114705 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258021.1 protein_id gnl|my_center|LOCUS_35670 116385 115516 gene locus_tag LOCUS_35680 116385 115516 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258021.1 protein_id gnl|my_center|LOCUS_35680 117135 116392 gene locus_tag LOCUS_35690 117135 116392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 118570 117410 gene locus_tag LOCUS_35700 118570 117410 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816129.1 protein_id gnl|my_center|LOCUS_35700 120446 118815 gene locus_tag LOCUS_35710 gene groL 120446 118815 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964087.1 protein_id gnl|my_center|LOCUS_35710 120811 120491 gene locus_tag LOCUS_35720 120811 120491 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964086.1 protein_id gnl|my_center|LOCUS_35720 121245 120913 gene locus_tag LOCUS_35730 121245 120913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 124134 121852 gene locus_tag LOCUS_35740 124134 121852 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_35740 126560 124356 gene locus_tag LOCUS_35750 126560 124356 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_35750 126698 127390 gene locus_tag LOCUS_35760 126698 127390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35760 127829 127527 gene locus_tag LOCUS_35770 127829 127527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 129237 128038 gene locus_tag LOCUS_35780 129237 128038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 129809 129234 gene locus_tag LOCUS_35790 129809 129234 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_35790 >Feature sequence08 1021 599 gene locus_tag LOCUS_35800 1021 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 1403 1005 gene locus_tag LOCUS_35810 1403 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35810 2479 1427 gene locus_tag LOCUS_35820 2479 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35820 3195 2626 gene locus_tag LOCUS_35830 3195 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 3870 3346 gene locus_tag LOCUS_35840 3870 3346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 6884 3867 gene locus_tag LOCUS_35850 6884 3867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35850 7243 6881 gene locus_tag LOCUS_35860 7243 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 8660 7290 gene locus_tag LOCUS_35870 8660 7290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 8931 8683 gene locus_tag LOCUS_35880 8931 8683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 9818 8949 gene locus_tag LOCUS_35890 9818 8949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 11236 10550 gene locus_tag LOCUS_35900 11236 10550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 11580 11263 gene locus_tag LOCUS_35910 11580 11263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 12217 11711 gene locus_tag LOCUS_35920 12217 11711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35920 13263 12616 gene locus_tag LOCUS_35930 13263 12616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 14305 13484 gene locus_tag LOCUS_35940 14305 13484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 14525 14334 gene locus_tag LOCUS_35950 14525 14334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 14668 14522 gene locus_tag LOCUS_35960 14668 14522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 15247 14756 gene locus_tag LOCUS_35970 15247 14756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35970 15572 15249 gene locus_tag LOCUS_35980 15572 15249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 16492 15704 gene locus_tag LOCUS_35990 16492 15704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 16907 16593 gene locus_tag LOCUS_36000 16907 16593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 17775 16855 gene locus_tag LOCUS_36010 17775 16855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 18225 18698 gene locus_tag LOCUS_36020 18225 18698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36020 18692 19192 gene locus_tag LOCUS_36030 18692 19192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 19286 19663 gene locus_tag LOCUS_36040 19286 19663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 19699 20550 gene locus_tag LOCUS_36050 19699 20550 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463805.1 protein_id gnl|my_center|LOCUS_36050 20790 21125 gene locus_tag LOCUS_36060 20790 21125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 21626 22543 gene locus_tag LOCUS_36070 21626 22543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 22766 23209 gene locus_tag LOCUS_36080 22766 23209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 23413 23610 gene locus_tag LOCUS_36090 23413 23610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 23586 24011 gene locus_tag LOCUS_36100 23586 24011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 24008 25342 gene locus_tag LOCUS_36110 24008 25342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 25424 25693 gene locus_tag LOCUS_36120 25424 25693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 25695 26258 gene locus_tag LOCUS_36130 25695 26258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 26212 26799 gene locus_tag LOCUS_36140 26212 26799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 27356 27991 gene locus_tag LOCUS_36150 27356 27991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 27952 28242 gene locus_tag LOCUS_36160 27952 28242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 28347 28592 gene locus_tag LOCUS_36170 28347 28592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 28610 28804 gene locus_tag LOCUS_36180 28610 28804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 29219 30247 gene locus_tag LOCUS_36190 29219 30247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 30240 30695 gene locus_tag LOCUS_36200 30240 30695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 30659 31093 gene locus_tag LOCUS_36210 30659 31093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 31100 31324 gene locus_tag LOCUS_36220 31100 31324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 31457 32695 gene locus_tag LOCUS_36230 31457 32695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 32922 33080 gene locus_tag LOCUS_36240 32922 33080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 33160 33750 gene locus_tag LOCUS_36250 33160 33750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 33941 34912 gene locus_tag LOCUS_36260 33941 34912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 34909 35229 gene locus_tag LOCUS_36270 34909 35229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 35407 35721 gene locus_tag LOCUS_36280 35407 35721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 35852 36094 gene locus_tag LOCUS_36290 35852 36094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 36121 36378 gene locus_tag LOCUS_36300 36121 36378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 36438 38525 gene locus_tag LOCUS_36310 36438 38525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 38534 38689 gene locus_tag LOCUS_36320 38534 38689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 38841 39284 gene locus_tag LOCUS_36330 38841 39284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 39608 40051 gene locus_tag LOCUS_36340 39608 40051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 40204 40554 gene locus_tag LOCUS_36350 40204 40554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 40864 43344 gene locus_tag LOCUS_36360 40864 43344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 43744 44112 gene locus_tag LOCUS_36370 43744 44112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36370 44504 44881 gene locus_tag LOCUS_36380 44504 44881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 44904 45131 gene locus_tag LOCUS_36390 44904 45131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 45166 45951 gene locus_tag LOCUS_36400 45166 45951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 46852 47010 gene locus_tag LOCUS_36410 46852 47010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 47033 47302 gene locus_tag LOCUS_36420 47033 47302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 47316 47936 gene locus_tag LOCUS_36430 47316 47936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 49091 49612 gene locus_tag LOCUS_36440 49091 49612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 49555 50661 gene locus_tag LOCUS_36450 49555 50661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 52845 50998 gene locus_tag LOCUS_36460 52845 50998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 53437 52922 gene locus_tag LOCUS_36470 53437 52922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 54857 53421 gene locus_tag LOCUS_36480 54857 53421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 55604 58264 gene locus_tag LOCUS_36490 55604 58264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 58983 58819 gene locus_tag LOCUS_36500 58983 58819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 59360 58980 gene locus_tag LOCUS_36510 59360 58980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809191.1 protein_id gnl|my_center|LOCUS_36510 60365 59526 gene locus_tag LOCUS_36520 60365 59526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 60741 60436 gene locus_tag LOCUS_36530 60741 60436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767450.1 protein_id gnl|my_center|LOCUS_36530 61430 60816 gene locus_tag LOCUS_36540 61430 60816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 62217 61504 gene locus_tag LOCUS_36550 62217 61504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36550 62672 62226 gene locus_tag LOCUS_36560 62672 62226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 62891 63499 gene locus_tag LOCUS_36570 62891 63499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36570 63448 64266 gene locus_tag LOCUS_36580 63448 64266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36580 64276 65787 gene locus_tag LOCUS_36590 64276 65787 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963016.1 protein_id gnl|my_center|LOCUS_36590 65784 66923 gene locus_tag LOCUS_36600 65784 66923 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008588454.1 protein_id gnl|my_center|LOCUS_36600 67001 67645 gene locus_tag LOCUS_36610 67001 67645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36610 67663 67974 gene locus_tag LOCUS_36620 67663 67974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 68823 67990 gene locus_tag LOCUS_36630 68823 67990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36630 69989 69108 gene locus_tag LOCUS_36640 69989 69108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 71001 70000 gene locus_tag LOCUS_36650 71001 70000 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791024.1 protein_id gnl|my_center|LOCUS_36650 71130 71552 gene locus_tag LOCUS_36660 71130 71552 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963530.1 protein_id gnl|my_center|LOCUS_36660 72293 71598 gene locus_tag LOCUS_36670 72293 71598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 72994 72386 gene locus_tag LOCUS_36680 72994 72386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 74906 74508 gene locus_tag LOCUS_36690 74906 74508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 76197 75673 gene locus_tag LOCUS_36700 76197 75673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 77181 76345 gene locus_tag LOCUS_36710 gene mdh 77181 76345 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404318.1 protein_id gnl|my_center|LOCUS_36710 77438 78445 gene locus_tag LOCUS_36720 77438 78445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 78615 78863 gene locus_tag LOCUS_36730 78615 78863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 79002 79439 gene locus_tag LOCUS_36740 79002 79439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36740 79430 79585 gene locus_tag LOCUS_36750 79430 79585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 79593 80003 gene locus_tag LOCUS_36760 79593 80003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36760 80432 79995 gene locus_tag LOCUS_36770 80432 79995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36770 81251 80484 gene locus_tag LOCUS_36780 81251 80484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36780 81409 81627 gene locus_tag LOCUS_36790 81409 81627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36790 82543 84183 gene locus_tag LOCUS_36800 82543 84183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 84134 84571 gene locus_tag LOCUS_36810 84134 84571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 84466 85059 gene locus_tag LOCUS_36820 84466 85059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 85066 85602 gene locus_tag LOCUS_36830 85066 85602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 85869 86156 gene locus_tag LOCUS_36840 85869 86156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 86645 86992 gene locus_tag LOCUS_36850 86645 86992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 86965 87561 gene locus_tag LOCUS_36860 86965 87561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36860 88494 88796 gene locus_tag LOCUS_36870 88494 88796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36870 90835 90506 gene locus_tag LOCUS_36880 90835 90506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 91769 92026 gene locus_tag LOCUS_36890 91769 92026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 >Feature sequence09 383 589 gene locus_tag LOCUS_36900 383 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36900 1122 1367 gene locus_tag LOCUS_36910 1122 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36910 1519 1965 gene locus_tag LOCUS_36920 1519 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36920 2211 2393 gene locus_tag LOCUS_36930 2211 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 2431 2574 gene locus_tag LOCUS_36940 2431 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36940 2723 2893 gene locus_tag LOCUS_36950 2723 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36950 3007 3243 gene locus_tag LOCUS_36960 3007 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 3569 4120 gene locus_tag LOCUS_36970 3569 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36970 4350 4523 gene locus_tag LOCUS_36980 4350 4523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 4554 5387 gene locus_tag LOCUS_36990 4554 5387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36990 5729 5959 gene locus_tag LOCUS_37000 5729 5959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37000 6024 6263 gene locus_tag LOCUS_37010 6024 6263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37010 6276 6434 gene locus_tag LOCUS_37020 6276 6434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 6427 6846 gene locus_tag LOCUS_37030 6427 6846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 7080 7451 gene locus_tag LOCUS_37040 7080 7451 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963264.1 protein_id gnl|my_center|LOCUS_37040 7490 8614 gene locus_tag LOCUS_37050 7490 8614 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_37050 8779 9930 gene locus_tag LOCUS_37060 8779 9930 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_37060 9961 11061 gene locus_tag LOCUS_37070 gene rfbB 9961 11061 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963426.1 protein_id gnl|my_center|LOCUS_37070 11220 12350 gene locus_tag LOCUS_37080 11220 12350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 12494 12895 gene locus_tag LOCUS_37090 12494 12895 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 protein_id gnl|my_center|LOCUS_37090 12935 13507 gene locus_tag LOCUS_37100 12935 13507 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_37100 13485 13724 gene locus_tag LOCUS_37110 13485 13724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 13714 14202 gene locus_tag LOCUS_37120 13714 14202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 14199 15164 gene locus_tag LOCUS_37130 14199 15164 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208044.1 protein_id gnl|my_center|LOCUS_37130 15189 16055 gene locus_tag LOCUS_37140 gene rfbA 15189 16055 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721498.1 protein_id gnl|my_center|LOCUS_37140 16058 16654 gene locus_tag LOCUS_37150 16058 16654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 16684 16878 gene locus_tag LOCUS_37160 16684 16878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 16868 17323 gene locus_tag LOCUS_37170 16868 17323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 17363 17884 gene locus_tag LOCUS_37180 17363 17884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37180 17881 18645 gene locus_tag LOCUS_37190 17881 18645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37190 19244 20101 gene locus_tag LOCUS_37200 19244 20101 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_37200 20158 21213 gene locus_tag LOCUS_37210 gene neuB 20158 21213 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230564.1 protein_id gnl|my_center|LOCUS_37210 21194 22135 gene locus_tag LOCUS_37220 21194 22135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 22125 22307 gene locus_tag LOCUS_37230 22125 22307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 22494 23294 gene locus_tag LOCUS_37240 22494 23294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37240 23294 23962 gene locus_tag LOCUS_37250 23294 23962 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403380.1 protein_id gnl|my_center|LOCUS_37250 23959 24585 gene locus_tag LOCUS_37260 23959 24585 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224137664.1 protein_id gnl|my_center|LOCUS_37260 24582 25628 gene locus_tag LOCUS_37270 24582 25628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 25625 25993 gene locus_tag LOCUS_37280 25625 25993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 26016 26321 gene locus_tag LOCUS_37290 26016 26321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37290 26318 27595 gene locus_tag LOCUS_37300 26318 27595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 27588 28625 gene locus_tag LOCUS_37310 27588 28625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 28636 29577 gene locus_tag LOCUS_37320 28636 29577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 29885 32152 gene locus_tag LOCUS_37330 29885 32152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 32469 33416 gene locus_tag LOCUS_37340 32469 33416 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963420.1 protein_id gnl|my_center|LOCUS_37340 33450 34556 gene locus_tag LOCUS_37350 33450 34556 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963418.1 protein_id gnl|my_center|LOCUS_37350 34562 35455 gene locus_tag LOCUS_37360 34562 35455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 35455 36627 gene locus_tag LOCUS_37370 gene wecB 35455 36627 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963417.1 protein_id gnl|my_center|LOCUS_37370 36708 37742 gene locus_tag LOCUS_37380 36708 37742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 37745 38734 gene locus_tag LOCUS_37390 37745 38734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37390 39188 39511 gene locus_tag LOCUS_37400 39188 39511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37400 39669 40412 gene locus_tag LOCUS_37410 39669 40412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37410 40409 40744 gene locus_tag LOCUS_37420 40409 40744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37420 40741 41022 gene locus_tag LOCUS_37430 40741 41022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 41393 42028 gene locus_tag LOCUS_37440 41393 42028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 42215 43198 gene locus_tag LOCUS_37450 42215 43198 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119728.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37450 43462 43803 gene locus_tag LOCUS_37460 43462 43803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37460 43804 44592 gene locus_tag LOCUS_37470 43804 44592 CDS product AglZ/HisF2 family acetamidino modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113421.1 protein_id gnl|my_center|LOCUS_37470 44737 45552 gene locus_tag LOCUS_37480 44737 45552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37480 45843 46166 gene locus_tag LOCUS_37490 45843 46166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 46191 46376 gene locus_tag LOCUS_37500 46191 46376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 46594 46953 gene locus_tag LOCUS_37510 46594 46953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 47519 47809 gene locus_tag LOCUS_37520 47519 47809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 48033 48461 gene locus_tag LOCUS_37530 48033 48461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 48464 49114 gene locus_tag LOCUS_37540 48464 49114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37540 49093 49824 gene locus_tag LOCUS_37550 49093 49824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 >Feature sequence10 968 576 gene locus_tag LOCUS_37560 968 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 1120 1281 gene locus_tag LOCUS_37570 1120 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 1587 1390 gene locus_tag LOCUS_37580 1587 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 2105 1686 gene locus_tag LOCUS_37590 2105 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37590 2505 2122 gene locus_tag LOCUS_37600 2505 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37600 4145 3384 gene locus_tag LOCUS_37610 4145 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 4473 4267 gene locus_tag LOCUS_37620 4473 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37620 5150 4470 gene locus_tag LOCUS_37630 5150 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37630 5815 5156 gene locus_tag LOCUS_37640 5815 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 6799 5858 gene locus_tag LOCUS_37650 6799 5858 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763930.1 protein_id gnl|my_center|LOCUS_37650 7186 6881 gene locus_tag LOCUS_37660 7186 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 7513 7325 gene locus_tag LOCUS_37670 7513 7325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 7896 7486 gene locus_tag LOCUS_37680 7896 7486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 8516 7932 gene locus_tag LOCUS_37690 8516 7932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 9265 8537 gene locus_tag LOCUS_37700 9265 8537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 9986 9456 gene locus_tag LOCUS_37710 9986 9456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 10236 10048 gene locus_tag LOCUS_37720 10236 10048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 11097 10465 gene locus_tag LOCUS_37730 11097 10465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 11730 12165 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tattttttggatatgctaaaat 13430 12657 gene locus_tag LOCUS_37740 13430 12657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 14734 13376 gene locus_tag LOCUS_37750 14734 13376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 14625 14873 gene locus_tag LOCUS_37760 14625 14873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 15468 14842 gene locus_tag LOCUS_37770 15468 14842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 15899 15513 gene locus_tag LOCUS_37780 15899 15513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 16159 15848 gene locus_tag LOCUS_37790 16159 15848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 17607 16240 gene locus_tag LOCUS_37800 17607 16240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 18576 18127 gene locus_tag LOCUS_37810 18576 18127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 19366 19040 gene locus_tag LOCUS_37820 19366 19040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 19914 19480 gene locus_tag LOCUS_37830 19914 19480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 20228 19929 gene locus_tag LOCUS_37840 20228 19929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 20746 20237 gene locus_tag LOCUS_37850 20746 20237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37850 22329 20812 gene locus_tag LOCUS_37860 22329 20812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 23047 22334 gene locus_tag LOCUS_37870 23047 22334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 24166 23078 gene locus_tag LOCUS_37880 24166 23078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 24948 24208 gene locus_tag LOCUS_37890 24948 24208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 25948 25394 gene locus_tag LOCUS_37900 25948 25394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 27732 26662 gene locus_tag LOCUS_37910 27732 26662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 28249 27839 gene locus_tag LOCUS_37920 28249 27839 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081163086.1 protein_id gnl|my_center|LOCUS_37920 28608 28261 gene locus_tag LOCUS_37930 28608 28261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 29589 29317 gene locus_tag LOCUS_37940 29589 29317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 30420 29866 gene locus_tag LOCUS_37950 30420 29866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 30809 30600 gene locus_tag LOCUS_37960 30809 30600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 32402 31365 gene locus_tag LOCUS_37970 32402 31365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37970 32982 32548 gene locus_tag LOCUS_37980 32982 32548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37980 33559 32993 gene locus_tag LOCUS_37990 33559 32993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 33809 33576 gene locus_tag LOCUS_38000 33809 33576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 34255 33788 gene locus_tag LOCUS_38010 34255 33788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38010 34703 34449 gene locus_tag LOCUS_38020 34703 34449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 34871 35494 gene locus_tag LOCUS_38030 34871 35494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 35621 35776 gene locus_tag LOCUS_38040 35621 35776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 35791 36003 gene locus_tag LOCUS_38050 35791 36003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 36413 36907 gene locus_tag LOCUS_38060 36413 36907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 37219 37653 gene locus_tag LOCUS_38070 37219 37653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38070 >Feature sequence11 468 31 gene locus_tag LOCUS_38080 468 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 2039 1743 gene locus_tag LOCUS_38090 2039 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 2923 2765 gene locus_tag LOCUS_38100 2923 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38100 3234 3079 gene locus_tag LOCUS_38110 3234 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38110 3487 4083 gene locus_tag LOCUS_38120 3487 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 4076 4465 gene locus_tag LOCUS_38130 4076 4465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 4667 4915 gene locus_tag LOCUS_38140 4667 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 4931 5338 gene locus_tag LOCUS_38150 4931 5338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38150 5332 5676 gene locus_tag LOCUS_38160 5332 5676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38160 5622 5915 gene locus_tag LOCUS_38170 5622 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 5899 6054 gene locus_tag LOCUS_38180 5899 6054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 6741 6046 gene locus_tag LOCUS_38190 6741 6046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38190 7072 6749 gene locus_tag LOCUS_38200 7072 6749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38200 7456 7818 gene locus_tag LOCUS_38210 7456 7818 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963844.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38210 9130 8738 gene locus_tag LOCUS_38220 9130 8738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 10861 9140 gene locus_tag LOCUS_38230 10861 9140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 11822 12772 gene locus_tag LOCUS_38240 11822 12772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 12769 12990 gene locus_tag LOCUS_38250 12769 12990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 14402 14803 gene locus_tag LOCUS_38260 14402 14803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 14930 15346 gene locus_tag LOCUS_38270 14930 15346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 15312 15464 gene locus_tag LOCUS_38280 15312 15464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 15725 16069 gene locus_tag LOCUS_38290 15725 16069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 15973 16809 gene locus_tag LOCUS_38300 15973 16809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 16790 17581 gene locus_tag LOCUS_38310 16790 17581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 17803 17994 gene locus_tag LOCUS_38320 17803 17994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 18006 18251 gene locus_tag LOCUS_38330 18006 18251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 18255 18755 gene locus_tag LOCUS_38340 18255 18755 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 protein_id gnl|my_center|LOCUS_38340 18743 19045 gene locus_tag LOCUS_38350 18743 19045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 19132 19680 gene locus_tag LOCUS_38360 19132 19680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38360 19689 20096 gene locus_tag LOCUS_38370 19689 20096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38370 20306 20653 gene locus_tag LOCUS_38380 20306 20653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 20930 20565 gene locus_tag LOCUS_38390 20930 20565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 21885 21325 gene locus_tag LOCUS_38400 gene purN 21885 21325 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108788.1 protein_id gnl|my_center|LOCUS_38400 22081 21932 gene locus_tag LOCUS_38410 22081 21932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 22852 22082 gene locus_tag LOCUS_38420 22852 22082 CDS product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38420 23273 22932 gene locus_tag LOCUS_38430 23273 22932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38430 23608 23195 gene locus_tag LOCUS_38440 23608 23195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38440 24102 23587 gene locus_tag LOCUS_38450 24102 23587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38450 24393 24115 gene locus_tag LOCUS_38460 24393 24115 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 protein_id gnl|my_center|LOCUS_38460 25255 24458 gene locus_tag LOCUS_38470 25255 24458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 25808 25533 gene locus_tag LOCUS_38480 25808 25533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 26182 25952 gene locus_tag LOCUS_38490 26182 25952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 26644 26228 gene locus_tag LOCUS_38500 26644 26228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 27464 27156 gene locus_tag LOCUS_38510 27464 27156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 28069 27485 gene locus_tag LOCUS_38520 28069 27485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 28713 28534 gene locus_tag LOCUS_38530 28713 28534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 28909 28697 gene locus_tag LOCUS_38540 28909 28697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 29319 29089 gene locus_tag LOCUS_38550 29319 29089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 30866 30747 gene locus_tag LOCUS_38560 30866 30747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 >Feature sequence12 779 988 gene locus_tag LOCUS_38570 779 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 1056 1298 gene locus_tag LOCUS_38580 1056 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 2137 2421 gene locus_tag LOCUS_38590 2137 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38590 2595 2870 gene locus_tag LOCUS_38600 2595 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38600 2872 3180 gene locus_tag LOCUS_38610 2872 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38610 3656 4006 gene locus_tag LOCUS_38620 3656 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38620 4105 4284 gene locus_tag LOCUS_38630 4105 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38630 5127 5507 gene locus_tag LOCUS_38640 5127 5507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 5978 6166 gene locus_tag LOCUS_38650 5978 6166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 6571 7011 gene locus_tag LOCUS_38660 6571 7011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 7201 7500 gene locus_tag LOCUS_38670 7201 7500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38670 7577 7894 gene locus_tag LOCUS_38680 7577 7894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38680 8929 7940 gene locus_tag LOCUS_38690 gene hemW 8929 7940 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38690 9528 9965 gene locus_tag LOCUS_38700 9528 9965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 9937 10635 gene locus_tag LOCUS_38710 9937 10635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 10670 10840 gene locus_tag LOCUS_38720 10670 10840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 10897 11208 gene locus_tag LOCUS_38730 10897 11208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38730 11216 11509 gene locus_tag LOCUS_38740 11216 11509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38740 12049 13431 gene locus_tag LOCUS_38750 12049 13431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 13646 13984 gene locus_tag LOCUS_38760 13646 13984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 14184 14618 gene locus_tag LOCUS_38770 14184 14618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 15822 14602 gene locus_tag LOCUS_38780 15822 14602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 16709 16065 gene locus_tag LOCUS_38790 16709 16065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38790 16969 16715 gene locus_tag LOCUS_38800 16969 16715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38800 17484 16957 gene locus_tag LOCUS_38810 17484 16957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 18166 17477 gene locus_tag LOCUS_38820 18166 17477 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_38820 19563 18373 gene locus_tag LOCUS_38830 19563 18373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 20180 19560 gene locus_tag LOCUS_38840 20180 19560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 20385 20143 gene locus_tag LOCUS_38850 20385 20143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 21281 20430 gene locus_tag LOCUS_38860 21281 20430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38860 22083 21601 gene locus_tag LOCUS_38870 22083 21601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 22979 22632 gene locus_tag LOCUS_38880 22979 22632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 24634 24936 gene locus_tag LOCUS_38890 24634 24936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38890 >Feature sequence13 870 643 gene locus_tag LOCUS_38900 870 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 1202 1008 gene locus_tag LOCUS_38910 1202 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 2189 1797 gene locus_tag LOCUS_38920 2189 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 2325 2170 gene locus_tag LOCUS_38930 2325 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 2917 2477 gene locus_tag LOCUS_38940 2917 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38940 4296 3616 gene locus_tag LOCUS_38950 4296 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 5459 4473 gene locus_tag LOCUS_38960 5459 4473 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810397.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38960 5671 5492 gene locus_tag LOCUS_38970 5671 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 6330 6256 gene locus_tag LOCUS_t00410 6330 6256 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6628 6407 gene locus_tag LOCUS_38980 6628 6407 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015000940.1 protein_id gnl|my_center|LOCUS_38980 6878 8416 gene locus_tag LOCUS_38990 6878 8416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38990 8442 9161 gene locus_tag LOCUS_39000 8442 9161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39000 10785 9130 gene locus_tag LOCUS_39010 10785 9130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 12410 10932 gene locus_tag LOCUS_39020 12410 10932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 13404 12811 gene locus_tag LOCUS_39030 13404 12811 CDS product 2OG-Fe(II) oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962260.1 protein_id gnl|my_center|LOCUS_39030 13670 14062 gene locus_tag LOCUS_39040 13670 14062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 14640 14182 gene locus_tag LOCUS_39050 14640 14182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 15143 14682 gene locus_tag LOCUS_39060 15143 14682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 16401 15241 gene locus_tag LOCUS_39070 16401 15241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 17492 16464 gene locus_tag LOCUS_39080 17492 16464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 17624 17806 gene locus_tag LOCUS_39090 17624 17806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 17843 19654 gene locus_tag LOCUS_39100 17843 19654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 19657 20256 gene locus_tag LOCUS_39110 19657 20256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 21372 20440 gene locus_tag LOCUS_39120 21372 20440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 21689 21498 gene locus_tag LOCUS_39130 21689 21498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 22183 21629 gene locus_tag LOCUS_39140 22183 21629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 22559 22194 gene locus_tag LOCUS_39150 22559 22194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 >Feature sequence14 347 913 gene locus_tag LOCUS_39160 347 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 1602 1724 gene locus_tag LOCUS_39170 1602 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 1827 2111 gene locus_tag LOCUS_39180 1827 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 3525 3755 gene locus_tag LOCUS_39190 3525 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39190 5987 6229 gene locus_tag LOCUS_39200 5987 6229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39200 6275 6565 gene locus_tag LOCUS_39210 6275 6565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39210 7242 6670 gene locus_tag LOCUS_39220 7242 6670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 8215 7955 gene locus_tag LOCUS_39230 8215 7955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39230 8494 8243 gene locus_tag LOCUS_39240 8494 8243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 8924 8505 gene locus_tag LOCUS_39250 8924 8505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39250 9508 9206 gene locus_tag LOCUS_39260 9508 9206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39260 10412 9513 gene locus_tag LOCUS_39270 10412 9513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39270 10769 10425 gene locus_tag LOCUS_39280 10769 10425 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 protein_id gnl|my_center|LOCUS_39280 10991 10806 gene locus_tag LOCUS_39290 10991 10806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 11574 10957 gene locus_tag LOCUS_39300 11574 10957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 12098 11721 gene locus_tag LOCUS_39310 12098 11721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 12957 12262 gene locus_tag LOCUS_39320 12957 12262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 13619 13209 gene locus_tag LOCUS_39330 13619 13209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 14309 13809 gene locus_tag LOCUS_39340 14309 13809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 14550 14224 gene locus_tag LOCUS_39350 14550 14224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 14937 14704 gene locus_tag LOCUS_39360 14937 14704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 15503 15132 gene locus_tag LOCUS_39370 15503 15132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 15980 15789 gene locus_tag LOCUS_39380 15980 15789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 16251 15919 gene locus_tag LOCUS_39390 16251 15919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 16920 16468 gene locus_tag LOCUS_39400 16920 16468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 17630 17854 gene locus_tag LOCUS_39410 17630 17854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39410 17829 17981 gene locus_tag LOCUS_39420 17829 17981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39420 18137 18547 gene locus_tag LOCUS_39430 18137 18547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39430 19449 19700 gene locus_tag LOCUS_39440 19449 19700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39440 >Feature sequence15 2723 2577 gene locus_tag LOCUS_39450 2723 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 3112 2879 gene locus_tag LOCUS_39460 3112 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 3772 3593 gene locus_tag LOCUS_39470 3772 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 4384 3839 gene locus_tag LOCUS_39480 4384 3839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 5076 5249 gene locus_tag LOCUS_39490 5076 5249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 5526 5807 gene locus_tag LOCUS_39500 5526 5807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39500 5788 6051 gene locus_tag LOCUS_39510 5788 6051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39510 7156 6518 gene locus_tag LOCUS_39520 7156 6518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 8233 7259 gene locus_tag LOCUS_39530 8233 7259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39530 8655 8227 gene locus_tag LOCUS_39540 8655 8227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39540 9065 8661 gene locus_tag LOCUS_39550 9065 8661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39550 9986 9126 gene locus_tag LOCUS_39560 9986 9126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39560 11370 9988 gene locus_tag LOCUS_39570 11370 9988 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404645.1 protein_id gnl|my_center|LOCUS_39570 13245 11380 gene locus_tag LOCUS_39580 13245 11380 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839376.1 protein_id gnl|my_center|LOCUS_39580 14246 13470 gene locus_tag LOCUS_39590 14246 13470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 15390 15145 gene locus_tag LOCUS_39600 15390 15145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 15899 16081 gene locus_tag LOCUS_39610 15899 16081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 16511 16729 gene locus_tag LOCUS_39620 16511 16729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 17354 17785 gene locus_tag LOCUS_39630 17354 17785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 >Feature sequence16 387 88 gene locus_tag LOCUS_39640 387 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 597 421 gene locus_tag LOCUS_39650 597 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 846 619 gene locus_tag LOCUS_39660 846 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 1960 1754 gene locus_tag LOCUS_39670 1960 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 2124 1912 gene locus_tag LOCUS_39680 2124 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 3049 2816 gene locus_tag LOCUS_39690 3049 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 3433 3164 gene locus_tag LOCUS_39700 3433 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 3745 3476 gene locus_tag LOCUS_39710 3745 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 4439 4098 gene locus_tag LOCUS_39720 4439 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 4999 4769 gene locus_tag LOCUS_39730 4999 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 5231 5007 gene locus_tag LOCUS_39740 5231 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 6057 5551 gene locus_tag LOCUS_39750 6057 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 6613 6834 gene locus_tag LOCUS_39760 6613 6834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39760 6869 7417 gene locus_tag LOCUS_39770 6869 7417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39770 7458 9017 gene locus_tag LOCUS_39780 7458 9017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39780 9135 9890 gene locus_tag LOCUS_39790 9135 9890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39790 10150 10386 gene locus_tag LOCUS_39800 10150 10386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39800 10759 10376 gene locus_tag LOCUS_39810 10759 10376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39810 11183 10740 gene locus_tag LOCUS_39820 11183 10740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39820 11668 11396 gene locus_tag LOCUS_39830 11668 11396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 12387 12223 gene locus_tag LOCUS_39840 12387 12223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 13239 12955 gene locus_tag LOCUS_39850 13239 12955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 14004 13663 gene locus_tag LOCUS_39860 14004 13663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 14460 14263 gene locus_tag LOCUS_39870 14460 14263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 15180 14956 gene locus_tag LOCUS_39880 15180 14956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 >Feature sequence17 496 167 gene locus_tag LOCUS_39890 496 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 810 601 gene locus_tag LOCUS_39900 810 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 1456 989 gene locus_tag LOCUS_39910 1456 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39910 1616 1933 gene locus_tag LOCUS_39920 1616 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 2211 4019 gene locus_tag LOCUS_39930 2211 4019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 4332 5573 gene locus_tag LOCUS_39940 4332 5573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 5756 5971 gene locus_tag LOCUS_39950 5756 5971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 5958 6152 gene locus_tag LOCUS_39960 5958 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 6163 6381 gene locus_tag LOCUS_39970 6163 6381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 7147 6542 gene locus_tag LOCUS_39980 gene gldD 7147 6542 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_39980 7444 7160 gene locus_tag LOCUS_39990 7444 7160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 8498 7383 gene locus_tag LOCUS_40000 8498 7383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40000 9024 8596 gene locus_tag LOCUS_40010 9024 8596 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_40010 10616 10251 gene locus_tag LOCUS_40020 10616 10251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40020 11105 10887 gene locus_tag LOCUS_40030 11105 10887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40030 11419 11105 gene locus_tag LOCUS_40040 11419 11105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40040